MATERIALS AND METHODS

SAMPLE COLLECTION

DNA ISOLATION

AMPLIFICATION OF leap 2 GENE USING POLYMERASE CHAIN REACTION:

COMPONENTS OF REACTION MIXTURE:

• DNA samples
• Forward Primer
• Reverse primer
• dNTPs
• MgCl2
• Taq Buffer
• Taq DNA polymerase

PROCEDURE:

All the solutions were gently vortexed and briefly centrifuged after thawing. The solutions
were added in appropriate amounts in a thin walled PCR tube. The DNA sample was added
to PCR tube, on ice. The sample was gently vortexed and briefly centrifuged to collect all
drops from walls of tube. The samples were placed in a thermocycler which was equipped
with a heated lid and PCR was started.

Reactions were carried out in PCR tubes, with a final volume of 25 µl mixture consisting of:
1 µl of crude bacterial lysate, 10 µmol leap 2 forward primer (5
´TTATACTTGGTTCAGGCCC3´), and leap 2 reverse primer (5
´TTGGAGCTCTCAAGGTGTAA3´), 2.5 U of Promega Taq DNA polymerase, 0.4 mM of
each dNTP, and 5 mM MgCl2 in a 1x PCR buffer (provided with Promega Taq). PCR
reactions were conducted simultaneously on all isolates in a PCR tubes in an Eppendorf
 Mastercycler Gradient thermocycler with the following protocol: denaturation for 1 min at
94°C, followed by25 cycles of 30 sec at 94°C, 30 sec at 60°C, 30 sec at 72°C with a final
extension step of 10 min at 72°C.

ELECTROPHORETIC SEPARATION OF PCR PRODUCT

AGAROSE GEL ELCTROPHORESIS

PROCEDURE:

2% Agarose gel was prepared with 1X TAE buffer and was placed in electrophoretic
chamber cell. The wells were oriented towards the cathode (black negative electrode)
because current moves from cathode to anode. The cell was filled with electrophoresis
buffer, so that 2 -3 mm of buffer is above the gel. 10 µl of DNA samples was mixed with
2 µl of loading dye and was loaded along with the DNA marker. The lid was placed on
the electrophoretic cells and voltage was set before the run. For electrophoresis of
agarose gels, a voltage gradient of 3 – 6.5v/cm was used (A setting of 70 – 100 works
well). After electrophoresis was completed, the power supply was turned off and
disconnected the electrical leads. The gel was removed from the electrophoresis unit.
DNA in the agarose gels was viewed under UV transilluminator.

COMPETENT CELL PREPARATION

MATERIALS REQUIRED:
• LB media
• 0.1M CaCl2
• 50% glycerol
• LB plates
PROCEDURE:
E. coli cells (JM109) were plated on an LB plate; Lys cells (BL21, CDE3) on LB plate + 34
mg/ml chloramphenicol. Cells were allowed to grow at 37°C overnight. One colony was placed
in 10 ml LB media (plus antibiotic selection if necessary) and grown overnight at 37°C. 2 ml of
LB media was taken and saved as blank. 5 ml overnight DH5 α culture was transferred into 500
ml Lb media in 3 L flask. The cells were allowed to grow at 37°C at 250 rpm until the OD600
 reaches 0.4 (≈2-3 hours). The cells were transferred to two centrifuge bottles (250 and was
placed in ice for 20 minutes. The cells were centrifuged in Sorval GSA rotor at 4°C for 10
minutes at 3000g. Subsequent resuspension may be done in the same bottle (cells must remain
cold for the rest of the procedure). The media was poured off and the cells were resuspended in
30 ml of cold 0.1M CaCl2. The suspended cells were transferred into 50 ml polypropylene
falcon tubes and incubated on ice for 30 minutes.
The cells were centrifuged using Sorval RT6000 B rotor at 4°C for 10 minutes at 3000g (2500)
rpm.The supernatant was poured off and the cells were resuspended (by pipetting) in 80ml cold
0.1M CaCl2 containing 15% glycerol. 140 µl of cells were transferred into 1.5 ml Eppendorf
tubes placed on ice.
CLONING OF THE ISOLATED GENES

The cloning was performed using CloneJET™ PCR Cloning Kit. The CloneJET™ PCR Cloning
Kit is an advanced positive selection system for the highest efficiency cloning of PCR products
generated with Pfu DNA polymerase, Taq DNA polymerase, DreamTaq™ DNA polymerase or
other thermostable DNA polymerases. Additionally, any other DNA fragment, either blunt or sticky-
end, can be successfully cloned using the kit. Cloning is fast and efficient; ligation takes only 5
minutes and yields more than 99% positive clones. The kit features the novel positive selection
cloning vector pJET1.2/blunt. This vector contains a lethal gene which is disrupted by ligation of a
DNA insert into the cloning site. As a result, only cells with recombinant plasmids are able to
propagate, eliminating the need for expensive blue/white screening.
The vector contains an expanded multiple cloning site, as well as a T7 promoter for in vitro
transcription. Sequencing primers are included for convenient sequencing of the insert.

PRINCIPLE:

PJET1.2/blunt is a linearized cloning vector, which accepts inserts from 6 bp to 10 kb. The
5'-ends of the vector cloning site contain phosphoryl groups, therefore, phosphorylation of the
PCR primers are not required. Blunt-end PCR products generated by proofreading DNA
polymerases can be directly ligated in just 5 min with the pJET1.2/blunt cloning vector. PCR
products with 3’-dA overhangs generated using Taq DNA polymerase or other non-proofreading
thermostable DNA polymerases are blunted in 5 min with a proprietary thermostable DNA blunting
enzyme (included in the kit) prior to ligation.
All common laboratory E.coli strains can be directly transformed with the ligation product.
Recircularized pJET1.2/blunt vector expresses a lethal restriction enzyme after transformation and
is not propagated. As a result, only recombinant clones containing the insert appear on culture
plates. Therefore, blue/white screening is not required.

CLONING PROTOCOL:

Sticky-End Cloning Protocol

Used for cloning PCR products with 3'-dA overhangs generated by Taq DNA polymerase,
DreamTaq™ DNA polymerase or enzyme mixtures containing Taq DNA polymerase.This
protocol can also be used for cloning DNA fragments with 5‘- or 3‘-overhangs generated by
restriction digestion. The DNA fragment was used in a 3:1 molar ratio with pJET1.2/blunt prior
to ligation. The DNA blunting enzyme is a proprietary thermostabile DNA polymerase with
proofreading activity. It will remove 3'- overhangs and fill-in 5'-overhangs.
Nucleotides for the blunting reactions are supplied in the reaction buffer. Blunting reaction was
set up using 2X reaction buffer, PCR product, nuclease free water and DNA blunting enzyme.
The reaction mixture was vortexed briefly and centrifuged for 3-5 s. The mixture was incubated
at 70°C for 5 min. Chilled briefly on ice. The ligation reaction was set up using pJET1.2/blunt
cloning vector (50 ng/μl) and T4 DNA ligase (5 u/μl). The reaction mixture was vortexed briefly
and centrifuged for 3-5 s. The ligation mixture was incubated at room temperature (22°C) for 5
 min and was used directly for bacterial transformation.

TRANSFORMATION
Transformation is the genetic alteration of a cell resulting from the introduction, uptake and
expression of foreign genetic material (DNA). Transformation of competent E.coli cells with the
ligation mixture can be performed using a number of different transformation methods.

MATERIALS REQUIRED:
• Competent cells
• Pre-chilled sterile Eppendorf tubes
• DNA fragment to be transformed
• Water bath set at 42°C
• Appropriate media and plates

PROTOCOL:
JM109 cells were removed from -80°C freezer and thawed on ice for 15-20 minutes. 100 µl
competent cells were aliquoted into pre-chilled sterile Eppendorf tubes. 2-10 µl of ligation mix
(or 1-5 µl of plasmid DNA) were added to each tube of 100 µl competent cells and incubated on
ice for 20 minutes. Then heat shock was given at 42°C for 45 to 60 seconds. 900 µl LB or SOC
medium was added and incubated for 1 hour at 37°C with shaking. 200 µl of the above was
plated on selective plates (LB + Amp or LB + Kan etc).

ANALYSIS OF RECOMBINANT CLONES

4-6 colonies were analyzed for the presence and orientation of the DNA insert using one of the
following methods:

COLONY PCR FOR leap 2 GENE INSERT:

Enough PCR master mix was prepared for the number of colonies analyzed. Reactions were carried
out in PCR tubes, with a final volume of 25 µl mixture consisting of: 10 µmol leap2 forward primer
(5´TTATACTTGGTTCAGGCCC3´), and leap 2 reverse primer (5
´TTGGAGCTCTCAAGGTGTAA3´), 2.5 U of Promega Taq DNA polymerase, 0.4 mM of each
dNTP, and 5 mM MgCl2 in a 1x PCR buffer (provided with Promega Taq). To each reaction mix, an
individual colony was picked up and resuspended. PCR reactions were conducted simultaneously
on all isolates in a PCR tubes in an Eppendorf Mastercycler Gradient thermocycler with the
following protocol: denaturation for 1 min at 94°C, followed by25 cycles of 30 sec at 94°C, 30 sec
at 60°C, 30 sec at 72°C with a final extension step of 10 min at 72°C. After the PCR, the DNA
insert was analyzed on an agarose gel.

PLASMID DNA ISOLATION Add principle and proper introductio

Isolation of plasmid DNA from E. coli is a common routine in research laboratories. You will
perform a widely-practiced procedure that involves alkaline lysis of cells. This protocol, often
referred to as a plasmid "mini-prep," yields fairly clean DNA quickly and easily.

MATERIALS REQUIRED

Solutions:
Solution 1: per 500 ml:
50 mM glucose 9 ml 50% glucose
25 mM Tris-HCl pH 8.0 12.5 ml 1 M Tris-HCl pH 8.0
10 mM EDTA pH 8.0 10 ml 0.5 M EDTA pH 8.0
Add H2O to 500 ml.

Solution 2: per 500 ml:

1% SDS 50 ml 10% SDS
0.2 N NaOH 100 ml 1 N NaOH
Add H2O to 500 ml.

Solution 3: per 500 ml:

3 M K+ 300 ml 5 M Potassium Acetate
5 M Acetate 57.5 ml glacial acetic acid
Add H2O to 500 ml.

per 100 ml:

TE
10 mM Tris-HCl pH 8.0 1 ml 1 M Tris-HCl pH 8.0
1 mM EDTA 0.5 ml 0.5 M EDTA pH 8.0
Add H2O to 100 ml.
Optional: RNAse can be added to TE at final concentration of 20 ug/ml

Procedure
1. Fill a microcentrifuge tube with saturated bacterial culture grown in LB broth + antibiotic. Spin
tube in microcentrifuge for 1 minute. Dump supernatant and drain tube briefly on paper towel.
2. Repeat step 1 in the same tube, filling the tube again with more bacterial culture.
3. Add 0.2 ml ice-cold Solution 1 to cell pellet and resuspend cells as much as possible using
disposable transfer pipet.
4. Add 0.4 ml Solution 2, cap tubes and invert five times gently. Let tubes sit at room temperature
for 5 minutes.
5. Add 0.3 ml ice-cold Solution 3, cap tubes and invert five times gently. Incubate tubes on ice for
10 minutes.
6. Centrifuge tubes for 5 minutes. Transfer supernatant to fresh microcentrifuge tube using clean
disposable transfer pipet.
7. Fill remainder of centrifuge tube with isopropanol. Let tube sit at room temperature for 2
minutes.
8. Centrifuge tubes for 5 minutes. A milky pellet should be at the bottom of the tube. Pour off
supernatant without dumping out the pellet. Drain tube on paper towel.
9. Add 1 ml of ice-cold 70% ethanol. Cap tube and mix by inverting several times. Spin tubes for 1
minute. Pour off supernatant (be careful not to dump out pellet) and drain tube on paper towel.
10. Allow tube to dry for ~5 minutes. Add 50 ul TE to tube. Mix thoroughly.

SEQUENCING:
The isolated plasmid was sent for sequencing.

Include appropriate references for all protocols.

Change the primer name sequence and PCR programme according to your

reaction
PHOTOS

Colony PCR

Marker 100bp

Band Size 278bp

PLASMID ISOLATION