Sie sind auf Seite 1von 4

Nama : WidyaNingrum

NIM : 17/411750/BI/09890

A. Sequences Aplocheilus panchax

>Aplocheilus panchax MK572038.1


CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTATTCGAGCTGAA
TTAAGCCAGCCGGGATCCCTTTTGGGTGACGATCAAATTTATAATGTAATCGTAACGGCACACGCTTTTG
TAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGCTTTGGGAACTGACTGATTCCTCTGATAAT
TGGCGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCTCCCTCCTTTTTA
CTCCTACTAGCTTCTTCTGGCGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTATATCCTCCCCTCGCAG
GAAATCTTGCTCATGCAGGACCTTCCGTGGATTTAACTATTTTCTCGCTTCATTTAGCGGGGGTTTCTTC
CATTCTAGGGGCTATTAATTTTATCACTACCATTATTAACATAAAACCTCCCGCCATTTCACAGTACCAA
ACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACTTTCCCTTCCTGTATTAGCTG
CCGGTATCACAATACTTTTAACAGACCGAAACCTAAACACCTCTTTCTTCGACCCGGCGGGAGGGGGTGA
CCCCATTCTTTACCAACACCTT

>Aplocheilus panchax MK572036.1


CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTATTCGAGCTGAA
TTAAGCCAGCCGGGATCCCTTTTGGGTGACGACCAAATTTATAATGTAATCGTAACGGCACACGCTTTTG
TAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGCTTTGGGAACTGACTAATTCCTCTGATAAT
TGGCGCCCCAGACATAGCATTCCCCCGAATAAATAATATGAGCTTTTGACTCCTCCCTCCCTCCTTTTTA
CTCCTACTAGCTTCTTCTGGCGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTATATCCCCCCCTCGCAG
GAAATCTTGCTCATGCAGGACCTTCCGTGGATTTAACCATTTTCTCGCTTCATTTAGCGGGGGTTTCTTC
CATTCTAGGGGCTATTAATTTTATCACTACCATTATTAATATAAAACCCCCCGCCATTTCACAGTACCAA
ACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACTTTCCCTTCCTGTATTAGCTG
CCGGTATCACAATACTTTTAACAGACCGAAATCTAAACACCTCTTTCTTCGACCCGGCAGGAGGGGGTGA
CCCCATTCTTTACCAGCACCTT

>Aplocheilus panchax MK572034.1


CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTATTCGAGCTGAA
TTAAGCCAGCCGGGGTCCCTTTTGGGTGACGACCAAATTTATAATGTGATCGTAACGGCACACGCTTTTG
TAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGCTTTGGGAACTGGCTAATTCCTCTGATAAT
TGGCGCCCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTTTGACTCCTCCCTCCCTCCTTTTTA
CTCCTGCTAGCTTCTTCTGGCGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTGTATCCTCCCCTCGCAG
GAAATCTTGCTCATGCAGGACCTTCCGTGGATTTAACCATTTTCTCACTTCATTTAGCGGGGGTTTCTTC
CATTCTAGGGGCTATTAATTTTATCACTACCATTATCAATATAAAACCTCCCGCCATTTCACAGTACCAG
ACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACTTTCCCTTCCTGTGTTAGCTG
CCGGTATCACAATACTTTTAACAGACCGAAACCTAAACACCTCTTTCTTCGACCCGGCAGGAGGGGGCGA
CCCCATTCTTTACCAGCACCTT

>Aplocheilus panchax MK572032.1


CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTATTCGAGCTGAA
TTAAGCCAGCCGGGATCCCTTTTGGGTGACGATCAAATTTATAATGTAATCGTAACGGCACACGCTTTTG
TAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGCTTTGGGAACTGACTGATTCCTCTGATAAT
TGGCGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCTCCCTCCTTTTTA
CTCCTACTAGCTTCTTCTGGCGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTATATCCTCCCCTCGCAG
GAAATCTTGCTCATGCAGGACCTTCCGTGGATTTAACTATTTTCTCGCTTCATTTAGCGGGGGTTTCTTC
CATTCTAGGGGCTATTAATTTTATCACTACCATTATTAACATAAAACCTCCCGCCATTTCACAGTACCAA
ACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACTTTCCCTTCCTGTATTAGCTG
CCGGTATCACAATACTTTTAACAGACCGAAACCTAAACACCTCTTTCTTCGACCCGGCGGGAGGGGGTGA
CCCCATTCTTTACCAACACCTTTTC

>Aplocheilus panchax KU692278.1


CCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTTGGAACGGCCTTAAGCCTACTTATTCGAGCTGAA
CTAAGTCAGCCGGGATCCCTTCTGGGCGACGACCAAATTTATAATGTAATCGTAACGGCACACGCTTTTG
TAATAATTTTCTTTATAGTAATACCAGTAATGATTGGAGGCTTTGGGAACTGATTAGTTCCTCTCATGAT
CGGCGCCCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTACTTCCTCCCTCCTTCTTA
CTTCTATTAGCTTCTTCTGGTGTAGAAGCAGGAGCTGGTACAGGCTGAACCGTTTACCCCCCTCTCGCAG
GAAATCTCGCTCATGCAGGACCTTCCGTCGATTTAACCATTTTCTCACTTCATTTAGCGGGGGTGTCCTC
TATTCTGGGGGCTATCAATTTTATTACTACCATTATTAATATAAAACCTCCCGCCATTTCACAATACCAA
ACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTTTACTTTCCCTTCCTGTATTAGCTG
CCGGTATTACAATACTTTTAACAGACCGAAACCTAAATACCTCTTTCTTCGACCCGGCAGGAGGAGGTGA
CCCCATTCTTTACCAACACCTT

B. Table % Similarity

MK572038 MK572036 MK572034 MK572032 KU692278


MK572038 -
MK572036 98.31 -
MK572034 97.39 97.85 -
MK572032 100 98.31 97.39 -
KU692278 92.79 93.25 92.48 92.79 -

C. Alignment with Clustal Omega

CLUSTAL O(1.2.4) multiple sequence alignment

KU692278.1 CCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTTGGAACGGCCTTAAGCCTACTTAT 60

MK572034.1 CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTAT 60

MK572038.1 CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTAT 60

MK572032.1 CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTAT 60

MK572036.1 CCTCTATTTAGTATTCGGTGCCTGAGCTGGGATAGTTGGAACGGCATTAAGCCTACTTAT 60

*************** *********** ***************** **************

KU692278.1 TCGAGCTGAACTAAGTCAGCCGGGATCCCTTCTGGGCGACGACCAAATTTATAATGTAAT 120

MK572034.1 TCGAGCTGAATTAAGCCAGCCGGGGTCCCTTTTGGGTGACGACCAAATTTATAATGTGAT 120

MK572038.1 TCGAGCTGAATTAAGCCAGCCGGGATCCCTTTTGGGTGACGATCAAATTTATAATGTAAT 120

MK572032.1 TCGAGCTGAATTAAGCCAGCCGGGATCCCTTTTGGGTGACGATCAAATTTATAATGTAAT 120

MK572036.1 TCGAGCTGAATTAAGCCAGCCGGGATCCCTTTTGGGTGACGACCAAATTTATAATGTAAT 120

********** **** ******** ****** **** ***** ************** **


KU692278.1 CGTAACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATACCAGTAATGATTGGAGG 180

MK572034.1 CGTAACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGG 180

MK572038.1 CGTAACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGG 180

MK572032.1 CGTAACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGG 180

MK572036.1 CGTAACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGG 180

****************************************** ******** ********

KU692278.1 CTTTGGGAACTGATTAGTTCCTCTCATGATCGGCGCCCCAGACATAGCATTCCCCCGAAT 240

MK572034.1 CTTTGGGAACTGGCTAATTCCTCTGATAATTGGCGCCCCAGACATAGCATTCCCCCGAAT 240

MK572038.1 CTTTGGGAACTGACTGATTCCTCTGATAATTGGCGCCCCAGACATAGCATTCCCCCGAAT 240

MK572032.1 CTTTGGGAACTGACTGATTCCTCTGATAATTGGCGCCCCAGACATAGCATTCCCCCGAAT 240

MK572036.1 CTTTGGGAACTGACTAATTCCTCTGATAATTGGCGCCCCAGACATAGCATTCCCCCGAAT 240

************ * ******* ** ** *****************************

KU692278.1 AAATAATATAAGCTTCTGACTACTTCCTCCCTCCTTCTTACTTCTATTAGCTTCTTCTGG 300

MK572034.1 AAATAATATAAGCTTTTGACTCCTCCCTCCCTCCTTTTTACTCCTGCTAGCTTCTTCTGG 300

MK572038.1 AAATAACATAAGCTTTTGACTCCTCCCTCCCTCCTTTTTACTCCTACTAGCTTCTTCTGG 300

MK572032.1 AAATAACATAAGCTTTTGACTCCTCCCTCCCTCCTTTTTACTCCTACTAGCTTCTTCTGG 300

MK572036.1 AAATAATATGAGCTTTTGACTCCTCCCTCCCTCCTTTTTACTCCTACTAGCTTCTTCTGG 300

****** ** ***** ***** ** *********** ***** ** *************

KU692278.1 TGTAGAAGCAGGAGCTGGTACAGGCTGAACCGTTTACCCCCCTCTCGCAGGAAATCTCGC 360

MK572034.1 CGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTGTATCCTCCCCTCGCAGGAAATCTTGC 360

MK572038.1 CGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTATATCCTCCCCTCGCAGGAAATCTTGC 360

MK572032.1 CGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTATATCCTCCCCTCGCAGGAAATCTTGC 360

MK572036.1 CGTAGAAGCAGGGGCCGGTACAGGCTGAACCGTATATCCCCCCCTCGCAGGAAATCTTGC 360

*********** ** ***************** ** ** ** ************** **

KU692278.1 TCATGCAGGACCTTCCGTCGATTTAACCATTTTCTCACTTCATTTAGCGGGGGTGTCCTC 420

MK572034.1 TCATGCAGGACCTTCCGTGGATTTAACCATTTTCTCACTTCATTTAGCGGGGGTTTCTTC 420

MK572038.1 TCATGCAGGACCTTCCGTGGATTTAACTATTTTCTCGCTTCATTTAGCGGGGGTTTCTTC 420

MK572032.1 TCATGCAGGACCTTCCGTGGATTTAACTATTTTCTCGCTTCATTTAGCGGGGGTTTCTTC 420

MK572036.1 TCATGCAGGACCTTCCGTGGATTTAACCATTTTCTCGCTTCATTTAGCGGGGGTTTCTTC 420

****************** ******** ******** ***************** ** **


KU692278.1 TATTCTGGGGGCTATCAATTTTATTACTACCATTATTAATATAAAACCTCCCGCCATTTC 480

MK572034.1 CATTCTAGGGGCTATTAATTTTATCACTACCATTATCAATATAAAACCTCCCGCCATTTC 480

MK572038.1 CATTCTAGGGGCTATTAATTTTATCACTACCATTATTAACATAAAACCTCCCGCCATTTC 480

MK572032.1 CATTCTAGGGGCTATTAATTTTATCACTACCATTATTAACATAAAACCTCCCGCCATTTC 480

MK572036.1 CATTCTAGGGGCTATTAATTTTATCACTACCATTATTAATATAAAACCCCCCGCCATTTC 480

***** ******** ******** *********** ** ******** ***********

KU692278.1 ACAATACCAAACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTTTACT 540

MK572034.1 ACAGTACCAGACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACT 540

MK572038.1 ACAGTACCAAACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACT 540

MK572032.1 ACAGTACCAAACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACT 540

MK572036.1 ACAGTACCAAACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTCTACT 540

*** ***** ********************************************* ****

KU692278.1 TTCCCTTCCTGTATTAGCTGCCGGTATTACAATACTTTTAACAGACCGAAACCTAAATAC 600

MK572034.1 TTCCCTTCCTGTGTTAGCTGCCGGTATCACAATACTTTTAACAGACCGAAACCTAAACAC 600

MK572038.1 TTCCCTTCCTGTATTAGCTGCCGGTATCACAATACTTTTAACAGACCGAAACCTAAACAC 600

MK572032.1 TTCCCTTCCTGTATTAGCTGCCGGTATCACAATACTTTTAACAGACCGAAACCTAAACAC 600

MK572036.1 TTCCCTTCCTGTATTAGCTGCCGGTATCACAATACTTTTAACAGACCGAAATCTAAACAC 600

************ ************** *********************** ***** **

KU692278.1 CTCTTTCTTCGACCCGGCAGGAGGAGGTGACCCCATTCTTTACCAACACCTT--- 652

MK572034.1 CTCTTTCTTCGACCCGGCAGGAGGGGGCGACCCCATTCTTTACCAGCACCTT--- 652

MK572038.1 CTCTTTCTTCGACCCGGCGGGAGGGGGTGACCCCATTCTTTACCAACACCTT--- 652

MK572032.1 CTCTTTCTTCGACCCGGCGGGAGGGGGTGACCCCATTCTTTACCAACACCTTTTC 655

MK572036.1 CTCTTTCTTCGACCCGGCAGGAGGGGGTGACCCCATTCTTTACCAGCACCTT--- 652

****************** ***** ** ***************** ******