G Model

HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS

Journal of Hazardous Materials xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Journal of Hazardous Materials

journal homepage: www.elsevier.com/locate/jhazmat

Ozonation and UV254 nm radiation for the removal of microorganisms

and antibiotic resistance genes from urban wastewater
José M. Sousa a,1 , Gonçalo Macedo b,1 , Marta Pedrosa c,1 , Cristina Becerra-Castro a,b ,
Sérgio Castro-Silva d , M. Fernando R. Pereira c , Adrián M.T. Silva c , Olga C. Nunes a,∗ ,
Célia M. Manaia b
a
LEPABE—Laboratory for Process Engineering, Environment, Biotechnology and Energy, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto
Frias, 4200-465 Porto, Portugal
b
Universidade Católica Portuguesa, CBQF-Centro de Biotecnologia e Química Fina-Laboratório Associado, Escola Superior de Biotecnologia, Rua Arquiteto
Lobão Vital, Apartado 2511, 4202-401 Porto, Portugal
c
Laboratory of Separation and Reaction Engineering—Laboratory of Catalysis and Materials (LSRE-LCM), Faculdade de Engenharia, Universidade do Porto,
Rua Dr. Roberto Frias, 4200-465 Porto, Portugal
d
Adventech—Advanced Environmental Technologies, Centro Empresarial e Tecnológico, Rua de Fundões 151, 3700-121 São João da Madeira, Portugal

h i g h l i g h t s

• Ozonation and UV can remove up to 4 log units of microorganisms from wastewater.

• UV radiation and mainly ozonation can remove some ARGs to values close to LOQ.
• Re-growth to pre-treatment levels may occur after ozonation or UV radiation.
• Enterococci is less prone to re-grow than enterobacteria, heterotrophs or fungi.
• Ozonation and UV radiation may lead to an increase of ARG prevalence.

a r t i c l e i n f o a b s t r a c t

Article history: Conventional wastewater treatment has a limited capacity to reduce antibiotic resistant bacteria and
Received 21 January 2016 genes (ARB&ARG). Tertiary treatment processes are promising solutions, although the transitory inac-
Received in revised form 9 March 2016 tivation of bacteria may select ARB&ARG. This study aimed at assessing the potential of ozonation and
Accepted 31 March 2016
UV254 nm radiation to inactivate cultivable fungal and bacterial populations, and the selected genes 16S
Available online xxx
rRNA (common to all bacteria), intI1 (common in Gram-negative bacteria) and the ARG vanA, blaTEM , sul1
and qnrS.
Keywords:
The abundance of the different microbiological parameters per volume of wastewater was reduced by
Synthetic wastewater
Urban wastewater
∼ 2 log units for cultivable fungi and 16S rRNA and intI1 genes, by ∼3–4 log units, for total heterotrophs,
Microbial inactivation enterobacteria and enterococci, and to values close or below the limits of quantification for ARG, for both
Microbial regrowth processes, after a contact time of 30 min. Yet, most of the cultivable populations, the 16S rRNA and intI1
Antibiotic resistance genes genes as well as the ARG, except qnrS after ozonation, reached pre-treatment levels after 3 days storage,
suggesting a transitory rather than permanent microbial inactivation. Noticeably, normalization per 16S
rRNA gene evidenced an increase of the ARG and intI1 prevalence, mainly after UV254 nm treatment. The
results suggest that these tertiary treatments may be selecting for ARB&ARG populations.
© 2016 Elsevier B.V. All rights reserved.

1. Introduction

The availability and quality of water is an increasing issue

∗ Corresponding author at: LEPABE, Faculdade de Engenharia, Universidade do
Porto, Rua Dr. Roberto Frias, 4200-465 Porto, Portugal.
E-mail address: opnunes@fe.up.pt (O.C. Nunes).
1
The authors contributed equally to this study.
around the world, not only in what concerns the protection of nat-
ural water resources, but also regarding wastewater reuse [1–5].
The limited capacity of the conventional wastewater treatment
processes to reduce the levels of different types of contaminants

http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
0304-3894/© 2016 Elsevier B.V. All rights reserved.

Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
2 J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx

A 10 C 10
9 9

Log (CFU / 100 mL)

Log (CFU / 100 mL)

8 8
7 7
6 6
5 5
4 4
3 3
2 2
1 1
0 0
Heterotrophs Enterobacteria Enterococci Fungi Heterotrophs Enterobacteria Enterococci Fungi

B 12
D 12
Log (copy number / 100 mL)

Log (copy number / 100 mL)

11 11
10 10
9 9
8 8
7 7
6 6
5 5
4 4
3 3
2 2
1 1
0 0
16S rRNA intI1 blaTEM vanA 16S rRNA intI1 blaTEM vanA

Fig. 1. Microbial inactivation by ozonation, assessed in inoculated synthetic wastewater based on the quantification of selected microbial groups using culture-dependent
methods (A, C) and qPCR of selected genes (B, D), for ozonation contact times of 15 min (dark grey) or 30 min (black), immediately after treatment (A, B) or three days after
storage at room temperature (C, D). Light grey bars represent freshly prepared synthetic wastewater (A, B) and untreated synthetic wastewater after three days storage (C, D).
The quantities of total DNA per 100 mL of sample were: 27.3 ng in freshly prepared synthetic wastewater; 0.2 ng in treated synthetic wastewater after 15 min of ozonation;
0.1 ng in treated synthetic wastewater after 30 min of ozonation; 12796.2 ng in untreated synthetic wastewater after three days storage; 42.3 ng in synthetic wastewater
treated for 15 min after three days storage; 0.1 ng in synthetic wastewater treated for 30 min after three days storage.

existing in wastewater, such as pharmaceutical and hygiene prod- the removal of all types of microorganisms or of antibiotic resis-
ucts or antibiotic resistant bacteria or genes has been intensively tance genes.
discussed over the last years [2,6–11]. This limitation implies that This study aimed at assessing the efficiency of currently used
wastewater treatment plants, originally designed as crucial nodes disinfection methods, ozonation and UV254 nm radiation, on the
in the protection of the environment and of the public health, removal of different microbial groups and antibiotic resistance
might have a significant burden on the environment and, indi- genes from conventionally treated effluents (i.e., that undergone
rectly, on the human health. Therefore, the implementation of secondary treatment) generated in an urban wastewater treatment
advanced wastewater treatment processes is increasingly recom- plant (UWTP). The disinfection potential of UV radiation is mainly
mended [3,8,11]. due to the capacity to introduce DNA damages, mainly pyrimi-
While the extent of removal of chemical contaminants is fre- dine dimers, causing DNA mutations and halting DNA replication,
quently used as a way of measuring the efficiency of a wastewater which, in the absence of effective DNA repairing systems will cause
treatment process [7,12–14], the assessment of water qual- cell death [25,26]. A different mechanism takes place in ozonation,
ity regarding the intended use (e.g. drinking, irrigation, aquifer capable of promoting the direct destruction of the cell wall and
recharging) includes microbiological indicators. The most fre- multiple oxidation reactions of cellular constituents, including the
quently used are the indicators of animal and human faecal purines and pyrimidines of the DNA [27]. Because these methods
contamination, Escherichia coli and Enterococcus spp. [15–17]. How- involve distinct mechanisms of microbial inactivation, they were
ever, numerous evidence had suggested that other organisms not used to test the hypothesis that different inactivation mechanisms
included in the routine monitoring schemes of water quality may may target different microbial populations or genes.
survive wastewater treatment processes [18,19]. The survival of
such microorganisms, mainly if they become prevalent and/or if 2. Material and methods
their presence may pose an additional danger, is an issue of major
concern. One of such microbial groups is represented by the wide 2.1. Synthetic and urban treated wastewater
range of bacteria harbouring acquired antibiotic resistance genes,
that conventional wastewater treatment may have a limited capac- A synthetic wastewater surrogating an urban conventionally
ity to remove [9]. In an attempt to mitigate such limitation, the treated effluent in terms of nutrients content and microbial density
disinfection potential of some tertiary wastewater treatment pro- was used to perform preliminary ozonation assays. The composi-
cesses has been studied [20–22]. However, it is not consensual tion of the sterile synthetic wastewater comprised different organic
that tertiary treatment processes lead to an effective reduction of and inorganic components as reported before [28] with the fol-
antibiotic resistance. While some studies have shown the effec- lowing composition (for 1 litter of distilled water): (NH4 )2 SO4
tive reduction of antibiotic resistant bacteria [20,23], others suggest (12 mg/L); tryptone (50 mg/L); meat extract (50 mg/L); yeast
that tertiary treatment may be ineffective. For instance, chlorina- extract (7.5 mg/L); urea (7.5 mg/L); K2 HPO4 (10 mg/L); CaCl2 ·2H2 O
tion was shown to promote an increase of antibiotic resistance (1 mg/L) and MgSO4 ·7H2 O (1 mg/L). Given the presence of humic
prevalence [20], and UV radiation was observed to be ineffec- substances in effluents of wastewater treatment plants, and
tive on the reduction of antibiotic resistant E. coli [24]. The range because they can influence different experimental aspects such
of advanced wastewater treatment processes currently available as interfere with molecular biology analyses or act as inner fil-
comprises different antimicrobial mechanisms and targets of action ters and/or photosensitizers [29–32] the synthetic wastewater
[3,8]. Therefore, different processes may be not equally efficient on was supplemented with 4 mg/L humic acids. In addition, syn-

Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx
Table 1
Characteristics of the microbial strains used in the synthetic wastewater.
Microorganism Isolation origin
Escherichia coli A2FCC14 Urban raw wastewater
Enterococcus faecalis H1EV10 Hospital wastewater
Pseudomonas aeruginosa H1FC49 Hospital wastewater
Rhodotorula rubra IA-5a-087A Compost
Aspergillus nigerDSM 1957 (spores) Leather
ND, not determined.
thetic wastewater was inoculated with microorganisms of different
groups commonly found in conventionally treated wastewaters.
Taxonomic identification, general characteristics and inoculum
density are indicated in Table 1.
Conventionally treated wastewater samples (i.e., that under-
gone secondary treatment, UWTP wastewater) were collected from
an UWTP, located in the Northern region of Portugal, between
January and April 2015. The UWTP treatment includes a homog-
enization chamber and a bar screen to remove gross solids; a grit
and a grease removal chambers, to remove small solids and fats; a
primary settling tank to remove the settleable solids; an activated
sludge biological treatment where the mixed liquor recirculates
between an aerobic and an anoxic tank to remove the organic load
and nutrients (N and P).
Wastewater samples were characterized for the content in
ammonium, chloride, phosphate, sulphate (ion chromatography
using a Metrohm 881Compact IC Pro apparatus, equipped with
a Metrosep C4 Cationic Exchange Column or a Metrosep A
Supp 7 Anionic Exchange Column, 250 mm × 4.0 mm each), pH
(WTW InoLab equipment), suspended solids and chemical oxy-
gen demand (Methods 2540 B and 5220 D, respectively, from
Standard Methods for the Examination of Water and Wastewater
[33]). The synthetic and UWTP wastewater samples were sim-
ilar in terms of pH (7.8 ± 0.5), phosphate (0.17 ± 0.05 mM) and
ammonium (0.50 ± 0.05 mM) concentrations. The chloride and sul-
phate concentrations for the UWTP wastewater samples were
3.0 mM and 0.60 mM, and for the synthetic wastewater were ca.
0.28 and 0.26 mM, respectively. The chemical oxygen demand for
the synthetic wastewater was ca. 300 mg O2 /L and for the UWTP
wastewater samples ranged 25–50 mg O2 /L. In the UWTP wastew-
ater samples the total suspended solids were 5.2 ± 1.7 mg/L.
2.2. Ozonation and UV254 nm processes
The ozonation and UV254 nm experiments were carried out at
room temperature (25 ± 2 ◦ C) in a 1 L lab-scale batch reactor loaded
with the wastewater and under continuous stirring at 350 rpm. In
ozonation experiments, ozone was produced from pure oxygen in
a BMT 802X ozone generator and its concentration in the gas phase
was monitored with a BMT 964 ozone analyser. The ozone leaving
the reactor in the gas phase was removed in gas washing bottles
filled with a potassium iodide solution. These experiments were
performed at a constant ozone flow rate (150 cm3 /min STP) and
inlet concentration (50 g/Nm3 ) for different contact times (15, 30 or
60 min) in order to select the most appropriate for comparison with
UV254 nm experiments. At the end of each experiment, the treated
wastewater was subjected to 30 min of oxygen flow (150 cm3 /min
STP) in order to dissipate any dissolved ozone remaining in the
liquid phase. UV254 nm experiments (30 min) were done with an
oxygen flow rate of 150 cm3 /min STP and by using a Heraeus TNN
15/32 low-pressure mercury vapour lamp (emission line at 254 nm)
Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
3
Antibiotic resistance determinants Density in the synthetic wastewater (CFU/100 mL)
aac(6 )- CTX-M15; 105
blaOXA-A-1;
Ib-cr;
blaTEM-1;
intI-1
vanA 105
intI-1 105
ND 103
ND 103
that was held in a quartz immersion tube located axially in the
reactor.
Each type of assay was performed with three independent syn-
thetic or UWTP wastewater samples.
2.3. Disinfection capacity
In order to assess the disinfection efficiency of each ter-
tiary treatment process and the microbial reactivation potential,
wastewater samples (synthetic or UWTP wastewater) were char-
acterized for the abundance of selected groups of cultivable
microorganisms and selected genes (Sections 2.3.1 and 2.3.2,
respectively), before and immediately after tertiary treatment and
after three days of storage. These wastewater samples were stored
at room light and temperature (approximately 12 h light/12 h dark;
20–22 ◦ C) in cotton plugged Erlenmeyer flasks with a liquid:air ratio
of 1:2, aiming at determining the microbial groups and genes able
to recover after tertiary treatment. Non-treated wastewater sam-
ples were stored and analysed in parallel with the other assays. All
determinations were performed in triplicate. Treatment efficien-
cies were calculated in reference to a volume of 100 mL of sample, as
recommended for water quality monitoring [15] as follows: (1) the
number of Colony Forming Units (CFU) and the number of copies
of each gene were referred to 100 mL of sample; (2) the % removal
was calculated as being = 100 × (Xuntreated − Xtreated )/Xuntreated or log
removal = log Xuntreated −log Xtreated , where Xuntreated and Xtreated were
the CFU of total heterotrophs, enterobacteria, enterococci or fungi,
or the gene copy number of 16S rRNA, intI1, blaTEM , vanA, qnrS or
sul1 per 100 mL of wastewater, before and after the ozonation or
UV254 nm treatment, respectively.
2.3.1. Enumeration of cultivable microorganisms
Cultivable microorganisms were enumerated based on the
membrane filtration method as described elsewhere [34]. Briefly,
adequate volumes of wastewater samples or serial dilutions thereof
were filtered through cellulose nitrate membranes (0.22 ␮m
porosity; Sartorius Stedim Biotech, Germany) and incubated on
culture media targeting different microbial groups: Plate Count
Agar (Merck, New Jersey, NJ; 30 ◦ C, 24 h) for total heterotrophs;
membrane Fecal Coliforms (Difco, Chicago, IL; 37 ◦ C, 24 h) for enter-
obacteria; m-Enterococcus agar (Difco; 37 ◦ C, 48 h) for enterococci;
and Rose Bengal Chloramphenicol agar (VWR International; 30 ◦ C,
7 days) for fungi.
2.3.2. Quantification of antibiotic resistance genes
Total DNA was extracted from wastewater samples with
volumes ranging from 200 to 1000 mL, after filtration through poly-
carbonate membranes (0.22 ␮m porosity; Whatman, UK), using the
commercial kit PowerWater® DNA Isolation (MO BIO Laborato-
ries, Inc., USA). Quantitative PCR (qPCR, StepOneTM Real-Time PCR
System; Life Technologies, USA) was performed, and results were
analysed using the StepOneTM v.2.3 software (Life Technologies),
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
4 J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx

A 10 B 10
9 9

Log (CFU / 100 mL)

Log (CFU / 100 mL)

8 8
7 7
6 6
5 5
4 4
3 3
2 2
1 1
0 0
Heterotrophs Enterobacteria Enterococci Fungi Heterotrophs Enterobacteria Enterococci Fungi

C D
10 10
Log (copy number / 100 mL)

Log (copy number / 100 mL)

9 9
8 8
7 7
6 6
5 5
4 4
3 3
2 2
1 1
0 0
16S rRNA intI1 blaTEM qnrS sul1 16S rRNA intI1 blaTEM qnrS sul1

Fig. 2. Microbial inactivation by ozonation (A, C) or UV254 nm (B, D), assessed in conventionally treated urban wastewater (UWTP wastewater) based on the quantification of
selected microbial groups using culture-dependent methods (A, B) and qPCR of selected genes (C, D), in non-treated control samples (filled bars) and after 30 min of treatment
with ozone or UV254 nm (striped bars), before and immediately after the treatment (black) and after three days of storage at room temperature (grey). The quantities of total
DNA per 100 mL of sample in ozonation experiments were: 3311.7 ng in freshly collected UWTP wastewater; 36.2 ng in treated UWTP wastewater after 30 min of treatment;
1658.3 ng in untreated UWTP wastewater after three days storage; 390.0 ng in UWTP wastewater treated for 30 min after three days storage. The quantities of total DNA per
100 mL of sample obtained in UV254 nm experiments were: 2210.7 ng in freshly collected UWTP wastewater; 55.0 ng in treated UWTP wastewater after 30 min of treatment;
1093.3 ng in untreated UWTP wastewater after three days storage; 679.4 ng in UWTP wastewater treated for 30 min after three days storage.

according to the conditions indicated in Table 2 [35–37]. Melting tact time of 15 min, log reductions varied between 4.4 ± 0.8 for the
curves at increments of 0.3 ◦ C from 60 to 95 ◦ C were used to assess tested enterobacteria (the antibiotic resistant Escherichia coli strain
the homogeneity of the amplification. Standards curves were pre- A2FCC14) and 2.3 ± 0.7 for fungi (Rhodotorula rubra and Aspergillus
pared using serial ten-fold dilutions of purified plasmid DNA, or niger), corresponding to removal percentages of 99.98 ± 0.03% and
genomic DNA extract, for each gene. The 16S rRNA gene stan- 98.25 ± 2.20%, respectively (Fig. 1A and Table 3). A contact time of
dard was prepared using the genomic DNA of E. coli ATCC 25992 30 min was sufficient to achieve log reductions of 3.3 ± 0.2 for fungi,
extracted with QIAamp DNA Stool Kit (QIAGEN, The Netherlands). 6.5 ± 0.1 for total heterotrophs, and >5.0 for enterobacteria (corre-
Standard curves for the remaining genes were prepared using sponding to <1CFU/100 mL after treatment) (Fig. 1A). For a longer
amplicons of blaTEM and intI1, vanA, qnrS and sul1 obtained from ozone exposure (60 min), the tested microorganisms were inacti-
genomic DNA of E. coli A2FCC14, E. faecalis H1EV23, Enterobacter vated to values below the limit of quantification (0.5 CFU/100 mL).
cloacae (S1+) and Achromobacter sp., respectively, and were cloned The raw and ozone treated synthetic wastewater samples were
with InsTAcloneTM PCR Cloning Kit (Thermo Fisher Scientific, USA) also screened for the quantity of selected genetic determinants,
[38–42]. Plasmid DNA was extracted using a GeneJET Plasmid the 16S rRNA gene (marker for bacteria, Table 1), the intI1 gene
Miniprep Kit (Thermo Fisher Scientific), treated with Plasmid- (maker for class 1 integrons, common in Gram-negative bacte-
SafeTM ATP-Dependent DNase (Epicentre, USA) and then purified ria, Table 1), the blaTEM gene (marker for beta-lactamase resistant
using a GRS PCR & Gel Band Purification Kit (GRISP, Portugal). DNA Gram-negative bacteria, Table 1) and the vanA gene (marker for
quantification was performed using a Qubit Fluorometer (Invitro- vancomycin resistant enterococci, Table 1). Except for the gene
gen, USA) and gene copy numbers were calculated by the Standard vanA that was reduced to values below the limit of quantifica-
Curve method as described elsewhere [43]. tion after 15 min of ozonation (Fig. 1B), the analyses of the genetic
markers confirmed the culture-dependent methods for contact
3. Results and discussion times of 15 and 30 min. A contact time of 30 min led to log reduc-
tions ranging from 4.2 ± 0.5 to > 6.7 for the 16S rRNA and blaTEM
3.1. Ozonation of synthetic wastewater genes, corresponding to removal percentages of 99.99% (Table 3).
As expected, lower decimal reductions were observed after 15 min
Given the complexity of the wastewater microbiome and antibi- of contact, varying between 2.3 ± 0.3 and 3.7 ± 0.1 for the 16S rRNA
otic resistome, preliminary ozonation assays were conducted in and intI1 genes, respectively, corresponding to removal percent-
synthetic wastewater inoculated with known microbial groups, ages above 99.57% (Fig. 1B, Table 3). After 60 min of ozonation, no
some of which harbouring known antibiotic resistance genes. These quantifiable amount of DNA could be extracted from 1000 mL of
preliminary assays supported the determination of the adequate treated synthetic wastewater.
ozonation contact time (15, 30 or 60 min) to inactivate the test Since the objective of this study was to assess the impact of dis-
organisms and also permitted to infer about the behaviour of the infection on different microbial populations, the use of a sub-lethal
different microbial groups or resistance genes after ozonation. As treatment, achieved with a contact time of 30 min, was consid-
expected, the increase of the contact time favoured the microbial ered the most adequate to test ozonation and UV254 nm radiation in
inactivation (Fig. 1A, where dark grey and black bars correspond the disinfection of an UWTP effluent resultant from conventional
to 15 and 30 min of treatment, respectively, while freshly prepared treatment.
synthetic wastewater is represented by light grey bars). At a con-

Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx 5

Table 2
Conditions used in quantitative PCR assays.

Gene Primers Reference Efficiency (%) Limit of quantification Conditions/Reference

(gene copy number)

16S rRNA 1114F E. coli (ATCC 25922) 100 385 95 ◦ C for 10 min (1 cycle); 95 ◦ C
(CGGCAACGAGCGCAACCC) for 15 s, 55 ◦ C for 20 s and 72 ◦ C
for 10 s (35 cycles) [35]
1275R
(CCATTGTAGCACGTGTGTAGCC)

blaTEM blaTEM-F (TTCCTGTTTTTGCTCACCCAG) E. coli (A2FCC14) 96 368 95 ◦ C for 10 min (1 cycle); 95 ◦ C

for 15 s, 60 ◦ C for 30 s and 72 ◦ C
for 10 s (40 cycles) [35]
blaTEM-R
(CTCAAGGATCTTACCGCTGTTG)

intI1 intI1-F E. coli (A2FCC14) 94 42 95 ◦ C for 10 min (1 cycle); 95 ◦ C

(CCTCCCGCACGATGATC) for 15 s, 55 ◦ C for 30 s and 72 ◦ C
for 10 s (40 cycles) [35]
intI1-R
(TCCACGCATCGTCAGGC)

qnrS qnrSrtF11 (GACGTGCTAACTTGCGTG) Enterobacter cloacae (S1+) 95 67 95 ◦ C 5 min (1 cycle); 95 ◦ C 15 s

−60 ◦ C 1 min (40 cycles) [36]
qnrSrtR11 (TGGCATTGTTGGAAACTT)

sul1 sul1-FW Achromobacter sp. 94 928 95 ◦ C 5 min (1 cycle); 95 ◦ C 15 s

(CGCACCGGAAACATCGCTGCAC) −60 ◦ C 1 min (40 cycles) [37]
sul1-RV
(TGAAGTTCCGCCGCAAGGCTCG)

vanA vanA3FP Enterococcus faecalis (H1EV23) 98 15 95 ◦ C 5 min (1 cycle); 95 ◦ C 15 s

(CTGTGAGGTCGGTTGTGCG) −60 ◦ C 1 min (40 cycles) [35]
vanA3RP
(TTTGGTCCACCTCGCCA)

(1) KAPA SYBR® FAST ABI Prism® qPCR Master Mix.

(2) SYBR® Select Master Mix.
(a) 200 nM of primer.
(b) 400 nM of primer.
(c) 600 nM of primer.

3.2. Ozonation and UV254nm radiation of UWTP wastewater
The treatment of UWTP wastewater samples with ozone or
UV254 nm radiation showed that both processes were able to reduce
the cultivable microbial populations, with log reduction values
ranging from 2.0 for fungi (UV254 nm and ozone) to 3.9 for total het-
erotrophs (ozone), corresponding to removal percentages above
96.13% (Table 3; Fig. 2A, B). Since part of the UWTP wastewa-
ter microbiota is non-cultivable, as could be inferred by the ∼2.5
log units higher number of copies of 16S rRNA gene in the UWTP
wastewater than in the synthetic wastewater (Figs. 1B and 2C),
the assessment of the disinfection capacity based on culture-
independent methods was an important complementary analysis.
As could be expected, in real wastewater, the reduction of the 16S
rRNA gene abundance after ozonation or UV254nm radiation was
lower than in synthetic wastewater inoculated with cultivable bac-
teria. Both types of treatment, ozonation or UV254 nm radiation,
led to similar log reduction values of 2.1 ± 0.5 and 2.0 ± 0.3, cor-
responding to ∼98.7% for the gene 16S rRNA (Fig. 2C, D; Table 3).
Similar findings were observed for the capacity to reduce the levels
of intI¸with log reduction values around 2 (2.0 ± 0.6 and 2.4 ± 0.4, for
ozonation and UV254 nm, respectively), corresponding to removal
percentages above 98.03%. Although both methods showed the
capacity to remove the analysed ARGs, differences between ozona-
tion and UV254 nm radiation were observed for the gene sul1. Indeed,
this ARG was removed from 400 mL of wastewater to values below
the limit of quantification by ozonation, while log removal val-
ues of 2.2 ± 0.4 where achieved with UV254 nm radiation. The other
two ARGs, blaTEM and qnrS, were removed to levels close or infe-
rior to the limit of quantification in 400 mL of wastewater by both
processes (Fig. 2C, D; Table 3). The gene vanA was below the quan-
tification limit in all samples analysed.
The synthetic wastewater contained both readily metabolizable
and recalcitrant organic matter (humic acids). The exact compo-
sition of the organic matter present in the UWTP wastewater is
not known, but beside natural readily metabolizable and recalci-
trant organic matter [29], it might contain different micropollutants
[44]. All of these substances may affect the efficiency of disinfec-
tion by ozonation or UV radiation because they are also targets
of the oxidation species and radiation used in these processes.
Because the chemical oxygen demand of the synthetic wastewa-
ter was at least 6 times higher than that of the UWTP wastewater,
it could be expected to have a comparatively lower disinfection
efficiency in the first, since part of oxidation species formed could
be absorbed by the organic rather than by the microbial cells. How-
ever, the opposite effect was observed. The suspended solids, which
are known to reduce the efficiency of ozonation and UV radiation
[26,27], the dissolved organic matter (DOM), that may have a dual
role acting as inner filters and/or photosensitizers [30,32], and the
complexity of the microbiota [45] in the real wastewater may be
the major factors explaining the lower inactivation values observed
for the UWTP wastewater than for the synthetic wastewater. In
fact, even if the initial pH values of synthetic and UWTP wastewa-
ter were similar (7.8 ± 0.5), a pH decrease (until 5.9) was observed
after 30 min ozonation for the synthetic wastewater only, proba-
bly due its less complex matrix and the possible formation of low
molecular weight carboxylic acids.
3.3. Regrowth and reactivation
Considering that microorganisms affected by the disinfection
could, in fact, maintain viability and therefore regrow when the
stress was relieved, the same microbial groups and genes were ana-
lysed after three days storage (Fig. 1C, D and grey bars in Fig. 2). This

Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
6 J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx
Table 3
Percentage of removal of cells and gene copy number per 100 mL wastewater observed for the different types of wastewater, treatment and ozonation contact time.
Synthetic wastewater
15 min
Culture dependent Heterotrophs 99.96 ± 0.03
Enterobacteria 99.98 ± 0.03
Enterococci 99.92 ± 0.11
Fungi 98.25 ± 2.20
Culture independent 16S rRNA 99.57 ± 0.22
intI1 99.99 ± 0.00
sul1 ND
blaTEM 99.96 ± 0.01
qnrS ND
vanA >99.99
ND, not determined; NDe, not detected
analysis was justified since disinfection is a process that eliminates
only part of the microorganisms, allowing subsequent regrowth,
which, in the case of the methods used, may be mainly due to the
availability of assimilable organic carbon resultant from the partial
degradation of complex organic matter, as it has been described
[46,47].
After storage of the treated synthetic wastewater, reactivation of
cultivable cells occurred for 30 min assays, although it was observed
to be less intense than in those stored after 15 min of ozonation. No
reactivation was observed after 60 min ozonation, suggesting that
this period of contact was sufficient to kill the majority of the cells.
For a contact time of 30 min, enterobacteria and enterococci counts
were close to the quantification limit, while slight increases in the
other cultivable microbial groups tested was observed (Fig. 1C).
For the shortest contact time tested, 15 min, the recovery of cul-
tivable microorganisms was comparatively higher, particularly for
fungi and total heterotrophs, while enterococci were those with the
lowest capability of regrowth (Fig. 1C). In comparison with the vari-
ations observed for cultivable microorganisms, higher variations,
corresponding to a stronger reactivation were observed for all the
analysed genes, except vanA in synthetic wastewater (Fig. 1D). For
30 min, reactivation led to the increase of the number of gene copies
per volume of synthetic wastewater, although to levels below those
observed before treatment.
Storage for 3 days of the untreated control synthetic wastew-
ater (filled light grey bars in Fig. 1C, D) led to a strong increase
in both the cultivable cell counts and in the copy number of the
16S rRNA gene, up to 3-fold. The different behaviour on the recov-
ery of the cells/genes in the treated and in the untreated control
wastewater was possibly related with the fact that most of the
microbial population was irreversibly inactivated after ozonation,
with the survivors being a minority that could not reach the pre-
treatment levels, at least during the storage period tested. However,
in real wastewater, with a higher microbial diversity than the syn-
thetic wastewater, regrowth was expected to be more intense.
Indeed, in stored treated UWTP wastewater the density of total
heterotrophs, enterobacteria and fungi was similar to or above the
pre-treatment levels (stripped grey bars, Fig. 2A, B). In line with
the results obtained with synthetic wastewater, enterococci were
the microorganisms with the lowest recovery rate, mainly after
the UV254 nm treatment (Fig. 2A, B). In agreement with the culture-
dependent data, after storage, the gene 16S rRNA reached levels
close to the pre-treatment values, suggesting that both processes
left viable cells able to recover and grow after the stress relieve
(Fig. 2C, D). A similar observation was made for the gene blaTEM ,
which reached values close to the pre-treatment levels after three
days of storage (Fig. 2C, D). Also the density of the genes intI1 and
sul1 was restored after storage, with values of about 0.5 and 1 log-
unit below the pre-treatment levels after UV254 nm and ozonation,
Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
UWTP wastewater
Ozonation Ozonation UV254 nm
30 min 60 min 30 min 30 min
>99.99 >99.99 99.96 ± 0.06 99.94 ± 0.02
>99.99 99.93 ± 0.11 99.97 ± 0.03
>99.99 99.78 ± 0.33 98.61 ± 1.45
99.99 ± 0.01 99.97 ± 0.03 96.13 ± 6.17
99.99 ± 0.00 ND 98.70 ± 1.38 98.71 ± 1.07
99.99 ± 0.00 98.03 ± 2.16 99.47 ± 0.52
ND > 99.99 99.01 ± 0.91
99.99 ± 0.00 > 99.99 > 99.99
ND > 99.99 > 99.99
>99.99 NDe NDe
respectively. An identical observation was made for the gene qnrS
after UV254 nm radiation, but not after ozone exposure. These results
suggest that ozonation may have a better performance on the inac-
tivation of the hosts of some ARGs, mainly of qnrS, than UV254nm .
The higher recovery of cultivable cell and genes in the stored
UWTP wastewater than in the synthetic wastewater may be related
with the fact that the tested disinfection processes were less effi-
cient in cell inactivation in the first than in the later. Curiously, while
the complexity of real UWTP wastewater could explain the intense
recovery observed after treatment, a phenomenon of competition
in the microbial community was probably behind the decrease in
the density of all microbial groups in control untreated UTWP sam-
ples (filled grey bars, Fig. 2A,B). Indeed, incubation of the untreated
UWTP wastewater for 3 days resulted in the decrease of the initial
cultivable cell counts of all the microbial groups, with log reduction
values ranging from 0.3 for total heterotrophs to 1.5 for enterococci.
3.4. Comparison of data normalization—volume, total DNA, 16S
rRNA gene
The assessment of the efficiency of the treatment processes was
made using normalization per volume of wastewater (Figs. 1 and 2),
specifically per 100 mL of water, as recommended in legal directives
defining water quality parameters and the respective threshold val-
ues. However, other normalization factors, in particular ng of DNA
or number of copies of the gene 16S rRNA, may give additional infor-
mation. Specifically, it may give information about the frequency,
rather than total abundance, of a gene in the biota (ng total DNA)
or bacterial community (16S rRNA). These calculations show that,
in spite of being observed an overall removal of antibiotic resis-
tance and integrase genes, there was, in general, an increase in
the prevalence of these genetic determinants among the organ-
isms surviving the treatment. Indeed, significantly higher ratios of
recovered/initial populations were observed for the different genes,
for UV254 nm radiation, when the normalization was made with the
marker for total bacteria, the 16S rRNA gene, than per volume or
amount of total DNA. Similar findings were observed for the genes
intI1 and sul1, for ozonation (Supplementary Fig. 1; Table 4). If it
is taken into account that each bacterial cell contains usually more
than one 16S rRNA gene copy, it may be argued that in fact such ratio
may be in reality higher than that shown in Table 4. In summary,
although antibiotic resistance and integrase genes were removed
in terms of total abundance, it may have occurred an enrichment
of these genes when regrowth was allowed.
The results presented confirm previous studies, which reported
that tertiary treatments based on UV254 nm radiation or on ozona-
tion are valuable contributes to reduce the microbial loads and
the spread of ARG [23,26,27,48,49]. However, despite the efficiency
on the reduction of the microbial and ARG loads, disinfection pro-
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx 7

Table 4
Balance of the removal rate after three days of storage, based on the ratio logT3/logC0 , using the different normalization parameters (volume, ng DNA or number of copies
of the gene 16S rRNA). T3, three days after treatment; C0 , freshly collected UWTP wastewater.

Normalization parameter

Marker gene/Disinfection process Volume of wastewater ng DNA 16S rRNA gene copy number

rRNA 16S
Ozonation 0.96 ± 0.02 1.10 ± 0.00 –
UV254 nm 1.00 ± 0.01 1.09 ± 0.03 –

intI1
Ozonation 0.91 ± 0.06a 1.07 ± 0.08a,b 1.21 ± 0.22b
UV254 nm 0.94 ± 0.01a 1.01 ± 0.03b 1.51 ± 0.06c

blaTEM
Ozonation 0.93 ± 0.18a 1.34 ± 0.49b 1.03 ± 0.28a,b
UV254 nm 0.92 ± 0.05a 1.02 ± 0.08b 1.13 ± 0.06c

qnrS
Ozonation ∼LOQ ∼LOQ ∼LOQ
UV254 nm 0.82 ± 0.16a 0.75 ± 0.30a 1.39 ± 0.33b

sul1
Ozonation 0.85 ± 0.09a 1.05 ± 0.15b 1.15 ± 0.12b
UV254 nm 0.96 ± 0.02a 1.06 ± 0.03b 1.15 ± 0.04c

LOQ, limit of quantification.

a,b,c
Significantly different values for the same type of treatment and considering different types of normalization.

cesses may promote the re-growth of the surviving cells [50–52].
Moreover, cells hosting some ARG may have a selective advantage
after disinfection treatment, leading to a bacterial community with
a higher prevalence of ARB [20], and tertiary treated wastewater
with ARG loads similar to those treated by conventional biological
processes. Hence, storage and distribution of wastewater treated
by the tertiary processes tested, for example in re-use scenarios,
should be carefully managed.
Acknowledgements
Financial support for this work was provided by project
NORTE-07-0202-FEDER-038900 (NEPCAT), financed by FEDER
(Fundo Europeu de Desenvolvimento Regional) through ON2
(Programa Operacional do Norte). This work was partially co-
financed by FCT (Fundação para a Ciência e a Tecnologia)/MEC and
FEDER under Programe PT2020 (Projects UID/EQU/00511/2013-
LEPABE and UID/EQU/50020/2013), PEst-OE/EQB/LA0016/2013
and by QREN, ON2 and FEDER through projects NORTE-07-
0124-FEDER-000025, NORTE-07-0124-FEDER-000015 and NORTE-
07-0162-FEDER-000050. MP and CBC acknowledge FCT grants
SFRH/BD/102086/2014 and SFRH/BPD/87152/2012, respectively.
AMTS acknowledges the FCT Investigator 2013 Programme
(IF/01501/2013), with financing from the European Social Fund and
the Human Potential Operational Programme. The authors would
like to acknowledge the staff of the UWTP and the financial support
provided by COST-European Cooperation in Science and Technol-
ogy, to the COST Action ES1403: New and emerging challenges and
opportunities in wastewater reuse (NEREUS). Disclaimer: The con-
tent of this article is the authors’ responsibility and neither COST
nor any person acting on its behalf is responsible for the use, which
might be made of the information contained in it.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.jhazmat.2016.03.
096.
References
[1] M.N. Chong, B. Jin, C.W.K. Chow, C. Saint, Recent developments in
photocatalytic water treatment technology: a review, Water Res. 44 (2010)
2997–3027.
[2] C. Becerra-Castro, A.R. Lopes, I. Vaz-Moreira, E.F. Silva, C.M. Manaia, O.C.
Nunes, Wastewater reuse in irrigation: a microbiological perspective on
implications in soil fertility and human and environmental health, Environ.
Int. 75 (2015) 117–135.
[3] D. Norton-Brandão, S.M. Scherrenberg, J.B. Van Lier, Reclamation of used
urban waters for irrigation purposes—a review of treatment technologies, J.
Environ. Manage. 122 (2013) 85–98.
[4] T. Wintgens, F. Salehi, R. Hochstrat, T. Melin, Emerging contaminants and
treatment options in water recycling for indirect potable use, Water Sci.
Technol. 57 (2008) 99–107.
[5] B.R. Bradley, G.T. Daigger, R. Rubin, G. Tchobanoglous, Evaluation of onsite
wastewater treatment technologies using sustainable development criteria,
Clean Technol. Environ. Policy 4 (2002) 87–99.
[6] J. Rivera-Utrilla, M. Sanchez-Polo, M.A. Ferro-Garcia, G. Prados-Joya, R.
Ocampo-Perez, Pharmaceuticals as emerging contaminants and their removal
from water. A review, Chemosphere 93 (2013) 1268–1287.
[7] A.R. Ribeiro, O.C. Nunes, M.F. Pereira, A.M. Silva, An overview on the advanced
oxidation processes applied for the treatment of water pollutants defined in
the recently launched Directive 2013/39/EU, Environ. Int. 75 (2015) 33–51.
[8] M.C. Dodd, Potential impact of disinfection processes on elimination and
deactivation of antibiotic resistance genes during water and wastewater
treatment, J. Environ. Monit. 14 (2012) 1754–1771.
[9] L. Rizzo, C.M. Manaia, C. Merlin, T. Schwartz, C. Dagot, M.C. Ploy, I. Michael, D.
Fatta-Kassinos, Urban wastewater treatment plants as hotspots for antibiotic
resistant bacteria and genes spread into the environment: a review, Sci. Total
Environ. 447 (2013) 345–360.
[10] T.U. Berendonk, C.M. Manaia, C. Merlin, D. Fatta-Kassinos, E. Cytryn, F. Walsh,
H. Burgmann, H. Sorum, M. Norstrom, M.N. Pons, N. Kreuzinger, P. Huovinen,
S. Stefani, T. Schwartz, V. Kisand, F. Baquero, J.L. Martinez, Tackling antibiotic
resistance: the environmental framework, Nat. Rev. Microbiol. 13 (2015)
310–317.
[11] C.M. Manaia, G. Macedo, D. Fatta-Kassinos, O.C. Nunes, Antibiotic resistance in
urban aquatic environments: can it be controlled? Appl. Microbiol.
Biotechnol. 100 (2016) 1543–1557.
[12] I. Michael, L. Rizzo, C.S. McArdell, C.M. Manaia, C. Merlin, T. Schwartz, C.
Dagot, D. Fatta-Kassinos, Urban wastewater treatment plants as hotspots for
the release of antibiotics in the environment: a review, Water Res. 47 (2013)
957–995.
[13] A.R. Ribeiro, M. Pedrosa, N.F.F. Moreira, M.F.R. Pereira, A.M.T. Silva,
Environmental friendly method for urban wastewater monitoring of
micropollutants defined in the Directive 2013/39/EU and Decision
2015/495/EU, J. Chromatogr. A 1418 (2015) 140–149.
[14] N.F.F. Moreira, C.A. Orge, A.R. Ribeiro, J.L. Faria, O.C. Nunes, M.F.R. Pereira,
A.M.T. Silva, Fast mineralization and detoxification of amoxicillin and
diclofenac by photocatalytic ozonation and application to an urban
wastewater, Water Res. 87 (2015) 87–96.

Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
G Model
HAZMAT-17608; No. of Pages 8 ARTICLE IN PRESS
8 J.M. Sousa et al. / Journal of Hazardous Materials xxx (2016) xxx–xxx
[15] ISO 9308-1, Water quality—Enumeration of Escherichia coli and coliform
bacteria—Part 1: Membrane Filtration Method for Waters with Low Bacterial
Background Flora, International Organization for Standardization (ISO),
Geneva, Switzerland, 2014.
[16] Council Directive, 98/83/EC, of 3 November 1998 on the quality of water
intended for human consumption as amended by regulation 1882/2003/EC,
Off. J. Eur. Communities L330 (1998) 32–54.
[17] WHO, World Health Organization, Guidelines for Drinking-water Quality. Vol
1: 3rd ed. Recommendations, Geneva, Switzerland (2004).
[18] I. Vaz-Moreira, O.C. Nunes, C.M. Manaia, Bacterial diversity and antibiotic
resistance in water habitats: searching the links with the human microbiome,
FEMS Microbiol. Rev. 38 (2014) 761–778.
[19] A.R. Varela, C.M. Manaia, Human health implications of clinically relevant
bacteria in wastewater habitats, Environ. Sci. Pollut. Res. 20 (2013)
3550–3569.
[20] L. Rizzo, A. Fiorentino, A. Anselmo, Advanced treatment of urban wastewater
by UV radiation: effect on antibiotics and antibiotic-resistant E. coli strains,
Chemosphere 92 (2013) 171–176.
[21] I. Michael-Kordatou, M. Iacovou, Z. Frontistis, E. Hapeshi, D.D. Dionysiou, D.
Fatta-Kassinos, Erythromycin oxidation and ERY-resistant Escherichia coli
inactivation in urban wastewater by sulfate radical-based oxidation process
under UV-c irradiation, Water Res. 85 (2015) 346–358.
[22] I. Michael, E. Hapeshi, C. Michael, A.R. Varela, S. Kyriakou, C.M. Manaia, D.
Fatta-Kassinos, Solar photo-fenton process on the abatement of antibiotics at
a pilot scale: degradation kinetics, ecotoxicity and phytotoxicity assessment
and removal of antibiotic resistant enterococci, Water Res. 46 (2012)
5621–5634.
[23] F. Lüddeke, S. Hess, C. Gallert, J. Winter, H. Güde, H. Löffler, Removal of total
and antibiotic resistant bacteria in advanced wastewater treatment by
ozonation in combination with different filtering techniques, Water Res. 69
(2015) 243–251.
[24] M. Munir, K. Wong, I. Xagoraraki, Release of antibiotic resistant bacteria and
genes in the effluent and biosolids of five wastewater utilities in Michigan,
Water Res. 45 (2011) 681–693.
[25] T.D. Cutler, J.J. Zimmerman, Ultraviolet irradiation and the mechanisms
underlying its inactivation of infectious agents, Anim. Health Res. Rev. 12
(2011) 15–23.
[26] EPA, U.S. Environmental Protection Agency, Wastewater Technology Fact
Sheet: Ultraviolet Disinfection, Washington D.C., USA, 1999.
[27] EPA, U.S. Environmental Protection Agency, Wastewater Technology Fact
Sheet: Ozone Disinfection, Washington D.C., USA, 1999.
[28] M. Bellucci, I.D. Ofiteru, I.M. Head, T.P. Curtis, D.W. Graham, Nitrification in
hybrid bioreactors treating simulated domestic wastewater, J. Appl.
Microbiol. 115 (2013) 621–630.
[29] A. Imai, T. Fukushima, K. Matsushige, Y.-H. Kim, K. Choi, Characterization of
dissolved organic matter in effluents from wastewater treatment plants,
Water Res. 36 (2002) 859–870.
[30] R. Andreozzi, M. Raffaele, P. Nicklas, Pharmaceuticals in STP effluents and
their solar photodegradation in aquatic environment, Chemosphere 50 (2003)
1319–1330.
[31] A. Rodrigues, A. Brito, P. Janknecht, M.F. Proença, R. Nogueira, Quantification
of humic acids in surface water: effects of divalent cations, pH, and filtration,
J. Environ. Monit. 11 (2009) 377–382.
[32] E.M.-L. Janssen, P.R. Erickson, K. McNeill, Dual roles of dissolved organic
matter as sensitizer and quencher in the photooxidation of tryptophan,
Environ. Sci. Technol. 48 (2014) 4916–4924.
[33] APHA, American Public Health Association, Standard Methods for the
Examination of Water and Wastewater, 20th ed., Washington D.C., USA, 1998.
[34] M.F. da Silva, I. Tiago, A. Verissimo, R.A.R. Boaventura, O.C. Nunes, C.M.
Manaia, Antibiotic resistance of enterococci and related bacteria in an urban
wastewater treatment plant, FEMS Microbiol. Ecol. 55 (2006) 322–329.
Please cite this article in press as: J.M. Sousa, et al., Ozonation and UV254 nm radiation for the removal of microorganisms and antibiotic
resistance genes from urban wastewater, J. Hazard. Mater. (2016), http://dx.doi.org/10.1016/j.jhazmat.2016.03.096
[35] C. Narciso-da-Rocha, A.R. Varela, C. Schwartz, O.C. Nunes, C.M. Manaia,
blaTEM and vanA as indicator genes of antibiotic resistance contamination in
a hospital–urban wastewater treatment plant system, J. Global Antimicrob.
Resist. 2 (2014) 309–315.
[36] E. Marti, J.L. Balcázar, Real-time PCR assays for quantification of qnr genes in
environmental water samples and chicken feces, Appl. Environ. Microbiol. 79
(2013) 1743–1745.
[37] R. Pei, S.C. Kim, K.H. Carlson, A. Pruden, Effect of river landscape on the
sediment concentrations of antibiotics and corresponding antibiotic
resistance genes (ARG), Water Res. 40 (2006) 2427–2435.
[38] C. Goldstein, M.D. Lee, S. Sanchez, C. Hudson, B. Phillips, B. Register, M. Grady,
C. Liebert, A.O. Summers, D.G. White, J.J. Maurer, Incidence of class 1 and 2
integrases in clinical and commensal bacteria from livestock, companion
animals, and exotics, Antimicrob, Agents Chemother. 45 (2001) 723–726.
[39] J.R. DiPersio, L.M. Deshpande, D.J. Biedenbach, M.A. Toleman, T.R. Walsh, R.N.
Jones, Evolution and dissemination of extended-spectrum
beta-lactamase-producing Klebsiella pneumoniae: epidemiology and
molecular report from the SENTRY Antimicrobial Surveillance Program
(1997–2003), Diagn. Microbiol. Infect. Dis. 51 (2005) 1–7.
[40] S. Dutka-Malen, S. Evers, P. Courvalin, Detection of glycopeptide resistance
genotypes and identification to the species level of clinically relevant
enterococci by PCR, J. Clin. Microbiol. 33 (1995) 24–27.
[41] V. Cattoir, L. Poirel, V. Rotimi, C.-J. Soussy, P. Nordmann, Multiplex PCR for
detection of plasmid-mediated quinolone resistance qnr genes in
ESBL-producing enterobacterial isolates, J. Antimicrob. Chemother. 60 (2007)
394–397.
[42] I.S. Henriques, F. Fonseca, A. Alves, M.J. Saavedra, A. Correia, Occurrence and
diversity of integrons and beta-lactamase genes among ampicillin-resistant
isolates from estuarine waters, Res. Microbiol. 157 (2006) 938–947.
[43] R. Brankatschk, N. Bodenhausen, J. Zeyer, H. Burgmann, Simple absolute
quantification method correcting for quantitative PCR efficiency variations for
microbial community samples, Appl. Environ. Microbiol. 78 (2012)
4481–4489.
[44] D. Fatta-Kassinos, I.K. Kalavrouziotis, P.H. Koukoulakis, M.I. Vasquez, The risks
associated with wastewater reuse and xenobiotics in the agroecological
environment, Sci. Total Environ. 409 (2011) 3555–3563.
[45] L. Ye, T. Zhang, Bacterial communities in different sections of a municipal
wastewater treatment plant revealed by 16S rDNA 454 pyrosequencing, Appl.
Environ. Microbiol. 97 (2013) 2681–2690.
[46] P. Thayanukul, F. Kurisu, I. Kasuga, H. Furumai, Evaluation of microbial
regrowth potential by assimilable organic carbon in various reclaimed water
and distribution systems, Water Res. 47 (2013) 225–232.
[47] X. Zhao, H.-Y. Hu, T. Yu, C. Su, H. Jiang, S. Liu, Effect of different molecular
weight organic components on the increase of microbial growth potential of
secondary effluent by ozonation, J. Environ. Sci. (China) 26 (2014) 2190–2197.
[48] J. Oh, D.E. Salcedo, C.A. Medriano, S. Kim, Comparison of different disinfection
processes in the effective removal of antibiotic-resistant bacteria and genes, J.
Environ. Sci. 26 (2014) 1238–1242.
[49] Y. Zhuang, H. Ren, J. Geng, Y. Zhang, L. Ding, K. Xu, Inactivation of antibiotic
resistance genes in municipal wastewater by chlorination, ultraviolet, and
ozonation disinfection, Environ. Sci. Pollut. Res. 22 (2015) 7037–7044.
[50] Z. Bohrerova, J. Rosenblum, K.G. Linden, Importance of recovery of E. coli in
water following ultraviolet light disinfection, J. Environ. Eng. 141 (2014)
04014094.
[51] L.A. Cipparone, A.C. Diehl, G.E. Speitel Jr., Ozonation and BDOC removal: Effect
on water quality, J. Am. Water Works Assoc. 89 (1997) 84–97.
[52] A. Fiorentino, G. Ferro, M.C. Alferez, M.I. Polo-López, P. Fernández-Ibáñez, L.
Rizzo, Inactivation and regrowth of multidrug resistant bacteria in urban
wastewater after disinfection by solar-driven and chlorination processes, J.
Photochem. Photobiol. B Biol. 148 (2015) 43–50.