Sie sind auf Seite 1von 356

Das Buch 

Der  Pathologe  Mitsuo  Ando  soll  die  Autopsie  an  seinem  früheren 
Klassenkameraden  Ryuji  Takayama  vornehmen,  der  im  ersten  Teil 
von The Ring verstarb. Während der Autopsie findet Ando in dessen 
Magen  eine  Zeitungsnachricht,  auf  der  sechs  Zahlen  stehen.  Ando 
und  sein  Freund  und  Kollege  Miyashita  beginnen  damit,  den  Code 
zu  entschlüsseln,  um  herauszufinden,  ob  der  Ring‐Bericht  —  eine 
komplette  Akte  über  Asakawas  Untersuchungen  des  Video‐Fluchs, 
dem bereits vier Teenager zum Opfer fielen — wahr sein könnte. Im 
Unterschied  zu  Asakawa  versucht  Ando  das  Rätsel  um  Sadakos 
Fluch  auf  wissenschaftliche  Weise  zu  lösen,  aber  je  mehr  er 
recherchiert, desto mysteriöser wird der Fall. 
 
Der Autor 
Kôji  Suzuki  wurde  1957  in  Hamamatsu  geboren  und  studierte  an 
der  Keio  University.  Er  gewann  1990  mit  dem  Roman  Rakuen  den 
japanischen Fantasy Novel Award, bevor er 1991 mit Ring (01/13741) 
den  Durchbruch  schaffte.  Zwei  weitere  Romane  und  eine  Story‐
sammlung aus der Mystery‐Saga um das geheimnisvolle Videoband 
machten  ihn  in  Japan  zum  Millionenseller  und  Erneuerer  des 
»Psycho‐Horror«.  Über  acht  Millionen  verkaufter  Bücher  der  Serie 
machten ihn zu einem Superstar, der mittlerweile in einem Atemzug 
mit  Stephen  King  genannt  wird.  Basierend  auf  den  Ring‐Romanen 
entstanden  in  Japan  bislang  vier  sehr  erfolgreiche  Kinofilme.  Steven 
Spielbergs Produktionsfirma DreamWorks sicherte sich die amerika‐
nischen  Verfilmungsrechte  und  brachte  den  ersten  Teil  der  Saga  im 
Herbst  2002  weltweit  sensationell  in  die  Kinos.  Weitere  amerikani‐
sche  Verfilmungen  sind  in  Vorbereitung.  Der  dritte  Band  der  Saga, 
Loop — The Ring III, wird ebenfalls im Heyne Verlag erscheinen. 
 
 
 

Kôji Suzuki 
 

 
Roman 

 
Aus dem Japanischen 
von Viktoria Heindorf und Tomonaga Horiguchi 
 
 
Mitten  im  Traum,  als  er  gerade  im  Meer  zu  versinken  drohte,  er‐
wachte Mitsuo Ando aus dem Schlaf — das Tosen der Wellen wurde 
vom Klingeln des Telefons durchbrochen. Er riss die Augen auf und 
griff nach dem Hörer. »Hallo?« 
Niemand antwortete. 
»Hallo, wer ist da?«, fragte Ando nachdrücklich. 
»Hast du sie bekommen?«, fragte eine Frauenstimme, deren düste‐
rer Klang ihn schaudern ließ. Ando hatte das Gefühl, als würde er in 
einen dunklen Abgrund hinabgezogen, und alle seine Kräfte würden 
aus  seinem  Körper  entweichen.  Die  Erinnerung  an  die  furchtbare 
Traumszene  wurde  wieder  lebendig.  Er  saß  an  einem  menschen‐
leeren, einsamen Strand. Gedankenverloren starrte er auf das beweg‐
te Meer. Ohne dass er es wahrnahm, türmte sich eine Riesenwelle vor 
ihm auf, und ehe er sichʹs versah, hatte sie ihn in die Tiefe gerissen. 
Verzweifelt  versuchte  er  aufzutauchen,  doch  er  wusste  nicht  mehr, 
wo oben und unten, rechts und links war — er hatte die Orientierung 
vollkommen verloren. Das Meer tobte, die Wellen rissen ihn hin und 
her, bis er schließlich für immer versank. 
Wie  so  oft  in  seinen  Träumen  vom  Meer  hatte  Ando  eine  kleine, 
tastende  Hand  an  seinem  Schienbein  gespürt.  Fünf  Finger,  die  einer 
Seeanemone glichen, glitten an seinem Bein hinunter. Sie versuchten, 
nach  seinem  Fußgelenk  zu  greifen,  rutschten  jedoch  ab  und  ver‐
schwanden  im  Meer.  Er  machte  sich  bittere  Vorwürfe.  Wenn  er  die 
Hände  ausstreckte,  war  er  so  nah  dran,  und  doch  konnte  er  den 
kleinen  Körper  nicht  greifen.  Ein  paar  feine,  weiche  Haare 
zurücklassend, glitt er in die Tiefe hinab. 
»Ja,  ja,  sie  sind  angekommen«,  antwortete  Ando  entnervt.  Vor  ein 
paar  Tagen  hatte  er  die  Scheidungsunterlagen  erhalten,  bereits  mit 
dem  Namen  und  Stempel  seiner  Frau  versehen.  Unterschrieb  er  sie 
und  setzte  seinen  Stempel  darunter,  wäre  die  Scheidung 
rechtskräftig. Bis jetzt hatte er sie aber noch nicht angerührt. 
»Und?«, drängte ihn seine Frau matt. Es schien ihr überhaupt nichts 
auszumachen,  dass  ihr  siebenjähriges  Eheleben  kurz  vor  dem  Ende 
stand. 
»Und was?« 
»Ich  möchte,  dass  du  die  Dokumente  unterschreibst  und  mir 
zurückschickst.« 
Ando  schüttelte  den  Kopf,  ohne  etwas  zu  sagen.  Immer  wieder 
hatte  er  ihr  zu  verstehen  gegeben,  dass  er  mit  ihr  gern  noch  einmal 
von  vorne  anfangen  würde.  Aber  sie  hatte  stets  abgeblockt  und 
signalisiert,  dass  ihre  Entscheidung  feststehe.  So  langsam  hatte  er 
genug  davon,  sich  immer  wieder  demütigen  zu  lassen  und  sie  an‐
zuflehen, es sich noch einmal zu überlegen. 
»Verstehe. Gut, ich werde unterschreiben, so wie du es willst.« 
Seine Frau schwieg einen Moment lang, dann fragte sie: »Was sagst 
du dazu?« 
»Wozu?  Was  meinst  du?«,  antwortete  Ando,  als  wüsste  er  von 
nichts. 
»Na, das, was du mir angetan hast.« 
Ando  umklammerte  den  Hörer  und  kniff  beide  Augen  fest  zu‐
sammen.  Ob  ich  mir  ihre  Vorwürfe  auch  dann  noch  jeden  Morgen  am 
Telefon anhören muss, wenn wir erst mal geschieden sind?, fragte er sich. 
Schon  der  Gedanke  daran  deprimierte  ihn  zutiefst.  »Ich  bedauere 
alles sehr«, entgegnete er. 
Das  schien  sie  zu  verstimmen.  »Dir  war  es  anscheinend  nicht  so 
wichtig.« 
»Was redest du da für einen Schwachsinn?« 
»Aber ...« 
»Das weißt du doch ganz genau. Also frag mich nicht so etwas.« 
»Aber warum hast du es dann getan?« 
Ihre  Stimme  zitterte,  das  Zeichen  dafür,  dass  sie  gleich  hysterisch 
wurde. Am  liebsten hätte er gesagt, »Ruf mich  nie wieder an!«, und 
den  Hörer  aufgeknallt.  Aber  er  riss  sich  zusammen.  Ihre  Vorwürfe 
schweigend ertragen — das war das Einzige, das er im Moment tun 
konnte, um ihr zu helfen, ihre Trauer zu überwinden. 
»Wie  wäre es,  wenn  du  etwas  dazu  sagen  würdest?«,  stieß  sie  mit 
weinerlicher Stimme hervor. 
»Was soll ich denn noch sagen ... Seit einem Jahr und drei Monaten 
sprechen  wir  jeden  Tag  über  nichts  anderes.  Es  gibt  nichts  mehr  zu 
sagen.« 
»Gib ihn mir zurück!«, schrie sie plötzlich. 
Ando musste nicht fragen, von wem sie sprach. Ihm ging es wie ihr. 
Obwohl er wusste, dass es nichts brachte, betete er jeden Tag zu Gott: 
Bitte  gib  ihn  uns  zurück.  Bitte.  »Das  ist  nicht  möglich«,  erwiderte  er 
und versuchte dabei, so beruhigend wie möglich zu wirken. 
»Gib ihn mir zurück ...« 
Seine  Frau  war  in  den  Schatten  der  Vergangenheit  gefangen  und 
nicht  im  Stande,  ein  neues  Leben  zu  beginnen.  Sie  tat  ihm  Leid.  Er 
versuchte  zumindest,  so  gut  es  ging  weiterzuleben.  Immer  wieder 
hatte er zu ihr gesagt: Was man verloren hat, bekommt man nicht zurück. 
Lass  uns  zusammenbleiben,  und  wenn  wir  noch  einmal  ein  Kind  kriegen, 
dann lass uns über ein neues Lehen nachdenken. 
Ando  wollte  nicht,  dass  seine  Ehe  daran  zerbrach  und  er  aus 
diesem Grund von seiner Frau geschieden wurde. Er hätte alles dafür 
gegeben,  wenn  sie  wieder  zueinander  gefunden  hätten.  Aber  seine 
Frau wälzte die ganze Verantwortung auf ihn ab und blickte nicht in 
die Zukunft. 
»Gib ihn mir zurück.« 
»Wie soll ich das denn anstellen?« 
»Du hast nicht begriffen, was du mit angetan hast.« 
Ando seufzte so tief, dass es am anderen Ende der Leitung zu hören 
war.  Er  hielt  seine  Frau  mittlerweile  für  psychisch  krank.  Das  Beste 
wäre  es  gewesen,  sie  einem  befreundeten  Psychologen  vorzustellen, 
aber da ihr Vater Krankenhausdirektor war, war das nicht so einfach. 
»Ich lege jetzt auf.« 
»Du läufst wie immer davon.« 
»Ich wünsche mir nur, dass du es möglichst schnell überwindest.« 
Ando wusste zwar, dass dies unmöglich war, aber was hätte er sonst 
sagen  sollen?  Gerade  wollte  er  auflegen,  als  erneut  ihr  Geschrei  aus 
dem Hörer drang. 
»Gib ihn mir zurück, meinen kleinen Takanori!« 
Obwohl Ando bereits aufgelegt hatte, drang noch immer das Wort 
›Takanori‹  aus  dem  Hörer,  bis  schließlich  der  ganze  Raum  davon 
erfüllt  war.  Ohne  es  zu  merken,  murmelte  er:  »Takanori,  Takanori, 
Takanori ...« Mit den Händen vor dem Gesicht lag er, wie ein Embryo 
zusammengerollt, auf dem Bett und war für einen Augenblick außer 
Stande, sich zu bewegen. Als er auf die Uhr sah, wurde ihm klar, dass 
es  höchste  Zeit  war,  sich  fertig  zu  machen.  Um  einen  weiteren  ähn‐
lichen Anruf zu verhindern, zog er das Telefonkabel aus der Buchse. 
Dann ging er zum Fenster und öffnete es, um die schwere Luft hin‐
auszulassen.  In  diesem  Moment  hörte  er  das  Krächzen  einer  Krähe, 
die  aus  dem  Yoyogi‐Park  hergeflogen  war  und  sich  auf  einer  nahen 
Leitung  niedergelassen  hatte.  Nach  dem  unheimlichen  Traum  vom 
tiefen Meer und der kreischenden Stimme seiner Frau beruhigte ihn 
der  weithin  hallende  Ruf  des  Vogels  irgendwie.  Es  war  der  Beginn 
eines schönen, ruhigen Herbstsamstages. 
Andererseits  berührte  das  schöne  Wetter  sein  schmerzendes  Herz. 
Tränen traten ihm in die Augen. Er schnäuzte sich die Nase und ließ 
sich  noch  einmal  auf  das  Bett  fallen.  Die  Tränen,  die  er  eben  noch 
hatte  unterdrücken  können,  strömten  nun  unaufhaltsam  aus  seinen 
Augen. Das lautlose Weinen ging in ein Schluchzen über. Er schloss 
das  Kissen  fest  in  die  Arme  und  rief  den  Namen  seines  Sohnes, 
obwohl er sich dafür schämte, dass er sich so gehen ließ. Die Trauer 
kam  nur  bei  bestimmten  Gelegenheiten  hoch.  In  den  letzten  zwei 
Wochen hatte Ando nicht um seinen verstorbenen Sohn geweint. Die 
Zeitabstände  zwischen  den  Gefühlsausbrüchen  wurden  immer  grö‐
ßer.  Aber  die  Intensität  seines  Schmerzes  war  die  gleiche  geblieben. 
Wie  viele  Jahre  würde  diese  tiefe  Trauer  wohl  an  ihm  nagen?  Der 
Gedanke löste unendliche Verzweiflung in ihm aus. 
Ando  zog  ein  Büschel  Haare  aus  einem  Briefumschlag,  der  zwi‐
schen den Büchern im Regal steckte. Sie stammten von seinem Sohn. 
Es war das Einzige, das ihm von seinem Kind geblieben war. Als er 
die  Hand  nach  dem  Kleinen  ausgestreckt  und  versucht  hatte,  ihn 
nach  oben  zu  ziehen,  hatten  sich  diese  Haare  zwischen  Finger  und 
Ehering verfangen. Dass sie dort haften blieben, obwohl er im Wasser 
herumgewirbelt wurde, grenzte an ein Wunder. Weil die Leiche des 
Kleinen  nie  gefunden  worden  war  und  somit  auch  nicht  verbrannt 
werden konnte, bedeuteten diese Haare für Ando das Gleiche wie die 
Knochen  eines  Verstorbenen.  Es  war  das  letzte  Andenken  an  seinen 
Sohn. 
Er hielt das Büschel an seine Wange. Dabei erinnerte er sich daran, 
wie  sich  sein  Sohn  angefühlt  hatte.  Als  er  die  Augen  schloss,  sah  er 
Takanori vor sich, als befände er sich ganz in seiner Nähe. 
Obwohl Ando die Zähne längst geputzt hatte, blieb er mit bloßem 
Oberkörper  vor  dem  Spiegel  stehen.  Er  fasste  sich  ans  Kinn  und 
schob es nach rechts, dann nach links, fuhr sich dann mit der Zunge 
über  die  Zähne,  um  Essensreste  aufzuspüren.  Unter  dem  Kinn,  am 
Kehlkopf,  standen  vereinzelt  Bartstoppeln  ab.  Er  setzte  das  Rasier‐
messer  an  die  Kehle  und  entfernte  sie,  während  er  sich  im  Spiegel 
beobachtete. Dann schob er das Kinn nach oben, so dass sein rasierter 
weißer  Kehlkopf  deutlich  zu  sehen  war.  Langsam  drehte  er  das 
Rasiermesser um und ließ es von der Kehle über Hals und Brust bis 
zum Bauch gleiten. Auf Höhe des Nabels hielt er inne. Zwischen den 
Brustwarzen  bis  zur  Mitte  des  Bauches  blieb  ein  weißer  Streifen  auf 
seiner Haut zurück. Er stellte sich vor, wie er mit dem Messer seinen 
eigenen Körper sezierte. Für ihn war es ein Leichtes, sich das Innere 
seiner Brust vorzustellen. Schließlich war er von Beruf Pathologe. Er 
spürte  seinem  Herzschlag  nach.  Diese  tiefen  Schmerzen  in  der  Brust  ... 
An  welchem  Organ  in  meinem  Körper  hat  sich  die  unendliche  Trauer 
festgesetzt?  Wenn  sie  sich  um  das  Herz  geschlungen  hat,  werde  ich  es  mit 
den Händen herausreißen. 
Das  Rasiermesser  drohte  ihm  aus  den  schweißnassen  Händen  zu 
entgleiten, und so legte er es auf die Ablage am Waschbecken. Als er 
das Gesicht zur Seite wandte, entdeckte er eine Blutspur rechts vom 
Kehlkopf.  Er  musste  sich  beim  Rasieren  geschnitten  haben.  Den 
scharfen  Schmerz,  der  normalerweise  zeitgleich  mit  der  Verletzung 
der Haut einsetzte, hatte er erst gespürt, als er das Blut sah. In letzter 
Zeit  hat  meine  Schmerzempfindlichkeit  offensichtlich  abgenommen,  dachte 
er. Es war zuletzt häufiger vorgekommen, dass er Wunden erst dann 
bemerkt  hatte,  wenn  er  sie  erblickte.  Ando  sah  den  Grund  dafür  in 
seiner verlorenen Leidenschaft für das Leben. 
Während er ein Handtuch gegen die kleine Wunde drückte, nahm 
er  seine  Armbanduhr  und  warf  einen  Blick  darauf.  8.30  Uhr,  er 
musste sich auf den Weg zur Arbeit machen. Ando war am Gerichts‐
medizinischen  Seminar  der  Universität  K  als  Dozent  tätig,  gleich‐
zeitig  arbeitete  er  im  Gerichtsmedizinischen  Institut  der  Präfektur 
Tokio.  Sein  Job  war  momentan  das  Einzige,  das  ihm  über  seine 
Trauer  hinweg  half.  Nur  während  der  Leichensezierung  konnte  er 
den Tod seines Sohnes vergessen und den Erinnerungen entkommen. 
Als  er  aus  seinem  Apartment  trat  und  durch  die  Lobby  ging, 
schaute  er,  so  wie  er  es  immer  tat,  auf  die  Uhr.  Heute  war  er  fünf 
Minuten  später  dran  als  sonst.  Das  waren  genau  die  fünf  Minuten, 
die er benötigt hatte, um das Scheidungsformular zu unterschreiben 
und  mit  seinem  Stempel  zu  versehen.  In  diesen  wenigen  Minuten 
war  auch  die  letzte  Verbindung  zu  seiner  Frau  unwiderruflich  ge‐
kappt  worden.  Auf  dem  Weg  zur  Universität  befanden  sich  drei 
Briefkästen. Ando entschloss sich, die Papiere gleich in den ersten zu 
werfen, und eilte zur U‐Bahn‐Station. 
 
 
 
 
 
 
 

 
 

 
Im Büro der Gerichtsmedizin sah Ando die Akte der zu sezierenden 
Leiche  durch.  Während  er  die  Polaroidfotos  vom  Tatort  betrachtete, 
überlief  es  ihn  erst  kalt,  dann  heiß.  Seine  Handflächen  waren 
schweißnass.  Mehrmals  lief  er  zum  Waschbecken  hinüber,  um  sich 
die  Hände  zu  waschen.  Oktober  war  weiß  Gott  nicht  die  Jahreszeit, 
die einem den Schweiß aus den Poren trieb. Dennoch brauchte er von 
Zeit zu Zeit eine Abkühlung. 
Erneut breitete er die Polaroidfotos, die zusammen mit dem Unter‐
suchungsprotokoll gekommen waren, auf dem Tisch aus und sah sie 
sich  genau  an.  Das  erste  zeigte  einen  Mann  von  kräftiger  Statur.  Er 
saß  an  die  Bettkante  gelehnt,  sein  Kopf  war  zurückgeworfen  —  er 
war tot. Äußere Verletzungen sah Ando nicht. Das nächste Foto war 
eine Nahaufnahme des Gesichtes. Auch hier gab es keine Anzeichen 
für eine äußere Verletzung, wie etwa Würgemerkmale am Hals oder 
blaue  Flecken.  Egal,  welches  Foto  Ando  sich  auch  anschaute,  es  gab 
keine  Auffälligkeiten,  die  auf  die  Todesursache  hätten  schließen  las‐
sen. Obwohl es auf den ersten Blick nicht aussah, als wäre der Mann 
einem  Verbrechen  zum  Opfer  gefallen,  musste  eine  Autopsie  veran‐
lasst  werden.  So  war  es  gesetzlich vorgeschrieben.  Doch  eines  stand 
fest: Selbst wenn dieser Mann eines natürlichen Todes gestorben sein 
sollte, handelte es sich um eine merkwürdige Angelegenheit. 
Ohne Feststellung der Todesursache durfte eine Leiche dem Gesetz 
zufolge nicht bestattet werden. Der Tote hatte beide Arme und Beine 
weit  von  sich  gestreckt.  Ando  hatte  ihn  gut  gekannt.  Nie  im  Leben 
hätte er gedacht, eines Tages einmal einen Freund aus alten Studien‐
zeiten  obduzieren  zu  müssen.  Einen  Freund,  der  vor  zwölf  Stunden 
noch  gelebt  hatte  ...  Ryuji  Takayama  und  er  hatten  sechs  Jahre  lang 
zusammen Medizin studiert. 
Die  meisten  Absolventen  der  medizinischen  Fakultät  beabsich‐
tigten,  klinischer  Arzt  zu  werden.  Über  Ando,  der  sich  entschieden 
hatte,  in  die  Gerichtsmedizin  zu  gehen,  hatten  sich  damals  viele 
seiner  Kommilitonen  lustig  gemacht.  Sie  hatten  ihn  für  einen  komi‐
schen Typen gehalten — dabei war Ryuji Takayama erst recht aus der 
Reihe getanzt. Obwohl er das Medizinstudium mit einem Topexamen 
abgeschlossen  hatte,  schrieb  er  sich  an  der  Fakultät  des  Philosophi‐
schen  Instituts  erneut  ein.  Zum  Zeitpunkt  seines  Todes  hatte  er  den 
Titel eines Dozenten, und sein Spezialfach war die Wissenschaft der 
Logik.  Trotz  des  Fachwechsels  hatte  er  inzwischen  die  gleiche  Posi‐
tion erklommen wie Ando. Dafür, dass er noch einmal neu angefan‐
gen  hatte,  war  er  schnell  aufgestiegen.  Auch  wenn  man  berücksich‐
tigte, dass er mit zweiunddreißig zwei Jahre jünger war als Ando. 
Als Todeszeit stand neben dem Datum von gestern ›9.45 Uhr‹. »Das 
ist aber eine ziemlich genaue Angabe«, sagte Ando leicht irritiert und 
schaute dabei zu dem als Zeugen anwesenden Polizisten hoch. Ryuji 
hatte allein in seinem Apartment in Higashi Nakano gelebt. 
»Reiner  Zufall«,  entgegnete  der  Polizist  unbekümmert  und  setzte 
sich auf einen nahe stehenden Stuhl. 
»Zufall? Was für ein Zufall?«, bohrte Ando nach. 
Der  Polizist  drehte  sich  zu  seinem  jüngeren,  ebenfalls  als  Zeuge 
dienenden Kollegen um. »Mai Takano ist doch hier, oder?« 
»Ja. Ich habe sie im Wartezimmer für die Hinterbliebenen gesehen.« 
»Können Sie Frau Takano bitte herholen?« 
Der Polizist verließ den Raum. 
»Die Frau, die den Toten gefunden hat. Sie war eine Studentin von 
Dr. Takayama und schätzte ihn wohl sehr. Kurzum, wir denken, sie 
war  seine  Freundin.  Sollte  Ihnen  bei  der  Durchsicht  des  Polizeibe‐
richtes etwas unklar erscheinen, dann fragen Sie sie danach.« 
Da die Leiche nach einer Autopsie den Hinterbliebenen übergeben 
wurde, warteten Ryujis Mutter und sein älterer Bruder samt Ehefrau 
im Wartezimmer der Gerichtsmedizin. Mai Takano saß neben ihnen, 
als der Polizist sie aufrief. 
Sie  trat  ein,  blieb  in  der  Mitte  des  Raumes  stehen  und  verbeugte 
sich. Als Ando sie sah, richtete er sich auf. 
»Vielen  Dank  für  Ihre  Mühe«,  begrüßte  er  sie  und  verbeugte  sich 
ebenfalls. Dann bat er Mai, sich zu setzen. Sie trug ein schlichtes dun‐
kelblaues Kleid und umklammerte mit ihren wohlgeformten Händen 
ein  weißes Taschentuch.  Die  Nähe  des  Todes  scheint  die  Schönheit  einer 
Frau  hundertfach  erstrahlen  zu  lassen,  dachte  Ando.  Ihre  Arme  und 
Beine waren schmal, der Körper zart. Die dunkle Farbe ihres Kleides 
schien  das  Weiß  ihrer  Haut  zu  betonen.  Sie  hatte  ein  feines,  ovales 
Gesicht. Ohne Zweifel, ihr Kopf war perfekt geformt. Das sah Ando 
auf den ersten Blick, auch ohne sie seziert zu haben. Er verspürte das 
drängende Verlangen, ihre Organe und den anmutigen Knochenbau 
unter ihrer Haut zu berühren. 
Der  Polizist  machte  sie  miteinander  bekannt,  und  sie  nannten  ihre 
Namen.  Als  Mai  sich  gerade  setzen  wollte,  geriet  sie  plötzlich  ins 
Taumeln. Mit einer Hand stützte sie sich an dem Tisch ab. 
»Ist alles in Ordnung?« Ando drehte Mais Kopf vorsichtig hin und 
her  und  betrachtete  aufmerksam  ihre  Gesichtsfarbe.  Ein  fahles  Grau 
hatte das Weiß ihrer Haut verdrängt. Wie blass sie ist ... 
»Es ist nichts.« Mai hielt das Taschentuch gegen ihre Wange, senkte 
den Blick und fixierte einen Punkt auf dem Boden. Der Polizist brach‐
te  ihr  ein  Glas  Wasser.  Hastig  trank  sie  einen  Schluck.  Als  sie  sich 
wieder etwas gefangen hatte, hob sie das Gesicht und sagte mit kaum 
hörbarer Stimme: »Es tut mir Leid. Es ist nur ...« 
Ando verstand sofort. Mai Takano hatte ihre Menstruation. Zudem 
mussten sie die Ereignisse vom Vortag natürlich sehr mitgenommen 
haben. »Übrigens, der Verstorbene war ein Studienfreund von mir«, 
sagte er. 
Mai, die noch immer ihre Augen nach unten gerichtet hielt, blickte 
plötzlich auf. »Sagten Sie, Ihr Name ist Ando?« 
»Ja.« 
Mai  blickte  Ando  intensiv  an  und  kniff  dabei  beide  Augen  zu‐
sammen. Ihre Miene wirkte, als wäre sie einem vertrauten Menschen 
begegnet. Dann senkte sie den Kopf. »Auf gute Zusammenarbeit.« 
Als Freund wird er Ryujis Leiche wohl sorgfältig behandeln — so deutete 
Ando die Veränderung in Mais Miene. Für ihn spielte es jedoch keine 
Rolle,  ob  es  sich  um  einen  Freund  gehandelt  hatte  oder  nicht,  er 
handhabte das Skalpell immer auf die gleiche Weise. 
»Entschuldigen  Sie  bitte,  Frau  Takano,  können  Sie  noch  einmal 
schildern,  wie  Sie  die  Leiche  gefunden  haben?«,  unterbrach  der 
Polizist  ihre  Unterhaltung.  Er  wollte  vermeiden,  dass  sie  zu  lange 
über einen Tod, dem allem Anschein nach kein Verbrechen zugrunde 
lag,  lamentierten.  Wenn  die  ganzen  Erinnerungen  erst  einmal  hoch‐
kamen, wäre das zu viel für ihn gewesen. 
Mai senkte die Stimme und begann, noch einmal zu erzählen, was 
sie am Vorabend bereits der Polizei gesagt hatte. »Ich kam gerade aus 
dem Bad und föhnte mir die Haare, als das Telefon klingelte. Ich sah 
auf  die  Uhr.  Sie  müssen  wissen,  das  ist  so  eine  Angewohnheit  von 
mir.  Ein  Blick  auf  die  Zeit  verrät  viel  darüber,  wer  der  Anrufer  sein 
könnte.  Meistens  war  ich  diejenige,  die  Dr.  Takayama  anrief,  nur 
selten  rief  er  bei  mir  an.  Und  wenn  er  anrief,  dann  nur  in  den 
seltensten Fällen nach 21 Uhr. Ich nahm den Hörer ab und sagte ›Ja, 
bitte?‹ Es verging eine ganze Weile, ohne dass ich etwas hörte. Dann 
erklang  ein  Schrei.  Zuerst  glaubte  ich,  es  handelte  sich  um  einen 
üblen Scherz, und hielt den Hörer etwas weiter vom Ohr weg. Dann 
jedoch  verwandelte  sich  das  Schreien  in  ein  langes,  klagendes  Heu‐
len... Und plötzlich verstummte es. Stille breitete sich aus, eine tiefe, 
unheimliche  Stille.  Voller  Angst  presste  ich  den  Hörer  ans  Ohr,  um 
mitzubekommen,  was  da  vor  sich  ging.  Plötzlich  sah  ich  Dr. 
Takayama  vor  mir.  Diese  Stimme,  irgendwie  war  sie  mir  bekannt 
vorgekommen  ...  Ich  legte  auf  und  wählte  Dr.  Takayamas  Nummer, 
aber am anderen Ende ertönte das Besetztzeichen. In diesem Moment 
war  ich  mir  sicher,  dass  der  Anruf  nur  von  ihm  gekommen  sein 
konnte,  und  ich  wusste,  dass  ihm  etwas  Schreckliches  zugestoßen 
sein musste.« 
»Dann  haben  Sie  also  nicht  mit  Ryuji  gesprochen?«,  vergewisserte 
sich Ando. 
Mai  schüttelte  den  Kopf.  »Nein,  kein  einziges  Wort.  Ich  habe  nur 
unheimliche, gequälte Schreie gehört.« 
Ando machte sich einige Notizen und bat Mai fortzufahren. 
»Ich  machte  mich  sofort  auf  den  Weg  und  erreichte  ungefähr  eine 
Stunde  später  sein  Apartment.  Ich  ging  hinein,  und  im  Zimmer, 
gleich hinter der Küche, am Bett ...« 
»Sie hatten einen Schlüssel für das Apartment?« 
»Dr.  Takayama  hatte  mir  seinen  Zweitschlüssel  anvertraut«, 
antwortete Mai sichtlich verlegen. 
»Das heißt, das Apartment war von innen abgeschlossen?« 
»Ja.« 
»Sie haben also aufgeschlossen und sind hineingegangen.« 
»So ist es. Und dann ... Diesen Anblick werde ich nie vergessen. Der 
Professor saß an die Bettkante gelehnt, den Kopf nach hinten gelegt, 
den  Blick  nach  oben  gerichtet,  beide  Arme  und  Beine  weit  von  sich 
gestreckt ...« Mai brach ab. Das schreckliche Szenario schien sich noch 
einmal  vor  ihren  Augen  abzuspielen.  Sie  schüttelte  den  Kopf,  als 
versuchte  sie,  die  furchtbaren  Bilder  aus  ihrem  Bewusstsein  zu 
verdrängen. 
Ando brauchte keine weiteren Erklärungen. Er hatte die Fotos von 
der  Leiche  gesehen  —  er  hielt  sie  sogar  noch  in  der  Hand  und 
fächerte  sich  damit  Luft  zu.  »Ist  Ihnen  im  Zimmer  irgendetwas 
Ungewöhnliches aufgefallen?« 
»Nein, da war nichts ... Nur dass der Hörer nicht auf der Gabel lag 
und ein lautes Tuten von sich gab.« 
Ando  versuchte,  sich  anhand  des  Polizeiprotokolls  und  der  Aus‐
führungen  von  Mai  die  Situation  vorzustellen.  Ryuji  wusste,  dass  mit 
ihm  etwas  Merkwürdiges  passierte.  Er  rief  Mai  Takano  —  seine  Freundin 
— an ... Vermutlich wollte er, dass sie ihm half. Aber warum wählte er nicht 
den Notruf? Wenn jemand Herzschmerzen hat und noch in der Lage ist zu 
telefonieren,  dann  ruft  er  doch  normalerweise  dort  an.  »Wer  hat  den 
Notarzt angerufen?« 
»Ich.« 
»Und von wo haben Sie angerufen?« 
»Aus dem Apartment von Dr. Takayama.« 
»Das heißt, Ryuji selbst hat den Notruf nicht gewählt.« 
Ando blickte fragend zu dem Polizisten hinüber. Dieser nickte. Die 
Polizei  hatte  bereits  überprüft,  ob  der  Notarzt  schon  vorher  gerufen 
worden war. 
Für einen kurzen Moment schoss Ando ein anderes Szenario durch 
den Kopf. Könnte es Selbstmord gewesen sein? Vielleicht hat Mai Takano 
Ryuji  verlassen,  und  das  hat  er  nicht  ertragen.  Er  hat  beschlossen,  seinem 
Leben  ein  Ende  zu  setzen,  und  Gift  genommen.  Dann  hat  er  die  Person 
angerufen, die ihn in diese Verzweiflung gestürzt hat, um sie zu quälen und 
Schuldgefühle in ihr zu wecken. Aber er konnte nur noch einen Todesschrei 
von sich geben. 
Doch als Ando das Protokoll las, schien ihm die Wahrscheinlichkeit 
eines Selbstmordes relativ gering. Weder war am Ort des Geschehens 
ein  Behältnis  mit  Giftspuren  gefunden  worden,  noch  gab  es  irgend‐
welche Hinweise dafür, dass Mai ein solches aus der Wohnung hatte 
mitgehen  lassen.  Und  spätestens  wenn  man  ihr  ins  Gesicht  sah, 
verflogen jegliche Zweifel. Selbst jemand, der das besondere Geheim‐
nis  zwischen  Mann  und  Frau  noch  nicht  vollends  ergründet  hatte, 
konnte  an  ihrem  Verhalten  auf  einen  Blick  erkennen,  dass  sie  für 
Ryuji Takayama sehr viel empfunden hatte. In ihren feuchten Augen 
lag  kein  Ausdruck  von  Reue,  weil  sich  ein  geliebter  Mensch  wegen 
ihr  umgebracht  hatte.  Die  Tränen  zeigten  vielmehr  ihre  unendliche 
Trauer  darüber,  dass  sie  diesen  Körper  nie  mehr  würde  berühren 
können. Außerdem war sie extra zum Gerichtsmedizinischen Institut 
gekommen,  um  die  Leiche  nach  der  Autopsie  mit  in  Empfang  zu 
nehmen. 
Ein  weiterer  Aspekt  sprach  gegen  einen  Liebesselbstmord:  Ryuji 
Takayamas  Charakter.  So  wie  Ando  ihn  gekannt  hatte,  war  Ryuji 
wirklich nicht der Typ gewesen, der sich das Leben nehmen würde, 
nur weil eine Frau ihn verlassen hatte. Nein, das war ausgeschlossen. 
Dann kann es nur das Herz oder das Gehirn gewesen sein. 
Ando  tippte  auf  plötzliches  Herzversagen  oder  einen  Schlaganfall. 
Damit  war  natürlich  nicht  ausgeschlossen,  dass  er  bei  der  Autopsie 
Zyankalispuren  im  Magen  finden  oder  eine  Lebensmittel‐  oder  eine 
Kohlenmonoxidvergiftung feststellen würde. Es kam hin und wieder 
vor,  dass  die  Todesursache  eine  ganz  andere  war  als  zunächst 
vermutet. Allerdings hatte er sich bisher noch nie getäuscht. 
In  dem  Moment,  als  Ryuji  spürte,  dass  irgendetwas  Merkwürdiges  mit 
seinem  Körper  geschah,  und  er  wusste,  dass  seine  Zeit  abgelaufen  war, 
wollte er vielleicht noch ein letztes Mal die Stimme seiner Freundin hören, 
ihr sagen, wie sehr er sie liebte. Doch dann konnte er nur noch einen Schrei 
ausstoßen ... So ungefähr musste es gewesen sein. 
Das Knarren der Tür riss Ando aus seinen Gedanken. Der Assistent 
steckte  den  Kopf  ins  Zimmer  und  informierte  Ando  mit  leiser 
Stimme: »Es ist alles vorbereitet.« 
Ando  stand  auf  und  murmelte  zu  sich  selbst:  »Nun,  dann  wollen 
wir mal.« Nach seinen bisherigen Erfahrungen gab es keinen Fall, bei 
dem  die  Todesursache  ungeklärt  blieb.  Gleich  würde  sich  heraus‐
stellen, wie Ryuji ums Leben gekommen war. 
 

 
Die  warme,  herbstliche  Mittagssonne  durchflutete  den  Gang  zum 
Obduktionssaal.  Dennoch  herrschte  eine  düstere  und  beklemmende 
Atmosphäre. Die Luft war feucht und kalt, und der süßliche Leichen‐
gestank schien sich bis in die kleinste Ecke geschlichen zu haben. Die 
Schritte Andos, seines Assistenten und der beiden Polizisten, die auf 
dem  Weg  zum  Obduktionssaal  waren,  hallten  von  den  Wänden 
wider.  Der  Protokollführer,  ein  Assistent  und  der  Fotograf  waren 
bereits vor Ort. 
Als  Ando  die  Tür  zum  Obduktionssaal  öffnete,  vernahm  er  das 
vertraute  Geräusch  fließenden  Wassers.  Ein  weiterer  Assistent  war 
dabei, das Sezierbesteck zu reinigen und zu desinfizieren. Ein weißer 
Strahl  schoss  aus  dem  wuchtigen  Wasserhahn,  der  während  der 
Autopsie vorwiegend aus Hygienegründen ununterbrochen lief. 
Auf dem Tisch lag splitternackt Ryuji Takayama. Seine Haut leuch‐
tete weiß unter den Halogenlampen. Ryuji war ungefähr einen Meter 
sechzig  groß  und  kräftig  gebaut.  Er  hatte  zwar  ein  paar  Fettpölster‐
chen am Bauch, dafür aber einen durchtrainierten, muskulösen Ober‐
körper.  Ando  hob  Ryujis  rechten  Arm  leicht  an.  Abgesehen  von  der 
Schwerkraft widersetzte sich ihm nichts. Mit dem Arm des  Mannes, 
der  früher  so  stolz  auf  seinen  Bizeps  gewesen  war,  konnte  er  jetzt 
spielen wie mit dem eines Babys. Zu Studienzeiten hatte Ryuji beim 
Armdrücken  jeden  besiegt.  Keiner  hatte  auch  nur  den  Hauch  einer 
Chance  gegen  ihn  gehabt.  Doch  nun  war  dieser  Arm  ohne  jegliche 
Kraft. 
Ando ließ den Blick nach unten wandern und betrachtete Ryujis un‐
verdeckte  Genitalien.  In  den  tiefschwarzen  Schamhaaren  lag  schlaff 
der Penis. Die Eichel war von der Vorhaut bedeckt. Im Vergleich zu 
Ryujis kräftigem Körper wirkte der Penis kümmerlich. Ryuji und Mai 
hatten  sicher  keine  sexuelle  Beziehung  miteinander...  Dieser  merkwürdige, 
kindliche Penis ... da kann nichts gewesen sein. 
Er nahm das Seziermesser in die Hand, setzte es unter dem Kinn an 
und schnitt die Leiche durch das feste Muskelgewebe von der Kehle 
über den Hals und die Brust bis zum Unterbauch auf. Zwölf Stunden 
nach  Eintritt  des  Todes  war  jegliche  Wärme  aus  dem  Körper 
gewichen, die Leiche kalt und steif. 
Mit  einer  Sezierzange  durchtrennte  er  die  Rippen  des  Brustkorbes 
und entfernte eine nach der anderen. Danach löste er die rechte und 
die  linke  Lunge  heraus  und  überreichte  sie  dem  Assistenten.  Ryuji, 
der  während  seiner  Studienzeit  strikter  Nichtraucher  gewesen  war, 
schien seinen Prinzipien bis zum Schluss treu geblieben zu sein. Seine 
Lungen hatten eine schöne, gesunde Farbe. Der Assistent überprüfte 
Größe und Gewicht und teilte das Ergebnis dem Protokollführer mit, 
der die Daten niederschrieb. Währenddessen blitzte es mehrmals im 
Raum hell auf. Die Lungen wurden von allen Seiten fotografiert. 
Das Herz war von dünnem Fettgewebe umhüllt. Je nach Lichteinfall 
schimmerte es gelb oder weiß. Es war verhältnismäßig groß und wog 
dreihundertzwanzig  Gramm.  Ando  betrachtete  die  Herzoberfläche 
eingehend  und  stellte  weit  reichende  arteriosklerotische  Ablagerun‐
gen an den Wänden der Arterien fest. Die Blutgefäße waren dadurch 
stark  verengt.  Im  linken  Teil  des  Herzens  entdeckte  er  unter  dem 
Fettgewebe  zudem  einen  ungewöhnlichen  dunkelroten  Fleck.  Er 
vermutete, dass es ein Blutthrombus war, der sich auf eine Gefäßver‐
engung  gesetzt  und  die  Herzader  verstopft  hatte.  Der  Herzmuskel 
hatte  daraufhin  nicht  mehr  ausreichend  mit  Blut  und  Sauerstoff 
versorgt werden können. Ein Herzinfarkt war die Folge gewesen. So 
sah es jedenfalls auf den ersten Blick aus. 
Den  Gefäßverschluss  vermutete  Ando  in  der  linken  Herz‐
kranzarterie,  kurz  bevor  sich  diese  verzweigte.  Wenn  es  an  dieser 
Stelle  zu  einem  Verschluss  kam,  war  die  Wahrscheinlichkeit  eines 
Herzinfarktes  relativ  hoch.  Momentan  konnte  Ando  allerdings  noch 
nicht  mit  Gewissheit  sagen,  was  die  genaue  Ursache  für  den 
Gefäßverschluss  gewesen  war,  und  ob  der  dunkelrote  Fleck  etwas 
damit  zu  tun  hatte.  Erst  mussten  die  Ergebnisse  der  Gewebeun‐
tersuchung abgewartet werden. 
Doch  die  Todesursache  stand  für  Ando  zweifelsfrei  fest:  ›Herz‐
infarkt durch Verschluss eines Herzkranzgefäßes‹. 
Er  nahm  Leber,  Nieren,  Milz  und  Darm  heraus  und  prüfte  jedes 
einzelne  Organ  auf  Besonderheiten.  Danach  untersuchte  er  den 
Mageninhalt,  aber  auch  hier  konnte  er  nichts  Auffälliges,  wie  etwa 
Giftspuren, feststellen. 
Als  er  gerade  den  Kopf  sezieren  wollte,  unterbrach  ihn  sein  As‐
sistent plötzlich. »Doktor, da an der Kehle ...«, sagte er und zeigte mit 
dem  Finger  auf  die  entsprechende  Stelle.  Als  Ando  genauer  hinsah, 
konnte  auch  er  das  Geschwür  erkennen.  Es  war  so  klein,  dass  er  es 
fast nicht bemerkt hätte. Er sah diese Art von Geschwür zum ersten 
Mal.  Obwohl  es  nicht  unmittelbar  mit  Ryujis  Tod  in  Verbindung  zu 
stehen  schien,  schnitt  er  es  vorsichtshalber  heraus.  Sobald  die  Er‐
gebnisse der Gewebeprobe vorlagen, würden sie Genaueres über den 
Tumor erfahren. 
Ando  setzte  das  Skalpell  erneut  an  und  schnitt  die  Haut  vom 
Hinterkopf bis zur Stirn auf. Dann zog er sie nach vorn; das Gesicht 
der  Leiche  wurde  nun  von  den  dicken  schwarzen  Haaren  verdeckt. 
Das  Weiß  des  Schädelknochens  leuchtete  hell  im  Lichtschein  der 
Lampen. 
Geübt  entfernte  Ando  den  Schädelknochen  und  das  Gehirn;  das 
Gehirn  war  weiß,  und  die  Großhirnrinde  bestand  aus  vielen  tiefen 
Falten.  Die  Tiefe  der  Falten  deutete  auf  Ryujis  Intelligenz  hin. 
Medizinstudenten sagte man ja allgemein eine hohe Intelligenz nach, 
aber  Ryuji  war  außergewöhnlich  talentiert  gewesen  —  ein  Genie. 
Nicht  selten  hatte  er  die  Dozenten  an  der  Universität  mit  seinen 
Fragen und Kommentaren, die sich auf aktuelle Fachartikel bezogen, 
in  Verlegenheit  gebracht.  Zudem  war  er  äußerst  gewandt  in 
Fremdsprachen gewesen; er hatte Deutsch, Englisch und Französisch 
beherrscht. Sein größtes Interesse neben der Medizin hatte jedoch der 
Mathematik gegolten. Ryujis mathematische Fähigkeiten hatten seine 
Kommilitonen  bei  ihren  verschiedenen  Intelligenzspielen  oft  in 
Erstaunen versetzt. Eines der beliebtesten Spiele war das so genannte 
›Kode‐Raten‹  gewesen.  Dabei  musste  sich  eine  Person  eine  Zahlen‐
kombination  ausdenken,  und  die  anderen  Teilnehmer  hatten  diese 
dann  zu  entschlüsseln.  Derjenige,  der  am  schnellsten  zum  richtigen 
Ergebnis kam, gewann. Ryuji war bei diesem Wettbewerb unschlag‐
bar gewesen. Nicht ein einziges Mal hatte er verloren. Selbst als Ando 
ihn  mit  einer  extrem  schwierigen  Zahlenkombination  konfrontiert 
hatte, war ihm die Entschlüsselung mit Leichtigkeit gelungen. Ando 
hatte  es  damals  die  Sprache  verschlagen,  jedoch  nicht  deshalb,  weil 
ihn Ryujis mathematische Genialität in Erstaunen versetzt hatte. Ihm 
war unbehaglich, ja geradezu unheimlich zumute gewesen, da er das 
Gefühl nicht loswurde, dass Ryuji seine Gedanken lesen konnte. Wie 
sonst hätte er den Kode entschlüsseln können? Eine andere Erklärung 
gab es nicht. 
Für  Ando  hingegen  war  es  nahezu  unmöglich  gewesen,  Ryujis 
Kodes  zu  entschlüsseln.  Nur  einmal  hatte  er  es  geschafft,  allerdings 
war  das  mehr  ein  Zufallstreffer  gewesen  als  das  Ergebnis  logischen 
Kombinierens.  Ein  Werbeplakat  mit  der  Telefonnummer  eines  Blu‐
menhändlers hatte ihn auf die Idee gebracht. 
Andos  damalige  Gefühle  Ryuji  gegenüber  ließen  sich  mit  einem 
Wort beschreiben: Neid. Ihn hatte es ungemein geärgert, dass er stets 
der Unterlegene gewesen war. Sein Selbstbewusstsein hatte darunter 
ziemlich gelitten. 
Jetzt  lag  dieses  geniale  Gehirn  in  Andos  Händen.  Es  war  zwar 
vergleichsweise groß, aber ansonsten sah es wie jedes andere Gehirn 
aus.  Als  Ryuji  noch  lebte,  waren  seine  grauen  Zellen  äußerst  aktiv 
gewesen.  Erst  hatte  er  Medizin  studiert  und  mit  einem  Topexamen 
abgeschlossen,  dann  hatte  er  sich  in  die  Mathematik  vertieft,  aber 
auch das schien ihn irgendwie nicht voll zu befriedigen. Und so hatte 
er sich schließlich der Wissenschaft der Logik zugewandt. Ando war 
überzeugt  davon,  dass  Ryuji  es,  wenn  er  noch  zehn  Jahre  länger 
gelebt hätte, auf diesem Gebiet weit gebracht hätte. 
Ando untersuchte das Gehirn nach inneren Blutungen. Der Befund 
war  negativ.  Ein  Schlaganfall  konnte  somit  als  Todesursache  ausge‐
schlossen werden. 
Inzwischen waren fünfzig Minuten vergangen, seit Ando die Leiche 
mit  dem  Skalpell  geöffnet  hatte.  In  den  meisten  Fällen  dauerte  eine 
Autopsie  ungefähr  eine  Stunde.  Ando  hatte  bereits  alle  Organe 
untersucht,  doch  plötzlich  fiel  ihm  etwas  ein.  Er  schob  seine  Hand 
noch  einmal  in  den  Bauch  der  Leiche,  tastete  sich  mit  den  Fingern 
langsam vorwärts und zog die graufarbenen Hoden heraus. Er fragte 
sich,  welches  Schicksal  wohl  schlimmer  war  —  das  von  Ryuji  oder 
sein  eigenes.  Ryuji  war  gestorben,  ohne  einen  Nachkommen  zu 
hinterlassen. Er hingegen hatte einen Sohn in die Welt gesetzt, doch 
war  dieser  im  Alter  von  drei  Jahren  und  vier  Monaten  qualvoll 
ertrunken.  Ryuji  war  gestorben,  ohne  die  bittere  Erfahrung  machen 
zu müssen, ein Kind zu verlieren. Das Gefühl der unendlichen, tiefen 
Trauer,  das  wie  Folterqualen  in  der  Brust  schmerzte  und  einen 
auffraß,  war  ihm  erspart  geblieben.  Ein  Kind  bedeutete  das  größte 
Glück auf Erden. Aber die Trauer um den Verlust hörte niemals auf, 
egal,  wie  viele  Jahre  vergingen.  Ando  legte  die  beiden  Hoden,  die 
keine Kinder gezeugt hatten, mitsamt den schwermütigen Erinnerun‐
gen auf den Seziertisch. 
Blieb  noch,  die  Leiche  wieder  zu  schließen.  Er  schob  eine  zu‐
sammengerollte  Zeitung  in  den  Brust‐  und  Bauchhohlraum  und 
nähte  den  Körper  einschließlich  des  Kopfes  wieder  zu.  Danach 
wurde  die  Leiche  gewaschen  und  angezogen.  Da  Ryuji  der  Magen 
herausgenommen worden war, sah er jetzt viel schlanker aus als vor 
der Autopsie. 
Schlanker  Ryuji.  Ando  sprach  unbewusst  immer  wieder  mit  der 
Leiche. Bisher hatte er das bei einer Autopsie noch nie getan. Warum 
war  es  dieses  Mal  anders?  Vielleicht,  weil  Ryuji  ein  alter  Studien‐
freund  gewesen  war.  Natürlich  war  die  Unterhaltung  sehr  einseitig 
— Ryuji antwortete nicht. Doch als die Assistenten die Leiche hoch‐
hoben, um sie in den Sarg zu legen, glaubte Ando, für einen Augen‐
blick tief aus dem Inneren Ryujis eine Stimme zu hören. Kurz darauf 
verspürte er einen starken Juckreiz in der Nähe des Bauchnabels. Er 
kratzte sich, aber das Jucken hörte nicht auf. 
Vielleicht  war  das  ein  Zeichen,  dachte  Ando.  Er  stellte  sich  neben 
den  Sarg  und  strich  mit  der  Hand  über  Ryujis  Körper.  In  der  Nähe 
des Bauchnabels hielt er inne. Da war etwas Spitzes. Er fühlte es ganz 
deutlich unter seinen Fingerkuppen. Ando öffnete das Hemd, und als 
er  genau  hinsah,  entdeckte  er  ein  Stück  Zeitungspapier,  das  direkt 
über  dem  Bauchnabel  aus  der  zusammengenähten  Haut  heraus‐
guckte.  Die  Zeitung  im  Bauchhohlraum  schien  sich  hochgeschoben 
zu haben, als die Leiche in den Sarg gelegt worden war. Das mit Blut 
befleckte  Stück  Zeitung  war  von  Fettgewebe  umhüllt.  Nachdem 
Ando  das  weiße  Fettgewebe  entfernt  hatte,  entdeckte  er  auf  dem 
Fetzen  Papier  sechs  Zahlen,  die  in  zwei  Reihen  gedruckt  waren.  Sie 
waren so klein, dass er sie auf den ersten Blick nicht erkennen konnte. 
Aber sie zogen seine Augen magisch an. Er las: 
 
1 7 8 
1 3 6 
 
Was  für  Zahlen  waren  das?  Vielleicht  war  es  ja  die  Seite  mit  den 
Aktienkursen oder der Anzeigenteil mit den vielen Telefonnummern. 
Oder  das  Fernsehprogramm  mit  den  Programmierkodes  für  den 
Videorekorder. Doch wie man es auch drehte, die Tatsache, dass eine 
Zeitungsecke  mit  nichts  anderem  als  sechs  Zahlen  darauf  aus  der 
genähten  Haut  herausstand,  war  mehr  als  ungewöhnlich.  Ando 
prägte sich die Zahlen ein. 
 
1 7 8 
1 3 6 
 
Mit  der  Fingerspitze  drückte  er  die  herausstehende  Zeitungsecke 
wieder  in  den  Bauch.  Dann  klopfte  er  mit  der  Hand  noch  einmal 
leicht  darauf  und  vergewisserte  sich,  dass  sie  nicht  wieder  durch 
irgendeine kleine Öffnung nach draußen gelangt war. Er schloss das 
Hemd  und  fuhr  ein  letztes  Mal  mit  der  Hand  über  Ryujis  Körper. 
Dieses Mal spürte er nichts Spitzes. 
Doch dann entfernte er sich erschrocken ein paar Schritte von dem 
Sarg.  Ein  kalter  Schauer  lief  ihm  über  den  Rücken,  und  sein  Körper 
war  mit  einer  Gänsehaut  überzogen.  Er  blickte  auf  Ryujis  Gesicht. 
Dessen  Augen  waren  zwar  fest  geschlossen,  aber  die  Wimpern  flat‐
terten  leicht,  so  als  würde  Ryuji  jeden  Moment  die  Augen  aufschla‐
gen. Alle anderen im Obduktionssaal gingen routiniert ihren Aufga‐
ben  nach,  nur  er  schien  die  beklemmende  Atmosphäre  im  Raum  zu 
spüren. Ob der Kerl wirklich tot ist? 
Was für eine blöde Frage ... Andos Nerven lagen blank. 
Dann  erschrak  er  erneut.  Er  hätte  schwören  können,  dass  sich 
Ryujis Bauchdecke leicht gehoben und wieder gesenkt hatte. 
 

 
Nach  der  Autopsie  machte  Ando  sich  auf  den  Weg  in  Richtung 
Otsuka‐Station  der  JR‐Linie,  um  Mittag  zu  essen.  Während  er  die 
Straße entlangging, ergriff ihn erneut ein unbehagliches Gefühl. Eine 
namenlose  Angst  begann,  langsam  seine  Wirbelsäule  hinabzu‐
kriechen. Er blieb mehrmals stehen und blickte sich ängstlich um. Er 
hatte den Eindruck, als würde ihn jemand verfolgen, auch wenn er in 
seinem  tiefsten  Inneren  wusste,  dass  dies  nicht  so  war.  Woher  kam 
diese Beklommenheit nur? An den Tod seines Sohnes hatte er gerade 
nicht gedacht. Vielleicht war es ja die Autopsie, die ihn noch immer 
beschäftigte. Aber auch das schien ihm als Erklärung nicht plausibel. 
Immerhin  hatte  er  in  seinem  Leben  schon  mehr  als  tausend  Leichen 
seziert.  Was  war  heute  anders  als  sonst  gewesen?  Warum  war  er 
innerlich so aufgewühlt? 
Plötzlich  glaubte  er  es  zu  wissen.  Gewöhnlich  war  er  sehr  gewis‐
senhaft  bei  allem,  was  er  tat.  Noch  nie  war  ihm  bei  einer  Leichen‐
obduktion  auch  nur  der  kleinste  Fehler  unterlaufen.  Heute  Morgen 
hatte sich das erste Mal in seiner Laufbahn als Pathologe die Zeitung, 
die in den Brust‐ und Bauchhohlraum der Leiche gelegt wird, hoch‐
geschoben  und  aus  der  zusammengenähten  Haut  herausgeschaut. 
Nur eine kleine Unachtsamkeit, ein winziger Fehler... 
Ando  machte  an  seinem  Stammlokal  Halt,  einem  chinesischen 
Restaurant. Er trat ein, setzte sich und bestellte das Mittagsmenü. Es 
war  12.05  Uhr,  doch  erstaunlicherweise  besuchten  heute  wesentlich 
weniger Gäste das Lokal als sonst um diese Uhrzeit. Außer Ando war 
nur ein älterer  Herr anwesend. Er saß in der  Nähe des Tresens, den 
Hut noch auf dem Kopf, und schlürfte Nudelsuppe. Ab und an warf 
er  einen  misstrauischen  Blick  zu  Ando  herüber.  Warum  in  aller  Welt 
setzt  er  seinen  Hut  nicht  ab  und  glotzt  ständig  zu  mir  rüber?,  dachte 
Ando.  Vermutlich  lag  es  an  seiner  momentanen  psychischen 
Verfassung und seinen schwachen Nerven, dass er darin eine tiefere 
Bedeutung suchte. 
Dann drehten sich seine Gedanken wieder um die Zeitungsecke mit 
den sechs Zahlen, die aus Ryujis zugenähtem Bauch herausgestanden 
hatte.  Die  Ziffern  ließen  ihm  keine  Ruhe.  So  sehr  er  sich  auch 
bemühte, sie zu verdrängen, es gelang ihm nicht. Bei jedem Lidschlag 
blinkten sie vor seinem inneren Auge auf. 
Vielleicht  ist  es  eine  Telefonnummer,  dachte  er  und  fixierte  das 
pinkfarbene Telefon auf dem Tresen. Für einen kurzen Moment über‐
legte  er,  ob  er  den  Hörer  nehmen  und  die  Nummer  wählen  sollte. 
Was  ihn  davon  abhielt,  war  die  Tatsache,  dass  es  in  Tokio  keine 
sechsstelligen  Telefonnummern  gab.  Ando  war  sicher:  Sobald  er  die 
Nummer gewählt hätte, würde eine freundliche Stimme sagen: Keine 
Verbindung. Aber wenn nun doch jemand abnehmen würde... 
Ando,  du  hast  mich  vorhin  aber  ganz  schön  zugerichtet.  Sogar  meine 
Hoden  hast  du  herausgenommen  ...  Falls  Ryuji  sich  melden  und  ihm 
derartige Vorhaltungen machen würde ... 
»Guten  Appetit«,  sagte  die  Kellnerin  mit  monotoner  Stimme  und 
stellte  das  Essen  vor  Ando.  Es  war  Gemüse  auf  Reis,  gekrönt  von 
zwei  Wachteleiern.  Dazu  gab  es  eine  Suppe.  Ando  blickte  auf  die 
Schale  mit  dem  Essen.  Die  zwei  Wachteleier  erinnerten  ihn  auf 
unangenehme  Weise  an  Ryujis  Hoden  —  sie  hatten  dieselbe  Farbe 
und Größe. 
Er  setzte  das  Glas  Wasser  an  die  Lippen  und  leerte  es  mit  einem 
Zug.  Seine  Kehle  war  wie  ausgedörrt.  Er  glaubte  nicht  an  über‐
natürliche  Phänomene,  sondern  an  die  Gesetze  der  Wissenschaft. 
Umso mehr ärgerte es ihn, dass es ihm nicht gelang, die Zahlen aus 
seinen Gedanken zu bekommen. 
 
1 7 8 
1 3 6 
 
Vielleicht haben sie doch eine Bedeutung? 
Ein Kode? 
Während Ando seine Suppe schlürfte, breitete er eine Serviette auf 
dem Tisch aus und schrieb die sechs Zahlen auf: 
 
1 7 8 
1 3 6 
 
Angenommen, man setzte den Buchstaben A mit der Zahl 0 und B 
mit der Zahl 1 gleich, C entspräche dann der Zahl 2, D stünde für 3, E 
für  4,  F  für  5  ...  und  Z  für  25;  eine  kinderleichte  Kode‐
Entschlüsselungsmethode.  Man  ersetzte  einfach  die  sechsund‐
zwanzig  Buchstaben  des  Alphabets  durch  die  Zahlen  von  0  bis  25. 
Ando  tauschte  jede  der  sechs  Zahlen  —  1,  7,  8,  1,  3,  6  —  durch  den 
entsprechenden Buchstaben aus. 
 
B H I 
B D G 
 
Zusammen ergab dies: BHIBDG. Auf den ersten Blick war ihm klar, 
dass es so ein Wort nicht gab. Er versuchte es weiter und schrieb nun 
alle  möglichen  Zahlenkombinationen,  die  sich  in  alphabetischen 
Buchstaben ausdrücken ließen, auf die Serviette. Da das Alphabet ein 
Sechsundzwanziger‐System war, fielen die Kombinationen 78 und 81 
von vornherein heraus. 
 
17 8 1 3 6 
R I B D G 
1 7 8 13 6 
B H I N G 
17 8 13 6 
R I N G 
 
Von  allen  Kombinationen  ergab  nur  das  letzte  Wort  eine  Bedeu‐
tung: ›Ring‹. 
»Ring«, murmelte Ando vor sich hin. Das englische Wort ring hatte 
als Substantiv die Bedeutung ›Kreis‹ und bedeutete als Verb ›läuten, 
klingen, schallen‹. 
War  das  ein  Zufall?  Alle  möglichen  Gedanken  schossen  Ando 
durch  den  Kopf.  Doch  dann  kam  er  zu  dem  Schluss,  dass  es  ver‐
mutlich wirklich nur ein Zufall war, dass sich ausgerechnet das Wort 
›Ring‹  ergab,  wenn  man  die  Zahlen  durch  die  Buchstaben  des 
Alphabets ersetzte. 
Während  er  darüber  nachsann,  drang  aus  weiter  Ferne  Sirenen‐
geheul an seine Ohren. Erinnerungen an seine Kindheit stiegen plötz‐
lich in ihm auf. Er war noch ein kleines Kind gewesen und hatte auf 
dem  Land  gelebt,  als  er  dieses  lärmende  Geräusch  zum  ersten  Mal 
gehört  hatte.  In  der  Nachbarschaft  war  ein  Feuer  ausgebrochen.  Er 
war damals mit seiner Großmutter allein zu Haus gewesen, da seine 
Eltern  noch  gearbeitet  hatten.  Als  plötzlich  das  schreckliche  Geheul 
der Sirenen die Stille der Nacht durchbrach, rannte er verschreckt in 
das Zimmer seiner Großmutter und klammerte sich an ihre Beine, am 
ganzen  Leib  zitternd.  Er  wusste  nicht,  dass  das  Geheul  lediglich  ein 
Feueralarm  war,  sondern  glaubte,  dass  es  irgendein  unvorstellbares 
Unheil ankündigte. 
Ein  Jahr  später  hatte  seine  Familie  tatsächlich  ein  furchtbares 
Unglück heimgesucht: Sein Vater starb eines plötzlichen Todes. 
Ando war der Appetit vergangen. Er hatte das Gefühl, als müsste er 
sich  jeden  Moment  erbrechen.  Blass  schob  er  das  Essen  beiseite  und 
ließ sich noch ein Glas Wasser bringen. 
Ryuji, was willst du mir mitteilen? 
Als  Ando  die  Leiche  nach  der  Autopsie  der  Familie  übergeben 
hatte,  hatte  ein  zufriedenes  Lächeln  Ryujis  Mundwinkel  umspielt. 
Mai  war  Ando  dafür  besonders  dankbar  gewesen.  Das  war  gerade 
mal  vor  einer  Stunde  gewesen.  Für  diesen  Abend  war  die  Toten‐
wache  angesetzt,  und  im  Laufe  des  morgigen  Tages  sollte  Ryujis 
Leiche verbrannt werden. Wo wohl gerade der Leichenwagen mit Ryujis 
Sarg  ist?  Schon  auf  dem  Weg  zu  seinem  Elternhaus  in  Sagamiono?  Ließe 
es sich irgendwie einrichten, dann wollte Ando auf jeden Fall bei der 
Verbrennung dabei sein. 
Denn  aus  unerklärlichen  Gründen  wurde  er  das  Gefühl  nicht  los, 
dass sein Freund noch sehr lebendig war. 
 

 
Treffpunkt war die Bank vor der Bibliothek. Nach dem Symposium 
an  der  juristischen  Fakultät  ging  Ando  eiligen  Schrittes  zum 
verabredeten Ort. 
Gestern  hatte  Mai  Takano  ihn  im  Gerichtsmedizinischen  Institut 
angerufen.  Während  Ando  ihrer  bezaubernden  Stimme  gelauscht 
hatte,  tauchte  ihr  feines,  ausgesprochen  hübsches  Gesicht  in  seiner 
Erinnerung auf. Nicht selten riefen Verwandte des oder der Verstor‐
benen an, um die Todesursache zu erfahren. Doch Mais Anruf hatte 
einen  anderen  Grund  gehabt.  Am  Tag  der  Autopsie  war  sie  abends 
nach der Totenwache noch einmal zu Ryujis Apartment gefahren, um 
die  unveröffentlichten  Aufsätze  ihres  Freundes  zu  sortieren.  Dabei 
war sie anscheinend auf etwas gestoßen, wovon sie Ando unbedingt 
erzählen  wollte.  »Es  könnte  etwas  mit  Ryujis  Tod  zu  tun  haben«, 
hatte sie zögernd gesagt. 
Ando war zwar neugierig zu erfahren, was Mai entdeckt hatte, aber 
sein  Verlangen,  sie  wiederzusehen,  übertraf  seine  Wissbegierde  bei 
weitem. So hatte er ihr ein gemeinsames Treffen am Nachmittag des 
folgenden  Tages  vorgeschlagen,  im  Anschluss  an  das  Symposium. 
Daraufhin hatte Mai gesagt: »Gut, dann treffen wir uns an der Bank 
unter den Kirschbäumen vor der Bibliothek.« 
Obwohl  Ando  sein  zweijähriges  Grundstudium  auf  diesem 
Campus verbracht hatte, hatte er sich noch nie mit Freunden an der 
Bank  vor  der  Bibliothek  getroffen.  Auch  mit  seiner  Frau,  die  an 
derselben  Universität  Literaturwissenschaft  studiert  hatte,  hatte  er 
sich  nie  dort  verabredet;  ihr  Treffpunkt  war  immer  der  Ginkobaum 
gewesen. 
Ando  erkannte  Mai,  die  auf  der  Bank  saß,  schon  von  weitem. 
Vielleicht  lag  es  an  der  Farbe  ihres  Kleides,  aber  heute  sah  sie  we‐
sentlich  jünger  und  noch  viel  attraktiver  aus  als  vor  zehn  Tagen  bei 
ihrer  ersten  Begegnung  im  Gerichtsmedizinischen  Institut.  Mai  war 
so in ihr Buch vertieft, dass sie ihn nicht bemerkte. 
Um sie auf sich aufmerksam zu machen, stampfte Ando mit einem 
Fuß auf. Rasch hob Mai den Kopf. 
»Hallo, Frau Takano ... Mai ...«, begrüßte Ando sie. 
»Vielen Dank, dass Sie sich Zeit genommen haben.« Mai erhob sich 
und  verbeugte  sich  leicht.  Sie  wirkte  etwas  unsicher,  als  wüsste  sie 
nicht so recht, wie sie Ando, den Pathologen, der ihren Freund seziert 
hatte, begrüßen sollte. 
»Haben Sie etwas dagegen, wenn ich mich setze?« 
Ohne ihre Antwort abzuwarten, setzte sich Ando neben Mai auf die 
Bank, schlug die Beine übereinander und blickte sie an. 
»Liegen die Untersuchungsergebnisse schon vor?«, erkundigte sich 
Mai. 
Ando  warf  einen  Blick  auf  seine  Armbanduhr.  »Haben  Sie  etwas 
Zeit? Wenn es Ihnen recht ist, könnten wir in ein Cafe gehen und uns 
in Ruhe unterhalten.« 
Mai stand wortlos auf, zupfte ihren Rock zurecht und lief los. 
 
Ando folgte ihr in ein Cafe, das nur wenige Minuten vom Campus 
entfernt  lag.  Es  war  zwar  ein  Studentencafe,  aber  die  ruhige  Atmo‐
sphäre  darin  glich  der  in  einer  Hotellobby.  Sie  wählten  einen  Tisch 
am  Fenster,  von  dem  aus  man  einen  schönen  Blick  nach  draußen 
hatte. Die Bedienung brachte Wasser und feuchte Erfrischungstücher. 
»Ich möchte ein Früchteparfait«, sagte Mai, ohne einen Blick in die 
Karte  zu  werfen.  Ando  war  überrascht  von  ihrer  Entschlossenheit, 
und  da  er  ihr  nicht  nachstehen  wollte,  bestellte  er  sich  einen  Kaffee, 
ohne die Karte zu verlangen. Er sah Mai jetzt in einem vollkommen 
anderen Licht als vor zehn Tagen. Ursprünglich hatte er sie nicht zu 
den  Menschen  gezählt,  die  schnell  und  spontan  Entscheidungen 
trafen. 
»Meine  große  Liebe  ...«,  hauchte  Mai  mit  glühenden  Augen, 
nachdem  die  Kellnerin  den  Tisch  verlassen  hatte.  Ein  wohliger 
Schauer  durchzuckte  Ando,  der  seinen  Höhepunkt  in  einem  ge‐
waltigen,  elektrisierenden  Blitz  fand.  Für  einen  Moment  dachte  er, 
Mais Worte würden sich auf ihn beziehen. Doch im nächsten Augen‐
blick kam er sich lächerlich vor. Natürlich hatte Mai das Parfait und 
nicht ihn gemeint. Wie töricht von mir zu glauben, dass Mai so etwas zu 
mir sagen würde. In meinem Alter! Auf was für absurde Gedanken komme 
ich eigentlich? 
Mais  prachtvolles  Parfait  war  mit  roten  Kirschen  und  Waffeln 
garniert. Sie schien dieses Dessert über alles zu lieben, das zeigte sich 
an  der  Art,  wie  sie  es  verspeiste.  Ähnlich  wie  Andos  kleiner  Sohn 
früher  schlang  sie  es  gierig,  und  ohne  aufzublicken,  in  sich  hinein. 
Dabei wirkte sie rührend kindlich — und unwiderstehlich. Es war ein 
Genuss, ihr zuzusehen. 
Betört  von  ihrem  Charme,  vergaß  Ando  ganz,  seinen  Kaffee  zu 
trinken. Er dachte an seine Frau. Sie hätte auf keinen Fall ein Früchte‐
parfait  bestellt,  wenn  er  mit  ihr  in  dieses  Cafe  gegangen  wäre,  son‐
dern Zitronentee ohne Zucker. Sie achtete konsequent auf ihre Figur 
und aß deshalb nie etwas Süßes. Als sie sich getrennt hatten, war sie 
so  abgemagert,  dass  sie  alles  andere  als  schön  aussah.  Dennoch 
existierte  in  Andos  Erinnerung  nur  das  rundliche  Gesicht,  das  sie 
zum Zeitpunkt ihrer Hochzeit gehabt hatte. 
Mai  steckte  sich  genüsslich  die  Kirsche  in  den  Mund,  spuckte  den 
Kern  aus  und  wischte  sich  mit  der  Serviette  den  Mund  ab.  Dann 
knabberte  sie  die  Waffel,  ohne  sich  davon  stören  zu  lassen,  dass  sie 
dabei  auf  den  Tisch  krümelte,  und  blickte  auf  den  Rest  Eis  am 
Glasboden.  Es  sah  aus,  als  überlegte  sie,  ob  sie  die  Schale  aus‐
schlecken  sollte.  Zum  ersten  Mal  in  seinem  Leben  durchströmte 
Ando  ein  tiefes  Glücksgefühl,  während  er  einer  Frau  beim  Essen 
zusah. 
Nachdem Mai das Parfait aufgegessen hatte, nahm sie das Gespräch 
wieder  auf  und  fragte  Ando  nach  den  Ergebnissen  der  Autopsie.  Er 
fühlte sich seltsam bei dem Gedanken, einer jungen Frau, die gerade 
ein  Eis  gegessen  hatte,  die  Autopsieergebnisse  zu  erörtern.  Aber  er 
musste sie ihr mitteilen und überlegte, wie er am besten anfing. 
Am  selben  Vormittag  hatte  Ando  Ryujis  Familie  über  die  Ergeb‐
nisse  informiert,  aber  sie  hatte  überhaupt  nicht  begriffen,  wovon  er 
sprach.  Als  er  dann  auch  noch  von  der  Gewebeprobe  angefangen 
hatte, war es mit dem Verständnis ganz vorbei gewesen. In ihrer Vor‐
stellung war eine Gewebeprobe ein Organ, das in einem mit Forma‐
linwasser  gefüllten  Gefäß  in  irgendeinem  Labor  gelagert  wurde.  So 
hatten sie die ganze Zeit aneinander vorbeigeredet und viel Zeit ver‐
geudet. Für Ando hingegen war eine Gewebeprobe dasselbe wie ein 
Kugelschreiber  für  einen  Büroangestellten.  Einem  Nicht‐Mediziner 
zu  erklären,  wie  sie  entnommen  und  untersucht  wurde,  stellte  sich 
als gar nicht so einfach heraus. 
Nach kurzer Überlegung entschied er sich, Mai alles von Anfang an 
zu berichten, also von der Gewinnung der Gewebeprobe bis zu deren 
Untersuchung.  »...  die  Gewebeprobe  wird  in  einem  Speziallabor 
untersucht.  Zunächst  wird  sie  dem  erkrankten  Organ  entnommen 
und in eine Formalinlösung gegeben. Danach wird sie zugeschnitten, 
in Paraffin eingebettet und fixiert. In einem nächsten Schritt schneidet 
man  die  Wachsblöcke  in  dünne  Scheiben  und  streicht  sie  auf  einen 
Objektträger  —  ein  spezielles  Glasplättchen  zum  Mikroskopieren. 
Nun  wird  das  Paraffin  durch  ein  Lösungsmittel  entfernt  und  das 
Gewebe  gefärbt.  Abschließend  muss  man  die  Gewebeschnitte  auf 
dem Objektträger versiegeln. 
Dazu  wird  eine  durchsichtige,  harzige  Substanz  auf  den  Gewebe‐
schnitt getropft und dann ein hauchdünnes Gläschen, das so genann‐
te Deckglas, darüber gelegt. Jetzt hat man eine Gewebeprobe, die ins 
Forschungslabor geschickt und dort untersucht werden kann.« 
»Ist  es  richtig,  wenn  ich  mir  vorstelle,  dass  das  entnommene 
Gewebe  dünn  geschnitten  und  auf  ein  Glasplättchen  aufgezogen 
wird?« 
»So ist es.« 
»Lässt sich das Gewebe auf diese Weise besser untersuchen?« 
»Selbstverständlich.« 
»Und haben Sie es mit eigenen Augen gesehen?« 
Haben Sie es mit eigenen Augen gesehen ... Was? Natürlich meinte Mai 
das Zellgewebe von Ryuji, das war Ando schon klar. Aber er konnte 
mit dieser Frage nichts anfangen, in seinen Ohren klang sie irgendwie 
merkwürdig. »Bevor ich die Proben an das Labor schicke, sehe ich sie 
mir immer kurz an.« 
»Wie sah es aus, das Zellgewebe von Ryuji?«, fragte Mai gespannt 
und beugte sich vor. 
»Herzinfarkt  durch  Verschluss  eines  Herzkranzgefäßes  —  ich 
denke,  so  sagte  ich  es  bei  der  Autopsie.  Als  ich  das  entnommene 
Gewebe dann aber unter dem Mikroskop näher untersuchte, erlitt ich 
ehrlich  gesagt  einen  kleinen  Schock.  Wie  Sie  vielleicht  wissen,  wird 
ein  Herzinfarkt  gewöhnlich  durch  eine  Verengung  der  Blutgefäße 
verursacht. Ein Grund für die Verengung können beispielsweise weit 
reichende  arteriosklerotische  Ablagerungen  an  den  Gefäßwänden 
sein. Man spricht im Volksmund auch von Arterienverkalkung, aber 
der medizinische Ausdruck ist Arteriosklerose. Je nach Stadium kann 
dies  zu  mehr  oder  weniger  starken  Durchblutungsstörungen  im 
betroffenen  Bereich  führen.  Weiterhin  besteht  die  Gefahr,  dass  sich 
ein  Blutthrombus  auf  die  Gefäßverengung  setzt  und  die  Arterien 
verstopft.  Der  Herzmuskel  kann  dann  nicht  mehr  ausreichend  mit 
Blut  und  Sauerstoff  versorgt  werden.  Die  Folge  ist  ein  Herzinfarkt. 
Was  wir  bisher  wissen,  ist,  dass  es  bei  Ryuji  zu  einer  solchen  Ver‐
stopfung der Blutgefäße — und zwar konkret der linken Herzkranz‐
arterie — kam. Die wurde aber nicht, wie ich zuerst vermutet hatte, 
durch  eine  Arterienverkalkung  hervorgerufen.  Der  Gefäßverschluss 
hatte eine andere Ursache.« 
»Und welche?«, fragte Mai. 
»Ein Geschwür.« 
»Ein Geschwür?« 
»Ja, Sie haben richtig gehört. Ein Geschwür hatte sich in den stark 
verengten Gefäßen gebildet und schließlich zu einem Verschluss der 
Herzader  geführt  —  so  viel  steht  fest.  Nur  kann  ich  zum  momen‐
tanen Zeitpunkt noch nicht sagen, ob dieser Tumor gut oder bösartig 
war.  Eines  weiß  ich  jedoch:  Ich  habe  so  eine  Art  von  Geschwür 
zwischen der inneren und äußeren Gefäßwand noch nie gesehen.« 
»Meinen Sie, es handelt sich um Krebszellen?« 
»Das könnte sein. Allerdings kommt es, wenn überhaupt, nur sehr 
selten  vor,  dass  sich  ein  Geschwür  genau  auf  dem  Rand  der  Gefäß‐
wand bildet.« 
»Aber wenn das Untersuchungsergebnis vorliegt, dann wissen wir 
doch warum sich dieses Geschwür dort gebildet hat, oder?« 
Ando  schüttelte  lachend  den  Kopf.  »Wenn  es  nicht  mehr  solche 
Fälle gibt, werden wir den Grund wohl nie herausfinden. Sie wissen 
sicher, was ich meine, ohne dass ich es Ihnen am Beispiel Aids erklä‐
ren  muss.«  Trotz  der  wissenschaftlichen  Fortschritte  in  den  letzten 
Jahrzehnten  gab  es  noch  immer  viele  Krankheiten,  deren  Ursachen 
man  bis  heute  nicht  kannte.  Ando  fuhr  fort:  »Es  besteht  allerdings 
noch  eine  andere  Möglichkeit.  Natürlich  könnte  es  auch  eine  Art 
Geburtsfehler sein; ganz abwegig ist das nicht.« 
Das  leuchtete  sogar  einem  Nicht‐Mediziner  ein.  Wenn  ein  Mensch 
allerdings  von  Geburt  an  ein  Geschwür  in  einem  der 
Herzkranzgefäße  hatte,  konnte  er  nur  sehr  eingeschränkt  Sport 
treiben. 
»Aber Dr. Takayama ...« 
»Ich  weiß,  bei  den  Sportfesten  des  Gymnasiums  belegte  er  immer 
einen der ersten Plätze. Am besten war er im Kugelstoßen.« 
»Ja, stimmt.« 
»Daher  können  wir  wohl  auch  mit  ziemlicher  Sicherheit  davon 
auszugehen,  dass  Ryuji  dieses  Geschwür  nicht  von  Geburt  an  hatte. 
Dennoch  möchte  ich  gern  von  Ihnen  wissen,  ob  er  mal  angedeutet 
hat, dass er Schmerzen in der Brust spürte oder so etwas Ähnliches.« 
Die  Beziehung  zwischen  Ando  und  Ryuji  war  nach  dem  Examen 
eingeschlafen.  Nur  ab  und  an  waren  sie  sich  auf  dem  Campus  der 
Universität  begegnet.  Sie  grüßten  sich  dann  kurz,  und  jeder  ging 
seiner  Wege.  Über  Ryujis  gesundheitlichen  Zustand  konnte  Ando 
sich während dieser Zeit absolut kein Bild machen. 
»Ich hatte nur zwei Jahre engen Kontakt zu Dr. Takayama.« 
»Das reicht vollkommen aus.« 
»Er  hatte  einen  ungewöhnlich  kräftigen  Körper.  Ich  kann  mich 
nicht  daran  erinnern,  dass  er  einmal  erkältet  oder  sonst  irgendwie 
krank  gewesen  wäre.  Es  kann  natürlich  sein,  dass  er  es  nur  nicht 
zugab, wenn es ihm mal einen Tag lang nicht so gut ging. Vielleicht 
gehörte  er  zu  den  Menschen,  die  nicht  jammern,  selbst  wenn  sie 
starke Schmerzen haben.« 
»Wenn Ihnen auch nur die geringste Kleinigkeit einfällt...« 
»Da  gibt  es  durchaus  etwas,  worüber  ich  gern  mit  Ihnen  reden 
würde.« 
Jetzt erinnerte Ando sich. Sie hatten sich schließlich nicht getroffen, 
um über die Ergebnisse der Autopsie zu sprechen, sondern weil Mai 
ihm  von  ihrer  merkwürdigen  Erfahrung  in  Ryujis  Apartment 
berichten wollte. »Ach ja ... Bitte erzählen Sie.« 
»Ich  weiß  allerdings  nicht,  ob  es  mit  der  Ursache  von  Dr. 
Takayamas Tod in Verbindung steht«, sagte Mai zaghaft. 
»Erzählen Sie, was passiert ist.« 
»Vor  zehn  Tagen,  als  ich  spät  abends  nach  der  Totenwache  die 
unveröffentlichten  Aufsätze  in  Ryujis  Apartment  sortierte,  klingelte 
plötzlich das Telefon. Für einen kurzen Moment überlegte ich, ob ich 
drangehen  sollte  oder  nicht.  Schließlich  nahm  ich  den  Hörer  ab.  Es 
meldete  sich  ein  Herr  Asakawa,  der  den  Doktor  aus  Schulzeiten  zu 
kennen schien.« 
»Kennen Sie diesen Asakawa?« 
»Ja,  ich  bin  ihm  einmal  begegnet,  ganz  unerwartet  eigentlich.  Ein 
paar  Tage  vor  Ryujis  Tod  kam  Asakawa  zu  Besuch,  als  ich  gerade 
auch da war.« 
»Und weiter?« 
»Nun  ja,  Asakawa  schien  noch  nicht  zu  wissen,  dass  der  Doktor 
gestorben  war,  und  ich  berichtete  ihm  am  Telefon  davon.  Er  wirkte 
ziemlich geschockt und sagte, dass er sofort kommen werde.« 
»Wohin?« 
»Natürlich in das Apartment von Ryuji Takayama.« 
»Und ist er gekommen?« 
»Ja, er stand sogar viel früher vor der Tür, als ich es erwartet hatte. 
Es war wirklich sehr seltsam, sage ich Ihnen. Er trat ein und nahm je‐
den Zentimeter im Zimmer genaustens unter die Lupe. Seine Augen 
wanderten von  rechts  nach  links, nicht  die  kleinste  Ecke ließ  er  aus. 
Es  machte  den  Eindruck,  als  würde  er  nach  etwas  Bestimmtem 
suchen. Immer und immer wieder fragte er mich, ob mir im Zimmer 
nicht  etwas  Ungewöhnliches  aufgefallen  sei.  Aber  das  war  es  gar 
nicht mal, was mich so verwunderte. Es waren seine Worte danach.« 
Mai verstummte und trank einen Schluck Wasser. 
»Was hat er denn gesagt?« 
»Ich  erinnere  mich  noch  genau  an  den  Wortlaut.  Er  fragte:  ›Hat 
Ryuji Ihnen etwas erzählt, bevor er starb? Hat er mit Ihnen über das 
Video gesprochen?‹« 
»Das Video?«, fragte Ando überrascht. 
»Ja.  Merkwürdig,  oder?«  Mai  war  dieses  Verhalten  absolut  un‐
verständlich gewesen. Sie konnte nicht begreifen, wie Asakawa sie in 
dieser  Situation  nach  so  etwas  Belanglosem  fragen  konnte.  Hatte  er 
denn  nichts  anderes  im  Kopf,  als  ein  Video  zu  finden,  das  er 
offensichtlich  bei  Ryuji  vergessen  hatte?  Das  waren  ihre  ersten 
Gedanken  gewesen.  Aber  dann  beschlich  sie  plötzlich  ein  merk‐
würdiges Gefühl. 
»Hat  Ryuji  Ihnen  denn  etwas  über  dieses  mysteriöse  Video  er‐
zählt?« 
»Nein, kein Wort.« 
»Ein Video, hm?« Ando lehnte sich zurück. Ihm war nicht wohl bei 
dem  Gedanken,  dass  ein  Mann  namens  Asakawa  vor  zehn  Tagen, 
also genau an dem Tag, als er Ryujis Leiche obduziert hatte, in dessen 
Apartment aufgekreuzt war ... 
»Es ist zwar nur so ein Gedanke, aber ist es nicht möglich, dass der 
Inhalt  des  Videos  Ryuji  so  geschockt  hat,  dass  er  einen  Herzanfall 
bekam?« 
»Denkbar  ist  das  schon.«  Ando  konnte  Mais  Gedankengang  gut 
nach vollziehen. Erst vor ein paar Tagen hatte er einen Thriller gese‐
hen, in dem eine ähnliche Szene vorkam. Der Film handelte von einer 
jungen  Frau,  die  mit  dem  Abteilungsleiter  ihres  Mannes  eine  Affäre 
hatte und in eine Falle tappte. Ein Voyeur hatte das Liebespaar beim 
Sex im Hotel beobachtet, die Szene mit der Videokamera aufgezeich‐
net und das Band zusammen mit einem Erpressungsbrief an die Frau 
geschickt.  Nervös  schob  sie  das  Video  in  den  Rekorder  und  schaute 
es sich an. In den ersten Sekunden war nichts auf der Mattscheibe zu 
sehen,  nur  ein  Flimmern,  doch  dann  sah  sie  plötzlich  einen  nackten 
Frauenkörper,  der  sich  rhythmisch  auf  dem  eines  jungen  Mannes 
bewegte. Ein abgehacktes Stöhnen begleitete die Bewegungen. Als sie 
merkte,  dass  sie  die  Frau  auf  dem  Videoband  war,  fiel  sie  in  Ohn‐
macht. 
Ähnliches  geschah  auch  in  der  Wirklichkeit  immer  wieder.  Die 
emotionalen Reaktionen eines Menschen konnten dann so heftig sein, 
dass er  einen  Schock  erlitt.  Bei  schlechter  Verfassung  trat  manchmal 
sogar der Tod ein. Ausgeschlossen war es also nicht. Aber Ando hatte 
Ryujis Leiche vor sich liegen gehabt, das Herz eingehend untersucht 
und eine Gewebeprobe entnommen. 
»Aber  Ryuji  ist  auf  keinen  Fall  durch  einen  Schock  gestorben.  Er 
hatte  nachweislich  einen  Verschluss  in  der  Herzader.  Davon  einmal 
abgesehen  —  können  Sie  sich  ernsthaft  vorstellen,  dass  der  Anblick 
eines  Videos  Ryuji  so  schocken  könnte,  dass  er  daran  stirbt?«,  sagte 
Ando leicht ironisch. 
»Da haben Sie allerdings recht. Das ist undenkbar.« Auch um Mais 
Mundwinkel zeichnete sich ein leichtes Lächeln ab. 
Sie  waren  sich  also  über  Ryujis  Charakter  einig.  Er  war  ein  Mann 
gewesen, der sich durch nichts so schnell aus der Ruhe hatte bringen 
lassen. 
»Übrigens ... wissen Sie, wie ich Asakawa erreichen kann?« 
»Nein,  also  so  weit  ...«,  antwortete  Mai.  Doch  plötzlich  schien  ihr 
etwas  einzufallen.  »›Das  ist  der  Journalist  Kazuyuki  Asakawa  von 
der  Zeitung  M.‹  —  so  hat  ihn  mir  der  Doktor  vorgestellt,  wenn  ich 
mich recht erinnere.« 
»Kazuyuki Asakawa von der Zeitung M.« Ando schrieb das in sein 
Notizbuch. Ein Anruf bei der Zeitung würde sicher genügen, um ihn 
ausfindig  zu  machen.  Es  war  nicht  ausgeschlossen,  dass  Ando  zu 
einem späteren Zeitpunkt einige Fragen an Asakawa haben würde. 
Mai  blickte  auf  den  hingekritzelten  Namen,  stützte  das  Kinn  auf 
ihre Hand und sah Ando mit großen, erstaunten Augen an. 
»Was ist?«, fragte er und hob den Blick. 
»Es geht um die Schriftzeichen von ›Kazuyuki‹.« 
Ando  sah  auf  das  Notizbuch  hinab.  ›Kazuyuki  Asakawa‹.  Er 
betrachtete  die  Schriftzeichen.  Plötzlich  wurde  ihm  klar,  was  Mai 
meinte. Ohne auch nur eine Sekunde zu zögern, hatte er den Namen 
fehlerlos  geschrieben.  Dabei  gab  es  viele  Möglichkeiten,  sowohl 
›Asakawa‹ als auch ›Kazuyuki‹ in Schriftzeichen auszudrücken. Auf 
Anhieb  hatte  er  sie  richtig  geschrieben,  als  hätte  er  diesen  Mann 
gekannt. 
»Woher  wissen  Sie,  wie  man  den  Namen  schreibt?«,  fragte  Mai 
verwundert. 
Ando  konnte  ihr  darauf  keine  Antwort  geben.  Es  war  eine  Art 
Intuition gewesen. Irgendetwas sagte ihm plötzlich, dass er in naher 
Zukunft zu diesem Mann Kontakt aufnehmen würde. 
 

 
Zum ersten Mal seit anderthalb Jahren trank Ando wieder Reiswein 
zum Essen. Das schlechte Gewissen, für den Tod seines einzigen Kin‐
des verantwortlich zu sein, hatte so schwer auf ihm gelastet, dass er 
bis  zum  heutigen  Tag  kein  Bedürfnis  nach  Alkohol  verspürt  hatte. 
Aber ganz konnte er sich dieses Laster dann doch nicht abgewöhnen. 
Dafür liebte er Alkohol viel zu sehr. Fatal aber war die Wirkung: Ge‐
fühle, die einen bewegten, verstärkten sich. War man glücklich, woll‐
te man die ganze Welt umarmen, trank man jedoch in sentimentaler 
Stimmung, dann riss der Alkohol einen in ein tiefes schwarzes Loch, 
und der Kummer wurde unerträglich. Der Schmerz über den Verlust 
seines Sohnes saß so tief, dass Ando, obwohl er früher kein Gläschen 
verschmäht hatte, freiwillig darauf verzichtet hatte. Zu groß war die 
Angst, dass er in einen Abgrund fallen, die Kontrolle über sich verlie‐
ren  und  von  der  Todessehnsucht  zum  Selbstmord  getrieben  werden 
würde. Deshalb hatte er lange Zeit nicht den Mut aufgebracht, auch 
nur einen Schluck zu trinken. 
Es  war  Ende  Oktober,  und  ein  feiner  Nieselregen  fiel.  Zu  dieser 
Jahreszeit  war  das  sehr  ungewöhnlich.  Selbst  als  Ando  den  Schirm 
aufspannte,  kroch  die  Feuchtigkeit  seinen  Nacken  hinauf.  Doch  kalt 
war ihm nicht. Der Alkohol hatte ihn gewärmt. Er streckte mehrmals 
die Hand unter dem Schirm hervor und versuchte, einen Regentrop‐
fen aufzufangen. Doch der Regen fiel nicht von oben herab, sondern 
schien von unten wie dichter Nebel aufzusteigen. 
Ando beschloss, auf dem Weg nach Hause eine Flasche Whisky zu 
kaufen. An einem kleinen Laden machte er Halt, trat aber nicht sofort 
ein. Für eine Weile blieb er in der Dunkelheit stehen und blickte auf 
die  Hochhäuser,  die  in  der  schwarzen  Nacht  vor  ihm  aufragten.  Sie 
faszinierten  ihn.  Der  Anblick  der  nächtlichen  Megapolis  übte  einen 
besonderen  Reiz  auf  ihn  aus,  mehr  als  irgendein  Naturschauspiel. 
Das  von  feuchtem  Nebel  umhüllte  Rathaus  erstrahlte  in  einer 
unheimlichen  Schönheit.  Die  Markierungslichter  auf  dem  Dach 
leuchteten  wie  Morsekodes  auf  und  langsam  und  gleichmäßig 
blinkten  sie rot  in  die  schwarze  Nacht.  Der  Anblick  erinnerte  an  ein 
großes Monster, das eine Nachricht schickte. 
In  einem  alten  vierstöckigen  Wohnhaus  in  der  Nähe  des  Yoyogi‐
Parks befand sich Andos Apartment. Er hatte es nach der Trennung 
von  seiner  Frau  bezogen.  Verglichen  mit  dem  hübschen,  exklusiven 
Apartmenthaus  in  Minami  Aoyama  war  dieses  hier  um  einiges 
schäbiger  und  wies  auch  sonst  wesentliche  Nachteile  auf.  Zum 
Beispiel  gab  es  keine Parkplätze.  Ando  hatte  sich  deshalb sogar  von 
seinem neuen BMW trennen müssen. Das Einzimmer‐Apartment war 
spartanisch eingerichtet und erinnerte an eine Studentenbude. Ledig‐
lich  ein  Bücherregal  und  ein  Stahlbett  standen  im  Zimmer,  mehr 
Möbel besaß Ando nicht. Es war nicht ein Hauch von Lebensqualität 
zu entdecken, die bei einem Mann seines Alters zu erwarten gewesen 
wäre. 
Er betrat das Apartment und legte seine Sachen ab. Während er das 
Fenster öffnete, klingelte das Telefon. 
»Hallo?« 
»Ich binʹs.« 
Ando  wusste  sofort,  wer  am  anderen  Ende  der  Leitung  war.  Es 
konnte  nur  Miyashita  sein,  ein  alter  Studienfreund,  der  am  Patho‐
logischen Institut der Universität arbeitete. Miyashita hatte die Ange‐
wohnheit,  am  Telefon  nie  seinen  Namen  zu  nennen;  nur  ein  kurzes 
›Ich binʹs‹ ließ er verlauten. 
»Bitte  entschuldige,  dass  ich  mich  noch  nicht  bei  dir  gemeldet 
habe«,  sagte  Ando  mit  schlechtem  Gewissen.  Er  wusste,  warum 
Miyashita anrief. 
»Ich war heute in deinem Büro in der Uni.« 
»Ich hatte Dienst in der Gerichtsmedizin. Deshalb konntest du mich 
dort nicht antreffen.« 
»Ich beneide dich wirklich. Ein doppeltes Gehalt einstreichen ...« 
»Du musst dich gerade beschweren! Wer von uns gehört denn zur 
Elite und verdient das dicke Geld?« 
»Scherz  beiseite  ...  Du  hast  mir  noch  nicht  gesagt,  ob  du  zu 
Funakoshis Abschiedsparty kommst.« 
Funakoshi war in der Abteilung für Innere Medizin tätig. Doch nun 
beabsichtigte  er,  seinen  Job  dort  an  den  Nagel  zu  hängen,  in  seine 
Heimatstadt  zurückzukehren  und  als  Nachfolger  seines  Vaters  die 
Leitung des Familienkrankenhauses zu übernehmen. Miyashita hatte 
sich bereit erklärt, die Abschiedsfeier für Funakoshi zu organisieren. 
Schon vor Tagen hatte er Ando den Termin mitgeteilt und um kurze 
Antwort gebeten. Wegen der Ereignisse und Aufregungen der letzten 
Tage hatte Ando die Abschiedsparty jedoch vollkommen vergessen. 
Wehmütig dachte er an sein eigenes Schicksal. Sicher wäre für ihn 
auch  so  eine  Feier  organisiert  worden,  hätte  das  Schicksal  ihm  nicht 
den  Sohn  entrissen.  Ursprünglich  wollte  er  nur  kurze  Zeit  in  der 
Gerichtsmedizin  arbeiten,  um  praktische  Erfahrungen  zu  sammeln. 
Zu gern hätte er dann in den klinischen Bereich übergewechselt, um 
später das Krankenhaus der Schwiegerfamilie zu übernehmen. Doch 
sein  Versagen  hatte  alle  Zukunftsträume  wie  Seifenblasen  platzen 
lassen. 
»Wann  ist  die  noch  mal?«,  stammelte  Ando,  den  Hörer  zwischen 
Ohr und Schulter geklemmt, den Terminkalender in der Hand. 
»Freitag in einer Woche.« 
»Freitag ...« 
Überflüssig, in den Terminkalender zu sehen — Ando wusste, dass 
er  an  diesem  Freitag  schon  etwas  vorhatte.  Erst  vor  drei  Stunden 
hatte  er  sich  mit  Mai  für  diesen  Abend  zum  Essen  verabredet,  und 
zwar für sechs Uhr. Er steckte in der Klemme. Aber die Entscheidung 
fiel ihm leicht. Nach zehn Jahren hatte er die Chance, wieder einmal 
mit  einer  jungen,  sehr  attraktiven  Frau  auszugehen.  Keine  Frage,  er 
würde die bezaubernde Mai treffen. Er hatte nicht die geringste Lust, 
die  Verabredung  mit  ihr  für  die  öde  Abschiedsparty  von  Funakoshi 
sausen  zu  lassen.  Dieses  Treffen  mit  Mai  konnte  immerhin  einen 
entscheidenden  Wendepunkt  in  seinem  Leben  darstellen.  Entweder 
erwachte er endlich aus seinem Albtraum, oder er blieb für immer in 
den Klauen seines trostlosen Daseins gefangen. 
»Wie sieht es aus? Kommst du?«, drängte Miyashita. 
»Es tut mir wirklich Leid, aber an diesem Tag habe ich schon etwas 
vor.« 
»Stimmt  das  auch  wirklich,  oder  ist  es  nur  wieder  eine  faule 
Ausrede, wie schon so oft?« 
Wie schon so oft... Ando wusste nicht, was Miyashita damit meinte. 
Er konnte sich nicht erinnern, Einladungen von Freunden aus irgend‐
einem  fadenscheinigen  Grund  abgesagt  zu  haben.  »Was  heißt  hier 
›faule Ausrede‹?« 
»Na, weil du keinen Alkohol trinkst. Immer das Gleiche, dabei hast 
du doch früher kein Glas verschmäht.« 
»Nein, das ist nicht der Grund.« 
»Wenn du keinen Alkohol trinken möchtest, brauchst du das auch 
nicht.  Keiner  zwingt  dich  dazu.  Du  kannst  dich  ja  mit  Oloong‐Tee 
begnügen. Komm wenigstens für ein Stündchen vorbei.« 
»Ich sagte doch schon, das ist nicht der Grund.« 
»Heißt das etwa, du trinkst wieder Alkohol?« 
»Ja.« 
»Dann  kann  es  nur  eines  sein:  Du  hast  eine  Frau  kennen  gelernt. 
Stimmtʹs? Bist du in sie verliebt?« 
Der  dickleibige  Miyashita  hatte  einen  sechsten  Sinn  für  solche 
Sachen.  Ando  hatte  sich  fest  vorgenommen,  seinem  Freund  gegen‐
über immer aufrichtig zu sein, aber dieses Mal wusste er nicht, was er 
antworten sollte. Es war einfach noch zu früh, um sagen zu können, 
ob  er  Mai  liebte  oder  nicht.  Schließlich  hatten  sie  sich  erst  zweimal 
gesehen. 
»Das  muss  ja  eine  ganz  heiße  Frau  sein,  wenn  sie  dich  sogar  von 
Funakoshis  Abschiedsparty  abhält  ...  Freut  mich  für  dich.  Du 
brauchst  nicht  verlegen  zu  sein.  Bring  sie  doch  mit.  Komm,  gib  dir 
einen Ruck.« 
»Nein, so weit sind wir noch nicht.« 
»Ach, stell dich doch nicht so an.« 
»Nein, nein, wirklich.« 
»Ich kann dich natürlich nicht zwingen zu kommen ...« 
»Tut mir Leid.« 
»Hör  auf,  dich  ständig  zu  entschuldigen.  Ich  habe  schon  verstan‐
den.  Mach  dir  keine  Sorgen,  ich  werde  Funakoshi  und  den  anderen 
Bescheid sagen. Aber mach dich auf einiges gefasst. Ich werde überall 
herumposaunen,  dass  sich  unser  Ando  bis  über  beide  Ohren 
verknallt hat«, prustete Miyashita. 
Ando  konnte  es  ihm  nicht  übel  nehmen.  Miyashita  war  ein  ausge‐
sprochen  netter  Kerl  und  nach  dem  Tod  von  Andos  Sohn  und  der 
Trennung von seiner Frau immer für ihn da gewesen. Ando erinnerte 
sich  noch  genau.  Eines  Tages  hatte  Miyashita  mit  einem  Roman  in 
der  Hand  vor  seiner  Tür  gestanden.  Der  Titel:  Kopf  hoch.  »Lies  das«, 
hatte  er  gutmütig  gebrummt.  Bis  zu  diesem  Moment  hatte  Ando 
nichts  von  Miyashitas  literarischer  Ader  gewusst.  Deshalb  war  er 
umso  erstaunter  über  das  Geschenk  gewesen.  Es  war  eine  Art  Bil‐
dungsroman, der von einem jungen Mann mit schweren physischen 
und psychischen Störungen handelte. Er erzählte, wie der Junge seine 
Vergangenheit  bewältigte  und  sich  weiterentwickelte.  Die  Lektüre 
des  Buches  war  so  beeindruckend  gewesen,  dass  Ando  neuen 
Lebensmut gefasst hatte. Der Roman hatte sogar einen Ehrenplatz in 
seinem Bücherregal bekommen. 
»Übrigens  ...«,  wechselte  Ando  das  Thema.  »Liegen  die  Unter‐
suchungsergebnisse  der  Gewebeprobe  von  Ryuji  Takayama  schon 
vor?« Die Probe wurde in Miyashitas Labor analysiert. 
»Ach, fang bloß nicht damit an«, seufzte Miyashita. 
»Wieso? Was ist los?« 
»Wie  soll  ich  es  sagen?  Ich  weiß  wirklich  nicht  mehr,  wo  mir  der 
Kopf steht. Sag mal, was hältst du eigentlich von Professor Seki?« 
Professor  Seki  arbeitete  am  selben  Pathologischen  Institut  wie 
Miyashita. Er galt als Kapazität auf dem Gebiet der Erforschung von 
Krebszellen. »Warum? Du kennst ihn doch viel besser als ich.« 
»Der Professor redet manchmal wirres Zeug.« 
»Was hat er denn gesagt?« 
»Also,  er  sieht  das  Problem  weniger  in  dem  Verschluss  der  Herz‐
kranzarterie.  Seine  Vermutung  ist  vielmehr,  dass  das  Geschwür  in 
der Kehle zum Tod geführt hat... Er hat zwar nur einen kurzen Blick 
auf  die  Probe  geworfen,  aber  er  hat  eine  These.  Rate  mal,  was  er 
gesagt hat.« 
»Nun spann mich nicht so auf die Folter. Was hat er gesagt?« 
»Ist  ja  gut.  Er  sagte,  es  ähnelt  den  Geschwüren,  die  durch  Pocken 
verursacht werden.« 
»Pocken?«, wiederholte Ando überrascht. 
Bereits  vor  vielen  Jahren  hatte  man  einen  Impfstoff  gegen  diese 
Krankheit  gefunden,  und  die  Seuche  galt  als  besiegt.  Der  letzte 
Pockenfall  weltweit  war  1977  in  Somalia  registriert  worden.  1979 
hatte die Weltgesundheitsorganisation die Pocken endgültig für aus‐
gerottet erklärt. Das Pockenvirus war hoch ansteckend, wenn es auch 
— solange kein Mensch damit infiziert war — keine Bedeutung hatte. 
Es wurde nur noch in zwei Forschungslaboratorien — in Moskau und 
im  amerikanischen  Atlanta  —  gelagert.  Falls  plötzlich  irgendwo  auf 
der  Welt  wieder  ein  Pockenfall  auftauchte,  konnte  der  Erreger  nur 
aus einem der beiden stammen. Aber in Anbetracht der verschärften 
Sicherheitskontrollen  in  den  Instituten  war  diese  Möglichkeit  gleich 
null. 
»Schockiert dich das etwa?« 
»Es muss ein Irrtum sein.« 
»Womöglich. Ich gebe ja nur wieder, was Professor Seki gesagt hat. 
Wir sollten die Möglichkeit trotzdem in Betracht ziehen.« 
»Wann,  meinst  du,  liegt  das  endgültige  Untersuchungsergebnis 
vor?« 
»In einer Woche, denke ich. Ich sehe schon die Schlagzeilen vor mir: 
›Der  schwarze  Tod  kehrt  zurück  —  neue  Pockenfälle!‹«,  scherzte 
Miyashita munter. 
Ando  glaubte  nicht,  dass  es  sich  um  einen  neuen  Pockenfall 
handelte. Er war felsenfest davon überzeugt, dass ein Irrtum vorlag. 
Noch nie hatte er einen mit dieser Krankheit Infizierten gesehen. Das 
Wissen über bestimmte Virenerkrankungen, die bereits als ausgerot‐
tet galten, eigneten sich Mediziner in seinem Alter in erster Linie aus 
Lehrbüchern  und  Forschungsarbeiten  an.  Einmal  hatte  er  ein  Foto 
von  einem  pockennarbigen  Kind  gesehen.  Der  Körper  war  mit 
braunen, erbsengroßen Flecken gesprenkelt und der Blick des Kindes 
ausdruckslos.  Nach  etwa  sieben  Tagen  Inkubationszeit  zeigten  sich 
die ersten Anzeichen. Zunächst kam es bei den Infizierten zu grippe‐
ähnlichen Symptomen mit Fieber, zwei bis drei Tage später traten die 
charakteristischen  Pusteln  in  Gesicht  und  auf  dem  gesamten  Körper 
auf, die sich dann zu Knoten entwickelten. 
»He, komm mal wieder auf den Boden der Tatsachen. Das ist doch 
absurd. Ich habe Ryujis Leiche obduziert und konnte bei ihm keiner‐
lei Ausschlag feststellen, weder im Gesicht noch sonst irgendwo.« 
»Mir  liegt  zwar  nicht  viel  daran,  diesen  Gedanken  weiterzu‐
spinnen — aber wusstest du, dass es in der Tat ein Pockenvirus gibt, 
das zu Geschwüren in den Gefäßen und mit fast hundertprozentiger 
Wahrscheinlichkeit zum Tod führt?« 
Ando  schüttelte  den  Kopf.  »Nein,  davon  habe  ich  noch  nichts 
gehört.« 
»Es existiert aber.« 
»Du willst mir doch wohl nicht allen Ernstes weismachen, dass der 
Verschluss  der  Herzader  durch  eine  Art  Pockenvirus  verursacht 
wurde?« 
»Das sage ich ja gar nicht. Aber Tatsache ist nun mal, dass sich an 
der Gefäßwand der Herzkranzarterie ein Geschwür gebildet hat. Was 
ist  es  denn  dann?  Du  hast  es  doch  unter  dem  Mikroskop  gesehen. 
Wie entsteht so was?« 
»Ich weiß es nicht.« 
»Du  hast  hoffentlich  eine  Pockenschutzimpfung,  oder?«,  scherzte 
Miyashita fröhlich. 
»Ha,  ha.  Wenn  ich  mich  tatsächlich  mit  dem  Virus  infiziert  hätte, 
wäre es jetzt sowieso zu spät... Aber jetzt mal Spaß beiseite, mir fällt 
da was ein.« 
»Was?« 
»Vergessen wir die Frage, ob wir es mit einem Ableger des Pocken‐
virus  zu  tun  haben.  Nur  mal  angenommen,  es  gäbe,  wie  du  sagst, 
tatsächlich  ein  Virus,  das  ein  Geschwür  in  den  Arterien  und  als 
Resultat  davon  einen  Herzinfarkt  hervorruft  ...  Dann  wäre  doch 
denkbar, dass es noch weitere, ähnliche Fälle gibt. Was meinst du?« 
Miyashita  seufzte  leise.  Er  schien  nachzudenken.  »Ausgeschlossen 
ist es sicher nicht.« 
»Könntest  du  nicht  mal  nachforschen,  ob  in  letzter  Zeit  ähnliche 
Fälle  aufgetaucht  sind?  Wenn  du  deine  Beziehungen  spielen  lässt, 
dürfte das doch kein Problem sein.« 
»In  Ordnung.  Nicht  auszudenken,  wenn  das  Resultat  positiv  ist! 
Stell dir das mal vor, was für ein gewaltiger Schock.« 
»Ich glaube, dass wir uns unnötig Sorgen machen.« 
Sie verabschiedeten sich und hängten ein. 
Durch  das  geöffnete  Fenster  drang  die  klamme  Abendluft  ins 
Zimmer.  Ando  trat  auf  den  Balkon.  Der  Regen  hatte  aufgehört.  Die 
Laternen warfen einen gleichmäßigen Schatten auf die nasse, dunkle 
Straße.  Die  Lichter  der  Stadt  und  das  laute  Brummen  der  Autos 
schienen tief in die neblige Feuchtigkeit einzutauchen, um sich dann 
wie  ein  Wirbelsturm  zu  erheben.  Als  Ando  das  Fenster  schloss,  trat 
Stille  ein.  Das  tosende  Geräusch  der  vorbeifahrenden  Autos  war 
vollkommen verstummt. 
Er  nahm  das  Medizinlexikon  aus  dem  Bücherregal  und  sah  unter 
›Pockenviren‹  nach.  Weil  die  Pocken  bereits  vor  Jahrzehnten  ausge‐
storben  waren,  standen  sie  nicht  mehr  im  Mittelpunkt  des  wissen‐
schaftlichen  Interesses.  Selbst  im  Rahmen  eines  Medizinstudiums 
wurde  das  Thema  nur  gestreift.  Wer  Einzelheiten  erfahren  wollte, 
musste sich das Wissen selbst aus Büchern aneignen. Ando las, dass 
das  Pockenvirus  zur  Gruppe  der  Prox‐Viren  und  zur  Gattung  der 
Orthopox‐Viren  gehörte.  Es  gab  zwei  verschiedene  Arten:  variola 
Major und Minor. Sie unterschieden sich vor allem durch Krankheits‐
verlauf und Todeswahrscheinlichkeit. Eine Infektion mit dem Major‐
Virus verlief zu dreißig bis vierzig Prozent tödlich, beim Minor‐Virus 
lag  die  Rate  unter  fünf  Prozent.  Neben  den  Prox‐Viren  gab  es 
Pockenviren,  die  speziell  bei  Tieren  —  wie  Affen,  Hasen,  Rindern 
und Mäusen — vorkamen. Aber in Japan waren derartige Fälle kaum 
bekannt geworden, zudem galten sie als ungefährlich. 
Ando  legte  das  Medizinlexikon  beiseite.  Was  für  ein  absurder 
Gedanke  ...  Professor  Seki  hatte  sich  das  Geschwür  nur  kurz  an‐
gesehen, nicht mal unter dem Mikroskop, und sich ja auch noch nicht 
festgelegt. Er hatte lediglich gesagt, dass dieses Geschwür den durch 
Pocken verursachten Knoten ähnele. Was lasse ich mich eigentlich derart 
von diesem Quatsch beeinflussen! Logisch gedacht gibt es nur eine Antwort: 
Es  kann  sich  auf  keinen  Fall  um  eine  neue  Art  von  Pockenvirus  handeln. 
Das ist ausgeschlossen. Aber warum musste er sich immer wieder dazu 
zwingen, so zu denken? 
Der  Grund  lag  auf  der  Hand:  Wenn  Ryuji  wirklich  mit  einem 
Pockenvirus  infiziert  gewesen  wäre,  könnte  Mai  sich  angesteckt 
haben.  Dieser  Gedanke  beunruhigte  Ando  zutiefst.  Mai  und  Ryuji 
waren  immerhin  ein  Paar  gewesen.  Hatte  man  sich  mit  dem 
Pockenvirus  infiziert,  bildete  sich  ein  Geschwür  in  den  Schleim‐
häuten  der  Mundhöhle  oder  Kehle;  die  Übertragung  des  Krank‐
heitserregers erfolgte per Tröpfcheninfektion, also mitunter über den 
Speichel. Plötzlich sah Ando zwei Liebende vor sich — Mai und Ryuji 
küssten  sich  innig.  Er  versuchte,  die  Bilder  aus  seinem  Bewusstsein 
zu verdrängen. 
Er  goss  sich  einen  Whisky  ein  und  trank  ihn  pur.  Der  Alkohol 
brannte  in  der  Kehle;  als  er  im  Magen  angekommen  war,  zeigte  er 
schnell  seine  Wirkung.  Alle  Kraft  wich  aus  Andos  Körper,  er  hatte 
das  Gefühl,  als  wären  seine  Gliedmaßen  aus  Gummi.  Nur  sein 
Gehirn arbeitete noch. Schlaff ließ er sich aufs Bett fallen und starrte 
gedankenverloren auf die Schimmelflecken an der Decke. 
Plötzlich  sah  er  sein  ganzes  Leben  klar  vor  sich.  Der  Traum  vom 
Meer,  genau  einen  Tag,  bevor  sein  Sohn  ertrunken  war,  war  eine 
Vision  gewesen.  Obwohl  er  diese  schreckliche  Vorahnung  gehabt 
hatte, hatte er sein Kind vor diesem traurigen Schicksal nicht bewah‐
ren  können.  Die  bittere  Reue  der  Vergangenheit  hatte  ihn  zu  einem 
Menschen  gemacht,  der  auf  sein  inneres  Gefühl  hörte,  egal  wie 
absurd und abwegig es auch sein mochte. 
Jetzt  hatte  er  wieder  so  ein  merkwürdiges  Gefühl.  Ihm  wurde 
immer  klarer,  dass  hinter  dem  Zahlenkode  auf  dem  Zeitungsfetzen, 
der  entschlüsselt  das  Wort  ›Ring‹  ergab,  eine  tiefere  Bedeutung 
stecken  musste.  Es  war  kein  Zufall,  dass  sich  genau  dieses  Wort 
ergab.  Ryuji  hatte  ihm  irgendetwas  mitteilen  wollen.  Aber  was?  Er 
zermarterte sich das Gehirn. Obwohl Ryujis Körper eingeäschert war 
und nur noch eine Gewebeprobe von ihm existierte, wurde Ando das 
Gefühl nicht los, dass er noch unter ihnen weilte und versuchte, ihm 
etwas Wichtiges mitzuteilen. Jetzt drehe ich vollkommen durch. Was für 
ein irrer Gedanke ... 
Er lag auf dem Bett, beide Arme und Beine weit von sich gestreckt. 
Just  in  diesem  Moment  schien  sein  Geist  seinem  Körper  zu  entwie‐
chen und von oben auf seine ausgestreckte Gestalt zu blicken. Irgend‐
wo  hatte  er  dieses  Bild  schon  einmal  gesehen.  Es  war  noch  nicht 
lange  her.  Obwohl  Ando  todmüde  war,  erinnerte  er  sich  plötzlich. 
Richtig,  auf  ein  paar  Polaroidfotos  hatte  er  die  Gestalt  gesehen  — 
Ryujis  Leiche  hatte  ähnlich  dagelegen,  als  Mai  sie  gefunden  hatte. 
Erschöpft schlüpfte Ando unter die Decke und schlief zitternd ein. 
 

 
Zwei  Leichen  hatte  Ando  heute  Vormittag  bereits  seziert.  Die 
restlichen  Arbeiten  überließ  er  den  Assistenten;  er  selbst  kehrte  zur 
Universität zurück. Miyashita hatte ihn angerufen und Andeutungen 
gemacht,  dass  es  in  der  »Sache  Ryuji«  etwas  Neues  gebe.  Ando 
konnte  es  kaum  erwarten  zu  hören,  was  Miyashita  zu  sagen  hatte. 
Hastig lief er die Treppen von der U‐Bahn‐Station hinauf ins Freie. 
Er rannte durch den Haupteingang des Universitätsklinikums und 
den  Flur  entlang,  der  zum  älteren  Gebäude  führte.  Der  Neubau  der 
Klinik,  ein  siebzehnstöckiges  Hochhaus,  war  erst  vor  zwei  Jahren 
errichtet  worden.  Alter  und  neuer  Gebäudekomplex  waren  über 
Treppen  und  Flure  auf  komplizierte  Weise  miteinander  verbunden. 
Ando kam sich jedes Mal wie in einem Labyrinth vor, sobald er das 
Krankenhaus betrat. Die Farben, die Ausmaße der Flure, ja sogar der 
Geruch  auf  den  Gängen  waren  unterschiedlich.  Blickte  man  durch 
die  Stahltür  des  alten  Gebäudekomplexes  auf  den  weitläufigen  Flur 
des neuen, so hatte man den Eindruck, als würde man in die dunkle, 
ferne Zukunft sehen. 
Durch die halboffene Tür des Pathologischen Instituts konnte Ando 
Miyashita  erkennen.  In  ein  Buch  versunken  saß  er  mit  dem  Rücken 
zur Tür. 
Ando tippte ihm von hinten auf die Schulter. Miyashita wandte sich 
um,  nahm  die  Brille  ab,  klappte  das  Buch  zu  und  legte  es  mit  der 
Aufschrift  nach  oben  auf  den  Tisch.  Enttäuscht  las  Ando  den  Titel: 
Einführung in die Astrologie. 
Miyashita fragte ernst: »Wann bist du geboren?« 
Ohne zu antworten, griff Ando nach der Einführung in die Astrologie 
und blätterte darin. »Wahrsagerei... du bist doch kein Mädchen!« 
»Sei  nicht  so  arrogant.  Da  ist  schon  was  Wahres  dran.  Nun  sag 
schon, wie sind deine Geburtsdaten?« 
Ando  zog  entnervt  einen  Stuhl  unter  dem  Tisch  hervor  und 
plumpste darauf. Das Buch fiel vom Tisch. 
»Nun  beruhige  dich.  Was  ist  denn  mit  dir  los?«  Miyashita  bückte 
sich seufzend und hob das Buch auf. 
Ando  kümmerte  sich  nicht  weiter  darum.  »Was  ist,  hast  du  etwas 
herausfinden können?«, fragte er ungeduldig. 
»Ich  habe  mich  bei  mehreren  gerichtsmedizinischen  Instituten 
erkundigt,  ob  sie  einen  ähnlichen  Fall  hatten,  das  heißt  eine  Leiche 
mit derselben Todesursache wie Ryuji. Ich sage dir, wir kommen der 
Sache allmählich näher.« 
»Spann mich nicht auf die Folter.« 
»Ryuji scheint kein Einzelfall zu sein. Tatsächlich sind in mehreren 
gerichtsmedizinischen Instituten Fälle aufgetaucht. Nach meinen Re‐
cherchen  starben  bisher  mindestens  sechs  Menschen  auf  die  gleiche 
Weise wie Ryuji.« 
»Sechs?«  Ando  wusste  nicht  so  recht,  was  er  von  dieser  Anzahl 
halten sollte — waren das nun viele oder wenige? 
»Ich  sage  dir,  auch  die  Pathologen  von  den  anderen  Instituten 
haben nicht schlecht aus der Wäsche geguckt, als sie hörten, dass es 
mehrere  Fälle  dieser  Art  gab.  Jeder  dachte,  er  wäre  der  Einzige,  bei 
dem eine so merkwürdige Leiche gelandet war.« 
»An  welchen  Universitäten  wurden  die  Obduktionen  durchge‐
führt?« 
Miyashita  streckte  die  Hand  nach  einem  Aktenordner  auf  dem 
Tisch aus. »An der Universität S wurden zwei Leichen obduziert, an 
der  Universität  T  eine  und  an  der  Universität  Y  in  Yokohama  drei; 
macht insgesamt sechs.« 
»Zeig mal.« 
Miyashita reichte Ando den Ordner. 
Erst am Vormittag hatte Miyashita die Unterlagen von den anderen 
Instituten  per  Fax  erhalten.  Es  waren  Kopien  der  Polizeiprotokolle 
und der Autopsieberichte. Ando zog eine Akte nach der anderen aus 
dem Ordner und überflog die wichtigsten Stellen. 
Zunächst sah er sich die Unterlagen an, die ihnen die Universität T 
zur  Verfügung  gestellt  hatte.  Dort  war  eine  männliche  Leiche 
obduziert worden, Alter neunzehn. Der Name war Shuichi Iwata. Im 
Protokoll  stand  als  Todeszeitpunkt  5.  September,  23  Uhr.  Der  junge 
Mann  war  auf  mysteriöse  Weise  an  einer  Kreuzung  vor  dem 
Shinagawa‐Bahnhof  gestorben.  Ohne  ersichtlichen  Grund  war  er 
plötzlich  von  seinem  Motorrad  gestürzt,  allerdings  nicht  während 
der  Fahrt,  sondern  während  er  vor  dem  Bahnhof  an  der  Ampel  ge‐
wartet hatte. Diagnostizierte Todesursache: plötzliches Herzversagen. 
In einem der Herzkranzgefäße hatte sich ein Geschwür gebildet, das 
schließlich  so  groß  geworden  war,  dass  es  die  Herzader  verstopfte. 
Die  natürliche  Folge  war  ein  Herzinfarkt  —  so  stand  es  im 
Autopsiebericht. 
Die  Universität  Y  hatte  nach  eigenen  Angaben  drei  Leichen  obdu‐
ziert, bei denen die Todesursache ähnlich rätselhaft war wie im Falle 
Ryuji.  Darunter  waren  ein  junger  Mann  namens  Takehiko  Nomi, 
neunzehn  Jahre  alt,  und  eine  junge  Frau  namens  Haruko  Tsuji, 
siebzehn  —  ein  Liebespaar.  Beide  waren  exakt  am  selben  Tag,  zur 
selben Uhrzeit und am selben Ort gestorben. Der tragische Todesfall 
hatte  sich  am  6.  September  in  den  frühen  Morgenstunden  ereignet. 
Das junge Paar wurde tot auf den Vordersitzen eines Wagens aufge‐
funden, der am Fuß des Berges Okusu in Yokosuka, Präfektur Kana‐
gawa, abgestellt war. Als die Polizei die Leichen fand, hatte Takehiko 
Nomi Jeans und Unterhose in den Kniekehlen hängen, dem Mädchen 
war der Slip bis zu den Fußgelenken heruntergerutscht. Das Pärchen 
hatte nachts in der Nähe eines Busches geparkt, um ungestört zu sein. 
Während  des  Vorspiels  war  bei  beiden  gleichzeitig  das  Herz 
stehengeblieben.  Die  Diagnose  nach  der  Autopsie  war  erneut 
Herzinfarkt  durch  Verschluss  eines  Herzkranzgefäßes.  Auch  hier 
wurde  ein  Geschwür  entdeckt,  das  sich  an  der  Gefäßwand  gebildet 
hatte und letztlich für den Tod verantwortlich zu sein schien. 
Ando hob den Kopf und starrte an die Decke. Das ist unmöglich. 
»Ein  junges  Paar  in  einem  Auto  ...  Was  meinst  du?«,  fragte 
Miyashita mit zugekniffenen Augen. 
»Hm.  Beide  starben  exakt  zur  gleichen  Zeit  am  gleichen  Ort  an 
Herzversagen ... Zählen wir Shuichi Iwata dazu, haben wir drei junge 
Menschen,  die  ungefähr  zur  selben  Zeit  an  derselben  Ursache 
gestorben sind. Was steckt bloß hinter diesen Todesfällen?« 
»Das ist schon sensationell, dass Todeszeitpunkt und Todesursache 
bei  drei  Menschen  faktisch  identisch  sind.  Hast  du  schon  die  Akten 
der anderen Leichen durchgesehen?« 
Ando blickte Miyashita an. »Nein, noch nicht.« 
»Du  solltest  sie  dir  ansehen.  Es  gab  da  zwei  Fälle,  eine  junge  Frau 
und  ein  kleines  Mädchen,  bei  denen  ebenfalls  ein  Geschwür  an  den 
Schleimhäuten der Kehle entdeckt wurde.« 
Ando durchstöberte hastig die Unterlagen, die von der Universität 
S gefaxt worden waren. Dort hatte man die Leichen einer jungen Frau 
und eines kleinen Kindes obduziert, Mutter und Tochter. Der Name 
der  dreißigjährigen  Frau  war  Shizu  Asakawaka,  die  Tochter  hieß 
Yoko. Sie war gerade mal ein Jahr und vier Monate alt geworden. 
Ando  hielt  einen  Augenblick  inne.  Moment  mal  ...  Hatte  er  den 
Namen Asakawa nicht schon einmal gehört? Aber wo? Es wollte ihm 
nicht einfallen. 
»Was ist?«, fragte Miyashita. 
»Nichts.« 
Ando  las  weiter.  Shizu  Asakawaka  und  ihre  Tochter  Yoko  waren 
bei  einem  Autounfall  am  21.  Oktober  ums  Leben  gekommen.  Das 
Unglück  hatte  sich  auf  der  Autobahn  in  der  Nähe  der  Ausfahrt  Oi 
gegen zwölf Uhr mittags ereignet. Kazuyuki Asakawa, der Ehemann 
und  Vater,  hatte  am  Steuer  gesessen.  Die  Strecke  zwischen  Urayase 
und  Oi  war  bekannt  dafür,  dass  sie  oft  verstopft  war.  Insbesondere 
auf  der  Höhe  des  Tokio‐Bay‐Tunnels  kam  es  häufig  zu  kilometer‐
langen  Staus.  In  einem  kurzen  Moment  der  Unaufmerksamkeit  war 
Asakawa  mit  voller  Geschwindigkeit  auf  einen  LKW  aufgefahren, 
der das Schlusslicht der Autoschlange bildete. Frau und Kind waren 
auf der Stelle tot gewesen. Asakawa hatte Glück im Unglück gehabt 
und war mit dem Leben davongekommen. 
»Ich verstehe nur nicht, warum die Leichen in der Gerichtsmedizin 
gelandet  sind«,  sagte  Ando  gereizt.  Gewöhnlich  wurden  Personen, 
die  bei  einem  Verkehrsunfall  starben,  nicht  intensiver  untersucht. 
Eine  Autopsie  wurde  in  der  Regel  nur  dann  angeordnet,  wenn  ein 
Verdacht auf ein Verbrechen vorlag oder ein Mensch auf eine andere 
nicht natürliche Weise ums Leben gekommen war. 
»Nun  sei  nicht  so  ungeduldig.  Lies  dir  lieber  erst  mal  die  Un‐
terlagen durch.« 
Ando  wurde  nur  noch  wütender.  »Du  hast  gut  reden.  Du  solltest 
dir  mal  ein  neues  Faxgerät  zulegen.  Das  kann  man  ja  kaum  lesen! 
Wirklich  eine  Zumutung!  Man  kriegt  ja  Kopfschmerzen.«  Aufge‐
bracht  wedelte  er  mit  den  gefaxten  Seiten,  die  sich  jeden  Moment 
zusammenzurollen  drohten,  vor  Miyashitas  Nase  herum.  Mühsam 
musste man sich durch jede einzelne Zeile quälen, um einen Sinn zu 
erfassen.  Ando  wollte  aber  auf  der  Stelle  wissen,  was  sich  ereignet 
hatte. Er war mit seiner Geduld am Ende. 
»Du  bist  wirklich  ein  ungeduldiger  Mensch«,  sagte  Miyashita  und 
berichtete dann: »Zunächst dachte man, dass die Frau und das Kind 
an  den  Verletzungen  gestorben  sind,  die  sie  bei  dem  Unfall  erlitten 
haben.  Weitere  Untersuchungen  ergaben  jedoch,  dass  sie  nur  leicht 
verletzt waren. Außer ein paar Schrammen und Kratzern konnte man 
nichts feststellen. Der Wagen hatte zwar Totalschaden, doch wirklich 
in  Mitleidenschaft  gezogen  war  lediglich  der  vordere  Teil.  Da  Frau 
und Tochter hinten saßen, schienen sie von dem Aufprall weitgehend 
verschont  geblieben  zu  sein.  So  ließen  sich  die  relativ  geringfügigen 
inneren  Verletzungen  erklären.  Der  Polizei  kam  die  ganze  Sache 
merkwürdig vor — sie vermutete, dass ein Verbrechen vorlag. Folg‐
lich  wurde  eine  Autopsie  der  Leichen  veranlasst.  Sämtliche  Kratzer 
und Schrammen, die die beiden auf Gesicht und Kopf hatten, wurden 
mit einer speziellen Methode auf den Zeitpunkt ihrer Entstehung hin 
überprüft.  Es  wurde  also  untersucht,  ob  die  Frau  und  das  kleine 
Mädchen noch lebten, als sie sich die Verletzungen zugezogen hatten. 
Was,  meinst  du,  hat  das  Untersuchungsergebnis  ergeben?  Ich  sage 
dir,  jetzt  wird  es  interessant.  Man  hat  herausgefunden,  dass  beide 
bereits  tot  waren,  als  sie  sich  die  Wunden  zugezogen  hatten  ...  So 
sieht es also aus. Das liegt doch in deinem Fachbereich.« 
Ando  konnte  auf  einen  Blick  erkennen,  ob  die  Verletzungen  einer 
Leiche  vor  oder  nach  ihrem  Tod  entstanden  waren,  auch  ohne  die 
Analyse  zur  vitalen  Reaktion  durchzuführen.  Shizu  Asakawaka  und 
ihre  Tochter  waren  bereits  tot,  als  sich  der  Autounfall  ereignete  ...  »Lass 
mich mal nachdenken. Vielleicht wollte der Mann die Leichen seiner 
Frau und seiner Tochter irgendwohin bringen.« 
Miyashita  warf  die  Hände  in  die  Luft,  als  wollte  er  damit  seiner 
Ratlosigkeit Ausdruck verleihen. »Könnte sein.« 
In  einem  solchen  Fall  würde  mit  Gewissheit  eine  Autopsie  an‐
geordnet werden. Tatsächlich war der Ehemann zunächst des Mordes 
verdächtigt worden. Die Theorie lag nahe, dass er einen Doppelmord 
und anschließend Selbstmord geplant hatte. Zuerst erwürgte er Frau 
und Tochter, dann trug er die Leichen in sein Auto. Während er nach 
einem  passenden  Ort  für  den  Selbstmord  suchte,  passierte  der 
Unfall ... Dieser Verdacht hatte sich jedoch durch die Autopsie nicht 
bestätigt.  Shizu  Asakawaka  und  ihre  kleine  Tochter  Yoko  waren  an 
einem  Herzinfarkt  gestorben  und  nicht  ermordet  worden.  Jegliche 
Verdächtigungen gegen den Ehemann waren hinfällig. Daraus folgte, 
dass  Mutter  und  Tochter  während  der  Fahrt  aus  heiterem  Himmel 
einen  Herzanfall  erlitten  hatten.  Der  Unfall  hatte  sich  definitiv 
danach ereignet. 
Man  brauchte  nicht  viel  Vorstellungskraft,  um  zu  verstehen,  dass 
Asakawa  in  dieser  Situation  die  Fassung  verloren  und  einen  Unfall 
verursacht  hatte.  Zunächst  hatte  er  vermutlich  gar  nicht  bemerkt, 
dass seine Frau und seine Tochter tot waren. Er dachte sicherlich, sie 
würden nur ein kurzes Schläfchen machen. Aus irgendeinem Grund 
wollte  er  seine  Frau  dann  wahrscheinlich  wecken.  Als  sie  nicht  rea‐
gierte, streckte er die Hand nach hinten und berührte sie. Spätestens 
in  diesem  Moment  spürte  er,  dass  irgendetwas  nicht  stimmte.  Er 
geriet in Panik und merkte nicht, dass er sich viel zu schnell auf die 
Autoschlange  zubewegte,  die  sich  am  Tokio‐Bay‐Tunnel  gebildet 
hatte.  Dann  prallte  der  Wagen  auch  schon  mit  voller  Wucht  gegen 
den LKW. 
So ungefähr musste es sich abgespielt haben. Ando konnte sich gut 
in  die  Lage  dieses  Mannes  hineinversetzen,  ja  nachempfinden,  wie 
der  Schock  ihn  lähmte,  ihn  erstarren  ließ,  als  er  die  furchtbare  Ent‐
deckung  machte,  dass  seine  Frau  und  seine  Tochter  tot  waren. 
Schließlich hatte Ando seinen Sohn verloren. Wäre er damals nicht in 
Panik  geraten  und  ruhig  geblieben,  hätte  er  Takanori,  den  er  über 
alles geliebt hatte, vielleicht retten können. Im Fall Asakawa spielte es 
keine Rolle, ob er sich unter Kontrolle gehabt hatte oder nicht, denn 
seine Frau und sein Kind waren bereits tot. 
»Was  ist  nach  dem  Unfall  mit  Asakawa  passiert?«  Ando  dachte 
voller  Mitleid  an  die  Zeit  des  Schmerzes  und  die  von  Einsamkeit 
überschattete Zukunft dieses Mannes. 
»Er wurde in ein Krankenhaus eingeliefert.« 
»Weißt du, wie schwer er bei dem Unfall verletzt worden ist?« 
»Physisch  hatte  wohl  auch  er  kaum  Verletzungen.  Die  Wunden 
sind eher psychischer Natur.« 
»Was meinst du damit?« 
»Er  befindet  sich  in  einem  Zustand  vollkommener  Geistesab‐
wesenheit. Liegt reglos im Bett und starrt an die Decke wie ein Koma‐
Patient.«  Selbst  wenn  Asakawa  für  kurze  Zeit  zu  Bewusstsein  kam, 
war er nicht in der Lage, allein zu essen oder zu trinken geschweige 
denn zur Toilette zu gehen. 
»Das  ist  ja  furchtbar.  Der  arme  Mann  ...  Er  kann  einem  wirklich 
Leid tun.« 
Andere  Worte  gab  es  dafür  nicht.  In  Anbetracht  von  Asakawas 
bedauerlichem  Zustand  ließ  sich  erraten,  wie  groß  der  Schock  ge‐
wesen sein musste. Sicherlich hatte er Frau und Tochter sehr geliebt. 
Von  einer  Stunde  auf  die  andere  hatte  ihm  das  Schicksal  alles 
genommen,  was  ihm  im  Leben  etwas  bedeutet  hatte.  Einen  solchen 
Schlag konnte ein Mensch nicht so einfach überwinden. Das brauchte 
Zeit — viel Zeit. 
Ando  nahm  die  Akte  von  Miyashita  entgegen,  leckte  an  Daumen 
und  Zeigefinger  und  blätterte  die  Seiten  durch.  Er  hoffte,  Informa‐
tionen  über  das  Krankenhaus  zu  finden,  in  das  Asakawa  nach  dem 
Unfall eingeliefert worden war. Falls er in einer Klinik lag, in der ein 
mit  Ando  befreundeter  Arzt  arbeitete,  könnte  er  diesen  nach  dem 
Zustand des Patienten fragen. 
Sein  Blick  fiel  zunächst  auf  den  Namen,  Kazuyuki  Asakawa  ... 
»Ah!«, stieß er erstaunt hervor. Das war doch derselbe Name, den er 
vor  zwei  Tagen  in  sein Notizbuch  geschrieben  hatte.  Der  Mann,  der 
einen  Tag  nach  Ryujis  Tod  aufgeregt  in  dessen  Apartment  gestürzt 
war und Mai merkwürdige Fragen über ein Video gestellt hatte! 
»Kennst du ihn?«, fragte Miyashita verwundert. 
»Ja, von Ryuji.« 
»Von Ryuji?« 
»Kazuyuki Asakawa ist ein alter Freund von Ryuji.« 
»Und woher kennst du ihn? Hast du ihn schon mal gesehen?« 
Ando  erzählte  Miyashita,  wie  Mai  Asakawa  begegnet  war,  und 
dass er nach einem Video gefragt hatte. »Das bedeutet nichts Gutes.« 
Ando  brauchte  nicht  zu  erklären,  was  er  damit  meinte.  Mit  Ryuji 
waren  sieben  Menschen  an  derselben  rätselhaften  Todesursache 
gestorben. Allein am 5. September waren vier ums Leben gekommen, 
am  19.  Oktober  ein  weiterer  und  schließlich  am  21.  Oktober  zwei. 
Damit  aber  nicht  genug.  Am  Fuße  des  Okusu‐Berges  waren  zwei 
junge  Menschen  exakt  am  selben  Tag  und  um  dieselbe  Uhrzeit 
gestorben. Ein weiterer tödlicher Vorfall hatte sich an der Autobahn‐
ausfahrt Minami‐Oi ereignet. Eine junge Frau und ihre kleine Tochter 
starben, allerdings nicht etwa an den Folgen des Unfalls, sondern an 
plötzlichem Herzversagen. Der Familienvater war mit Ryuji befreun‐
det gewesen. Alle Personen schienen auf irgendeine Weise miteinan‐
der in Verbindung zu stehen, und bei allen war die gleiche, unerklär‐
liche  Todesursache  ermittelt  worden:  Herzinfarkt  durch  Verschluss 
der  Herzader.  Rätsel  gab  dabei  vor  allem  der  Grund  für  die  Ver‐
stopfung  der  Blutgefäße  auf.  Nicht  wie  üblich  eine  fortgeschrittene 
Arteriosklerose  war  verantwortlich,  sondern  ein  Geschwür,  das  sich 
auf die Gefäßwand gesetzt und somit die Blut‐ und Sauerstoffzufuhr 
zum  Herzen  unterbrochen  hatte.  Folge:  plötzliches  Herzversagen. 
Aber wie konnte man diese mysteriösen Todesfälle erklären? 
Ando  war  geneigt,  einer  wissenschaftlichen  Theorie  Glauben  zu 
schenken.  Vielleicht  steckte  hinter  all  dem  ein  Virus,  das  zu  derarti‐
gen Herzinfarkten führte. Selbst wenn man bisher noch kein solches 
entdeckt  hatte,  konnte  es  plötzlich  aufgetaucht  sein.  Ja,  zunächst 
würde  er  von  einem  Virus  ausgehen.  Wenn  er  diese  Hypothese 
weiterverfolgte,  konnte  er  annehmen,  dass  dieses  neue  Virus  nicht 
über die Atemwege übertragen wurde, weil die Verstorbenen sich in 
unterschiedlichen  Gegenden  aufgehalten  hatten.  Denkbar  war,  dass 
es auf ähnliche Weise wie der HIV‐Virus übertragen wurde. 
Ando  dachte  an  Mai,  und  Sorgen  verdunkelten  sein  Gesicht.  Mai 
und  Ryuji  waren  ein  Paar  gewesen,  folglich  hatten  sie  auch 
Intimitäten  miteinander  ausgetauscht.  Bei  diesem  Gedanken  wurde 
ihm ganz bang ums Herz. Wie sollte er ihr das alles nur erklären? Zu 
diesem Zeitpunkt konnte er ihr lediglich sagen, dass die Sache etwas 
komplizierter  war  als  zunächst  angenommen.  Aber  würde  sie  ver‐
stehen, wenn er so durch die Blume sprach? 
Ich  sollte  der  Universität  S  einen  Besuch  abstatten,  dachte  er.  Die 
Informationen über die Leichen, die er den Unterlagen hatte entneh‐
men  können,  befriedigten  ihn  nicht.  Er  hoffte,  dass  er  mehr  Details 
erfahren würde, wenn er persönlich mit dem Pathologen sprach, der 
die Autopsien von Shizu Asakawaka und ihrer Tochter Yoko durch‐
geführt  hatte.  Kurz  entschlossen  nahm  er  den  Telefonhörer  in  die 
Hand und rief beim Gerichtsmedizinischen Institut der Universität S 
an, um einen Termin zu vereinbaren. 
 

 
Ando  machte  sich  auf  den  Weg  zur  medizinischen  Fakultät  der 
Universität S im Bezirk Ota. Am liebsten wäre er noch am selben Tag 
vorbeigekommen, an dem er angerufen hatte, einem Freitag. Aber die 
sanfte  Stimme  am  Telefon  hatte  ihn  auf  Montag  vertröstet.  »Bitte 
gedulden Sie sich bis Anfang der nächsten Woche, dann nimmt sich 
jemand  Zeit  für  Sie«,  hatte  der  Mann  gesagt.  Da  es  nicht  um  Mord 
ging und der Grund für das gewünschte Gespräch Andos persönliche 
Wissbegierde war, musste er natürlich warten, bis es zeitlich passte. 
Er  klopfte  an  die  Tür  des  Gerichtsmedizinischen  Instituts,  wartete 
eine Weile, doch aus dem Raum waren weder Stimmen noch Schritte 
zu  hören.  Es  war  mucksmäuschenstill.  Ando  blickte  auf  seine  Arm‐
banduhr; er war zehn Minuten zu früh. Sie hatten am Telefon Punkt 
13  Uhr  vereinbart.  Im  Vergleich  zur  Chirurgie  oder  der  Inneren 
Abteilung war die Gerichtsmedizin mit nur wenig Personal bestückt. 
Die drei oder vier Angestellten waren vermutlich gerade beim Essen. 
Während  Ando  überlegte,  wie  er  die  verbleibenden  zehn  Minuten 
totschlagen  könnte,  sprach  ihn  von  hinten  ein  Mann  an.  »Kann  ich 
Ihnen helfen?« 
Ando  drehte  sich  um.  Ein  junger,  relativ  klein  gewachsener  Mann 
stand vor ihm. Er trug eine randlose Brille. Für einen Dozenten vom 
Gerichtsmedizinischen  Institut  sah  er  zwar  zu  jung  aus,  aber  Ando 
erinnerte sich an die hohe Stimme. Rasch zog er eine Visitenkarte aus 
der Tasche, stellte sich vor und nannte das Anliegen seines Besuches. 
Der  junge  Mann  begrüßte  ihn  freundlich  und  überreichte  ihm 
ebenfalls seine Visitenkarte. Es war in der Tat die gleiche Person, mit 
der er am Freitag telefoniert hatte. Auf der Visitenkarte stand: Kazu‐
yoshi Kurahashi, Dozent am Gerichtsmedizinischen Institut der Uni‐
versität S. Ando schloss aus seiner Position, dass Kurahashi ungefähr 
in  seinem  Alter  sein  musste.  Würde  er  allerdings  behaupten,  er  sei 
Ende  zwanzig,  dann  würde  man  ihm  das  auch  abnehmen  —  Kura‐
hashi sah sehr jung aus. Um nicht wie ein Student zu wirken, sprach 
er  mit  vorgestreckter  Brust.  Das  verlieh  ihm  einen  Hauch  von 
Autorität, und er wirkte dadurch erwachsener. 
»Bitte, treten Sie ein.« 
Kurahashi  bat  Ando  mit  einer  höflichen  Geste  in  sein  Büro.  Die 
Unterlagen,  die  das  Institut  an  Miyashita  gefaxt  hatte,  kannte  Ando 
in‐  und  auswendig.  Von  seinem  Besuch  erhoffte  er  sich,  vor  allem 
etwas über die Meinung des Pathologen zu erfahren, der die beiden 
Leichen  seziert  hatte.  Vielleicht  gelang  es  ihm  sogar,  einen  Blick  auf 
die Gewebeproben zu werfen. 
Nachdem  Ando  und  Kurahashi  die  üblichen  Höflichkeitsfloskeln 
ausgetauscht  hatten,  kamen  sie  zu  den  mysteriösen  Todesfällen.  Sie 
besprachen  die  Ergebnisse  der  Autopsien  und  ihre  persönlichen 
Eindrücke.  Kurahashi  schien  der  Schock  noch  in  den  Knochen  zu 
sitzen.  Noch  nie  in  seiner  beruflichen  Laufbahn  hatte  er  so  merk‐
würdige  Leichen  zu  Gesicht  bekommen.  Auch  hatte  er  zum  ersten 
Mal  die  Todesursache  Herzinfarkt  infolge  eines  Gefäßverschlusses 
der Herzkranzarterie, verursacht durch ein Geschwür, diagnostiziert. 
Seine anfängliche Ruhe und Gelassenheit waren wie weggeblasen, als 
sie  näher  auf  das  Thema  eingingen.  Er  wurde  nervös,  und  seine 
Stimme zitterte. 
»Möchten Sie sich die Gewebeprobe ansehen?« Kurahashi stand auf 
und holte die Probe. 
Ando  nahm  sie,  betrachtete  sie  zunächst  mit  bloßem  Auge  und 
legte  sie  anschließend  unter  das  Mikroskop.  Was  er  sah,  war  un‐
glaublich.  Die  Zellen  wiesen  exakt  die  gleichen  Veränderungen  wie 
die  von  Ryuji  Takayama  auf.  Das  Gewebe  war  nach  der  gängigen 
Methode  gefärbt  worden,  das  Zytoplasma  rötlich  und  der  Zellkern 
bläulich.  So  waren  die  Veränderungen  der  Zellen  leichter  zu  erken‐
nen. Verglichen mit gesunden Zellen unterschieden sich diese in ihrer 
Form,  auch  fiel  der  extrem  vergrößerte  Zellkern  ins  Auge.  Gesunde 
Zellen  wiesen  zudem  eine  durchgehend  rötliche,  beschädigte  hinge‐
gen  eine  bläuliche  Färbung  auf.  Was  in  Gottes  Namen  hatte  diese 
extreme  Zellveränderung  bewirkt?  Ando  war  klar:  Dieses  Rätsel  zu 
lösen würde bedeutend schwieriger werden, als einen Verbrecher zu 
stellen. 
Er blickte kurz auf und holte tief Luft. Je länger er die Gewebeprobe 
betrachtete, desto schwerer fiel ihm das Atmen. Es war, als hätte ihm 
jemand eine Schlinge um den Hals gelegt und würde sie nun langsam 
zuziehen. »Wessen Zellen sind das?« 
Nach den Unterlagen, die Miyashita ihm gezeigt hatte, waren zwei 
Leichen  an  diesem  Institut  obduziert  worden:  Asakawas  Frau  und 
Tochter. 
»Die  von  Shizu  Asakawaka«,  erwiderte  Kurahashi,  der  vor  einem 
Regal stand und sich an irgendwelchen Ordnern zu schaffen machte. 
Er  schien  etwas  Bestimmtes  zu  suchen.  Verwundert  neigte  er  den 
Kopf. 
Ando sah wieder durch das Mikroskop. Das sind also die Zellen von 
Asakawas  Frau.  Er  versuchte,  sich  vorzustellen,  was  mit  dem  Körper 
der Frau passiert war. Der Unfall hatte sich am Mittag des 21. Okto‐
ber,  einem  Sonntag,  ereignet.  Dem  Autopsiebericht  zufolge  waren 
Frau  und  Kind  bereits  eine  Stunde  tot  gewesen,  als  Asakawa  mit 
seinem  Wagen  auf  den  LKW  geprallt  war.  Das  bedeutete,  dass  die 
Todeszeit  zirka  11  Uhr  vormittags  gewesen  sein  musste.  Mysteriös 
war nur, dass beide an exakt derselben Krankheit gestorben waren. 
Das Geschwür war zwar im Vergleich zur Größe des menschlichen 
Körpers  winzig,  aber  es  schien  rasant  zu  wachsen,  bis  es  schließlich 
so groß war, dass keine ausreichende Blut‐ und Sauerstoffzufuhr zum 
Herzen mehr stattfand. Dies hatte einen Herzstillstand zur Folge. Das 
war die einzige Erklärung, die einen Sinn ergab. 
Das  Geschwür  hatte  zwei  Menschenleben  zur  gleichen  Zeit 
ausgelöscht. Deshalb konnte man ausschließen, dass es sich langsam 
entwickelte. Selbst wenn Shizu Asakawaka und Yoko sich zur selben 
Zeit mit dem Virus infiziert hatten, war die Wahrscheinlichkeit, dass 
sie exakt im selben Moment starben, gleich null. Krankheiten verlie‐
fen je nach Person unterschiedlich. Zwischen Mutter und Tochter lag 
ein Altersunterschied von knapp dreißig Jahren. Allein das bedingte 
unterschiedliche Krankheitsverläufe. 
Vielleicht  ist  ja  alles  auch  nur  purer  Zufall  ...  Doch  Andos  innere 
Stimme  sagte:  Nein,  ausgeschlossen.  Es  gab  ja  auch  noch  das  junge 
Paar,  das  an  der  Universität  Y  obduziert  worden  war.  Beide  waren 
ebenfalls  am  selben  Tag,  zur  selben  Uhrzeit  und  am  selben  Ort 
gestorben. Wenn das kein Zufall war, gab es nur eine Erklärung: Die 
Zeit zwischen Ansteckung und Tod musste kurz sein. 
Damit war die Theorie von einem tödlichen Virus aber noch lange 
nicht bestätigt. Es gab bisher keinerlei Hinweise, die die Schlussfolge‐
rung  nahelegten,  dass  hinter  diesen  unerklärlichen,  merkwürdigen 
Todesfällen  wirklich  ein  Virus  steckte.  Ando  warf  seine  These  für 
einen Augenblick über Bord und überlegte, ob nicht eine Nahrungs‐
mittelvergiftung die Ursache gewesen sein könnte. Bei Nahrungsmit‐
telvergiftungen  wiesen  die  betroffenen  Personen  erfahrungsgemäß 
dieselben  Krankheitssymptome  auf.  Das  würde  zumindest  erklären, 
warum alle Verstorbenen dieses Geschwür gehabt hatten. 
Doch  es  gab  verschiedene  Arten  von  Nahrungsmittelvergiftung. 
Man  musste  zwischen  einer  chemischen  und  einer  Bakterienver‐
giftung differenzieren. Bisher war noch kein Fall bekannt geworden, 
bei dem sich aufgrund einer chemischen Vergiftung ein Geschwür in 
den  Blutgefäßen  gebildet  hatte.  Und  was  war  mit  entschlüpften 
Krankheitserregern,  die  für  die  Entwicklung  biologischer  Waffen 
unter strengster Geheimhaltung in irgendeinem Forschungslabor ge‐
züchtet worden waren und jetzt womöglich ihr Unwesen trieben? 
Ando löste den Blick von den Zellen und hob erschöpft den Kopf. 
Welche Möglichkeit er auch in Betracht zog, im Augenblick entspran‐
gen alle nur seiner Fantasie. Es gab keine Beweise. Und so, wie es mo‐
mentan aussah, würde sich das auch nicht ändern. 
Kurahashi  ging  mit  einer  Akte  in  der  Hand  zu  Ando,  der  sich 
inzwischen am Tisch niedergelassen hatte, und setzte sich neben ihn. 
Er  zog  ein  paar  Fotos  hervor  und  legte  sie  vor  Ando  auf  den  Tisch. 
»Das sind Fotos vom Unfallort. Vielleicht möchten Sie ja einen Blick 
darauf werfen.« 
Ando  sah  desinteressiert  auf  die  Fotos,  die  vor  ihm  lagen.  Er 
glaubte  nicht,  dass  sie  ihn  der  Lösung  näherbringen  würden.  Sie 
bewegten sich in der Welt der Zellen, was sollten da Fotos von einem 
Unfall  zur  Aufklärung  der  mysteriösen  Todesfälle  beitragen?  Trotz‐
dem  wollte  er  die  Fotos  nicht  einfach  beiseite  schieben.  Schließlich 
hatte  Kurahashi  sie  extra  herausgesucht.  Also  nahm  Ando  ein  Foto 
nach dem anderen in die Hand und schaute sie sich gleichgültig an. 
Das  erste  zeigte  das  stark  beschädigte  Auto.  Die  Motorhaube 
bäumte  sich  wie  ein  Berg  auf,  Stoßstange  und  Scheinwerfer  waren 
eingedrückt, die Frontscheibe vollkommen zertrümmert. Glassplitter 
funkelten  im  Licht  der  Mittagssonne.  Das  Armaturenbrett  schien 
allerdings  unversehrt  zu  sein.  Daraus  ließ  sich  folgern,  dass  die 
hintere  Hälfte  des  Wagens  von  dem  Aufprall  weitgehend  verschont 
geblieben war. 
Auf dem zweiten Foto war die Straße zu sehen. Nirgends erkannte 
man  schwarze  Bremsspuren  auf  der  trockenen  Fahrbahn.  Asakawa 
musste  mit  voller  Geschwindigkeit  in  das  Stauende  gerast  sein. 
Offensichtlich  hatte  er  nicht  auf  die  Fahrbahn  geschaut.  Aber  wo  hat 
Asakawa hingesehen, wenn nicht auf die Straße? Vermutlich hatte er sich 
nach  hinten  gedreht,  nachdem  er  den  kalten  und  steifen  Körper 
seiner Frau berührt hatte. 
Ando streckte die Hand nach den nächsten drei Fotos aus und legte 
sie nacheinander auf den Tisch. Kein Bild hatte bisher seine Aufmerk‐
samkeit erregt. Doch beim nächsten hielt er inne. Das Foto zeigte den 
Innenraum des Wagens. Es war durch das Fenster auf der Fahrerseite 
aufgenommen  worden,  und  man  sah  den  vorderen  Bereich  des 
Autos.  Der  Gurt  über  dem  Fahrersitz  hing  verdreht  nach  unten,  die 
Lehne des Beifahrersitzes war vorgeklappt. Dieses Bild machte Ando 
aus irgendeinem Grund neugierig. Er wusste nur nicht, warum. 
Plötzlich wurden seine Hände feucht, Schweißperlen traten ihm auf 
die  Stirn.  Instinktiv  fühlte  er,  dass  ihm  dieses  Foto  etwas  mitteilen 
wollte. Er hielt es dichter ans Gesicht, so dass er es fast mit der Nase 
berührte.  Jedes  kleinste  Detail  nahm  er  in  Augenschein.  Da!  Ein 
kleiner  schwarzer  Fleck.  Dieser  Fleck  hatte  ihn  daran  gehindert,  das 
Foto aus der Hand zu legen. 
Er wusste, dass er etwas Wichtiges entdeckt hatte. 
Zwischen Sitz und vorgeklappter Lehne klemmte etwas Schwarzes. 
Und  auf  der  Fußmatte  unter  dem  Beifahrersitz  lag  ebenfalls  ein 
flacher schwarzer Gegenstand. 
Ando wandte sich Kurahashi zu. »Schauen Sie sich das bitte mal an. 
Was könnte es Ihrer Meinung nach  sein?« Er legte das Foto auf den 
Tisch und zeigte auf die entsprechende Stelle. 
Kurahashi  setzte  seine  Brille  ab  und  beugte  sich  über  das  Bild. 
Dabei schüttelte er leicht den Kopf, allerdings nicht, um Ratlosigkeit 
zu  signalisieren.  Ihn  schien  vielmehr  zu  verwundern,  dass  Ando 
diese zwei kleinen schwarzen Flecke so faszinierten. »Wieso, was ist 
damit?«, entgegnete er, ohne den Blick von dem Foto abzuwenden. 
»In  meinen  Augen  sieht  das  nach  einem  Videorekorder  aus.  Was 
meinen Sie?« 
»Ja, könnte durchaus ein Videorekorder sein«, bestätigte Kurahashi 
und gab Ando das Foto zurück. 
Wäre  es  ein  glatter  rechteckiger  Gegenstand  gewesen,  hätte  man 
ihn  für  eine  Pralinenschachtel  halten  können.  Aber  bei  genauer 
Betrachtung ließ sich an der linken Vorderseite eine Taste ausmachen. 
Damit  hatte  sich  die  Pralinenschachtel  erledigt.  Es  konnte  nur  ein 
Videorekorder,  Tuner,  Verstärker  oder  etwas  Derartiges  sein.  Doch 
Ando  war  sicher:  Es  war  ein  Videorekorder.  Immerhin  hatte 
Asakawa Mai nach einer Videokassette gefragt. 
Das  schwarze  Ding  auf  der  Fußmatte  unter  dem  Beifahrersitz  war 
dem Design nach ein Laptop. Zog man Asakawas Beruf — Journalist 
—  in  Betracht,  war  es  nicht  sonderlich  merkwürdig,  dass  er  einen 
Laptop bei sich hatte. Mit dem Videorekorder sah es anders aus. 
»Warum  hatte  er  wohl  einen  Videorekorder  bei  sich?«  Wenn  das 
Gerät defekt gewesen war, warum hatte er es dann auf die Autobahn 
mitgenommen?  Asakawa  hätte  den  Videorekorder  ins  Elektronik‐
geschäft nebenan zur Reparatur geben können. Das ergibt alles keinen 
Sinn. Ando ließ die Frage nicht los, wohin Asakawa mit dem Video‐
gerät  wollte,  und  vor  allem:  zu  welchem  Zweck.  Ohne  besonderen 
Grund fuhr man wohl kaum mit einem Rekorder im Auto herum. 
Nun  betrachtete  er  die  restlichen  Fotos.  Auf  einem  Bild  war  das  
Nummernschild des Wagens zu erkennen. Er zog sein Notizbuch aus 
der Tasche und schrieb das Kennzeichen auf: Shinagawa wa 5287. 
Das  ›Wa‹  verriet,  dass  es  sich  um  einen  Mietwagen  handelte. 
Asakawa hatte also eigens ein Auto gemietet, um den Videorekorder 
zu  transportieren.  Aber  warum?  Ando  versuchte,  sich  in  die  Lage 
Asakawas  zu  versetzen,  und  überlegte:  Wenn  ich  einen  Videorekorder 
im Auto transportieren würde, warum würde ich das wohl tun? 
Ah, ich habʹs! Natürlich, um eine Kopie zu ziehen! 
Ein anderer Grund fiel  Ando spontan nicht ein. Er reimte sich das 
Ganze  so  zusammen:  Asakawa  erhielt  einen  Anruf  von  einem 
Freund, der außerhalb der Stadt wohnte. Dieser erzählte ihm, dass er 
auf  einen  tollen  Videostreifen  gestoßen  sei,  der  ihn  zutiefst  beein‐
druckt  habe  und  den  er  Asakawa  gern  überspielen  würde.  Das 
Problem  war  nur,  dass  er  keinen  zweiten  Rekorder  besaß,  um  eine 
Kopie  zu  machen.  Deshalb  vereinbarten  die  beiden,  dass  Asakawa 
seinen Videorekorder mitbrachte. 
Aber selbst wenn es sich in etwa so abgespielt hätte ... Ando kratzte 
sich  ratlos  am  Kopf.  Wenn  ich  nur  wüsste,  welcher  Zusammenhang 
zwischen dem Video und den rätselhaften Todesfällen besteht. 
Mit  Logik  allein  ließ  sich  dieser  Fall  nicht  lösen,  so  viel  stand  fest. 
Wenn ich dieses Video oder den Rekorder irgendwie in die Fingerbekommen 
könnte ... Das würde mich vielleicht weiterbringen. 
Plötzlich  hatte  er  eine  Idee.  Im  Grunde  müsste  er  nur  das  zustän‐
dige  Polizeirevier  ausfindig  machen,  das  den  Unfall  auf  der  Auto‐
bahn in Höhe der Ausfahrt Oi bearbeitet hatte. Das demolierte Fahr‐
zeug  war  dort  mit  Sicherheit  kurzfristig  in  Verwahrung  genommen 
worden.  Da  sich  der  Videorekorder  zum  Zeitpunkt  des  Unfalls  im 
Auto  befunden hatte, würde er  ihn dort auch finden — und mit ein 
bisschen  Glück  vielleicht  sogar  die  mysteriöse  Kassette.  Zwei  der 
Autoinsassen  waren  tot,  Asakawa  lag  im  Krankenhaus.  Wenn  kein 
anderer  den  Rekorder  aus  dem  Wagen  genommen  hatte,  müsste  er 
noch dort sein. 
Glücklicherweise  kannte  Ando  durch  seine  Tätigkeit  in  der  Ge‐
richtsmedizin  viele  Polizisten.  Wenn  er  seine  Beziehungen  spielen 
ließ, kam er vielleicht an den Videorekorder heran. 
Doch zuvor wollte er eine andere Person aufsuchen: Kazuyuki Asa‐
kawa. Es wäre natürlich der einfachste und effektivste Weg, von ihm 
selbst zu erfahren, worum es bei dem Ganzen ging — vorausgesetzt, 
er  war  in  der  Lage,  Auskunft  zu  erteilen.  Aus  den  Unterlagen  ging 
hervor,  dass  sich  Asakawa  in  einer  relativ  schlechten  Verfassung 
befand.  Ando  hoffte  inständig,  dass  sein  Zustand  inzwischen  etwas 
stabiler  und  dass  er  bei  Bewusstsein  war.  Immerhin  hatte  sich  der 
Unfall bereits vor zehn Tagen ereignet. 
Ando  wurde  plötzlich  von  Ungeduld  gepackt.  Wenn  es  möglich 
war,  würde  er  Asakawa  noch  heute  im  Krankenhaus  besuchen. 
»Wissen  Sie,  in  welches  Krankenhaus  Asakawa  gebracht  wurde?«, 
erkundigte er sich bei Kurahashi. 
»Soviel  ich  weiß,  ist  er  im  Shinagawa‐Saisei‐Krankenhaus«,  gab 
Kurahashi  zurück,  vergewisserte  sich  aber  noch  einmal  in  seinen 
Unterlagen. »Ja, ich hatte es richtig in Erinnerung. Aber Sie wissen, er 
ist geistig verwirrt.« 
»Ich werde es trotzdem versuchen. Vielleicht hat sich sein Zustand 
inzwischen ja gebessert«. 
 

 
Ando  hatte  den  Kopf  an  die  Fensterscheibe  des  Taxis  gelegt  und 
döste.  Plötzlich  verlor  er  den  Halt  und  stieß  gegen  den  Fahrersitz. 
Gleichzeitig drang aus der Ferne das Aufheulen von Sirenen an sein 
Ohr.  Reflexartig  blickte  er  auf  die  Uhr:  14.10  Uhr.  Seit  etwa  zehn 
Minuten  saß  er  in  dem  Taxi.  Folglich  konnte  er  höchstens  zwei  bis 
drei Minuten geschlummert haben. Aber er hatte das Gefühl, als wäre 
sehr  viel  Zeit  vergangen,  ja  als  wäre  es  schon  Tage  her,  seit  er  die 
Gerichtsmedizin  der  Universität  aufgesucht  und  sich  mit  Kurahashi 
unterhalten  hatte.  Sein  Tagtraum  hatte  ihn  offensichtlich  aus  der 
Realität entfernt, bis ihn das Sirenengeheul wachrüttelte. 
Das  Taxi  hatte  sich  in  der  Zwischenzeit  keinen  Zentimeter  wei‐
terbewegt.  Sie  standen  nach  wie  vor  auf  der  äußeren  Fahrbahn. 
Gewöhnlich ging es auf dieser Spur recht zügig voran, heute jedoch 
nicht.  Ando  beugte  sich  ungeduldig  nach  vorne,  um  zu  sehen,  was 
los war. Ein Blick durch die Windschutzscheibe machte deutlich, was 
sie am Weiterfahren hinderte: Die Bahnschranken waren geschlossen, 
und  die  Warnblinkanlage  leuchtete.  Andos  Ziel,  das  Shinagawa‐
Saisei‐Krankenhaus,  lag  auf  der  anderen  Seite  des  Bahnüberganges. 
Der  Zug  nach  Shinagawa  war  zwar  bereits  durchgefahren,  doch  die 
Schranken  blieben  geschlossen.  Ein  Pfeil  in  die  entgegengesetzte 
Richtung signalisierte, dass sie auf einen weiteren Zug warten muss‐
ten.  Ando  verließ  jede  Hoffnung  auf  ein  schnelles  Weiterkommen. 
Der  Taxifahrer  schrieb  mit  einem  deutlich  vernehmbaren  Kratzen 
etwas in ein Notizbuch. Auch er schien nicht davon auszugehen, dass 
sie den Bahnübergang bald passieren würden. 
Es  besteht  kein  Grund  zur  Eile.  Mir  bleibt  genügend  Zeit  bis  zum  Ende 
der Besuchszeit um 17 Uhr. 
Ando lehnte sich zurück und hing wieder seinen Tagträumen nach. 
Doch nur kurz, dann schoss er wie vom Blitz getroffen erneut hoch. 
Er  spürte  bohrende  Blicke  im  Rücken.  Die  Augen,  die  ihn  fixierten, 
mussten ganz in seiner Nähe sein. Ando fühlte sich wie eine Gewebe‐
probe,  die,  zwischen  zwei  Glasplättchen  eingebettet,  durchs  Mikro‐
skop angestarrt wurde, machtlos, sich den Blicken zu entziehen. Das 
Augenpaar  durchbohrte  ihn  wie  das  eines  Forschers.  Nervös  blickte 
er  sich  um.  Vielleicht  saß  in  einem  Auto  hinter  ihnen  ein  Bekannter 
oder  Freund?  Doch  außer  ihnen  war  weit  und  breit  kein  anderes 
Fahrzeug  auf  der  Straße  zu  entdecken,  selbst  auf  dem  Fußweg  war 
kein Mensch. Sicher täusche ich mich, dachte Ando. Aber die Intensität 
des Blickes ließ nicht nach. Sie lösten körperliches Unbehagen in ihm 
aus.  Irgendjemand  beobachtete  ihn.  Doch  wer?  Andos  Augen  irrten 
nach rechts und links, dann nach vorne und hinten. Beim Blick durch 
die Heckscheibe fiel ihm ein kleiner Grashügel ins Auge. Da bewegte 
sich doch etwas im Gras! Sekundenlang regte sich nichts mehr. Dann 
rührte  es  sich  wieder,  erstarrte  erneut...  Vielleicht  ein  kleines  Tier?  Es 
fixierte  Ando  unentwegt,  ohne  auch  nur  für  den  Bruchteil  einer  Se‐
kunde den Blick von ihm zu lassen. Wieder eine langsame Bewegung 
in  der  gleißenden  Herbstsonne  ...  Das  Wesen  blitzte  ihn  mit 
schmalen, funkelnden Augen an. Siehe da, eine Schlange, die ihn aus 
der Ferne anstarrte. 
Vor  Andos  geistigem  Auge  tauchten  Bilder  aus  seiner  Jugend  auf. 
Es  war  an  einem  ruhigen,  warmen  Frühlingsnachmittag  gewesen. 
Auf dem Nachhauseweg von der Schule entdeckte Ando eine kleine 
graue  Schlange.  Sie  lag  wie  ein  dünner,  langer  Faden  auf  der 
niedrigen Mauer, die den Fluss begrenzte. Zuerst dachte er, es wäre 
ein Mauerriss, aber dann sah er, dass es eine Schlange war. Sie rollte 
sich  gerade  zusammen.  Ando  hob  einen  Stein  auf,  ließ  ihn  ein  paar 
Mal  in  die  Luft  fliegen,  um  Größe  und  Gewicht  abzuschätzen,  und 
schleuderte ihn dann über den Fluss. Bis zum Ruheplatz der Schlange 
waren es mehrere Meter. Ando hatte keinen Moment lang geglaubt, 
dass er die Schlange aus dieser Entfernung treffen könnte. Doch der 
Stein flog direkt auf sie zu und zermalmte ihr den Kopf. Ando schrie 
laut auf. Er fühlte sich, als hätte er mit bloßen Händen brutal auf den 
Schlangenkopf  eingeschlagen.  Rasch  rieb  er  sich  die  Hände  an  der 
Hose ab. Alle Kraft war aus dem Körper der Schlange gewichen, und 
sie fiel leblos in den Fluss. 
Ando  rannte  zum  Ufer  hinunter,  blieb  an  einem  Grashügel  stehen 
und  beobachtete,  wie  die  kleine,  tote  Schlange  von  der  Strömung 
weggerissen  wurde.  Irgendwer  oder  irgendetwas  beobachtete  ihn, 
durchfuhr es ihn plötzlich. Es waren intensive, bohrende Blicke. Die 
Augen der toten Schlange konnten es nicht sein. Es war viel schlim‐
mer.  Eine  wesentlich  größere  Schlange  lauerte  hinter  ihm  im  Gras 
und  fixierte  ihn.  Ein  flaches  Gesicht  ohne  jeglichen  Ausdruck  mit 
dunklen,  böse  funkelnden  Augen  blitzte  ihn  gefährlich  an.  Ihr  Blick 
ließ  nicht  eine  Sekunde  von  Ando  ab.  Panische  Angst  ergriff  ihn.  O 
Gott,  vielleicht  war  es  die  Mutter  der  kleinen  Schlange,  die  er  auf 
dem Gewissen hatte! In diesem Fall würde ihm Unheil drohen, davon 
war  Ando  überzeugt.  Vielleicht  würde  ihn  die  Schlange  mit  einem 
Fluch  belegen,  so  intensiv  war  ihr  Blick.  Worte  seiner  Großmutter 
schossen  ihm  durch  den  Kopf:  Wenn  du  eine  Schlange  tötest,  wirst  du 
dafür  bestraft.  Ando  bereute  seine  Tat  zutiefst  und  rechtfertigte  sich 
mit der Entschuldigung, dass es keine Absicht gewesen sei. 
Kaum  zu  glauben,  dass  dieses  Ereignis  zwanzig  Jahre  her  war, 
erschien es ihm doch wie ein Spuk von gestern. Dass Schlangen einen 
Menschen  verfluchen  konnten,  war  sicher  nur  Aberglaube.  Doch 
irgendetwas warnte ihn: Ando, gib Acht! 
Er beschloss, nicht weiter darüber nachzusinnen, sondern an etwas 
Schönes  zu  denken.  Doch  vor  seinem  inneren  Auge  zogen  wieder 
und  wieder  die  Bilder  von  der  jungen,  toten  Schlange  vorüber,  die 
mit dem weißen Bauch nach oben stromabwärts getrieben wurde. Die 
trauernde  Mutter  holte  ihr  Kind  ein,  umschlang  es,  und  die  beiden 
glitten wie zwei ineinander verwobene Fäden den Fluss hinunter. 
Der Fluch der Schlange ...er hat mich heimgesucht. 
Wider  alle  Vernunft  verstärkte  sich  in  Ando  das  Gefühl,  dass  sein 
persönliches  Unglück  mit  diesem  Ereignis  zusammenhing.  Erneut 
sah er die Szene vor sich. Die beiden ineinander verschlungenen Rep‐
tilien glichen der DNA im Zellkern, die die Erbinformation über meh‐
rere  Generationen  weitergab  ...  Vor  diesen  zwei  in  sich  verwobenen 
Schlangen konnte man nicht fliehen. 
Auch Ando hatte seine DNA auf seinen Sohn übertragen. 
Takanori... 
Die Stimme, die seinen Sohn rief, klang niedergeschlagen. Reiß dich 
zusammen,  Ando,  mahnte  er  sich.  Er  musste  vermeiden,  in  ein  noch 
tieferes  Loch  zu  fallen.  Mach  endlich  Schluss  mit  diesen  Gedanken! 
Er  blickte  nach  draußen.  Ein  roter  Zug  kroch  langsam  wie  eine 
kriechende  Schlange  über  die  Gleise  heran.  Jetzt  hatte  er  schon 
wieder  an  dieses  Ereignis  gedacht  ...  Es  war  nicht  zu  fassen;  seine 
Gedanken kreisten unaufhörlich um diese Begebenheit. Er schloss die 
Augen und versuchte, an ein erfreulicheres Thema zu denken. 
Sie  waren  ans  Meer  gefahren.  Während  Ando  gedankenverloren 
am  Strand  stand,  überspülte  ihn  plötzlich  eine  große  Welle  und  riss 
ihn  in  die  Tiefe  ...  Eine  kleine  tastende  Hand  griff  nach  seinem 
Fußgelenk ... 
Wieder  hatte  ihn  die  Vergangenheit  eingeholt.  Sein  Schicksal  war 
ganz  offensichtlich  von  dem  Fluch  der  Schlange  bestimmt  worden. 
Genau wie sie hatte er sein Kind verloren. Tränen schossen ihm in die 
Augen,  und  er  weinte  lautlos.  Nach  zwanzig  Jahren  hatte  sich  die 
Schlange gerächt... Obwohl sein Sohn so nahe gewesen war, hatte er 
den  kleinen  Körper  nicht  ergreifen  und  aus  dem  Wasser  ziehen 
können ... 
Das  alles  hatte  sich  im  Juni  ereignet,  vor  Beginn  der  Badesaison. 
Der Strand war wie leergefegt. Sein Sohn und er paddelten auf einer 
Luftmatratze  aufs  offene  Meer  hinaus.  Von  weitem  vernahm  Ando 
die besorgte Stimme seiner Frau: Taka‐chan, komm zurück. 
Doch Takanori hörte nicht auf seine Mutter. Es machte ihm viel zu 
viel Spaß, auf der Luftmatratze über die Wellen zu reiten. 
Kommt  auf  der  Stelle  zurück!,  schrie  Andos  Frau  mit  einem  leichten 
Anflug  von  Hysterie.  Da  die  Wellen  sich  inzwischen  ziemlich  hoch 
auftürmten, war auch Ando klar, dass sie schnellstens zurückpaddeln 
mussten.  Während  er  versuchte,  die  Luftmatratze  zu  wenden, 
bäumte  sich  eine  Riesenwelle  vor  ihnen  auf,  erfasste  die  Matratze 
und wirbelte sie herum. Vater und Sohn wurden ins Wasser gerissen. 
Erst  jetzt  begriff  Ando,  wie  weit  sie  vom  rettenden  Ufer  entfernt 
waren.  Selbst  ein  Erwachsener  konnte  an  dieser  Stelle  nicht  mehr 
stehen.  Ando  packte  die  nackte  Angst.  Verzweifelt  suchte  er  nach 
seinem  Sohn,  aber  von  Takanori  war  nichts  zu  sehen.  Aus  dem 
Augenwinkel  sah  Ando  seine  Frau  in  voller  Bekleidung  ins  Wasser 
laufen. Gleichzeitig spürte er, wie eine kleine Hand nach seinem Fuß 
tastete. Bei dem Versuch, sein Kind aus dem Wasser zu ziehen, hatte 
Ando  sich  offenbar  zu  schnell  bewegt.  Die  kleine  Hand  glitt  von 
seinem  Fuß  ab  und  verschwand  im  dunklen  Wasser.  Ando  machte 
sich  furchtbare  Vorwürfe.  Hätte  er  sich  doch  bloß  nicht  so  ruckartig 
bewegt! So konnte er nur noch das Haar seines Sohnes mit der linken 
Hand berühren. 
Die  kreischende  Stimme  seiner  Frau  hallte  über  das  weite  Meer. 
Sein Kind war so nah ... doch Ando gelang es nicht, es mit der Hand 
zu ergreifen. Von Panik getrieben, tauchte er, versuchte, seinen Sohn 
zu retten, aber der kleine Körper sank immer tiefer. 
Er  würde  sein  Kind  nie  wiedersehen.  Takanori  war  für  immer  im 
Meer  begraben.  Nur  ein  paar  Haare,  die  sich  an  Andos  Ehering 
verfangen hatten, waren ihm von seinem kleinen Liebling geblieben. 
Die Schranken öffneten sich. Noch immer liefen Ando Tränen über 
die  Wangen.  Der  Taxifahrer  schien  es  bemerkt  zu  haben,  denn  er 
blickte ab und zu in den Rückspiegel und beobachtete ihn. 
Reiß dich zusammen, Ando! 
Würde er allein in seinem Bett weinen, wäre es ja in Ordnung. Aber 
mitten  am  Tag  in  einem  Taxi  war  es  ihm  peinlich.  Ando  versuchte 
erneut,  seine  Gedanken  in  andere  Bahnen  zu  lenken.  Dabei  fiel  ihm 
das  hübsche  und  glückliche  Gesicht  Mai  Takanos  ein,  während  sie 
gierig  das  Fruchtparfait  verschlang.  Unter  ihrem  zauberhaften  Kleid 
trug  sie  eine  weiße  Bluse,  die  linke  Hand  lag  auf  ihrem  schön 
geformten  Oberschenkel.  Nachdem  sie  sich  den  Mund  sorgfältig 
abgewischt hatte, erhob sie sich ... 
Erst die Erinnerung an Mai löschte die furchtbaren Szenen der Ver‐
gangenheit fürs Erste aus Andos Gehirn. Seit er seinen Sohn verloren 
und sich von seiner Frau getrennt hatte, waren keinerlei romantische 
oder  sexuelle  Gefühle  mehr  in  ihm  aufgekeimt.  Sicherlich  lag  das 
daran, dass er mit seinem Leben irgendwie abgeschlossen hatte. 
Endlich  überquerte  das  Taxi  den  Bahnübergang.  Gleichzeitig  sah 
Ando  den  unbekleideten,  feuchten  Körper  Mais  vor  sich,  der  sich, 
von einem Keuchen begleitet, rhythmisch auf‐ und abbewegte. 
 

 
Mit  der  Odakyu‐Linie  fuhr  Mai  bis  zur  U‐Bahn‐Station  Sagami‐
Ono. Hastig lief sie die Treppen hinauf ins Freie. Aber kaum war sie 
an der Oberfläche angekommen, blieb sie unvermittelt stehen. Ratlos 
schaute sie sich um. Erst vor vierzehn Tagen hatte sie Ryujis Eltern‐
haus  zur  Totenwache  aufgesucht,  doch  jetzt  konnte  sie  sich  nicht 
mehr an den Weg erinnern. Ihr Orientierungssinn ließ sie, wie schon 
so oft in ihrem Leben, im Stich. Inzwischen hatte Mai sich daran ge‐
wöhnt, ihre Ziele nicht auf Anhieb zu finden. Mindestens einmal ver‐
lief  sie  sich  immer.  Trotzdem  ärgerte  sie  sich  über  ihre  Unfähigkeit, 
sich zu orientieren. Zwar konnte sie dieses Mal zu ihrer Verteidigung 
vorbringen, dass es ein gewaltiger Unterschied war, ob man mit dem 
Auto  oder  zu  Fuß  unterwegs  war,  aber  was  nützte  ihr  das?  Damals 
hatte  sie  der  Leichenwagen  mitgenommen.  Heute  war  sie  mit  den 
öffentlichen  Verkehrsmitteln  gekommen  und  musste  noch  ein  Stück 
zu  Fuß  gehen.  Die  Perspektive  war  eben  eine  völlig  andere.  Mai 
beschloss, auf gut Glück loszulaufen. 
Der  erhoffte  Lichtblick  kam  nicht.  Zwar  hätte  ein  Anruf  genügt, 
und Ryujis Mutter wäre gekommen, um sie abholen, aber Mai wollte 
ihr keine Umstände bereiten. Also entschied sie sich, noch ein Stück 
weiter nach Gefühl zu laufen. Sie gab die Hoffnung nicht auf, dass sie 
sich  unterwegs  vielleicht  doch  an  etwas  erinnern  würde.  Schließlich 
war  es  von  der  U‐Bahn‐Station  bis  zu  Ryujis  Elternhaus  nur  ein 
Katzensprung, zehn Gehminuten, mehr auf keinen Fall. 
Während sie die Straße entlanglief, dachte sie plötzlich an Ando. Sie 
waren für diesen Freitag zum Essen verabredet. Mittlerweile bereute 
sie  es,  sich  auf  dieses  Treffen  eingelassen  zu  haben.  Von  der  Hoff‐
nung geleitet, dass die Freundschaft zu Ando ihr über den schmerz‐
lichen Verlust von Ryuji hinweghalf und ihr Zugang zu Ryujis kom‐
plizierter Gedankenwelt verschaffte, hatte sie eingewilligt. Schließlich 
waren  Ryuji  und  Ando  in  jungen  Jahren  befreundet  gewesen.  Wie 
gern  würde  sie  Andos  Worten  lauschen,  wenn  er  Episoden  aus  der 
gemeinsamen Studienzeit erzählte. 
Doch  nun  beschlichen  sie  Zweifel.  Irgendwie  hatte  sie  das  Gefühl, 
sich die Finger verbrannt zu haben. Sie hatte überhaupt nicht darüber 
nachgedacht, welche Gefühle Ando ihr gegenüber hegen könnte. Wie 
stand er zu ihr? Mai befürchtete, dass er vielleicht nur an ihr als Frau 
— also am Sex — ein tiefer gehendes Interesse hatte ... 
Eine  glückliche  Beziehung  baute  zweifellos  auf  Vertrauen,  Liebe 
und  gegenseitigem  Verständnis  auf.  Aber  das  allein  reichte  Mai  bei 
weitem nicht aus. Ein  Mann musste sie intellektuell  inspirieren: Das 
war  der  für  sie  alles  entscheidende  Knackpunkt  in  einer  Beziehung. 
Nur dann flammte auch ihre Leidenschaft auf. Doch Männer ›tickten‹ 
anders.  Ihr  Interesse  beschränkte  sich  in  der  Regel  auf  die  untere 
Körperhälfte  einer  Frau,  alles  andere  —  wie  Esprit  und  Intellekt  — 
schien  ihnen  gleichgültig  zu  sein.  Geriet  die  Beziehung  ernsthaft  in 
Gefahr,  winselten  sie  kleinlaut.  Mai  hatte  die  Nase  voll  von  all  den 
Eintagsfliegen, die völlig aus der Fassung gerieten, wenn man ihnen 
den Laufpass gab. Die seitenlangen Briefe mit Entschuldigungen, das 
Es‐tut‐mir‐Leid‐Gefasel am Telefon — Mai hatte es satt. Die Männer 
begriffen nicht, dass sie das Problem dadurch nur vergrößerten. Ihre 
Entschuldigungen  konnten  sie  sich  sparen.  Für  Mai  war  dieses 
Verhalten  ein  Ausdruck  von  Schwäche.  Sie  hätte  sich  stattdessen 
gewünscht,  dass  ein  Mann  die  Trennung  von  ihr  als  wertvolle 
Erfahrung  begriff,  sein  pubertäres  Verhalten  ablegte  und  endlich 
erwachsen  wurde.  In  einem  solchen  Fall  wäre  sie  sogar  zu  einem 
Neuanfang  bereit  gewesen.  Aber  auf  einen  Mann,  der  mental  nicht 
über  das  Niveau  eines  Kindes  hinausreichte,  konnte  sie  gut  ver‐
zichten. Sie wünschte sich eine psychisch reife Person als Partner. 
Doch es war nicht einfach, einen solchen Menschen zu finden. Nur 
von einem Mann war Mai bislang wirklich fasziniert gewesen: Ryuji 
Takayama. Mit ihm hatte sie bis spät in die Nacht hinein diskutieren 
können. Die vielen geistig anregenden Gespräche waren ihr noch gut 
in  Erinnerung.  Ryuji  hatte  sie  inspiriert.  Würde  sich  ihre  Beziehung 
zu Ando ähnlich entwickeln, spräche aus ihrer Sicht nichts dagegen, 
wenn sie sich ab und zu träfen. Aber sie stand dem Ganzen skeptisch 
gegenüber. Die Wahrscheinlichkeit, einem selbstständigen, psychisch 
starken Mann zu begegnen, war ihrer Erfahrung nach fast null. Und 
Ando schien dem Klischee der nur auf Sexualität fixierten Schwäch‐
linge genau zu entsprechen. 
Abgeneigt war sie dennoch nicht. 
Das hatte auch einen triftigen Grund. Ando war immerhin ein guter 
Freund  von  Ryuji  gewesen.  So  war  ihr  sein  Name  bereits  vor  ihrer 
ersten Begegnung in der Gerichtsmedizin ein Begriff gewesen. Ryuji 
hatte  ihn  in  seinen  Erzählungen  oft  erwähnt;  das  erste  Mal  war  der 
Name  gefallen,  als  sie  sich  über  Genetik  unterhalten  hatten.  Mai 
erinnerte sich noch ziemlich gut an diesen Tag. 
Ryuji hatte ihr den Unterschied zwischen einem Gen und der DNA 
erklärt. Bis dato war sie der Auffassung gewesen, dass es sich dabei 
um dasselbe handelte. Aber er hatte sie eines Besseren belehrt. Bei der 
DNA  handelt  es  sich  um  eine  komplexe  chemische  Struktur;  sie  ist  Träger 
der gesamten genetischen Information. Gene dagegen bezeichnen Abschnitte 
auf der DNA, die jeweils  nur einen Teil der Erbinformation enthalten, das 
heißt  für  eine  bestimmte  Eigenschaft  oder  ein  Merkmal  stehen  —  so  hatte 
Ryuji ihr den Unterschied mit einfachen Worten klar gemacht. 
Damals  hatte  sie  auch  das  erste  Mal  von  der  DNA‐Sequenzierung 
gehört,  einer  Methode,  mit  der  die  Erbinformationen  in  einzelne 
Stücke zerlegt wurden. Das erinnert mich an ein Puzzle, war es aus ihr 
herausgeplatzt. Ja, es ähnelt einem Puzzle, aber auch dem Entziffern eines 
Kodes, hatte Ryuji gesagt. Während meiner  Uni‐Zeit war Kode‐Raten in. 
Zwischen den Vorlesungen haben wir damit immer die Zeit totgeschlagen ... 
Es  war  eine  Clique  von  ungefähr  zehn  Leuten gewesen;  die  meisten 
kamen  aus  dem  Fachbereich  Molekularbiologie.  Die  Spielregeln 
waren einfach. Eine Person musste sich eine Zahlenkombination aus‐
denken,  und  die  anderen  Teilnehmer  hatten  sie  zu  entschlüsseln. 
Derjenige, der innerhalb der gesetzten Frist am schnellsten zu einem 
Ergebnis  kam,  gewann.  Es  war  ein  Spiel,  bei  dem  vor  allem  mathe‐
matisches  Wissen  und  logisches  Denkvermögen  auf  den  Prüfstand 
gestellt  wurden.  Intuition  war  ebenfalls  wichtig.  Viele  der  Medizin‐
studenten hatten an diesem Wettbewerb allerdings weniger aus Spaß 
an  der  Sache  teilgenommen,  sondern  um  mit  ihrer  Intelligenz  zu 
protzen. 
Der  Schwierigkeitsgrad  eines  Kodes  hing  vom  Wissen  der  Person 
ab, die gerade an der Reihe war. Ryuji war phänomenal gut in diesem 
Spiel  gewesen;  nahezu  unschlagbar.  Selbst  wenn  ihn  jemand  mit 
einer extrem schwierigen Zahlenkombination konfrontiert hatte, war 
ihm  die  Entschlüsselung  stets  mit  Leichtigkeit  gelungen.  Für  die 
anderen Teilnehmer hingegen war es fast unmöglich gewesen, Ryujis 
Kodes  erfolgreich  zu  entschlüsseln.  Nur  einer  hatte  es  einmal 
geschafft:  Ando.  Als  hätte  Ando  meine  Gedanken  gelesen,  hatte  Ryuji 
Mai erzählt. 
In  diesem  Zusammenhang  hatte  Mai  das  erste  Mail  den  Namen 
Ando  gehört.  Ihre  Überraschung  war  groß  gewesen,  als  er  plötzlich 
in  der  Gerichtsmedizin  vor  ihr  gestanden  hatte.  Vom  ersten  Augen‐
blick hatte sie ihm vollkommen vertraut. Immerhin war er derjenige, 
der  einen  von  Ryujis  Kodes  entschlüsselt  hatte.  Er  wird  auch  Ryujis 
Tod aufklären ... 
Ernüchtert  konstatierte  Mai  nun,  dass  sie  sich  zu  sehr  von  den 
Worten  eines  Toten  hatte  leiten  lassen.  Sie  bereute  ihre  Dummheit 
und  Naivität.  Hätte  Ryuji  den  Namen  ›Ando‹  doch  nie  in  ihrer 
Gegenwart  erwähnt,  dann  säße  sie  jetzt  nicht  in  der  Patsche  ...  Sie 
hätte ihn nicht angerufen, und erst recht wäre sie nicht mit ihm zum 
Essen verabredet. 
Mai  bog  in  eine  kleine,  verschlungene  Gasse  ein.  Erleichtert  ent‐
deckte sie zwischen den Häusern ein bekanntes Ladenschild. Ab hier 
war  es  nicht  mehr  weit;  da  sie  jetzt  den  Weg  kannte,  ging  sie  etwas 
zügiger. 
Das architektonisch unspektakuläre Haus der Takayamas stand auf 
einem  etwa  dreihundert  Quadratmeter  großen  Grundstück.  Mai 
klingelte.  Ryujis  Mutter  steckte  den  Kopf  aus  der  Tür.  Ihr  Gesichts‐
ausdruck  verriet,  dass  sie  schon  auf  Mai  gewartete  hatte.  Sie  führte 
sie  in  Ryujis  altes  Zimmer,  in  dem  er  bis  zum  Ende  seines  Grund‐
studiums gewohnt hatte. Danach war er in ein kleines Apartment in 
Uni‐Nähe gezogen. 
Ryujis  Mutter  brachte  Kaffee  und  Kuchen.  Daraufhin  verschwand 
sie. Mai spürte einen Stich im Herzen, als sie die gekrümmte Gestalt 
weggehen  sah.  Tiefes  Mitgefühl  erfasste  sie.  Nur  zu  gut  konnte  sie 
nachempfinden,  welche  Qualen  Ryujis  Mutter  im  Moment  durch‐
lebte.  Ihre  eigenen  Gefühle  waren  nicht  viel  anders.  Auch  sie  ging 
durch das Tal der Tränen. 
Mai  ließ  den  Blick  durch  das  Zimmer  mit  den acht  Tatami‐Matten 
streifen. Es war im japanischen Stil gehalten. Nur in einer Ecke lag ein 
kleiner  Teppich,  auf  dem  ein  Schreibtisch  stand.  Die  Wände  waren 
mit  Bücherregalen  voll  gestellt.  Unzählige  Kartons,  Elektronikgeräte 
und  sonstiger  Kram  stapelten  sich  davor.  Mai  grauste  es  bei  dem 
Gedanken, all die Sachen durchwühlen zu müssen. Deprimiert zählte 
sie  die  Kartons.  Es  waren  vierundzwanzig.  In  ihnen  waren  Ryujis 
Habseligkeiten  aus  seinem  Apartment  in  Higashi  Nakano  verstaut, 
hauptsächlich Bücher und Aufsatzordner. 
Seufzend ließ sie sich auf den Boden sinken. Sie trank einen Schluck 
Kaffee. Ich sollte mir ernsthaft Gedanken darüber machen, was ist, wenn ich 
den  Artikel  nicht  finde  ...  Der  Anblick  der  vielen  Kisten  hatte  ihr  den 
Mut  genommen.  Wie  sollte  sie  die  paar  Seiten  unter  all  den  Sachen 
aufstöbern?  Das  war  wie  die  Suche  nach  der  Nadel  im  Heuhaufen. 
Und wer sagte, dass sich der Artikel überhaupt in einem der Kartons 
befand?  Hoffentlich  sind  nicht  alle  Bemühungen  umsonst.  Am  liebsten 
wäre sie gleich wieder heimgegangen, ohne mit der Suche zu begin‐
nen,  aber  nun  war  sie  hier,  und  da  blieb  nur  eines:  Augen  zu  und 
durch. Vielleicht wurde sie ja fündig. 
Mai  krempelte  sich  die  Ärmel  hoch  und  öffnete  einen  Karton.  Er 
war  bis  an  den  Rand  mit  Büchern  gefüllt.  Gedankenverloren  nahm 
sie  eines  nach  dem  anderen  heraus.  Plötzlich  hielt  sie  inne.  Tränen 
schossen  ihr  in  die  Augen.  Dieses  Buch  hatte  sie  Ryuji  geschenkt. 
Erinnerungen an die gemeinsam erlebte Zeit stiegen in ihr auf. 
Das  ist  nun  wirklich  nicht  der  richtige  Zeitpunkt,  um  sentimental  zu 
werden! 
Mai  unterdrückte  die  Tränen  und  kramte  weiter  in  den  Sachen 
herum. Hier war nichts. 
In  welchem  der  verdammten  Kartons  könnte  der  Artikel  stecken? 
Komm, denk nach. Entweder ist er in den Literaturunterlagen oder in einem 
der Aufsatzordner. Mai öffnete einen Karton nach dem anderen. 
Schweißperlen  liefen  ihr  die  Wirbelsäule  hinunter.  Verzweifelt 
suchte  sie  weiter,  allerdings  ohne  Erfolg.  Es  war  doch  viel  schwie‐
riger,  den  handgeschrieben  Artikel  unter  all  den  Sachen  aufzustö‐
bern, als sie zunächst geglaubt hatte. Erneut hielt sie für einen kurzen 
Augenblick inne und dachte nach. Vielleicht sollte ich den fehlenden Teil 
selbst  schreiben.  Das  wäre  wesentlich  effizienter,  als  stundenlang  in  den 
Sachen  zu  wühlen  und  am  Ende  doch  nichts  zu  finden.  Das  ist  reine 
Zeitverschwendung. Ryuji hatte kurz vor seinem Tod an einem Aufsatz 
gearbeitet,  der  als  letzter  Teil  seiner  Artikelserie  im  Dezember  ver‐
öffentlicht  werden  sollte.  Es  war  eine  Abhandlung  über  die  Theorie 
der  Logik.  Zwar  klang  das  wissenschaftlich  anspruchsvoll,  aber  der 
Text  war  weniger  an  ein  Fachpublikum,  sondern  in  erster  Linie  an 
den  nicht‐wissenschaftlichen  Leser  gerichtet.  Es  ging  um  die 
Beziehungen von Logik, Chemie und Gesellschaft. 
Mai  war  von  Beginn  an  in  die  Sache  involviert  gewesen.  Sie  hatte 
Ryujis  handgeschriebene  Artikel  abgetippt  und  den  Gesprächen  mit 
dem  Chefredakteur  der  Zeitschrift  beigewohnt.  Daher  hatte  sie  eine 
ungefähre  Vorstellung  davon,  wie  man  einen  Aufsatz  schrieb.  Eine, 
zwei Seiten zu ergänzen, das dürfte nun wirklich kein Riesenakt sein. Wenn 
ich  nur  wüsste,  wie  viel  fehlt.  Ryujis  Abhandlungen  variierten  jeden 
Monat in der Länge. Manchmal hatten sie fünfunddreißig, manchmal 
vierzig  oder  noch  mehr  Seiten.  Mai  hatte  nicht  die  leiseste  Ahnung, 
wie lang Ryujis Ergüsse dieses Mal waren. Als sie den Aufsatz für die 
Monatszeitschrift am Abend der Totenwache in Ryujis Apartment ge‐
funden hatte, war sie davon ausgegangen, dass er bereits fertig war. 
Alles hatte daraufhingedeutet: Die Seiten waren durchnummeriert, es 
gab  eine  Einleitung  und  einen  abschließenden  Ausblick  ...  Hätte  ich 
ihn doch bloß nicht bis zum letzten Moment liegen gelassen. Dann säße ich 
jetzt nicht in der Tinte. Mai machte sich Vorwürfe, dass sie sich erst in 
letzter Minute, als der Abgabetermin unmittelbar bevorstand, an die 
Abschrift  gesetzt  hatte.  Aber  wie  hätte  sie  das  auch  noch  auf  die 
Reihe  bekommen  sollen?  Schließlich  war  sie  mit  sich  selbst  genug 
beschäftigt. Ryujis Tod hatte sie vollkommen aus der Bahn geworfen. 
Der  Schock  hätte  kaum  größer  sein  können,  als  sie  beim  Lesen 
plötzlich die Entdeckung gemacht hatte, dass zwischen der vorletzten 
und letzten Seite ein Teil fehlte. Die unteren zwei Zeilen auf Seite 37 
waren durchgestrichen und mit einem Kreuzchen versehen. Der Satz 
hörte  mittendrin  mit  ›aber‹  auf.  Dann  folgte  das  Schlusswort.  Wenn 
die  mit  einem  Kreuzchen  versehenen  neuen  Sätze  irgendwo 
gestanden  hätten,  wäre  es  kein  Problem  gewesen,  nur  konnte  sie 
leider keinen Vermerk finden. Folglich war Mai davon ausgegangen, 
dass Ryuji die Korrekturen auf ein extra Blatt geschrieben hatte. 
Die zwölfteilige Artikelserie mit ihren insgesamt über fünfhundert 
Seiten sollte als Buch publiziert werden. Dies war der letzte und be‐
deutendste Aufsatz. Mai wurde ganz heiß bei dem Gedanken. 
Bekümmert starrte sie auf die Kartons und dachte: Wie konntest du 
einfach  so  sterben?  Komm  sofort  her  und  zeig  mir,  wo  du  die  fehlenden 
Seiten versteckt hast! 
Sie nippte an ihrem kalt gewordenen Kaffee. Sie steckte gehörig in 
der  Klemme.  Sollten  die  Seiten  mit  den  Ergänzungen  nicht  auftau‐
chen, musste sie, ob sie nun wollte oder nicht, selbst ein paar Zeilen 
formulieren.  Doch  so  einfach  war  das  nun  auch  wieder  nicht.  Was, 
wenn  sie  etwas  schrieb,  das  von  Ryujis  Gedankengängen  gänzlich 
abwich? Mai fühlte sich unbehaglich. Gewissenbisse plagten sie. Wie 
kann  ich  nur  daran  denken,  die  Worte  eines  herausragenden  Forschers  zu 
fälschen  ...  Ich,  eine  kleine  Studentin  von  gerade  mal  zwanzig  Jahren  ... 
Nein,  das  kann  ich  nicht  machen.  Ich  sollte  nicht  einmal  einen  Gedanken 
daran verschwenden. 
Sie öffnete den nächsten Karton. Inzwischen war es kurz nach vier. 
Im  Zimmer  war  es  bereits  dämmerig.  Mai  knipste  das  Licht  an  und 
zog die Vorhänge zu. Irgendwie fühlte sie sich schon die ganze Zeit 
von draußen beobachtet. 
Obwohl  sie  bereits  über  die  Hälfte  der  Kartons  durchforstet  hatte, 
hatte sie noch immer keine Spur von dem Manuskript gefunden. 
Aus  heiterem  Himmel  begann  plötzlich  ihr  Herz  zu  rasen.  Mai 
beschloss,  eine  kleine  Pause  einzulegen,  bis  sich  ihr  Herzschlag 
wieder  normalisiert  hatte.  Doch  auch  nach  ein  paar  Minuten  Ruhe 
blieb  ihr  Zustand  unverändert.  Noch  nie  in  ihrem  Leben  hatte  ihr 
Herz  so  stark  gepocht.  Mai  legte  die  Hand  auf  die  linke  Brustseite 
und  überlegte,  woran  das  liegen  könnte.  Das  ist  bestimmt  mein 
schlechtes Gewissen, weil ich mich nicht um Ryujis Artikel gekümmert habe 
...  Nein,  Schwachsinn!  Das  kann  es  nicht  sein.  Sie  spürte  eine  starke 
Beklemmung.  Irgendetwas  Geheimnisvolles  verbarg  sich  in  diesem 
Zimmer. Sie konnte es fühlen. Es lag ein Knistern, ja eine ungeheure 
Spannung in der Luft, als würde jeden Moment eine schwarze Katze 
mit funkelnden grünen Augen hinter einem Karton hervorspringen. 
Eine  teuflische  Kälte  stieg  um  Mais  Nacken  herum  auf.  Sie  spürte 
bohrende  Blicke  im  Rücken.  Irgendein  Etwas  lauerte  hinter  ihr.  Sie 
wirbelte  herum.  Das  Etwas  war  ein  pinkfarbener  Pullover,  der  ihr 
gehörte. Sie musste ihn auf den Karton gelegt haben, als sie gekom‐
men war. Dennoch ließ ihr der Anblick einen kalten Schauer über den 
Rücken  laufen.  Zwei  dunkle,  böse  funkelnde  Augen  schienen  sie 
durch die  Maschen des Pullovers  zu fixieren. Vorsichtig zog sie den 
Pullover weg. Nur ein schwarzer Videorekorder... 
Mai atmete erleichtert auf. 
Auf  dem  Rekorder  lag  ein  zusammengerolltes  Kabel.  Zweifellos 
waren diese Sachen aus Ryujis Apartment in Higashi Nakano. 
Ängstlich streckte Mai die Hand aus und berührte den Rekorder. Er 
bewegte sich leicht. Irgendwie unheimlich! Ich kann mich gar nicht daran 
erinnern, meinen Pullover auf das Gerät gelegt zu haben. 
Aber  eine  andere  Möglichkeit  gab  es  nicht.  Wer  sonst  hätte  den 
Pullover  dorthin  legen  sollen?  Mai  beschlich  ein  seltsames  Gefühl. 
Mit jeder Minute wurde ihr unbehaglicher zumute. 
Noch immer starrte sie auf den Videorekorder. Den Artikel hatte sie 
völlig  vergessen.  In  Gedanken  hörte  sie  Asakawas  Worte:  Hat  Ryuji 
mit Ihnen über das Video gesprochen, bevor er starb? 
Mai nahm das Kabel und suchte eine Buchse. Unter dem Tisch fand 
sie schließlich eine Mehrfachsteckdose. Sie stöpselte den Stecker ein. 
Das  rote  Lämpchen  leuchtete  auf.  Das  Blinken  erinnerte  sie  an  den 
Herzschlag eines ins Leben zurückgekehrten Menschen. Soll ich, oder 
soll ich nicht? Ihre innere Stimme riet ihr: Lass die Finger davon! Doch 
da war es schon zu spät. Sie hatte bereits auf die Eject‐Taste gedrückt. 
Aus dem Rekorder sprang eine Kassette, auf deren Etikett stand: Liza 
Minelli, Frank Sinatra, Sammy Davis Jr., 1989. 
Der Anblick des Videorekorders erinnerte sie an ein großes, dunk‐
les  Maul,  aus  dem  eine  Riesenzunge  heraushing.  Mai  griff  nach  der 
schwarzen Zunge und riss sie heraus. 
 

 
Kurz  vor  dem  Shinagawa‐Saisei‐Krankenhaus  überholte  das  Taxi 
einen  Krankenwagen.  Plötzlich  heulten  die  Sirenen  auf.  Der  Taxi‐
fahrer  fuhr  an  die  Seite  und  quetschte  sich  in  eine  enge  Parknische, 
um  den  Rettungswagen  passieren  zu  lassen.  Zu  Fuß  bin  ich  bestimmt 
schneller, dachte Ando. Er zückte seine Brieftasche, zahlte und verließ 
das  Taxi.  Schon  nach  wenigen  Minuten  ragte  das  zehnstöckige 
Klinikum vor ihm auf. 
Ando  bog  von  der  Einkaufsstraße  ab  und  lief  auf  den  Haupt‐
eingang  des  Krankenhauses  zu.  Just  in  dem  Moment  bog  auch  der 
Krankenwagen ein und parkte zwischen altem und neuem Gebäude. 
Das Blaulicht reflektierte sich an den weißen Wänden des Kranken‐
hauses, die Sirene war bereits abgestellt. Vom hellen Himmel senkte 
sich  eine  undurchdringliche,  spannungsgeladene  Stille  herab.  Man 
hatte  den  Eindruck,  als  würde  der  Krankenwagen  im  Rampenlicht 
stehen.  Das  Blaulicht  drehte  sich  allmählich  langsamer.  Jeden 
Moment  würde  die  Tür  aufspringen,  und  zwei  Notärzte  würden 
hektisch die Krankentrage herausrollen. Aber nichts passierte. Ando 
blieb  stehen  und  beobachtete  das  Geschehen.  Es  vergingen  zehn 
Sekunden, zwanzig, die Tür blieb geschlossen. Immer noch herrschte 
Stille,  ja  eine  geradezu  bedrohliche  Ruhe.  Dreißig  Sekunden  ...  Die 
Luft  um  Ando  herum  schien  zu  gefrieren.  Erstaunlicherweise  lief 
auch niemand aus dem Krankenhaus herbei. 
Ando kam wieder zu sich und ging weiter. Plötzlich sprang die Tür 
des  Krankenwagens  auf,  und  ein  Helfer  stieg  aus.  Der  andere  blieb 
im  Wagen.  Vorsichtig  rollten  sie  das  mobile  Bett  nach  draußen. 
Sicherlich gab es einen triftigen Grund, dass der Notfallpatient nicht 
gleich auf die Station gebracht worden war, dachte Ando.  Dennoch, 
es war ungewöhnlich viel Zeit verstrichen. 
Das  Bett  senkte  sich  leicht  zur  Seite,  und  deshalb  schaute  der 
Kranke genau in Andos Richtung. Mund und Nase waren von einer 
Beatmungsmaske bedeckt. Für einen Moment trafen sich ihre Blicke. 
Der  Mann  versuchte,  sich  auf  die  Seite  zu  rollen,  doch  plötzlich 
verharrte  er.  Regungslos  blickte  er  zu  Ando.  In  seinen  Augen  war 
kein  Leben  mehr.  Der  Mann  war  soeben  gestorben.  Im  Beruf  hatte 
Ando  es  schon  oft  erlebt,  dass  ein  Mensch  vor  seinen  Augen  starb, 
aber  noch  nie,  wenn  er  privat  unterwegs  war.  Das  bedeutet  nichts 
Gutes,  dachte  er.  Sorgen  befielen  ihn.  Aus  Angst,  dass  dies  ein 
Vorbote eines schrecklichen Unheils sein könnte, wandte er rasch den 
Blick  von  der  Leiche  ab.  Im  Grunde  genommen  unterschied  er  sich 
gar nicht so sehr von Miyashita, der abergläubisch war und an Wahr‐
sagerei glaubte. Auch er interpretierte neuerdings in jede Kleinigkeit 
eine  tiefere  Bedeutung  hinein.  Erst  hatte  ihn  die  Schlange  auf  dem 
Grashügel  beunruhigt,  jetzt  flößte  ihm  der  Tod  eines  Menschen 
Furcht ein. Früher hatte er sich immer über die Leute lustig gemacht, 
die an Unheil verheißende Omen oder Wahrsagerei glaubten und ihr 
Leben  nach  den  Sternen  richteten.  Doch  nun  musste  er  die  ernüch‐
ternde Entdeckung machen, dass er einer von ihnen war. 
Das  Shinagawa‐Saisei‐Krankenhaus  war  ein  Universitätsklinikum. 
Den Kontakt zu Asakawas behandelndem Arzt, Dr. Wada, hatte Ku‐
rahashi eingefädelt. Sie waren alte Studienkollegen. Dr. Wada führte 
Ando zu Asakawas Zimmer, das im Westgebäude im sechsten Stock 
lag. 
Ando  erschrak  beim  Anblick  Asakawas.  Seine  Augen  hatten 
denselben  leblosen  Ausdruck  wie  die  des  vor  wenigen  Minuten 
verstorbenen Mannes — es waren die Augen eines Toten. 
Regungslos  lag  Asakawa  im  Bett  und  starrte  geistesabwesend  an 
die Decke. Da er nicht in der Lage war, sich selbst zu ernähren oder 
Medikamente  einzunehmen,  hing  er  an  zwei  Tropfen.  Zwar  hatte 
Ando  keine  Vorstellung,  wie  Asakawa  früher  einmal  ausgesehen 
hatte,  aber  sein  Anblick  erschütterte  ihn  zutiefst.  Asakawa  war  ein 
menschliches  Wrack.  Seine  Wangen  waren  eingefallen  und  der  Bart 
struppig, gleichsam grau durchwachsen. 
Ando stellte sich an das Krankenbett und sagte mit ruhiger Stimme: 
»Herr Asakawa...« 
Asakawa antwortete nicht. Fragend blickte Ando zu Dr. Wada, der 
ihm  zunickte.  Sanft  berührte  Ando  Asakawa  an  der  Schulter.  Unter 
seinen  Fingern  spürte  er  nur  Haut  und  Knochen.  Ando  nahm 
Asakawas  Hand  und  hob  sie  leicht  an.  Doch  auch  jetzt  zeigte  der 
Kranke keine Regung. 
»Ist Asakawa ununterbrochen in diesem Zustand, oder geht es ihm 
manchmal  auch  besser?«  Ando  trat  ein  paar  Schritte  vom  Kranken‐
bett weg. 
»Nein, sein Zustand ist immer so«, entgegnete Wada. 
Seit  Asakawa  eingeliefert  worden  war,  hatte  er  offenbar  weder 
gesprochen,  noch  geweint  oder  gelacht.  Er  aß  nicht  und  ging  auch 
nicht allein zur Toilette. 
»Was,  denken  Sie,  ist  der  Grund  für  dieses  Verhalten?«,  fragte 
Ando den Arzt höflich. 
»Zuerst  gingen  wir  davon  aus,  dass  es  bei  dem  Unfall  zu  inneren 
Verletzungen  des  Gehirns  gekommen  war.  Die  Untersuchungen 
haben  diese  Vermutung  allerdings  nicht  bestätigt.  Wir  haben 
keinerlei  Gehirnblutungen  feststellen  können.  Inzwischen  denken 
wir, dass sein Zustand rein psychologisch bedingt ist.« 
»Sie meinen eine Art Schock ...« 
»Ja, wahrscheinlich.« 
Es  fiel  nicht  schwer,  sich  vorzustellen,  dass  der  plötzliche  Tod 
seiner  Frau  und  Tochter  Asakawas  psychischen  Zusammenbruch 
ausgelöst  hatte.  Doch  Ando  zweifelte  daran,  dass  sich  Asakawas 
bedenklicher  Zustand  allein  auf  den  Verlust  seiner  Familie  zurück‐
führen  ließ.  Seine  Vermutung  beruhte  auf  den  Fotos  vom  Unfallort 
und  dem  schwarzen  Videorekorder.  Warum  hatte  Asakawa  ein 
Videogerät bei sich gehabt, und wo hatte er damit hingewollt? Wenn 
er Ando doch nur diese eine Frage beantworten würde! 
Ando  zog  einen  Stuhl  an  das  Krankenbett  und  setzte  sich. 
Nachdenklich blickte er auf das knochige, fahle Gesicht Asakawas. Er 
schien  in  einer  Fantasiewelt  zu  leben,  schöner  und  bunter  als  die 
reale.  Vermutlich  war  er  dort  bei  seiner  Frau  und  Tochter,  hielt  sie 
glücklich in den Armen. 
»Herr  Asakawa  ...«,  sagte  Ando  sanft.  Aber  auch  dieses  Mal  blieb 
eine  Antwort  aus.  Tiefes  Mitgefühl  erfasste  Ando.  Asakawa  musste 
zwei Jahre jünger sein als er, denn er war mit Ryuji zusammen aufs 
Gymnasium  gegangen.  Doch  Ando  hatte  den  Eindruck,  als  läge  ein 
alter Mann von über sechzig Jahren vor ihm. 
Was  hatte  ihn  nur  so  verändert?  Natürlich  wusste  er,  dass  Trauer 
und  Kummer  den  Alterungsprozess  erheblich  beschleunigen  konn‐
ten. Er selbst hatte im letzten Jahr ziemlich abgebaut. War er noch vor 
zwei  Jahren  stets  jünger  geschätzt worden,  als  er  tatsächlich  war,  so 
verhielt es sich heute genau anders herum: Man hielt ihn für älter. 
»Herr Asakawa, können Sie mich hören?« 
»Ich  denke,  es  hat  keinen  Sinn.  Sie  können  ihn  noch  so  oft  an‐
sprechen, er wird nicht antworten«, sagte Dr. Wada. 
Ando  sah  ein,  dass  es  vergeblich  war.  »Meinen  Sie,  sein  Zustand 
könnte sich in nächster Zeit bessern?« 
Wada  zuckte  ratlos  mit  den  Achseln.  »Das  weiß  nur  Gott.«  Bei 
Patienten wie Asakawa konnte sich der Zustand von einer Stunde auf 
die  andere  schlagartig  verändern,  ohne  jegliches  Anzeichen  im 
Vorfeld. Voraussagen ließen sich nicht machen. 
»Bitte informieren Sie mich, wenn sich irgendetwas tut.« 
»Ja, gern.« 
Da Ando einsah, dass es nichts brachte, in diesem Zimmer herum‐
zusitzen  und  der  Dinge  zu  harren,  verließ  er  gemeinsam  mit  Dr. 
Wada  das  Krankenzimmer.  Bevor  sie  die  Tür  hinter  sich  schlossen, 
blickte  er  noch  ein  letztes  Mal  auf  Asakawas  ausgemergeltes,  von 
Kummer gezeichnetes Gesicht, doch nichts hatte sich verändert. Noch 
immer  lag  er  regungslos  da  und  starrte  mit  den  Augen  eines  Toten 
geistesabwesend an die Decke. 
 

 
Mai  klappte  die  Sessellehne  zurück  und  starrte  an  die  Decke.  Das 
war ein typisches Verhalten, wenn sie in eine Sackgasse geraten war. 
Langsam ließ sie den Kopf nach hinten sinken und schloss die Augen. 
Ihr nasses schwarzes Haar berührte den Boden. 
Mais Apartment war kaum größer als sechzehn Quadratmeter. An 
den  Wänden  ragten  Bücherregale  bis  zur  Decke  hoch. Die Mitte  des 
Raumes  füllte  ein  kleiner,  flacher  Tisch.  Das  waren  auch  schon  so 
ziemlich alle Einrichtungsgegenstände, die sie besaß. Da für ein Bett 
nicht  ausreichend  Platz  gewesen  war,  schlief  Mai  auf  einem  Futon, 
den sie abends ausrollte und am Tag in einer Ecke verstaute. Mit den 
paar Yen, die sie von ihren Eltern monatlich bekam, und dem Geld, 
das sie als Nachhilfelehrerin verdiente, konnte sie sich kein größeres 
Apartment  in  Uni‐Nähe  leisten.  Allein  die  Miete  vertilgte  die  Hälfte 
ihres  monatlichen  Einkommens.  An  den  Stadtrand  wollte  sie  aber 
auch  nicht  ziehen,  nur  um  etwas  großzügiger  leben  zu  können.  Sie 
war eigentlich sehr zufrieden mit ihrer momentanen Wohnsituation. 
In ihren Augen wies die Enge des Apartments den Riesenvorteil auf, 
dass man an alles bequem herankam, ohne aufstehen zu müssen, wie 
den Fernseher oder das Radio. 
Mit geschlossenen Augen bediente sie den CD‐Player. Ihr Lieblings‐
song drang aus der HiFi‐Anlage. Im Rhythmus der Musik trommelte 
sie mit den Händen auf ihre muskulösen Oberschenkel, die sie ihren 
sportlichen  Aktivitäten  während  der  Schulzeit  zu  verdanken  hatte. 
Sie war Hundertmeterläuferin gewesen. Im Takt der Musik ein‐ und 
ausatmend,  betete  sie  zu  Gott,  dass  ihr  ein  Gedankenblitz  kommen 
möge.  Allmählich  machte  sie  sich  ernsthaft  Sorgen.  Der  Abgabe‐
termin rückte immer näher. Was, wenn ihr nichts einfiel? Ihr Magen 
krampfte sich zusammen. 
Morgen Nachmittag musste Ryujis Artikel bei Herrn Kimura, dem 
Chefredakteur  des  S‐Shogo  Verlags,  auf  dem  Tisch  liegen.  Viel  Zeit 
blieb  ihr  nicht  mehr.  Zu  allem  Übel  fehlte  ihr  noch  immer  die 
zündende Idee. Dieses Mal steckte sie verdammt tief in der Klemme. 
Verzweifelt  hatte  sie  am  Nachmittag  sämtliche  Kartons  in  Ryujis 
Zimmer  nach  den  verflixten  Seiten  durchwühlt,  doch  vergeblich. 
Plötzlich  kam  ihr  der  Gedanke,  dass  Ryuji  den  Artikel  möglicher‐
weise gar nicht zu Ende geschrieben hatte. Vielleicht hatte er ja vor‐
gehabt, den Rest später zu schreiben, und bevor er dazu gekommen 
war, hatte ihn der Tod geholt. 
Grübelnd  saß  Mai  vor  dem  leeren  Blatt  Papier.  Nicht  eine  Zeile 
hatte sie in der letzten Stunde zustande gebracht. Wie sollte sie diese 
Aufgabe  nur  bewerkstelligen?  Vielleicht  half  ja  ein  heißes  Bad,  um 
die  grauen  Zellen  ein  wenig  auf  Trab  zu  bringen.  Doch  der  erhoffte 
Geistesblitz kam nicht. Ein leichter Anflug von Panik machte sich in 
ihr  breit.  Sie  ärgerte  sich  über  sich  selbst.  Warum  stehe  ich  heute  nur 
dermaßen  auf  der  Leitung?  Es  kann  doch  nicht  so  schwierig  sein,  ein  paar 
Worte aufs Papier zu bringen. Entschlossen nahm sie den Stift wieder in 
die Hand und schrieb eine Zeile auf das weiße Blatt. Was schreibe ich 
da  eigentlich  für  einen  Mist?  Schon  hatte  sie  den  gerade  formulierten 
Satz  wieder  durchgestrichen.  Erneut  klierte  sie  etwas  aufs  Papier, 
aber auch diese Worte fielen dem Radiergummi zum Opfer. 
Plötzlich hatte sie eine Eingebung. 
Warum so kompliziert, wenn es doch viel einfacher geht? Mir fällt nichts 
ein, weil ich darauf fixiert bin, Ryujis Ausdrucksweise zu benutzen. 
Mai war klar geworden, dass sie die ganze Sache falsch angepackt 
hatte.  Natürlich  konnte  sie  Ryujis  Sätze  nicht  auf  intelligente  Weise 
vervollständigen,  dafür  fehlte  ihr  einfach  das  grundlegende 
Verständnis  der  Materie.  Die  Lösung  war  einfach.  Sie  musste  den 
Aufsatz nur an Anfang und Ende so geschickt kürzen, dass er in sich 
ein logisches Ganzes ergab und die Brüche für den Leser nicht mehr 
spürbar waren. 
Sie führte ein kleines Freudentänzchen auf. Das wäre auch in Ryujis 
Sinn,  dachte  sie.  Immerhin  war  es  besser,  einen  Text  zu  kürzen,  als 
fremde Gedankengänge einzubauen. 
Jetzt  fühlte  Mai  sich  wesentlich  besser.  Plötzlich  schoss  ihr  der 
Gedanke  an  das  Video  wieder  durch  den  Kopf.  Getrieben  von  einer 
zügellosen  Neugierde,  hatte  sie  es  heimlich  aus  Ryujis  Zimmer 
mitgehen lassen. Natürlich hätte es sich gehört zu fragen. Doch als sie 
vor den Eltern gestanden und sich verabschiedet hatte, fielen ihr die 
passenden Worte nicht ein. Sie wusste nicht, wie sie ihr Interesse an 
der Videokassette begründen sollte. 
Dürfte ich mir dieses Video ausleihen? Es interessiert mich brennend. 
Ein  merkwürdiger  Satz:  Es  interessiert  mich  brennend.  Was  hieß  das 
schon? Wenn Ryujis Familie gefragt hätte, warum ihr so viel an dem 
Video lag, wäre sie in Erklärungsnot geraten. Also hatte sie das Band 
einfach in ihrer Handtasche verschwinden lassen. 
Eiza Minelli, Frank Sinatra, Sammy Davis Jr., 1989. 
Das klang nicht besonders spannend. Trotzdem ging Mai das Band 
nicht  mehr  aus  dem  Kopf.  Wann  hatte  sie  es  eigentlich  auf  den 
Fernseher gelegt? Es übte eine magische Anziehungskraft auf sie aus. 
Schau mich an, schien es ihr zuzuflüstern. Auch ihr kombiniertes TV‐ 
und Videogerät schien sie zu einem Videoabend einladen zu wollen. 
Schon  in  Ryujis  Zimmer  hatte  sie  ein  unersättliches  Verlangen 
gespürt, sich das Band anzuschauen. 
Eines wusste sie: Die auf dem Etikett angekündigte Musikrichtung 
war  keineswegs  Ryujis  Geschmack  gewesen.  Er  hatte  Klassik  bevor‐
zugt,  aber  insgesamt  hatte  sich  seine  Musikbegeisterung  in  Grenzen 
gehalten. Das Video hatte ihm sicher nicht gehört. Für diese Vermu‐
tung sprach auch die Handschrift auf dem Etikett. Irgendwer musste 
die  Kassette  in  Ryujis  Zimmer  gelegt  haben.  Aber  was  tat  das  jetzt 
noch zur Sache? Nun lag sie bei ihr. 
Aufgeregt  schob  Mai  die  Videokassette  in  den  Rekorder.  Der 
Fernseher  ging  automatisch  an.  Sie  drückte  auf  ›Play‹.  Das  Band 
begann zu laufen. Wirre Geräusche ertönten. Unvermittelt drückte sie 
die Pause‐Taste. Sollte sie sich das Video wirklich anschauen? Wenn 
sie es erst gesehen hatte, gab es kein Zurück mehr. Die Bilder wären 
für  immer  und  ewig  in  ihr  Gehirn  eingebrannt.  Vielleicht  sollte  ich 
lieber  die  Finger  davon  lassen,  bevor  ich  es  bereue,  dachte  Mai.  Sie 
überlegte  hin  und  her,  doch  schließlich  siegte  die  Neugier  über  ihre 
Zweifel. Sie löste die Pause‐Taste. 
Wirre Geräuschfetzen ertönten, verzerrte Bilder flackerten über den 
Bildschirm. Plötzlich vollzog sich ein Wechsel von dem unregelmäßi‐
gen  Weiß  zu  einem  tiefen  Schwarz;  eine  pechschwarze  Flüssigkeit 
kroch  wie  ein  schmieriger,  dunkler  Ölfilm  über  die  Mattscheibe,  bis 
sie vollkommen in Finsternis getaucht war. 
Seltsamerweise verspürte Mai keinerlei Verlangen, die Stopp‐Taste 
zu  drücken.  Sie  war  jetzt  fest  entschlossen,  sich  das  Video  bis  zum 
Schluss  anzusehen.  In  den  nächsten  Minuten  offenbarten  sich  ihr 
Szenen, entsetzliche und bizarre Bilder, die sie nie erwartet hätte und 
deren Bedeutung sie nicht verstand. 
Kaum  war  der  Film  vorbei,  übermannte  sie  eine  heftige  Übelkeit. 
Sie stürzte ins Bad. Inzwischen bereute sie es zutiefst, sich das Band 
bis zum Schluss angeschaut zu haben. Zu sehr hatte sie sich von den 
Bildern  und  Szenen  mitreißen  lassen.  Halt,  das  war  so  nicht  richtig! 
Während  sie  darüber  nachdachte,  verstärkte  sich  ihr  Eindruck,  dass 
ihr  die  Bilder  aufgezwängt  worden  waren.  Nicht  sie  hatte  sich  das 
Video  bis  zum  Ende  angesehen,  sondern  es  war  ihr  gezeigt  worden. 
Irgendeine  namenlose  Kraft  hatte  sie  daran  gehindert,  die  Stopp‐
Taste zu drücken. 
Ihr  schweißüberströmter  Körper  zitterte,  und  aus  ihrem  Magen 
stieg  bittere  Galle  auf.  Mai  konnte  sich  des  Gefühls  nicht  erwehren, 
das  irgendein  mysteriöser,  ungreifbarer  Fremdkörper  durch  ihre 
Sinnesorgane  in  sie  eingedrungen  war  und  sich  ihrer  allmählich 
bemächtigte. Sie steckte den Finger in den Hals, weil sie hoffte, dieses 
Etwas gleich mit loswerden zu können. Dann übergab sie sich in die 
Toilette.  Viel  kam  jedoch  nicht.  Ihre  Augen  brannten,  ein  Husten‐
anfall überkam sie. Totenblass sank sie vor der Toilette in sich zusam‐
men. Sie hatte das Gefühl, als würde genau in diesem Moment ihr Ich 
sterben. 
Dann verlor sie das Bewusstsein. 
 
 
 
 
 
 
 

 
 

 
Sie war bereits fünfzehn Minuten zu spät. Ando begann allmählich 
unruhig  zu  werden.  Wo  bleibt  sie  nur?  Hatte  er  sich  womöglich  im 
Datum  getäuscht?  Nervös  zog  er  seinen  Terminkalender  aus  der 
Tasche. 
Freitag,  9.  November,  Shibuya‐JR‐Station,  Westausgang,  vor  dem 
Hachiko, 18 Uhr. 
Nein, alles stimmte. 
Ando drängte sich durch die Menschenmenge und hielt dabei nach 
Mai Ausschau. Jedes Mal, wenn er eine elegante, hübsche junge Frau 
entdeckte, lief er automatisch auf sie zu. Zu seiner Verärgerung war 
es  jedoch  stets  eine  unbekannte  Schöne,  nicht  die  sehnsüchtig 
Erwartete. 
Auch nach dreißig langen Minuten war noch immer nichts von Mai 
zu  sehen.  Enttäuschung  flammte  in  Ando  auf.  Vielleicht  hat  sie  die 
Verabredung vergessen? Er lief zu einem öffentlichen Fernsprecher und 
tippte  ihre  Nummer.  Während  er  es  mehrmals  klingeln  ließ,  klopfte 
sein Herz bis zum Hals. 
Der Klingelton ertönte bereits das zehnte Mal... Mai war eindeutig 
nicht zu Hause. Betrübt senkte Ando den Hörer. Sicher ist sie nur auf‐
gehalten worden und auf dem Weg hierher. Mit dieser Hoffnung hängte 
er ein. 
Wieder  blickte  er  ungeduldig  auf  die  Uhr.  Nun  wartete  er  schon 
fast eine Stunde, aber von Mai war noch immer nichts zu sehen. 
Wenn die Stunde voll ist und sie dann immer noch nicht aufgetaucht ist, 
gehe ich. 
Sein letztes Rendezvous mit einer Frau war eine Ewigkeit her. An‐
do  hatte  völlig  vergessen,  wie  lange  man  warten  sollte.  Er  fand  sich 
ziemlich unmodern. Die bittere Erfahrung, versetzt zu werden, hatte 
er nie erleben müssen. Seine Frau war zu ihren ersten Treffen immer 
pünktlich  erschienen.  Und  er  selbst  hatte  auch  noch  nie  jemanden 
warten lassen, von geringfügigen Verspätungen abgesehen. 
Während  Ando  in  Erinnerungen  an  frühere  Verabredungen 
schwelgte, verging die Stunde. Trotz seiner Entscheidung brachte er 
es nicht fertig zu gehen. Noch immer schlummerte in ihm ein kleiner 
Funken  Hoffnung,  dass  Mai  gleich  schuldbewusst,  aber  mit  einem 
hinreißenden  Lächeln  um  die  Ecke  kommen  würde.  Nur  noch  fünf 
Minuten, dann gehe ich aber wirklich. Er hatte sich die ganze Woche so 
auf  dieses  Treffen  gefreut;  jeden  Tag,  jede  Stunde,  ja  jede  Sekunde 
hatte  er  gezählt.  Nun  war  der  Tag  endlich  gekommen,  dem  er  so 
entgegengefiebert hatte. Da konnte er doch nach ein bisschen Warten 
nicht gleich das Handtuch werfen und wie eine beleidigte Leberwurst 
von dannen ziehen. 
Er beschloss, noch eine Weile dazubleiben. 
Schließlich  waren  eine  Stunde  und  dreiunddreißig  Minuten 
vergangen. Doch Mai war nicht gekommen. 
 
Ando  betrat  die  Hotellobby  und  erkundigte  sich  an  der  Rezeption 
nach  Funakoshi.  Zwar  hatte  er  die  Abschiedsfeier  abgesagt,  doch 
sprach nun nichts mehr gegen die Party, weil Mai ihn versetzt hatte. 
Während  der  schier  endlosen  Wartezeit  waren  Dutzende  verliebte 
Pärchen  an  ihm  vorbeiflaniert.  Der  kühle  Herbstabend  bot  sich  für 
einen  kuscheligen,  romantischen  Abend  zu  zweit  an.  Ausgehungert 
nach  Liebe  und  innerlich  leer  war  Ando  absolut  nicht  in  der 
Stimmung gewesen, gleich nach Hause zu fahren. Unvorstellbar, den 
Abend einsam und verlassen in seiner trostlosen Bude zu hocken. So 
hatte  er  beschlossen,  auf  die  Feier  von  Funakoshi  zu  gehen  und  mit 
ein paar alten Kumpels seinen Frust hinunterzuspülen. Jetzt wollte er 
sich  erst  recht  amüsieren.  Nur  so  konnte  er  der  inneren  Leere  den 
Kampf ansagen. 
Der  offizielle  Teil  der  Party  im  Kollegenkreis  neigte  sich  bereits 
dem  Ende  zu.  Nur  die  engsten  Freunde,  etwa  drei  bis  fünf  Leute, 
hatten  beschlossen,  weiterzuziehen  und  unbeschwert  in  die  Nacht 
hineinzufeiern.  Er  kam  gerade  zum  richtigen  Zeitpunkt.  Perfektes 
Timing, dachte er. 
Miyashita  erspähte  Ando  sofort.  Er  kam  auf  ihn  zugelaufen  und 
klopfte ihm freundschaftlich auf die Schulter. »Was machst du denn 
hier?  Hattest  du  heute  nicht  ein  Rendezvous  mit  dieser  heißen 
Braut?« 
»Sie  hat  mich  versetzt«,  entgegnete  Ando  mit  scheinbarer  Ge‐
lassenheit. 
»Das tut mir Leid. He, komm mal kurz mit.« Ohne auf die verpatzte 
Verabredung einzugehen, packte Miyashita Andos Arm und zog ihn 
hinter die Tür. 
»Was ist los?«, fragte Ando verwundert. 
Miyashita  wollte  gerade  loslegen,  als  Professor  Yasukawa  von  der 
Abteilung für Innere Medizin an ihnen vorbeiging. Hektisch flüsterte 
Miyashita  Ando  ins  Ohr:  »Wie  siehtʹs  aus?  Ziehst  du  nachher  noch 
mit uns um die Häuser?« 
»Ja, das hatte ich vor.« 
»Hervorragend.  Ich  muss  dir  nämlich  unbedingt  etwas  erzählen. 
Du wirst Augen machen.« 
Dann ließ er Ando stehen und näherte sich Professor Yasukawa. Er 
bedankte  sich  höflich  für  dessen  Kommen,  und  während  sie  über 
dieses  und  jenes  schwatzten,  trug  er  ein  breites,  einschmeichelndes 
Lächeln zur Schau. Das war typisch Miyashita. Mit dieser Art kam er 
überall  gut  an.  Alle  Professoren  mochten  ihn.  Auch  Ando  war  von 
ihm  beeindruckt.  Hätte  irgendein  anderer  das  Gleiche  getan,  dann 
hätte er das mit Sicherheit abstoßend gefunden. 
Ando  stand  noch  immer  an  der  Tür  und  wartete  ungeduldig  auf 
das  Ende  des  Gesprächs  zwischen  Miyashita  und  Yasukawa.  Einige 
Bekannte  liefen  vorbei,  doch  nahm  keiner  so  richtig  Notiz  von  ihm. 
Nach einem flüchtigen Gruß waren sie schon wieder verschwunden. 
Offensichtlich hatten sie kein Interesse an ihm. Das war die Realität, 
mit der er sich abzufinden hatte. Ganz schuldlos war er daran nicht. 
Nach  dem  tragischen  Tod  seines  Sohnes  im  letzten  Sommer  hatte 
sich  ein  Großteil  seiner  Freunde  von  ihm  abgewandt.  Er  konnte  es 
ihnen  nicht  verübeln.  Ando  wusste  selbst  nur  zu  gut,  dass  er  derje‐
nige  gewesen  war,  der  den  Scherbenhaufen  zu  verantworten  hatte. 
Als  seine  Freunde  von  dem  schrecklichen  Schicksalsschlag  erfahren 
hatten,  waren  sie  sofort  zur  Stelle  gewesen,  um  Trost  zu  spenden. 
Doch jede Art  von Fürsorge hatte Ando genervt. Sie alle  waren ihm 
unheimlich  lästig  gewesen.  Ohne  Rücksicht  auf  Verluste  hatte  er 
ihnen  das  deutlich  zu  verstehen  gegeben.  So  war  es  nur  eine  Frage 
der  Zeit  gewesen,  bis  er  alle  vergrault  hatte.  Durch  den  schmerzli‐
chen Verlust seines Kindes in ein tiefes schwarzes Loch voller Schuld‐
gefühle  und  Selbstmitleid  gerissen,  hatte  er  jede  Kontrolle  über  sich 
verloren. Monatelang vegetierte er in absoluter Lethargie dahin. Egal, 
wer ihn aufzumuntern versuchte, stets saß er mit betrübtem, leerem 
Gesichtsausdruck da, unfähig, auch nur ein Wort von sich zu geben. 
Wie oft kam der Spruch: Das wird schon wieder. Was für hohle Worte 
... Gefangen in tiefer Trauer, war ihm hundeelend zumute, Besserung 
war nicht in Sicht. 
Während  das  immer  so  weiterging,  verlor  er  einen  Freund  nach 
dem anderen, und plötzlich blieb ihm nur noch einer: Miyashita. Der 
hatte es verstanden, Andos bekümmerte Miene einfach zu ignorieren. 
Stets war er zu einem Scherz aufgelegt, und es gelang ihm blendend, 
sogar  unglückselige  Geschichten  und  Ereignisse  in  Witze  zu 
verpacken.  Nur  in  Miyashitas  Gegenwart  vergaß  Ando  für  einige 
Augenblicke sein Leid. 
Heute  war  ihm  der  Unterschied  zwischen  Miyashita  und  den 
anderen  Freunden  klar.  Miyashita  kam  zu  ihm,  weil  er  mit  ihm  ein 
paar heitere Stunden verbringen wollte. 
Die  Phrase  ›Das  wird  schon  wieder‹  war  an  Bedeutungslosigkeit 
kaum  zu  übertreffen,  fand  Ando.  Statt  ihm  ein  besseres  Gefühl  zu 
vermitteln, führte sie ihm das Geschehene nur erneut vor Augen, und 
die  schrecklichen  Erinnerungen  konnten  nicht  verblassen.  Der 
Zauberspruch  für  einen  Trost  war  nicht  ›Das  wird  schon  wieder‹, 
sondern ›vergessen lassen‹. Die Kunst lag darin, den Betroffenen aus 
seiner Trübsal zu reißen, ihn abzulenken, selbst für kurze Zeit. Worte 
allein führten nicht aus der psychischen Tretmühle. 
Ando  war  in  den  letzten  eineinhalb  Jahren  nur  noch  mit  sorgen‐
voller  Miene  durch  die  Gegend  gelaufen.  Er  konnte  sich  nicht  mehr 
daran erinnern, wann er das letzte Mal herzhaft gelacht, geschweige 
denn  ein  fröhliches  Gesicht  gemacht  hatte.  Wie  sah  Mai  ihn  wohl? 
Diese knochigen, von Sorgenfalten durchzogenen Gesichtszüge ... Sie 
hätte sich mit ihm sicherlich zu Tode gelangweilt. 
Bestimmt ist Mai deshalb nicht erschienen. 
Dieser Gedanke machte ihn traurig. Betrübt konstatierte er, dass er 
bis zu dem Schicksalsschlag ein vor Kraft strotzender Mann mit einer 
gehörigen  Portion  Selbstvertrauen  gewesen  war.  Vor  ihm  hatte  eine 
viel  versprechende  Zukunft  gelegen.  Er  führte  eine  glückliche  Ehe, 
die  durch  einen  wunderbaren  Sohn  gekrönt  worden  war.  Sie  be‐
wohnten ein exklusives Apartment in Minami Aoyama. Dazu war er 
stolzer Besitzer eines BMW mit Lederausstattung. Schließlich winkte 
der  Chefposten  im  Krankenhaus  ...  Je  mehr  er  darüber  nachdachte, 
desto klarer wurde ihm, dass er sein wunderbares Leben im Grunde 
genommen  hauptsächlich  seiner  Frau  und  deren  Familie  zu  verdan‐
ken hatte. Vielleicht war es eine Ironie des Schicksals, dass ihm alles 
aus den Händen geglitten war. 
Miyashita  und  Professor  Yasukawa  unterhielten  sich  noch  immer 
angeregt, während Ando herumstand. Also ging er in die Lobby. Drei 
Telefonzellen  sprangen  ihm  ins  Auge.  Rasch  zog  er  seine  Telefon‐
karte aus der Brieftasche, betrat eine Zelle und tippte Mais Nummer 
ein.  Den  Hörer  zwischen  Ohr  und  Schulter  geklemmt,  beobachte  er 
Miyashita. Er wollte ihn auf keinen Fall aus den Augen verlieren, so 
groß war seine Angst, den Abend allein verbringen zu müssen. 
Nach  dem  achten  Klingelton  hängte  er  besorgt  ein.  Er  sah  auf  die 
Uhr.  Es  war  kurz  vor  neun.  Wo  zum  Teufel  steckte  Mai?  Er  begann 
sich ernsthafte Sorgen zu machen. 
Miyashita  und  Professor  Yasukawa  schienen  ihr  Gespräch  gerade 
zu  beenden.  Nach  einer  kurzen  Verbeugung  machte  Miyashita  sich 
auf den Weg. Ando hängte sich an seine Fersen. 
»Es  tut  mir  Leid,  dass  ich  dich  so  lange  allein  gelassen  habe«, 
entschuldigte Miyashita sich. 
»Das macht doch nichts.« 
Miyashita  zog  einen  Zettel  aus  seiner  Hosentasche  und  gab  ihn 
Ando.  »Hier  feiern  wir  nachher  weiter.  Kennst  du  die  Kneipe?  Ich 
schlage vor, du gehst schon mal vor, da ich hier noch einiges zu er‐
ledigen habe.« Miyashita war gerade im Begriff, sich abzuwenden, da 
zog Ando ihn am Ellenbogen zurück. 
»Warte einen Augenblick.« 
»Was ist?« 
»Was  wolltest  du  mir  vorhin  sagen?«  Ando  platzte  schier  vor 
Neugierde. 
Miyashita  leckte  sich  genüsslich  die  Lippen.  »Die  ersten  Unter‐
suchungsergebnisse  der  Gewebeproben  liegen  vor.  Jetzt  halt  dich 
fest, was sie im Labor entdeckt haben.« 
»Was? Nun rück schon raus damit.« 
»Es ist ein Virus.« 
»Ein Virus?« 
»Heute Nachmittag erhielt ich einen Anruf von der Universität Y in 
Yokohama.  Erinnerst  du  dich  noch  an  den  jungen  Mann,  der  dort 
obduziert wurde?« 
»War das diese mysteriöse Geschichte mit dem Liebespaar, das im 
Auto plötzlich einen Herzanfall erlitt?« 
»Genau.  Bei  beiden  ist  ein  Virus  im  Blut  entdeckt  worden.  Aber 
damit nicht genug: Es war dasselbe.« 
»Rück schon raus mit der Sprache — was für ein Virus?« 
Miyashita zog die Mundwinkel nach unten und seufzte. »Du wirst 
es nicht glauben. Mich hätte es fast umgehauen, als ich es erfuhr. Es 
ähnelt genetisch dem Pockenvirus.« 
Ando verschlug es die Sprache. 
»Professor Seki hat Recht behalten. Ich sage doch, er ist ein Genie. 
Ein  Blick  auf  das  Geschwür  genügte,  und  schon  kam  das  Wort 
›Pocken‹ aus seinem Mund. Faszinierend.« 
»Das ist unglaublich«, murmelte Ando. 
»Ob du es nun glaubst oder nicht, ich bin jedenfalls felsenfest davon 
überzeugt,  dass  wir  in  Ryujis  Blut  das  gleiche  Virus  finden  werden. 
Selbst  du  wirst  deine  Zweifel  dann  über  Bord  werfen.«  Miyashitas 
rundliches  Gesicht  leuchtete  nach  reichlichem  Alkoholgenuss  knall‐
rot.  Offensichtlich  freute  er  sich  über  das  Untersuchungsergebnis. 
Das war nicht untypisch für einen Wissenschaftler. Tauchte irgendwo 
eine neue Krankheit auf, siegten Neugierde und Forscherdrang über 
die Ängste in Bezug auf die Folgen. 
Andos  Begeisterung  über  diese  Entdeckung  hielt  sich  hingegen  in 
Grenzen.  Seine  Gedanken  kreisten  um  Mai.  Warum  geht  sie  nicht  ans 
Telefon?  Wo  steckt  sie  nur?  Eine  seltsame  Vorahnung  ergriff  ihn.  Und 
wenn die Entdeckung des mysteriösen Virus und das rätselhafte Verschwin‐
den  Mais  in  irgendeinem  Zusammenhang  miteinander  stünden?  Vielleicht 
wird  Mai  schon  bald  dem  gleichen  mysteriösen  Schicksal  zum  Opfer  fallen 
wie Ryuji. Vielleicht hat es ja längst zugeschlagen ... 
Stimmengewirr  und  das  Gelalle  von  Betrunkenen  dröhnten  durch 
die  Hotellobby.  Aus  all  diesem  Lärm  drang  eine  lachende  Kinder‐
stimme  an  Andos  Ohr.  Erstaunlich,  um  diese  Zeit  noch  ein  Kind  zu 
hören.  Er  drehte  sich  um.  Sein  Blick  schweifte  umher,  doch 
nirgendwo konnte er ein kleines Kind entdecken. 
 

 
Mittwoch,  14.  November.  Auf  Andos  Programm  stand  der  Besuch 
der  Fakultät  des  Philosophischen  Instituts  für  Literatur.  Dort  fing  er 
Mais Professoren und einige Dozenten ab, erkundigte sich besorgt, ob 
Mai in den letzten Tagen an den Lehrveranstaltungen teilgenommen 
hatte. Aber egal, wen er ansprach, es kam immer die gleiche Antwort: 
Seit  ungefähr  einer  Woche  hatte  niemand  Mai  gesehen.  Philosophie 
war  weiß  Gott  kein  Frauenfach.  Mai  war  wie  eine  exotische  Blume, 
und ihre Abwesenheit war aufgefallen. 
Ando  hatte  immer  wieder  versucht,  sie  zu  erreichen.  Seit  der  ge‐
platzten Verabredung letzten Freitag gab es kein Lebenszeichen von 
ihr.  Zwei‐  bis  dreimal  pro  Tag  rief  er  bei  ihr  an,  jedes  Mal  ohne 
Erfolg.  Vielleicht  war  sie  ja  bei  einer  Freundin  —  oder  schlimmer: 
Vielleicht  war  ein  neuer  Mann  im  Spiel.  Auf  alle  Fälle  stimmte 
irgendetwas nicht. 
Oder ist sie für ein paar Tage zu ihren Eltern gefahren? Das müsste sich 
relativ leicht klären lassen, dachte Ando. Er ging ins Studentensekre‐
tariat. Dort schilderte er dem Verantwortlichen die Situation und bat 
um Einsichtnahme in die Studentenkartei von Mai. Der Mann zeigte 
sich  äußerst  kooperativ.  In  null  Komma  nichts  hatte  Ando  Mais 
Heimatadresse.  Die  Eltern  wohnten  in  dem  kleinen  Städtchen 
Toyoda,  Präfektur  Shizuoka,  etwa  zwei  bis  drei  Stunden  von  Tokio 
entfernt, wenn man die Schwebebahn benutzte. 
Nach  Feierabend  ging  Ando  ohne  Umwege  nach  Hause.  Sofort 
schnappte er sich den Telefonhörer und wählte nervös die Nummer 
von  Mais  Eltern.  Es  meldete  sich  eine  freundliche  Frauenstimme; 
vermutlich  Mais  Mutter.  Er  nannte  seinen  Namen.  Schlagartig 
verstummte  die  Stimme  am  anderen  Ende.  Ando  spürte  ihre 
Anspannung durchs Telefon. Der unerwartete Anruf eines Dozenten 
der  Medizinischen  Fakultät  der  Universität,  an  der  ihre  Tochter 
studierte, schien ihr einen Schrecken eingejagt zu haben. Hätte er sich 
als Dozent des Literaturwissenschaftlichen Instituts vorgestellt, wäre 
es  sicherlich  zu  keinerlei  Missverständnissen  gekommen.  Aber  so 
konnte es aus ihrer Sicht nur einen Grund für den Anruf geben: eine 
schlechte  Nachricht,  etwa  dass  ihre  Tochter  todkrank  war.  Die  Stu‐
denten  konnten  sich  kostenlos  im  Universitätsklinikum  untersuchen 
lassen.  Vielleicht  hatte  sich  Mai,  ohne  ihr  ein  Sterbenswörtchen  zu 
sagen,  einem  Gesundheitscheck  unterzogen.  Nun  waren  die  Ergeb‐
nisse so schlecht, dass Ando die undankbare Aufgabe zugefallen war, 
sie davon in Kenntnis zu setzen — so in etwa schien die Mutter sei‐
nen Anruf zu interpretieren. Er beschloss, sie nicht länger im Dunk‐
len tappen zu lassen, und erklärte ihr den Grund seines Anrufes. 
Mais  Mutter  begriff  zunächst  nicht,  warum  Ando  sie  wegen  einer 
derartigen  Lappalie  kontaktierte.  In  ihren  Augen  war  das  viel  Lärm 
um nichts. Höchstens zwei‐ bis dreimal im Monat telefonierte sie mit 
ihrer  Tochter.  Ein  Versuch  ihrerseits  in  der  letzten  Woche  war  ohne 
Erfolg gewesen. Sie hatte die Stimme ihrer Tochter seit drei Wochen 
nicht mehr gehört. Das war völlig normal; was sollte da merkwürdig 
sein?  Ihr  wollte  nicht  in  den  Kopf,  dass  ein  Universitätsdozent  so 
einen  Wirbel  veranstaltete  und  eigens  bei  ihr  anrief,  nur  weil  ihre 
Tochter ein paar Tage telefonisch nicht erreichbar war und die Vorle‐
sungen geschwänzt hatte. 
»Verstehe. Als  Sie  letzte  Woche  bei  Ihrer  Tochter  anriefen,  war  sie 
also nicht zu Hause?« Ando runzelte die Stirn. Seine Hoffnung, Mai 
hatte spontan ihre Eltern besucht, war wie eine Seifenblase zerplatzt. 
Er  hatte  das  Gefühl,  als  würde  ihm  jemand  den  Boden  unter  den 
Füßen wegziehen. 
»Ja. Aber das ist wirklich nichts Außergewöhnliches, wenn man sie 
mal  nicht  erreicht.  Es  kam  sogar  vor,  dass  wir  uns  Monate  nicht 
gesprochen  haben.  Gerade  erst  vor  einem  halben  Jahr  war  das  der 
Fall.  Ständig  haben  wir  uns  verpasst.  Aber  irgendwann  klappt  es 
schon mal.« 
Ando drohte allmählich der Geduldsfaden zu reißen. Doch es war 
nicht die Zeit, Mais Mutter mit den Ereignissen zu konfrontieren und 
sie den wahren Grund seiner Sorgen wissen lassen. Erst gestern hat‐
ten  die  Untersuchungsergebnisse  von  Ryujis  Gewebeprobe  Licht  ins 
Dunkel  gebracht.  Miyashitas  Prophezeiung  hatte  sich  bewahrheitet. 
Ryujis  Blut  wies  das  rätselhafte  Virus  ebenfalls  auf.  Hinsichtlich  der 
Übertragungswege  herrschte  zwar  noch  Unklarheit,  aber  man  kam 
der  Sache  schon  näher.  Die  Angelegenheit  durfte  jedoch  auf  keinen 
Fall  an  die  Öffentlichkeit  gelangen;  noch  nicht  ...  Dafür  wussten  sie 
zu  diesem  Zeitpunkt  einfach  viel  zu  wenig  über  das  neue  Virus. 
Wenn die Medien erst mal Wind von der Sache bekämen ... Das wäre 
eine absolute Katastrophe. Ando blieb also gar nichts anderes übrig, 
als vorerst mit der Wahrheit hinter dem Berg zu halten. 
»Entschuldigen Sie bitte die indiskrete Frage, aber übernachtet Mai 
öfter bei Freunden?« 
»Nein, ich glaube nicht.« 
»Sie sagten, Sie hätten Mai letzte Woche angerufen. Können Sie sich 
noch an den Tag erinnern?« 
Nach  einer  kurzen  Pause  entgegnete  die  Mutter:  »Das  muss  am 
Dienstag gewesen sein.« 
»Dienstag ...« Heute war Mittwoch; das würde bedeuten, dass Mai 
schon  über  eine  Woche  wie  vom  Erdboden  verschluckt  war.  Wo 
konnte sie nur sein? Wieso wusste kein Mensch, nicht mal ihre Eltern, 
wo sie sich aufhielt? »Könnte es sein, dass sie spontan verreist ist?« 
»Nein, auf keinen Fall.« 
Die  Mutter  sagte  dies  so  bestimmt,  dass  Ando  nachhakte.  »Was 
spricht denn dagegen?« 
»Mai  hat  nicht  die  finanziellen  Möglichkeiten  dazu.  Sie  jobbt  als 
Nachhilfelehrerin,  und  wir  geben  ihr  monatlich  einen  kleinen  Zu‐
schuss.  Damit  kommt  sie  gerade  so  über  die  Runden.  Für  luxuriöse 
Sperenzchen bleibt da nichts übrig.« 
In diesem Moment war Ando plötzlich sicher: Mai war etwas zuge‐
stoßen. Man brauchte nur eins und eins zusammenzuzählen. Letzten 
Freitag  war  sie  nicht  zu  der  Verabredung  erschienen.  Falls  alles  in 
Ordnung  wäre,  hätte  sie  abgesagt,  damit  er  nicht  stundenlang 
wartete.  Doch  das  war  nicht  geschehen.  Dafür  gab  es  nur  eine 
Erklärung: Mai war bereits am Freitag nicht in der Lage gewesen zu 
telefonieren.  Ando  sah  Ryujis  Leiche  vor  sich.  Plötzlich  änderte  sich 
die  Szenerie,  und  er  sah  Mai,  an  ein  Bett  gelehnt,  Arme  und  Beine 
erstarrt von sich gestreckt — tot. Nein, das durfte nicht sein! Er ver‐
suchte, die entsetzlichen Bilder zu verdrängen. 
»Es  wäre  schön,  wenn  Sie  morgen  nach  Tokio  kommen  könnten.« 
Mit dem Hörer in der Hand verbeugte Ando sich leicht. 
»Das  kommt  etwas  überraschend  ...«,  seufzte  die  Mutter  und 
schwieg. 
Natürlich kannte sie die wahren Umstände nicht und ahnte folglich 
auch  nichts  Böses,  aber  Ando  fand  ihre  Reaktion  dennoch  etwas  zu 
unbekümmert. Am liebsten hätte er zu ihr gesagt: Man kann schneller, 
als  man  denkt,  einen  geliebten  Menschen  verlieren.  Gerade  hört  man  noch 
die vertraute Stimme, und im nächsten Moment ist alles still. Der Mensch, 
der einem alles im Leben bedeutet hat, ist für immer verschwunden. 
»Was  soll  ich  denn  in  Tokio?  Sie  denken  doch  nicht  allen  Ernstes, 
dass  ich  eine  Vermisstenanzeige  bei  der  Polizei  aufgeben  sollte  ...«, 
stammelte die Mutter mit gedämpfter Stimme. 
»Ich  möchte,  dass  Sie  in  der  Wohnung  Ihrer  Tochter  nachschauen, 
ob  alles  in  Ordnung  ist.  Ich  begleite  Sie.  Eine  Vermisstenmeldung 
wäre  dann  erst  der  zweite  Schritt«,  gab  Ando  zurück.  Aber  im 
Grunde  glaubte  er  nicht,  dass  es  überhaupt  noch  zu  einer  Vermiss‐
tenanzeige kommen würde. 
»Ich weiß nicht... Morgen passt mir eigentlich gar nicht.« 
Mais Mutter schien noch mit sich zu ringen. Natürlich sah sie kei‐
nen Sinn in Andos Bitte. Trotzdem konnte er ihre Sorglosigkeit nicht 
nachvollziehen. Immerhin war nicht ausgeschlossen, dass sie die Lei‐
che  ihrer  Tochter  vorfinden  würden.  Was  könnte  es  da  Wichtigeres 
geben? 
Aber  er  hatte  keine  Lust  mehr,  weiter  Überzeugungsarbeit  zu 
leisten.  »Verstehe.  Dann  werde  ich  morgen  allein  zu  Mai  fahren.  Im 
Haus wird es ja sicherlich einen Hausmeister geben.« 
»Ja, den gibt es. Ich habe ihn bei Mais Einzug kennen gelernt.« 
»Könnten  Sie  ihn  bitte  anrufen  und  informieren,  dass  ich  morgen 
Nachmittag zwischen zwei und drei Uhr vorbeikommen werde? Ich 
gehe dann mit ihm in Mais Wohnung.« 
»Hm ... « 
»Ich  bitte  Sie  inständig.  Tun  Sie  mir  den  Gefallen.  Wenn  ich  dort 
unangemeldet  aufkreuze,  wird  der  Hausmeister  mir  wohl  kaum  die 
Tür aufsperren.« 
»Das sehe ich ein. Gut, ich werde ihn anrufen.« 
»Ich verlasse mich auf Sie. Wenn noch etwas sein sollte, melde ich 
mich bei Ihnen.« 
Ando  wollte  gerade  auflegen,  da  hörte  er  die  Mutter  sagen:  »Ach, 
übrigens ... Grüßen Sie Mai von mir, wenn Sie sie sehen.« 
Sie ahnt nichts ... 
Deprimiert legte Ando auf. 
 

 
Von  der  Universität  gelangte  man  mit  der  U‐Bahn  auf  direktem 
Weg  zu  Mais  Apartment.  Ando  passierte  die  Schranken  und  warf 
noch  einmal  einen  Blick  auf  die  Adresse  im  Notizbuch.  Einen 
Stadtplan unter den Arm geklemmt, ging er los. 
Während er in Gedanken versunken die Straße entlangeilte, lief ihm 
ein kleines Mädchen mit ihren Eltern entgegen. Sie trug einen orange‐
farbenen  Kimono,  dessen  leuchtende  Schönheit  in  der  herbstlichen 
Nachmittagssonne  bezaubernd  wirkte.  Die  Kleine  schaute  ihm  ins 
Gesicht. Sie war etwa sieben und für ihr Alter ziemlich groß. Außer‐
dem hatte sie ein selten hübsches Gesicht. Stolz tappte sie in ihren ja‐
panischen Sandalen, die Hand ihrer Mutter umklammernd, an Ando 
vorüber.  Sie  war  unbeschreiblich  niedlich.  Von  ihrem  Charme 
gefangen, drehte Ando sich um und blickte dem kleinen Mädchen so 
lange nach, bis sie schließlich in der Ferne verschwand. In zehn Jahren 
wird dieses Mädchen zu einer ebenso atemberaubend schönen Frau wie Mai 
herangewachsen sein ... 
Ando  verglich  die  Hausnummer  des  vor  ihm  aufragenden,  sechs‐
stöckigen  Hauses  mit  der  Nummer  in  seinem  Notizbuch;  sie  waren 
identisch.  Hier  also  wohnte  Mai  Takano.  Die  Fassade  des  Hauses 
wirkte sehr hübsch, obgleich zu erkennen war, dass die Apartments 
ziemlich klein waren. 
Ando  klingelte  beim  Hausmeister.  Ein  älterer  Mann  steckte  den 
Kopf aus einem Fenster. Ando stellte sich vor. 
»Ah, guten Tag. Frau Takanos Mutter hat mir schon gesagt, dass Sie 
heute  vorbeikommen.«  Der  Hausmeister  trat  mit  einem  dicken 
Schlüsselbund in der Hand aus der Tür. 
»Vielen  Dank  für  Ihre  Mühe.  Ich  weiß  das  wirklich  sehr  zu 
schätzen.« 
»Nichts  zu  danken.  Das  mache  ich  doch  gern.  Sie  trifft  es  ja  noch 
schlimmer ... Ich meine, das mit Frau Takano.« 
Ando wusste zwar nicht, was Mais Mutter ihm erzählt hatte, aber er 
sagte »Ja« und folgte dem Mann. 
Bei einem kurzen Blick durch die Lobby fielen Ando die Briefkästen 
der  Hausbewohner  ins  Auge.  Speziell  einer  erregte  seine  Aufmerk‐
samkeit: Er war bis an den Rand mit Post und Zeitungen voll gestopft 
und  drohte  überzuquellen.  Andos  Intuition  sagte  ihm,  dass  er  nur 
Mai  gehören  konnte.  Bei  näherer  Betrachtung  bewahrheitete  sich 
seine Vermutung; auf dem Namensschild stand ›Mai Takano*. 
»Das  ist  der  Briefkasten  von  Frau  Takano.  Normalerweise  holt  sie 
ihre Post regelmäßig.« 
Ando fischte eine Zeitung nach der anderen heraus und überprüfte 
das  Datum.  Die  älteste  war  eine  Morgenausgabe  von  Donnerstag, 
dem  8.  November.  Seitdem  waren  sieben  Tage  verstrichen.  Das 
bedeutete,  dass  Mai  ihren  Briefkasten  exakt  eine  Woche  nicht  mehr 
geleert hatte. Mai ist ganz sicher nicht bei Freunden untergetaucht. Sie ist 
in  ihrem  Apartment  und  vermutlich  in  so  schlechter  körperlicher 
Verfassung,  dass  sie  die  Post  nicht  hochholen  kann  ...  Der  übervolle 
Briefkasten ließ nur diese Schlussfolgerung zu. 
»Können wir gehen?«, fragte der Hausmeister mit einem Unterton, 
der verriet, dass er erraten hatte, woran Ando dachte. Die Furcht vor 
dem  Anblick,  der  sich  ihm  in  Kürze  bieten  könnte,  war  Ando  ins 
Gesicht geschrieben. Ein flaues Gefühl breitete sich in seiner Magen‐
gegend  aus.  Was  erwartete  ihn  in  dem  Apartment?  In  Gedanken 
malte  er  sich  die  schrecklichsten  Szenarien  aus.  Er  versuchte,  sich 
innerlich zu wappnen. 
»Ja, lassen Sie uns hochfahren«, sagte er mit fester Stimme, als hätte 
er  inzwischen  Mut  geschöpft.  Mais  Apartment  lag  in  der  dritten 
Etage.  Nachdem  sie  den  Fahrstuhl  verlassen  hatten,  ging  der  Haus‐
meister auf eine Tür mit der Nummer 303 zu. Ando trottete hinterher. 
Der  Hausmeister  fischte  einen  Schlüssel  aus  dem  klirrenden  Bund 
heraus und steckte ihn ins Schloss. Ando trat unbewusst einen Schritt 
zurück. 
Ich  hätte  Gummihandschuhe  mitbringen  sollen.  Er  ärgerte  sich  über 
seine  Nachlässigkeit.  Warum,  verdammt  noch mal,  hatte  er  nicht  an 
Handschuhe,  gleichsam  als  Wunderwaffe  gegen  unbekannte  Viren, 
gedacht?  Wo  hatte er  nur  seinen  Kopf  gehabt?  Er  versuchte,  sich  zu 
beruhigen.  Ändern  konnte  er  jetzt  sowieso  nichts  mehr.  Das  Virus 
wird schon nicht durch die Luft übertragen, hoffte er insgeheim. Bis dato 
wussten  sie  ja  nicht  mal,  ob  wirklich  ein  Virus  an  den  mysteriösen 
Todesfällen schuld war. Falls ja, ähnelte es sicherlich dem HIV‐Virus 
und  war  nicht  so  leicht  übertragbar.  Dennoch  war  es  ein  unge‐
schriebenes  Gesetz,  besonders  vorsichtig  zu  sein,  wenn  man  den 
Gegner nicht genau kannte. Todesangst hatte Ando zwar nicht, aber 
er  hatte  es  sich  in  den  Kopf  gesetzt,  diese  merkwürdigen  Todesfälle 
aufzuklären.  Zumindest  wollte  er  so  lange  leben,  bis  er  das 
Geheimnis gelüftet hatte. 
Der  Hausmeister  schloss  die  Tür  auf.  Wieder  dieses  Unheil  ver‐
heißende  metallische  Geräusch!  Ando  trat  noch  ein  Stück  zurück. 
Seine  Anspannung  wuchs.  Alle  Sinne  waren  alarmiert.  Der  Geruch 
toten Fleisches war nichts Neues für ihn. Läge hier also wirklich eine 
Leiche,  würde  ihm  der  süß‐säuerliche  Gestank  sofort  in  die  Nase 
stechen.  Plötzlich  hatte  Ando  jedoch  das  Gefühl,  die  Situation  unter 
Kontrolle zu haben. 
Als die Tür einen Spalt breit geöffnet war, spürte er einen leichten 
Windzug.  Das  Balkonfenster  schien  offen  zu  stehen.  Vorsichtig 
atmete er ein. Nein, da war kein süß‐säuerlicher Geruch verwesenden 
Fleisches.  Er  sog  die  Luft  erneut  ein,  atmete  wieder  aus  ...  Hier  lag 
definitiv keine Leiche. Ando fiel ein Stein vom Herzen. Was hätte es 
Schlimmeres  geben  können,  als  die  Frau,  die  er  so  begehrte,  tot 
aufzufinden?  In  diesem  Moment  wich  alle  Kraft  aus  seinen  Beinen, 
und er musste sich mit einer Hand an der Wand abstützen. 
»Bitte,  treten  Sie  ein«,  sagte  der  Hausmeister.  Er  selbst  zog  es  vor, 
draußen zu warten. Durch die offene Wohnungstür konnte Ando das 
kleine  Zimmer  ganz  überblicken.  Fest  stand  eines:  Mai  Takano  war 
nicht  zu  Hause;  das  war  auf  den  ersten  Blick  zu  erkennen.  Erneut 
atmete er tief durch. Erst jetzt zog er seine Schuhe aus und betrat die 
Wohnung. Geduldig wartete der Hausmeister vor der Tür. 
»Wo könnte sie nur sein?«, hörte Ando ihn murmeln. 
In der Mitte des Zimmers angelangt, blieb Ando plötzlich die Luft 
im Halse stecken. Er fühlte sich, als würde eine Zentnerlast auf seiner 
Brust  liegen.  Sein  Herz  begann  zu  klopfen,  das  Blut  pulsierte  in 
seinen Adern. Dabei hatte seine Anspannung doch für einen Moment 
nachgelassen.  Aber  irgendwie  herrschte  in  diesem  Zimmer  eine 
gespenstische Atmosphäre. 
Mais Aura fehlt seit einer Woche; das ist es! Herrgott noch mal, wo hat sie 
sich nur versteckt? 
Vielleicht würde er die Antwort ja hier finden. 
Als  Nächstes  inspizierte  Ando  das  Badezimmer.  Aber  auch  dort 
war keine Spur von Mai. Zurück im Wohnbereich, musterte er jeden 
Winkel.  Die  Einrichtung  war  funktional,  das  Bettzeug  ordentlich  in 
einer  Ecke  zusammengelegt,  und  die  Kleider  hingen  fein  säuberlich 
auf  einer  Stange.  Für  ein  Bett  oder  einen  Kleiderschrank  wäre  nicht 
genug  Platz  gewesen.  Die  Mitte  des  Raumes  füllte  ein  flacher,  auf 
allen  Seiten  von  einer  Steppdecke  umgebener  Tisch,  der  im  Winter 
auch  als  Wärmespender  für  den  fröstelnden  Körper,  insbesondere 
kalte  Füße  diente.  Ein  Fetzen  Schmierpapier  auf  dem  Tisch  war  die 
Unterlage für eine Kaffeetasse. Ein verdorbener Rest Milch klebte auf 
dem Boden der Tasse. 
Die Wände waren mit Bücherregalen voll gestellt. Das Regal für das 
kombinierte  TV‐  und  Videogerät  schien  wie  maßgefertigt  zu  sein. 
Auch  alle  anderen  elektronischen  Geräte  waren  passend  zur  Größe 
des Zimmers ausgewählt worden. 
Auf  dem  Stuhl  lagen  zusammengelegt  ein  Nachthemd,  darauf  BH 
und Slip. Wahrscheinlich klopft mein Herz deshalb so wild, weil ich hier die 
Ausstrahlung  dieser  elektrisierenden  Frau  fühle.  Er  kam  sich  wie  ein 
Voyeur vor. 
»Wie  lange  brauchen  Sie  noch,  Doktor?«,  erkundigte  sich  der 
Hausmeister,  immer  noch  im  Hausflur  stehend.  Da  Mai  definitiv 
nicht  zu  Hause  und  allem  Anschein  nach  alles  in  bester  Ordnung 
war, drängte er Ando zum Gehen. 
Ohne  zu  antworten,  trat  Ando  in  die  Kochnische.  Das  Apartment 
war  zwar  mit  Parkett  ausgelegt,  aber  irgendwie  hatte  er  den  Ein‐
druck, dass sich der Boden unter seinen Füßen absenkte. Außerdem 
fiel  ihm  jetzt  auf,  dass  eine  Hundert‐Watt‐Birne  über  ihm  glühte. 
Draußen  war  es  noch  hell,  und  das  Zimmer  wurde  von  Licht 
durchflutet. In der Spüle standen zwei benutzte Gläser. Ando drehte 
den Wasserhahn auf, bis er heißes Wasser spürte, dann schloss er ihn. 
Anschließend  knipste  er  die  Neonröhre  aus.  Als  er  gerade  von  der 
Kochnische  ins  Wohnzimmer  zurückgehen  wollte,  durchzog  ihn  ein 
eisiges Frösteln, ohne dass er wusste, weshalb. 
»Lassen  Sie  uns  endlich  gehen«,  drängelte  der  Hausmeister.  In‐
zwischen  stand  auch  er  in  der  Wohnung,  aber  nur,  um  Ando  he‐
rauszuholen.  Blitzartig  schoss  er  ins  Treppenhaus  zurück,  diesmal 
mit  Ando  im  Gefolge.  Dieser  hörte,  wie  die  Tür  ins  Schloss  fiel  und 
der Hausmeister den Schlüssel umdrehte. 
Während  sie  gemeinsam  auf  den  Fahrstuhl  warteten,  schoss  Ando 
aus heiterem Himmel der Anblick einer jungen Frau durch den Kopf. 
Sie  war  in  ihrem  Haus  ermordet  aufgefunden  worden  und  auf  sei‐
nem  Seziertisch  gelandet.  Laut  Polizeiprotokoll  hatte  sich  der  Mord 
zehn Stunden zuvor ereignet. Ando erinnerte sich an diesen Tag, als 
wäre  es  gestern  gewesen.  Die  Leiche  hatte  ihm  einen  furchtbaren 
Schrecken  eingejagt,  da  sie,  obwohl  so  viel  Zeit  vergangen  war, 
weder  erkaltet  noch  steif  war  —  im  Gegenteil,  sie  hatte  nahezu  die 
Körpertemperatur  eines  Lebenden.  Die  Wärme  der  Organe  war 
während der Obduktion deutlich zu spüren. Verblüffend: In der Re‐
gel sank die Körpertemperatur nach Eintritt des Todes um ein Grad 
Celsius  pro  Stunde.  Natürlich  war  dies  nur  ein  Durchschnittswert, 
der je nach Klima und Ort variieren konnte. Aber es kam nur selten 
vor,  das  die  Körpertemperatur  eines  seit  über  zehn  Stunden  toten 
Menschen kaum gesunken war. 
Endlich  kam  der  Fahrstuhl.  Als  der  Hausmeister  gerade  eintreten 
wollte,  hielt  Ando  ihn  zurück.  »Bitte  warten  Sie.«  Er  hatte  den 
Entschluss  gefasst,  sich  nicht  eher  wegzubewegen,  als  bis  er  eine 
befriedigende  Antwort  auf  seine  Vermutung  gefunden  hatte.  Ir‐
gendetwas  war  faul.  Dieser  starke  Druck  auf  der  Brust,  das  Herz‐
rasen,  die  merkwürdige  Atmosphäre  im  Zimmer,  das  Gefühl,  als 
würde sich der Boden unter seinen Füßen absenken ... All dies schrie 
nach  einer  Erklärung.  Ando  versuchte  verzweifelt,  sein  Gefühl  in 
Worte zu kleiden, aber es wollten ihm einfach keine passenden in den 
Sinn kommen. Vielleicht gab es ja auch keine Worte dafür. 
Es  ist  das  gleiche  seltsame  Gefühl,  das  ich  damals  gespürt  habe,  als  die 
noch  warme  Leiche  der  jungen  Frau  vor  mir  auf  dem  Seziertisch  lag.  Die 
Atmosphäre in Mais Apartment ist irgendwie ähnlich. 
Die  Türen  des  Fahrstuhls  standen  noch  offen,  aber  Ando  machte 
keine  Anstalten  einzusteigen.  Dem  Hausmeister  war  es  nicht  mög‐
lich, da Ando ihm den Weg versperrte. 
»Wollen Sie nicht einsteigen?« 
Ohne  zu  antworten,  fragte  Ando:  »Sie  haben  Mai  Takano  in  der 
letzten Woche nicht gesehen, oder?« 
Die  Türen  des  Fahrstuhls  schlossen  sich,  und  er  fuhr  wieder  nach 
unten. 
»Wenn ich sie gesehen hätte, hätte ich das doch gesagt.« 
Ando  überlegte.  Der  Hausmeister  hatte  Mai  in  den  letzten  Tagen 
nicht gesehen. Auch an der Universität hatte sie sich seit einer Woche 
nicht blicken lassen. Das war vollkommen untypisch für sie. Gewöhn‐
lich fehlt Mai nie länger als einen Tag; und wenn doch einmal, dann immer 
mit  Entschuldigung,  hatte  ihr  Professor  erklärt.  Zu  Hause  war  sie 
offensichtlich nicht gewesen, denn seit sieben Tagen versuchte Ando 
vergeblich,  sie  telefonisch  zu  erreichen.  Einen  weiteren  Beweis  für 
ihre Abwesenheit lieferte der beinahe überquellende Briefkasten. All 
diese Indizien deuteten daraufhin, dass Mai seit Donnerstag, dem 8. 
November,  nicht  in  ihr  Apartment  zurückgekehrt  war.  Aber  diese 
Atmosphäre im Zimmer ... 
Es  war  eine  gewisse  menschliche  Wärme  zu  spüren,  als  wäre  bis 
vor kurzem noch jemand dort gewesen. 
»Ich würde mich gern noch einmal im Apartment von Frau Takano 
umsehen«,  sagte  Ando.  Der  alte  Mann  erschrak  sichtlich.  In  seiner 
Miene  spiegelte  sich  Furcht  wider,  dann  Ratlosigkeit,  schließlich 
verdüsterte sich sein Gesicht. 
Irgendetwas scheint dem Alten Angst einzujagen. 
»Wenn  Sie  mir  den  Schlüssel  zurückbringen,  bevor  Sie  gehen  ...« 
Der  Hausmeister  überreichte  Ando  den  Schlüssel  mit  einer  Miene, 
die  eindeutig  verriet,  was  er  dachte:  Schau  dich  ruhig  um,  wenn  du 
unbedingt willst, aber ohne mich. Ich verzichte auf derartige Abenteuer. 
Ando  hätte  den  Hausmeister  gern  gefragt,  welche  Wirkung  Mais 
Apartment  auf  ihn  gehabt  hatte.  Aber  wenn  er  ihn  diesbezüglich 
angesprochen hätte, dann hätte auch der Hausmeister wahrscheinlich 
keine  passenden  Worte  gefunden.  Es  war  nicht  einfach,  diese  selt‐
same, ja gespenstisch mysteriöse Atmosphäre zu beschreiben. 
»Haben Sie vielen Dank für den Schlüssel.« 
Ando  nahm  den  Schlüssel  entgegen  und  ging  auf  Mais  Woh‐
nungstür zu. Hätte er auch nur eine Minute gezögert, dann hätte ihn 
wahrscheinlich  der  Mut  verlassen.  Woher  nur  kam  dieser  starke 
Impuls, den er im Zimmer gespürt hatte? Etwas stimmte nicht. Ehe er 
nicht  eine  befriedigende  Antwort  gefunden  hatte,  würde  er  nicht 
heimkehren. 
Ando öffnete die Wohnungstür. Sein Versuch, sie einen Spalt offen 
zulassen,  scheiterte.  Kaum  hatte  er  einen  Fuß  in  die  ʺWohnung  ge‐
setzt, fiel die Tür auch schon hinter ihm ins Schloss. 
Er ging zum offenen Balkonfenster, machte es zu und riss die Vor‐
hänge  mit  einem  Ruck  auf.  Der  Stand  der  Nachmittagssonne  verriet 
ihm, dass es etwa 15 Uhr war. Während er die warmen Strahlen der 
Herbstsonne  auf  seinem  Rücken  spürte,  schaute  er  sich noch  einmal 
genau um. Der Raum strahlte weder eine weibliche noch eine männ‐
liche  Atmosphäre  aus.  Auf  den  ersten  Blick  hätte  man  nicht  sagen 
können, ob das Apartment einer Frau oder einem Mann gehörte. 
Auf  dem  Stuhl  lag  das  Nachthemd,  darauf  Mais  Unterwäsche. 
Zitternd streckte Ando eine Hand nach dem Slip aus und hob ihn an 
seine  Nase.  Er  sog  Mais  Geruch  tief  ein.  Rasch  legte  er  den  Slip  auf 
den  Stuhl  zurück.  Doch  seine  sexuelle  Fantasie  war  entflammt. 
Getrieben  von  einer  bebenden  Lust,  griff  Ando  erneut  nach  dem 
erotischen Wäschestück und vergrub das Gesicht darin. Er nahm den 
Geruch von Milch wahr. Sein Sohn hatte so gerochen, als er noch ein 
Baby  gewesen  war.  Vielleicht  hatte  sie  doch  noch  nie  Sex  mit  einem 
Mann? Der Geruch einer Jungfrau ähnelte dem eines Babys. 
Ando legte die Unterwäsche auf den Stuhl zurück. Dabei geriet der 
Fernseher  in  seinen  Blickfang.  Ein  rotes  Lämpchen  glühte,  er  schien 
angeschaltet  zu  sein.  Instinktiv  drückte  Ando  auf  ›Eject‹.  Und  siehe 
da, eine Videokassette sprang heraus. 
Liza  Minelli,  Frank  Sinatra,  Sammy  Davis  Jr.,  1989,  stand  auf  dem 
Etikett. 
Die Handschrift verriet, dass es sich nicht um die einer Frau handel‐
te.  Mit  einem  dicken  schwarzen  Stift  waren  die  Buchstaben  auf  das 
weiße  Label  geschmiert  worden.  Ando  betrachtete  die  Kassette  von 
allen Seiten. Das Band war an den Anfang zurückgespult, aber darü‐
ber hinaus konnte er nichts Besonderes feststellen. Gleichgültig schob 
er das Video in den Rekorder. Just in dem Moment durchzuckte ihn 
ein Geistesblitz: das Video! Die verrückte Geschichte von Mai kam ihm 
wieder in den Sinn. Verwundert hatte sie ihm erzählt, dass Asakawa 
sich  einen  Tag  nach  Ryujis  Tod  bei  ihr  nach  einem  Video  erkundigt 
habe.  Zudem  hatte  ein  schwarzer  Videorekorder  auf  dem  Beifahrer‐
sitz  des  Unfallwagens  gelegen.  Welcher  Zusammenhang  bestand 
zwischen  diesen  Ereignissen?  Was  hatte  ein  Video  mit  den  rätsel‐
haften Todesfällen zu tun? 
Ando drückte auf ›Play‹. 
Das  Band  begann  zu  laufen.  Wirre  Geräusche  waren  zu  hören. 
Doch plötzlich trat Stille ein, eine tiefe, undurchdringliche Stille. Eine 
pechschwarze  Flüssigkeit  kroch  wie  ein  schmieriger,  dunkler  Ölfilm 
über  die  Mattscheibe,  bis  sie  vollkommen  in  schwarze  Finsternis 
getaucht  war.  Ein  winziger  Lichtpunkt  flackerte  mitten  auf  dem 
schwarzen Bildschirm auf; er sprang von einer Seite zur anderen und 
wurde immer größer. 
Obwohl  der  Film  noch  nicht  lange  lief,  fühlte  Ando  sich  mit  jeder 
Sekunde  unbehaglicher.  In  seiner  Magengegend  breitete  sich  ein 
flaues Gefühl aus. 
Der Lichtpunkt begann sich in verästelte Linien aufzuzweigen; die 
Szenerie  wechselte.  Auf  dem  Bildschirm  erschien  ein  bekannter 
Werbespot.  Der  Wechsel  war  äußerst  abrupt  erfolgt,  die  schwarze 
Finsternis  wich  einem  weißen  Bildschirmhintergrund.  Es  schien,  als 
wäre die dunkle Seite des Lebens durch die helle verdrängt wurden. 
Es  folgte  eine  Werbung  nach  der  anderen.  Ando  spulte  das  Band 
vor.  Die  Wettervorhersage  erschien  auf  der  Mattscheibe.  Eine 
freundlich  lächelnde  Frau  erklärte  die  Wetterkarte.  Anschließend 
begann  eine  Morgenshow.  Nervös  lief  der  Moderator  mit  einem 
Mikrofon  in  der  Hand  vor  der  Kamera  auf  und  ab  und  berichtete 
ausschweifend  über  den  neuesten  Klatsch  und  Tratsch  aus  der 
Promiwelt.  Belangloses  Zeug:  Wer  ließ  sich  von  wem  scheiden  und 
Ähnliches.  Doch  von  der  angekündigten  Musiksendung  keine  Spur. 
Vermutlich war sie überspielt worden. 
Während Ando sich das Video ansah, löste sich seine Anspannung 
allmählich.  Er  hatte  von  Anfang  an  nicht  wirklich  geglaubt,  Frank 
Sinatra oder Liza Minelli auf der Mattscheibe zu sehen, und sich auf 
schreckliche  und  bizarre  Szenen  gefasst  gemacht.  Doch  abgesehen 
von  den  ersten  Momenten  war  das  Video  wirklich  harmlos  — 
lediglich  Sendungen  aus  dem  alltäglichen  Fernsehprogramm.  Die 
Wettervorhersage, eine Morgenshow, gefolgt von einem historisches 
Drama. 
Plötzlich  hatte  Ando  eine  Idee.  Nervös  spulte  er  das  Band  zurück, 
bis die nett lächelnde Wetterfee wieder auf der Mattscheibe erschien. 
Mit freundlicher Stimme begann sie: »Und nun das Wetter von heute, 
Dienstag, den 13. November.« 
Er drückte die Pause‐Taste. 
13. November. 
Heute  war  der  15.  November.  Die  Sendung  war  also  vorgestern 
Morgen aufgenommen worden. Aber von wem? 
Von Mai? War sie vielleicht vorgestern hier? 
Aber  dann  stellte  sich  die  Frage,  warum  der  Briefkasten  so  voll 
gestopft war. Eher unwahrscheinlich, dass sie vergessen hatte, ihn zu 
leeren. 
Plötzlich  begriff  er.  Vermutlich  hatte  Mai  den  Videorekorder  vor 
ihrer Abreise programmiert. 
Das  Geräusch  eines  aufprallenden  Wassertropfens  unterbrach  An‐
dos Gedanken. Automatisch fixierte er den Wasserhahn in der Koch‐
nische, doch dieser schien nicht zu tropfen. Er ging zum Badezimmer. 
Die  Tür  stand  nach  wie  vor  halb  offen.  Ando knipste  das Licht  an 
und stieß sie auf. Es gab einen lauten Knall, als sie gegen das Klosett 
prallte. Irritiert zwängte er sich in das enge Bad hinein und prüfte, ob 
die  Dusche  oder  der  Wasserhahn  undicht  waren.  Alles  schien  in 
Ordnung zu sein, da tropfte nichts. Just in dem Moment vernahm er 
wieder  das  Geräusch  eines  aufprallenden  Wassertropfens.  Er  kam 
von  der  Decke.  Ungläubig  starrte  Ando  in  die  Badewanne;  das 
Wasser  stand  etwa  zehn  Zentimeter  hoch  auf  dem  Wannenboden. 
Abermals  platschte  ein  dicker  Tropfen  von  der  Decke  herab  und 
schlug kleine, ringförmige Kreise auf der Wasseroberfläche. Ein paar 
Haare tanzten im Kreis. 
Der  Stöpsel  war  herausgezogen.  Ando  verstand  nicht,  was  das 
bedeutete.  Vermutlich  eine  Abflussverstopfung  durch  Haare,  dachte  er 
dann, während er beobachtete, wie das Wasser langsam absickerte. 
Plötzlich begriff er — doch damit kam eine neue Frage auf: Wer in 
Teufels  Namen  hat  den  Stöpsel  aus  der  Badewanne  gezogen?  Der  Haus‐
meister konnte es nicht gewesen sein, war er doch nur für den Bruch‐
teil einer Minute in der Wohnung gewesen. Aber wer sonst könnte das 
Wasser abgelassen haben? 
Vorsichtig  tippte  Ando  mit  dem  Finger  in  das  Wasser.  Es  war 
lauwarm. Um seinen Finger wickelten sich ein paar Haare. Das gleiche 
Gefühl ..., dachte er erschrocken. Als er damals seine Hand in die seit 
über zehn Stunden tote Leiche der jungen Frau geschoben hatte, hatte 
er dieselbe Wärme gespürt. Offensichtlich hat jemand vor ungefähr einer 
Stunde heißes Wasser in die Badewanne gelassen und vor wenigen Minuten 
den Stöpsel herausgezogen. 
Wie war das möglich? In der letzten Stunde war definitiv niemand 
außer  ihm  hier  gewesen,  ja  alles  deutete  daraufhin,  dass  seit  über 
einer Woche kein Mensch mehr seinen Fuß in das Apartment gesetzt 
hatte. Aber ... 
Ando fühlte sich unbehaglich. 
Rasch  zog  er  die  Hand  aus  dem  Wasser  und  wischte  sie  an  seiner 
Hose ab. Sein Blick fiel auf den Boden. Was war das? Auf den Fliesen 
unterhalb des Toilettenpapierbehälters klebte etwas Grünlich‐blaues. 
Kot  schien  es  nicht  zu  sein.  Es  sah  nach  Erbrochenem  aus.  Die 
Flecken schienen sich bereits in den Boden gefressen zu haben. 
Mai hat sich anscheinend erbrochen ... 
Ando  bückte  sich,  um  das  Erbrochene  aus  nächster  Nähe  zu 
betrachten.  Dabei  verlor  er  das  Gleichgewicht  und  prallte  mit  dem 
Kopf gegen die Kloschüssel. 
Sein  Sturz  wurde  von  einem  höhnischen,  unheimlich  dröhnenden 
Lachen begleitet. Ando stellten sich die Haare auf. Er versuchte, sich 
zu  beruhigen.  Das  war  sicher  nur  Einbildung.  Jetzt  habe  ich  schon 
Hirngespinste!  Regungslos  lag  er  mit  verzerrter  Miene  über  dem 
Klosett. Da, schon wieder! Erneut hallte ein gespenstisches Lachen in 
seinen Ohren. 
Ando  durchzuckte  ein  Schauer.  Kalter  Schweiß  rann  ihm  übers 
Gesicht.  Den  Atem  anhaltend,  verharrte  er  mucksmäuschenstill  und 
lauschte. 
Nein, es war keine Einbildung. Ich habe es eindeutig gehört. Das Lachen 
kam  von  unten  ...  wie  eine  Blume,  die  aus  dem  Boden  wächst  und  ihre 
Blüten entfaltet... 
Schon  wieder!  Ando  war  sich  nun  ganz  sicher:  Das  teuflische 
Lachen  war  keine  Einbildung.  Er  spürte  intensive,  bohrende  Blicke 
im Rücken. Irgendetwas schien hinter ihm zu lauern. Panische Angst 
ergriff ihn. Sein Herz begann wie wild zu pochen, das Blut pulsierte 
in  seinen  Adern.  Vielleicht  spielte  ihm  seine  Fantasie  nur  einen 
Streich? Wie gern hätte Ando daran geglaubt ... Doch das Gefühl war 
zu  intensiv.  Nein,  das  konnte  unmöglich  Einbildung  sein.  Wenn  er 
sich jetzt umdrehte, hätte er Gewissheit ... Doch er war unfähig, sich 
zu bewegen. In den Klauen der Angst gefangen, konnte er sich nicht 
einmal umdrehen. 
Um  seine  Schultern  herum  stieg  ein  teuflischer  Kälteschauer  auf, 
der  seinen  Rücken  erfasste  und  schließlich  seine  Wirbelsäule  hinab‐
zukriechen  begann,  tiefer  und  immer  tiefer.  Trotz  seiner  Bemühun‐
gen,  zum  rationalen  Denken  zurückzufinden,  gelang  es  Ando  nicht, 
einen  klaren  Gedanken  zu  fassen.  Erneut  ergriff  ihn  die  Panik.  Am 
liebsten  hätte  er  laut  geschrien.  Schließlich  stieß  er  mit  krächzender, 
zitternder  Stimme  hervor:  »Sind  Sie  das,  Hausmeister?«  Ein  leichter 
Windzug streifte seine Beine. Etwas berührte seine nackte Haut zwi‐
schen  Hose  und  Socken.  Eine  Gänsehaut  überzog  seine  Beine.  Nein, 
er  durfte  sich  nicht  von  seiner  Angst  überwältigen  lassen.  Er  nahm 
allen Mut zusammen und richtete sich langsam auf. Immerhin wusste 
er, dass es Ängste gab, die durch die Einbildungskraft noch verstärkt 
wurden. Er versuchte, sich einzureden, dass vermutlich nur eine Kat‐
ze um seine Beine gestrichen war, die sich zuvor in irgendeiner Ecke 
des Zimmers versteckt hatte. Aber seine körperliche Reaktion war zu 
stark  gewesen,  als  dass  er  das  hätte  glauben  können.  Sein  sechster 
Sinn  sagte  ihm,  dass  es  etwas  anderes  gewesen  war  —  etwas  Über‐
sinnliches. 
Erneut nahm er das Gluckern des Abflusses wahr. Gleichzeitig hör‐
te er Schritte auf dem Parkett, die sich langsam von ihm zu entfernen 
schienen. 
Nun konnte er seiner Angst nicht länger standhalten. Er stieß einen 
lauten  Schrei  aus,  trat  mit  den  Füßen  gegen  die  Badezimmertür, 
veranstaltete  einen  Riesenlärm,  drückte  sogar  die  Toilettenspülung. 
Während seines inszenierten Kampfes gewann er allmählich an Mut. 
Er richtete sich auf und lauschte, ob das unheimliche Phänomen noch 
hinter  ihm war.  Verzweifelt  überlegte  er,  wie er  hier  am besten  her‐
auskam, ohne sich umdrehen zu müssen. Es könnte ja sein ... Allein 
der Gedanke ließ ihn erschaudern. Tausend kleine Spinnen schienen 
über seine Haut zu krabbeln. 
Langsam bewegte Ando sich rückwärts, mit der Ferse tastend, um 
nicht  gegen  etwas  zu  stoßen.  Kaum  im  anderen  Zimmer  angekom‐
men,  wirbelte  er  wie  der  Blitz  herum  und  rannte  in  Panik  ins  Trep‐
penhaus. Aus dem Augenwinkel sah er noch, wie die Tür ins Schloss 
fiel. 
Nach  Atem  ringend  lief  er  zum  Fahrstuhl.  In  seiner  Hosentasche 
klirrte der Schlüssel. Dieses Geräusch beruhigte ihn. Zum Glück hatte 
er ihn nicht im Apartment liegen gelassen. 
Keine zehn Pferde kriegen mich da noch mal rein. Irgendein Etwas lauert 
dort... 
Ando  konnte  sich  an  jeden  Zentimeter  in  der  Wohnung  erinnern. 
Nirgends  hatte  es  einen  Schlupfwinkel  gegeben.  Der  zusammen‐
gelegte Futon, der Kleiderständer... Wenn es nicht etwas sehr Kleines 
war ... 
Ein lautes Summen drang an sein Ohr — ein Moskito. Ungewöhnlich 
für  die  kalte  Jahreszeit,  dachte  er,  mit  den  Händen  über  dem  Kopf 
herumfuchtelnd. Aber der Moskito ließ sich nicht verjagen. Plötzlich 
hatte  Ando  einen  Hustenanfall.  Eine  eisige  Kälte  umklammerte  ihn. 
Fröstelnd  steckte  er  die  Hände  in  die  Hosentaschen.  Wo  bleibt  nur 
dieser  verdammte  Fahrstuhl?  Wütend  blickte  er  auf  die  digitale  An‐
zeige. Der Lift stand im Erdgeschoss. Nichts bewegte sich. Vermutlich 
habe  ich  vergessen,  auf  den  Knopf  zu  drücken.  Er  betätigte  die  Taste. 
Dann vergrub er die Hände wieder in den Hosentaschen. 
 

 
»He, über was grübelst du nach?« 
Erst jetzt merkte Ando, dass Miyashita mit ihm sprach. Er war mit 
seinen  Gedanken  weit  weg  gewesen.  Die  Erinnerung  an  das  Gefühl 
in Mais Apartment hatte ihn wie eine Flutwelle weggerissen. Er war 
noch  in  den  Klauen  der  Angst  gefangen,  sein  Pulsschlag  hatte  sich 
nicht  beruhigt.  Ohne  seinen  Zustand  wahrzunehmen,  plapperte 
Miyashita  unbekümmert  weiter.  Zwar  hallten  seine  Worte  in  Andos 
Ohren nach, doch ihre Bedeutung erreichte ihn nicht. 
»Hörst du mir überhaupt zu?« 
»Ja,  ja.  Ich  höre  dir  zu.  Und  dann?«,  entgegnete  Ando  desinte‐
ressiert. 
»Was ist nur mit dir los? Du weißt, ich bin immer für dich da. Also, 
wenn dir etwas auf dem Herzen liegt...« 
Miyashita  zog  einen  Hocker  unter  dem  Tisch  hervor  und  legte 
gemütlich seine Beine darauf. 
Außer  den  beiden  war  niemand  mehr  in  der  Gerichtsmedizin.  Die 
Dunkelheit hatte sich bereits über die Stadt gesenkt, obwohl es erst 18 
Uhr  war.  Ando  war  von  Mais  Apartment  zu  seinem  Büro  zurück‐
gefahren.  Dort  hatte  Miyashita  schon  ungeduldig  auf  ihn  gewartet. 
Wenn  ich  doch  nur  eine  Minute  für  mich  gehabt  hätte,  eine  kleine  Ver‐
schnaufpause...  Ando  war  nicht  einmal  Zeit  geblieben  durchzuatmen, 
geschweige denn, sich von dem Schock zu erholen. Kaum hatte er das 
Büro  betreten,  quasselte  Miyashi‐ta  auch  schon  auf  ihn  ein.  Aber 
Ando  war  mit  seinen  Gedanken  woanders.  Die  Ereignisse  von  vor 
zwei  Stunden  spielten  sich  immer  wieder  vor  seinem  inneren  Auge 
ab. Wie hätte er das Erlebte auch in so kurzer Zeit verarbeiten sollen? 
Der  Schrecken  saß  zu  tief,  um  ihn  von  einer  Minute  auf  die  andere 
abzuschütteln. Ängste verflogen nicht so schnell ... Nach Fassung rin‐
gend, versuchte er, sich auf das Jetzt zu konzentrieren, doch das war 
nicht  einfach.  »Nein,  es  ist  nichts.  Wirklich,  mir  geht  es  gut.«  Ando 
verschwieg den Besuch in Mais Apartment, aber nicht, weil er seinem 
Freund  etwas  vorenthalten  wollte.  Der  Grund  war  ein  anderer.  Er 
wusste  nicht,  wie  er  das  Erlebte  in  Worten  hätte  ausdrücken  sollen. 
Vielleicht  so?  Stell  dir  vor,  du  gehst  um  Mitternacht  nichts  ahnend 
aufs Klo, und während du gemütlich dein Geschäft verrichtest, spürst 
du  plötzlich  etwas  hinter  deinem  Rücken.  Du  hast  das  Gefühl,  ein 
unheimliches Phänomen starrt dich an, lässt nicht eine Sekunde den 
Blick von dir. Angst packt dich. Verzweifelt überlegst du, was du tun 
sollst,  aber  du  kannst  keinen  klaren  Gedanken  fassen.  Mit  jeder 
Sekunde  arbeitet  deine  Einbildungskraft  intensiver.  So  reift  das 
lauernde  Etwas  in  deiner  Fantasie  zu  einem  bedrohlichen  Monster 
heran,  das nur  darauf  wartet,  dich  in  seine  Fänge  zu  bekommen.  Es 
wird  immer  größer  und  gefährlicher,  bis  du  dich  umdrehst  und 
dieser schrecklichen Vision ein Ende setzt. 
Die Sache hatte nur einen Haken. Was Ando gespürt hatte, ließ sich 
nicht  so  einfach  beschreiben.  Als  er  in  Mais  Bad  gestürzt  war,  hatte 
irgendein  mysteriöses,  höhnisch  lachendes  Phantom  hinter  ihm  ge‐
lauert. Das Gefühl war zu intensiv gewesen, als dass alles nur seiner 
Fantasie  entsprungen  sein  konnte.  Außerdem  war  er  von  Natur  aus 
kein schreckhafter oder furchtsamer Mensch. Doch dieses namenlose 
Etwas  hatte  ihm  eine  derartige  Angst  eingejagt,  dass  er  sich  nicht 
einmal mehr umdrehen konnte, um die ›Vision‹ auszulöschen. 
»Du  siehst  ganz  schön  fertig  aus.  Ist  wirklich  alles  in  Ordnung?«, 
fragte Miyashita, während er seine Brille putzte. 
»Es  liegt  sicher  nur  daran,  dass  ich  in  den  letzten  Wochen  wenig 
geschlafen  habe.«  Das  war  nicht  mal  eine  Lüge.  Ando  schreckte  in 
letzter Zeit oft mitten in der Nacht schweißgebadet hoch und konnte 
dann nicht wieder einschlafen. 
»Na  gut.  Aber  tu  mir  einen  Gefallen,  ja?  Frag  mich  nicht  alles 
zweimal.  Dir  würde  es  doch  auch  auf  den  Senkel  gehen,  wenn  dich 
ständig jemand mitten im Satz unterbrechen und dasselbe noch mal 
fragen würde.« 
»Tut mir Leid«, gab Ando kleinlaut zurück. 
»Kann ich fortfahren?« 
»Ja, leg los.« 
»Stell  dir  vor,  das  Virus,  das  bei  den  beiden  in  Yokohama  obdu‐
zierten Leichen entdeckt wurde...« 
»Du  meinst  das  Virus,  das  dem  Pockenerreger  ähnlich  sein  soll?«, 
unterbrach Ando. 
»Richtig, dieses Virus.« 
»Was  hat  die  Analyse  denn  ergeben?  Weist  es  eine  Überein‐
stimmung mit dem in Ryujis Blut entdeckten Virus auf?« 
Miyashita  schlug  schnaufend  mit  der  Hand  auf  den  Tisch.  Er 
konnte seine Wut kaum verbergen. Fassungslos schaute er Ando ins 
Gesicht. »Du hast mir nicht zugehört! Davon rede ich doch die ganze 
Zeit.  Wo  bist  du  nur  mit  deinen  Gedanken?  Es  ist  zum  Verrückt‐
werden mit dir. Also noch mal: Wir haben das Virus mit dem DNA‐
Sequenzer analysiert, um den genetischen Kode zu entschlüsseln. Die 
Daten  wurden  dann  mit  dem  Computer  ausgewertet.  Und  was  soll 
ich  dir  sagen,  die  bei  den  Leichen  entdeckten  Viren  sind  zu  einem 
hohen  prozentualen  Anteil  miteinander  identisch,  und  —  halt  dich 
fest  —  es  besteht  in  der  Tat  eine  verdammt  starke  Ähnlichkeit  mit 
dem Pockenvirus ...« 
»Du  sagst  also,  es  ähnelt  dem  Pockenvirus,  ist  aber  nicht  hun‐
dertprozentig  mit  ihm  identisch.  Habe  ich  das  richtig  verstanden?« 
Ungläubig schaute Ando Miyashita an. 
»Genau so ist es. Die DNA des Virus stimmt zu siebzig Prozent mit 
den Pocken überein.« 
»Und was ist mit den übrigen dreißig Prozent?« 
»Das ist das Verblüffende. Die übrigen dreißig Prozent stimmen mit 
der Nukleotid‐Sequenz überein, die für ein Enzym kodiert.« 
»Wessen Enzym?« 
»Das eines Menschen.« 
»Du scherzt, oder?« 
»Ich  kann  verstehen,  dass  dies  in  deinen  Ohren  unglaubwürdig 
klingen mag. Aber das sind nun mal die Fakten. Die Gene des Virus, 
das  bei  einer  anderen  Leiche  entdeckt  wurde,  enthielten  wiederum 
den  Kode  für  Eiweiß.  Mit  anderen  Worten,  wir  haben  es  hier  mit 
einer  neuen  Virengruppe  zu  tun;  eine  genetische  Kombination  aus 
Pocken und menschlichem DNA‐Virus.« 
Das  Pockenvirus  gehörte  zur  Gruppe  der  DNA‐Viren.  Hätte  es  zu 
den  Retroviren  gezählt,  wäre  es  weniger  erstaunlich  gewesen,  wenn 
es  menschliche  Gene  enthielt.  Der  Grund  dafür  war  einfach.  Das 
Retrovirus brachte von Haus aus ein Enzym mit, die Reverse Trans‐
kriptase,  das  die  RNA  des  Virus  in  DNA  ›um‐schrieb‹,  mit  anderen 
Worten  eine  DNA‐Kopie  der  Virus‐RNA  herstellte,  die  dann  in  das 
Genom  der  Wirtszelle  eingebaut  werden  konnte.  Doch  im  Unter‐
schied dazu besaßen DNA‐Viren dieses Enzym nicht. Wie konnte es 
dann aber menschliche Gene in sich aufnehmen? Ando hatte keinen 
blassen Schimmer. Noch ein anderer Aspekt war ihm unerklärlich: Je 
nach  Virus  schienen  dreißig  Prozent  der  DNA  zu  variieren.  Mal 
waren  es  Nukleotid‐Sequenzen,  die  für  ein  Enzym  kodierten,  dann 
wiederum Gene, die für ein Eiweiß kodierten. 
»Lässt sich das bei Ryuji entdeckte Virus dieser neuen Virusgruppe 
zuordnen? Kannst du dazu schon etwas sagen?« 
»Endlich  sind  wir  an  dem  Punkt  angelangt,  über  den  ich  mit  dir 
schon die ganze Zeit sprechen wollte. Du hast es erraten: Das Virus, 
das  in  Ryujis  Blut  festgestellt  wurde,  gehört  zu  dieser  neuen 
Virusgruppe.« 
»Wir  haben  es  also  mit  einem  Virus  zu  tun,  das  ein  Gemisch  aus 
Pockenvirus und menschlichem DNA‐Virus ist?« 
»Ja, weitgehend.« 
»Weitgehend? Was heißt das nun wieder?« 
»Es stimmt nur in gewisser Weise, denn das ist noch nicht alles. Wir 
haben  bei  der  DNA‐Sequenzierung  eine  weitere  Besonderheit 
festgestellt;  und  zwar  wiederholt  sich  die  veränderte  Nukleotid‐
Sequenz  in  jedem  Gen‐Abschnitt.  Mit  anderen  Worten:  Welchen 
Abschnitt  man  auf  der DNA  auch  herausgreift  und  analysiert,  es  ist 
immer die gleiche Vierziger‐Basenfolge vorzufinden.« 
Ando schwieg verblüfft. 
»Das Verrückte an der ganzen Sache ist aber, dass dies nur bei Ryuji 
so zu sein scheint. Das Virus der in Yokohama sezierten Leichen wies 
diese Besonderheit nicht auf.« 
»Nur um sicher zu sein, dass ich es richtig verstehe: Du sagst, das in 
Yokohama entdeckte Virus unterscheidet sich von dem in Ryujis Blut 
geringfügig?« 
»Du  hast  es  erfasst.  Einerseits  ähneln  sie  sich  zwar,  aber  sie  un‐
terscheiden  sich  auch  geringfügig  voneinander.  Ich  kann  erst  mehr 
dazu sagen, wenn die Daten von den anderen Instituten vorliegen.« 
In  diesem  Moment  klingelte  das  Telefon.  Miyashita  schnalzte  mit 
der Zunge. »Jetzt auch noch das Telefon!« 
»Entschuldige mich bitte kurz.« Ando stand auf und griff nach dem 
Hörer. »Ja, bitte?« 
»Mein Name ist Yoshino. Ich bin ein Journalist bei der Zeitung M. 
Könnte ich bitte Herrn Ando sprechen?« 
»Am Apparat.« 
»Sie  sind  Dr.  Ando  von  der  Gerichtsmedizin?«,  vergewisserte  sich 
Yoshino. 
»So ist es.« 
»Ich  habe  gehört,  dass  Sie  am  20.  des  vergangenen  Monats  die 
Leiche von Ryuji Takayama obduziert haben. Ist das richtig?« 
»Ja. Ich habe die Autopsie durchgeführt.« 
»Verstehe.  Ich  würde  Ihnen  gern  einige  Fragen  stellen.  Natürlich 
nur, wenn es Ihnen recht ist.« 
»Nun ...« Während Ando überlegte, wie er reagieren sollte, flüsterte 
Miyashita neugierig: 
»Wer ist das?« 
Ando hielt die Muschel zu. »Ein Journalist von der Zeitung M.« Er 
nahm die Hand weg und fragte Yoshino: »Worum geht es denn?« 
»Ich  würde  gern  Ihre  Meinung  zu  der  mysteriösen  Todesserie 
erfahren ...« 
Ando  schrak  zusammen.  Die  Bezeichnung  ›mysteriöse  Todesserie‹ 
gefiel  ihm  überhaupt  nicht  —  die  Medien  waren  also  an  der  Sache 
dran. Das war nun wirklich nicht der richtige Zeitpunkt dafür. So ein 
verdammter  Mist.  Wie  konnte  das  nur  passiert  sein?  Die  Leichen 
waren doch gerade erst vor zwei Wochen obduziert worden! 
»Was meinen Sie mit ›mysteriöse Todesserie‹?« Ando versuchte, so 
ruhig wie möglich zu klingen. Er wollte den Eindruck vermitteln, als 
hätte  er  nicht  den  leisesten  Schimmer,  wovon  Yoshino  sprach.  Das 
war  der  einzige  Weg,  um  aus  diesem  Journalisten  herauszukitzeln, 
wie viel er wusste. 
»Ryuji  Takayama,  Tomoko  Oishi,  Haruko  Tsuji,  Shuichi  Iwata, 
Takehiko  Nomi  sowie  die  Frau  und  Tochter  von  Asakawa  —  das 
meine ich damit.« 
Ando  gefror  das  Blut  in  den  Adern.  Durch  welches  Nadelöhr 
konnten diese Informationen nur durchgesickert sein? Er schwieg. 
»Wie sieht es bei Ihnen aus? Können wir uns treffen?« 
Ando  dachte  verzweifelt  nach.  Sicherlich  wäre  es  gut  zu  erfahren, 
was  dieser  Journalist  bisher  herausgefunden  hatte.  Möglicherweise 
verfügte er ja über interessante Informationen, auf die er selbst noch 
nicht gestoßen war. Er könnte Yoshino treffen und sich anhören, was 
der  zu  sagen  hatte.  Sein  Wissen  brauchte  er  ja  nicht  preiszugeben. 
»Gut, einverstanden. Wir können uns gern unterhalten.« 
»Wann würde es Ihnen am besten passen?« 
Ando  blickte  in  seinen  Terminkalender.  »Ich  nehme  an,  Sie  be‐
vorzugen ein baldiges Treffen? Wie wäre es mit morgen Mittag? Da 
hätte ich zwei Stunden Zeit.« 
Für  einen  Moment  herrschte  Schweigen.  Yoshino  schien  ebenfalls 
seine  Termine  zu  checken.  »Das  müsste  gehen.  Ich  werde  morgen 
Mittag zu Ihnen ins Büro kommen.« 
Sie verabschiedeten sich und hängten ein. 
»Was wollte der Typ von dir?«, fragte Miyashita neugierig. 
»Er möchte mich treffen.« 
»Dich  treffen?  Wozu?  Nun  lass  dir  doch  nicht  alles  aus  der  Nase 
ziehen!« 
»Er möchte mir Fragen stellen.« 
»Ach  so  ...«  Miyashita  dachte  nach.  »Da  haben  wir  den  Salat.  Ich 
befürchte,  die  Sache  ist  an  die  Presse  durchgesickert...  Aber  wie 
haben sie davon Wind bekommen? Ob vielleicht ein Betroffener oder 
ein Pathologe von einem anderen Institut geredet hat?« 
»Ich weiß es nicht. Das werde ich morgen schon herausfinden.« 
»Pass  bloß  auf,  was  du  sagst.  Überleg  dir  jedes  Wort  genau.  Diese 
Journalisten sind mit allen Wassern gewaschen.« 
»Das weiß ich. Mach dir keine Sorgen.« 
»Erwähn unter gar keinen Umständen das Virus. Hast du gehört?« 
»Natürlich nicht. Was denkst du denn von mir? Aber was, wenn er 
längst davon weiß?« 
In diesem Moment erkannte Ando die Zusammenhänge: Asakawa 
war für die gleiche Zeitung tätig. Vermutlich war Yoshino sogar ein 
Kollege  von  ihm.  Nicht  auszuschließen,  dass  sie  gemeinsam  in  dem 
Fall  recherchierten.  Sicherlich  verfügte  dieser  Yoshino  über  eine 
Menge  interessanter  Informationen.  Ando  konnte  das  Treffen  am 
folgenden Tag kaum erwarten. 
 

 
Yoshino saß wie auf Kohlen. Mehrmals streckte er seine Hand nach 
dem Glas Wasser aus, um unauffällig einen Blick auf seine Armband‐
uhr zu werfen. Doch Ando war der nervöse Blick keineswegs entgan‐
gen. Er verstand: Yoshino würde sich in den nächsten paar Minuten 
höflich  von  ihm  verabschieden.  Dann  wäre  das  Gespräch  beendet. 
Vermutlich hatte er heute noch einen wichtigen Termin. 
Aber es kam anders. 
»Bitte  entschuldigen  Sie  mich  für  einen  Moment.«  Yoshino  sprang 
auf und verbeugte sich leicht. Hastig drängte er sich durch die Tisch‐
reihen  und  lief  auf  das  Telefon  neben  der  Kasse  zu.  Dort  kramte  er 
sein  Notizbuch  aus  der  Tasche,  schlug  es  auf  und  tippte  mit  flinken 
Fingern eine Nummer ein. 
Ando lehnte sich zurück. Yoshino hatte ihn heute Mittag in seinem 
Büro aufgesucht. Seit ungefähr einer Stunde saßen sie in diesem Cafe. 
Noch immer lag die Visitenkarte vor Ando — Kenzo Yoshino, Zeitung 
M, Yokosuka‐Office. 
Yoshino  hatte  ihm  eine  unglaubliche  Geschichte  aufgetischt.  Ando 
war  noch  immer  wie  benebelt  von  dem,  was  er  eben  gehört  hatte. 
Tausend Gedanken schwirrten ihm durch den Kopf. Unendlich viele 
Fragen  hatten  sich  ihm  aufgedrängt,  während  er  gespannt  Yoshinos 
Worten  gelauscht  hatte. Als  er  sie  eben  aussprechen  wollte,  war  der 
Journalist aufgesprungen und zum Telefon gerannt. 
Schenkte  man  Yoshinos  Ausführungen  Glauben,  hatte  die  rät‐
selhafte  Todesserie  am  späten  Abend  des  29.  August  ihren  Anfang 
genommen. Ort des Geschehens war das Pazifikland in Süd‐Hakone 
auf  der  Izu‐Halbinsel.  Vier  junge  Leute,  die  einen  vergnüglichen 
Abend  im  Blockhüttendorf  dieses  Ferienressorts  verbracht  hatten, 
waren  auf  ein  mysteriöses  Videoband  gestoßen,  das  durch  den  Ein‐
satz  der  menschlichen  Sinne  zustande  gekommen  war.  Wer  dieses 
Video sah, war dazu verdammt, exakt eine Woche später zu sterben 
— so lautete der Wortlaut am Schluss des unheimlichen Videos. 
Ando  fand  diese  Geschichte  zwar  äußerst  amüsant  und  packend, 
aber  vollkommen  unglaubwürdig.  Das  Ganze  war  absurd  ... 
Gedankenbilder!  Es  war  unmöglich,  ohne  technische  Hilfe,  nur  mit 
den  eigenen  Sinnen,  ein  Video  zu  bespielen.  Obwohl,  wenn  er  so 
nachdachte ... 
Er hielt für einen Moment inne. Was war mit seinen eigenen Erleb‐
nissen in dieser Richtung? Die Zeitungsecke mit den sechs magischen 
Zahlen,  die  aus  Ryujis  zusammengenähter  Haut  herausgestanden 
hatte  ...  Der  starke  Impuls  in  Mais  Apartment...  Würde  er  einem 
anderen  Menschen  davon  berichten,  dann  hielte  ihn  dieser  mit 
Sicherheit für mindestens genauso verrückt. Was redet der dafür wirres 
Zeug?, hieße es. Ando wusste, dass sich das Realitätsempfinden eines 
Menschen je nach Beteiligungsgrad unterschied. Hing jemand tief in 
einer Sache drin und machte die Erfahrungen am eigenen Leibe, dann 
war das etwas vollkommen anderes, als wenn ein indirekt Beteiligter 
nur die Resultate präsentiert bekam. 
Yoshino hatte in diesem Fall recherchiert, und was er Ando erzählt 
hatte,  waren  seine  Erkenntnisse.  Insofern  hatten  seine  Worte  eine 
gewisse Bedeutung. 
»Es tut mir Leid, dass ich Sie warten gelassen habe.« Yoshino setzte 
sich.  Sein  Stift  kratzte  über  Papier.  Ab  und  zu  bohrte  er  sich  damit 
nachdenklich  in  seine  unrasierten  Wangen.  Vermutlich  ließ  er  sich 
einen  Bart  stehen,  um  von  seinem  lichten  Haar  abzulenken,  dachte 
Ando. »Wo waren wir stehen geblieben?« 
»Ryuji Takayama begann, Nachforschungen anzustellen ...« 
»Darf ich fragen, in welcher Beziehung Sie zu ihm standen?« 
»Wir haben zusammen Medizin studiert.« 
»Ja, das habe ich gehört.« 
Yoshino  hatte  also  Nachforschungen  angestellt,  bevor  er  sich  mit 
Ando in Verbindung gesetzt hatte. Sieh an, so ein Schlitzohr. 
»Haben  Sie  sich  das  Video  auch  angeschaut?«,  erkundigte  sich 
Ando.  Diese  Frage  hatte  ihm  schon  die  ganze  Zeit  auf  der  Seele 
gebrannt. 
»Um  Himmels  willen!«  Yoshinos  runde  Augen  weiteten  sich.  »Ich 
bin  doch  nicht  lebensmüde.  Hätte  ich  es  gesehen,  würde  ich  jetzt 
schon längst im Reich der Toten weilen. Ehrlich gesagt, mir fehlte der 
Mumm.« Er lachte. 
Ando hatte zwar so eine Ahnung gehabt, dass die mysteriösen To‐
desfälle in irgendeiner Weise mit dem Video in Verbindung standen. 
Aber  er  hätte  in  seinen  wildesten  Träumen  nicht  gedacht,  das  die‐
jenigen, die es sich ansahen, exakt sieben Tage später starben. Er war 
noch immer völlig fassungslos. Diese Story glaubte man wahrschein‐
lich erst, wenn man dem Tod nach Ablauf der Frist ins Auge sah. 
Yoshino  nippte  an  seinem  kalt  gewordenen  Kaffee.  Er  wirkte  jetzt 
viel  gelassener.  Wahrscheinlich  hatte  er  seinen  nächsten  Termin 
verschieben  können.  Auch  Ando  entspannte  sich.  Dieses  ständige 
Geglotze auf die Uhr hatte ihn ganz unruhig gemacht. 
»Aber wie erklären Sie es sich, dass Asakawa noch lebt? Er hat sich 
das Video doch auch angeschaut.« Ando konnte sich einen ironischen 
Unterton  nicht  verkneifen.  So  ließ  er  durchblicken,  dass  er  von 
Yoshinos Geschichte nicht hundertprozentig überzeugt war. 
»Das  ist  genau  der  Punkt,  den  ich  auch  nicht  verstehe.«  Yoshi‐no 
beugte sich vor und fuhr fort: »Deshalb beschloss ich, ihn zu fragen. 
Vor  ein  paar  Tagen  stattete  ich  Asakawa  einen  Besuch  im  Kranken‐
haus ab. Aber leider bin ich der Antwort nicht näher gekommen. Mit 
Asakawa  war  absolut  nichts  anzufangen,  ein  Gespräch  war 
unmöglich.« 
Yoshino hatte also die gleiche Idee gehabt... 
»Aber vielleicht...« Yoshino schien etwas eingefallen zu sein. 
Ando spitzte die Ohren. »Vielleicht was?« 
»Ich  hätte  da  eine  Idee,  wie  wir  der  Sache  auf  den  Grund  gehen 
könnten. Wenn ich sie nur in die Hände bekommen könnte ...« 
»Sie?« 
»Asakawa  hat  mir  mal  erzählt,  dass  er  eine  Reportage  über  die 
Todesfälle schreiben will. Meines Wissens hatte er damit auch schon 
angefangen.  Sie  wissen  ja,  ein  Journalist  ist  nur  erfolgreich,  wenn  er 
brandneue,  aufregende  Storys  wie  am  Fließband  produziert.  Asaka‐
wa war eigentlich mehr oder weniger zufällig in die ganze Sache hin‐
eingestolpert. Eine heiße Spur, die er verfolgte, bis er sich schließlich 
das Video in der Blockhütte ansah. Dann kam Ryuji ins Spiel. Asaka‐
wa  wollte  einen  guten  Freund  an  seiner  Seite  wissen.  Allein,  dachte 
er,  würde  er  das  nicht  durchstehen.  Ryuji  schien  genau  die  richtige 
Person zu sein. Asakawa weihte ihn in alle Details ein, und sie began‐
nen mit den Nachforschungen. Schließlich wollten sie nach Atami auf 
die Izu‐Halbinsel fahren. Dort liegt vermutlich der Schlüssel für das Ge‐
heimnis  des  Fluchs  begraben,  hat  Asakawa  gesagt.  Das  ist  die  letzte 
Information,  die  ich  von  ihnen  bekommen  habe.  Sicher  haben  sie  in 
Atami  etwas  herausgefunden.  Und  Asakawa  hat  das,  wie  ich  ihn 
kenne, bestimmt niedergeschrieben und auf einer Diskette abgespei‐
chert.« Yoshino überlegte. »Wo hat er die Diskette wohl versteckt? In 
seinem Zimmer ist sie jedenfalls nicht.« 
»In welchem Zimmer?« 
Asakawa lag bekannterweise im Krankenhaus, seine Frau und seine 
Tochter  waren  tot.  Das  Apartment  der  Asakawas  konnte  Yoshino 
demnach  nicht  meinen.  Oder  etwa  doch?  Vielleicht  war  er  ja  dort 
gewesen,  um  nach  der  Diskette  zu  suchen.  So  abwegig  war  der 
Gedanke nicht. 
»Ich habe mich mit dem Hausmeister in Verbindung gesetzt. Er hat 
mir freundlicherweise die Wohnung aufgeschlossen.« 
Ando  hatte  gestern  aus  Sorge  um  Mai  das  Gleiche  getan.  Deshalb 
konnte  er  Yoshino  keine  Vorwürde  machen.  Die  Motivation  war 
zwar eine andere, aber sie waren beide ohne Befugnis in ein fremdes 
Apartment  eingedrungen.  Yoshino  machte  allerdings  nicht  im 
Geringsten  den  Eindruck,  als  hätte  er  deswegen  ein  schlechtes 
Gewissen. So waren Reporter nun mal. 
»Jeden  Winkel  habe  ich  unter  die  Lupe  genommen,  aber  nichts  ... 
Weder ein Computer noch eine Diskette.« 
Yoshino  wackelte  nervös  mit  dem  Bein.  Als  er  es  merkte,  legte  er 
sofort eine Hand auf den Oberschenkel und lächelte verlegen. 
Ando  kamen  plötzlich  die  Fotos  vom  Unfallort  in  den  Sinn.  Eines 
zeigte  den  Videorekorder  auf  dem  Beifahrersitz  —  und  auf  der 
Fußmatte  ein  Laptop.  Seine  Gedanken  begannen  sich  zu 
überschlagen. Vielleicht weiß ich, wo sich die Diskette befindet! 
Yoshino war also noch nicht auf den Trichter gekommen ... Bestens! 
Inzwischen war  Ando  recht  zuversichtlich,  dass  er  an  die  Diskette 
herankommen  würde.  Natürlich  würde  er  Yoshino  nichts  sagen  — 
der  durfte  nichts  davon  erfahren.  Wenn  Ando  die  Diskette  erst  ein‐
mal hatte, konnte er sich immer noch überlegen, ob er sie den Medien 
zuspielte  oder  nicht.  Das  kam  ganz  auf  den  Inhalt  an.  Zu  diesem 
Zeitpunkt  wusste  er  nur  eines  sicher:  Sieben  Menschen  waren  auf 
mysteriöse  Weise  ums  Leben  gekommen  —  aufgrund  derselben 
rätselhaften  Ursache:  plötzliches  Herzversagen.  Und  alle  Personen 
wiesen ein dem Pockenerreger sehr ähnliches Virus im Blut auf. 
Doch das war auch schon alles, was sie wussten. Damit konnte man 
nicht  einmal  einen  Kurzvortrag  auf  einer  Fachtagung  zum  Besten 
geben, geschweige denn Lorbeeren in der Wissenschaftsszene ernten. 
Die  Zeit  war  noch  nicht  reif.  Sie  standen  erst  ganz  am  Anfang. 
Würden  die  Medien  jetzt  von  einem  rätselhaften  Killervirus 
berichten, der sein Unwesen trieb, dann würde womöglich eine Panik 
ausbrechen.  Ando  musste  äußerste  Vorsicht  walten  lassen,  um  eine 
Massenhysterie zu vermeiden. 
Jetzt prasselte eine Frage nach der anderen auf Ando ein. 
»Was hat die Autopsie eigentlich ergeben? Welche Todesursache ist 
festgestellt worden? Haben Sie etwas gefunden, das mit dem, was ich 
Ihnen erzählt habe, irgendwie zusammenpasst?« 
Stift und Notizzettel bereit haltend, versuchte Yoshino, Details über 
die Obduktion aus Ando herauszuquetschen. Zwar antwortete Ando 
auf  jede  Frage  höflich,  doch  so  schwammig  wie  möglich.  Die  wich‐
tigsten Informationen ließ er einfach weg. In Gedanken war er ohne‐
hin woanders: Er dachte an die Diskette mit Asakawas Bericht. 
 

 
Obwohl  Samstag  war,  standen  zwei  Obduktionen  auf  dem  Pro‐
gramm.  Ando  packte  die  Gelegenheit  beim  Schopf  und  erkundigte 
sich bei dem als Zeugen anwesenden Polizisten, wie Verkehrsunfälle 
abgewickelt  wurden.  »Was  passiert  eigentlich,  wenn  sich  zum 
Beispiel  auf  der  Autobahn  in  der  Nähe  der  Ausfahrt  Oi  ein  Unfall 
ereignet?«, lautete seine erste Frage. 
»Hm,  zunächst  untersucht  man  den  Unfallort  eingehend,  dann 
macht  man  Fotos,  führt  Zeugenbefragungen  durch  und  versucht 
schließlich,  auf  Basis  dieser  Informationen  den  Unfallhergang  zu 
rekonstruieren«, erwiderte der junge Polizist mit ernster Miene. Zwar 
kannte  Ando  den  Beamten  von  mehreren  Autopsien,  doch  heute 
unterhielt er sich das erste Mal mit ihm. 
»Und dann?« 
»Das  Unfallauto  wird  abgeschleppt,  sofern  man  es  nicht  mehr 
fahren kann, ansonsten fährt der Besitzer damit weiter.« 
»Angenommen, es handelt sich um einen Mietwagen ...« 
»Dann geht das Fahrzeug an die Verleihfirma zurück.« 
»Verstehe  ...  Bitte  entschuldigen  Sie,  dass  ich  Sie  mit  so  vielen 
Fragen  löchere,  aber  in  meinem  persönlichen  Umfeld  hat  sich  ein 
tragischer  Unfall  ereignet.  Zwei  Menschen  sind  dabei  ums  Ueben 
gekommen:  eine  junge  Frau  und  ihre  Tochter.  Der  Ehemann  kam 
glimpflich  davon,  zumindest  was  die  körperlichen  Verletzungen 
betrifft. Momentan liegt er im Krankenhaus. Mich interessiert, was in 
so einem Fall mit den persönlichen Sachen der Familie geschieht, die 
sich zum Zeitpunkt des Geschehens im Auto befanden.« 
»Dafür  ist  die  Abteilung  für  Verkehrsunfälle  des  zuständigen 
Polizeireviers verantwortlich. In der Regel werden die Dinge dort für 
einen bestimmten Zeitraum aufbewahrt.« 
»Wissen  Sie  zufällig,  welches  Revier  bei  einem  Unfall  in  der  Nähe 
der Ausfahrt Oi zuständig ist?« 
»Das  kommt  darauf  an,  ob  sich  der  Unfall  auf  der  Autobahn  zu‐
getragen hat oder erst, nachdem man sie verlassen hat.« 
Die Fotos vom Unfallort waren Ando noch gut im Gedächtnis. Das 
Unglück hatte sich definitiv auf der Autobahn ereignet, kurz vor dem 
Tokio‐Bay‐Tunnel...  Er  konnte  sich  auch  dunkel  erinnern,  das 
irgendwo gelesen zu haben. »Auf der Autobahn«, antwortete er. 
»Dann ist die Autobahnpolizei zuständig.« 
Da Ando keinen blassen Schimmer hatte, wo diese ihren Sitz hatte, 
fragte er: »Wo ist das zuständige Revier?« 
»Im Bezirk Shintomi.« 
»Verstehe. Sollten sich die persönlichen Sachen nun aber nicht mehr 
dort befinden — ich meine, die werden da sicherlich keine Ewigkeit 
aufbewahrt —, was wird dann daraus?« 
»Die Familie wird kontaktiert und gebeten, sie abzuholen.« 
»Und wenn alle bei dem Unfall tödlich verunglückt sind?« 
»Gibt es noch Verwandte des Verletzten?« 
Diese  Frage  konnte  Ando  nicht  beantworten.  Natürlich  wusste  er 
nichts über Asakawas Familienverhältnisse, ob er ein Einzelkind war 
oder  Geschwister  hatte,  ob  die  Eltern  noch  lebten  ...  Schließlich 
kannte er ihn ja gar nicht. Da Asakawa jedoch ungefähr sein Jahrgang 
war, konnte er davon ausgehen, dass dessen Eltern mit großer Wahr‐
scheinlichkeit noch lebten. Vermutlich hatten sie die persönlichen Ge‐
genstände  entgegengenommen.  Noch  einen  weiteren  Anhaltspunkt 
hatte er: Asakawa und Ryuji waren Freunde aus Gymnasiumszeiten. 
Ryuji  war  in  Sagamiono  aufgewachsen.  Ohne  Zweifel  befand  sich 
auch  Asakawas  Elternhaus  in  dieser  Gegend.  Ando  beschloss,  sich 
gleich  dahinterzuklemmen.  Zunächst  galt  es,  die  Adresse  der  Eltern 
herauszufinden... 
»Herzlichen Dank für Ihre Geduld. Sie haben mir sehr geholfen.« 
Kaum hatte er sich von dem Polizisten verabschiedet, stürzte Ando 
sich  in  die  Nachforschungen.  Er  hatte  richtig  getippt.  Asakawas 
Eltern  waren  noch  am  Leben.  Sie  wohnten  in  Zama‐City,  Kurihara. 
Ohne  lange  zu  fackeln,  hängte  Ando  sich  ans  Telefon.  Mit  heiserer 
Stimme  erklärte  ihm  der  über  siebzigjährige  Vater,  dass  ihr  ältester 
Sohn die persönlichen Sachen vom Revier abgeholt habe. Er selbst sei 
zu schwach auf den Beinen, um den weiten Weg bewältigen zu kön‐
nen.  Doch  das  sei  nicht der  einzige Grund  gewesen.  Es hätte  ihn zu 
sehr  mitgenommen,  die  Dinge  nach  dem  furchtbaren  Unfall  entge‐
genzunehmen.  Da  sein  ältester  Sohn  und  dessen  Frau  in  Kanda 
wohnten, also relativ nahe bei der Polizeibehörde im Bezirk Shintomi, 
hatte er dessen Telefonnummer weitergegeben. Asakawa hatte insge‐
samt  drei  Geschwister;  er  selbst  war  das  Nesthäkchen  der  Familie. 
Sein  ältester  Bruder  arbeitete  beim  S‐Shobo  Verlag  im  Bereich  Belle‐
tristik,  der  Zweitgeborene  war  als  Japanischlehrer  an  einer  Mittel‐
schule tätig. 
Kaum  hatte  er  aufgelegt,  da  wählte  Ando  auch  schon  mit  fliegen‐
den Fingern die Nummer von  Asakawas älterem Bruder, Jun‐ichiro. 
Doch  niemand  schien  zu  Hause  zu  sein.  Nach  unzähligen  fehlge‐
schlagenen  Versuchen  erreichte  er  ihn  endlich  zu  fortgeschrittener 
Stunde. Ando sagte offen, worum es ging. Hätte er ihm irgendein Lü‐
genmärchen aufgetischt, und wäre das herausgekommen, dann wäre 
Jun‐ichiro vermutlich nicht mehr bereit gewesen, Diskette und Video 
herauszurücken.  Dieses  Risiko  wollte  Ando  um  keinen  Preis  ein‐
gehen. 
Andererseits  konnte  er  Yoshinos  Geschichte  nicht  eins  zu  eins 
wiedergeben, weil er selbst nicht so recht daran glaubte. Der Bruder 
hätte ihn für verrückt gehalten. Schließlich fand Ando einen Kompro‐
miss:  Die  Punkte,  die  nur  schwer  zu  glauben  waren,  ließ  er  weg, 
dafür betonte er die Schlüsselrolle Asakawas bei der Aufklärung der 
mysteriösen  Todesserie  und  erwähnte  dessen  Bericht.  Nach  aus‐
schweifenden  Lobeshymnen  bat  er  Jun‐ichiro  um  eine  Kopie  dieses 
wichtigen Dokuments. 
»Hm.  Ich  weiß  wirklich  nicht,  ob  das,  was  Sie  suchen,  bei  den 
Sachen  ist«,  antworte  Jun‐ichiro.  Es  schien,  als  hätte  er  noch  keinen 
Blick  in  den  Karton  mit  den  persönlichen  Dingen  seines  Bruders 
geworfen. 
»Können  Sie  mir  sagen,  ob  vielleicht  ein  Laptop  dabei  war?«, 
erkundigte Ando sich. 
»Ja,  ein  Laptop  war  dabei.  Aber  ich  glaube,  das  Gerät  ist  bei  dem 
Unfall ziemlich demoliert worden.« 
»Steckte eine Diskette darin?« 
»Da  bin  ich  überfragt.  Ins  Laufwerk  habe  ich  nicht  geschaut  ... 
Ehrlich gesagt habe ich die Kiste, so wie sie war, in eine Ecke gestellt, 
ohne darin herumzuwühlen. Das hätte die Wunden nur wieder auf‐
gerissen. Für uns alle war der Unfall ein gewaltiger Schock.« 
»Das  verstehe  ich  natürlich.  Ist  Ihnen  vielleicht  ein  Videorekorder 
aufgefallen?« 
»Ja, der war auf jeden Fall dabei. Ich habe ihn entsorgt... Ich hoffe, 
dass ist kein Problem?« 
»Sie haben ihn weggeschmissen?« Ando stockte der Atem. 
»Mir war nicht klar, warum Kazuyuki den alten Rekorder bei sich 
hatte. Ein Laptop, das ist verständlich, aber ein Videogerät ...« 
»Und Sie haben den Rekorder auf den Müll geworfen?« 
»Ja.  Damit  war  wirklich  nichts  mehr  anzufangen.  Gerade  gestern 
habe ich ihn zusammen mit unserem alten Fernseher entsorgt. Auch 
eine  Reparatur  hätte  nichts  mehr  gebracht,  der  Rekorder  war 
vollkommen  eingedrückt.  Kazuyuki  wird  es  mir  schon  nicht  übel 
nehmen.« 
Wie  ärgerlich!  Fast  hätte  Ando  zwei  Fliegen  mit  einer  Klappe 
geschlagen.  So  ein  Mist!  Der  Schlüssel  zur  Lösung  der  rätselhaften 
Todesserie — das Video — steckte in einem Rekorder, der vermutlich 
gerade in einer Müllverarbeitungsanlage zermalmt wurde. Dabei hat‐
te Ando Diskette und Videoband schon in seinen Händen gewähnt... 
Doch manchmal liefen die Dinge nicht so glatt, wie man es sich vor‐
stellte. Warum war er nicht schon viel früher auf die Idee gekommen, 
sich mit Asakawas Eltern oder Bruder in Verbindung zu setzten? 
»Eine  einzelne  Videokassette  haben  Sie  nicht  zufällig  gefunden?« 
Ando betete zu Gott, das die Antwort positiv ausfiel ... 
»Ich  weiß  lediglich  von  einem  Videorekorder,  einem  Laptop  und 
zwei  Taschen,  die  vermutlich  Shizuka  und  Yoko  gehörten;  da  habe 
ich noch nicht hineingeschaut.« 
Auf  die  Distanz  brachten  diese  Auskünfte  nicht  viel.  Ando  wollte 
die Sachen selbst sehen. Seine Nerven waren zum Zerreißen gespannt, 
als er fragte: »Würde es Ihnen etwas ausmachen, wenn ich bei Ihnen 
vorbeikomme?« 
»Nein, das ist kein Problem. Sie können gern kommen«, antwortete 
Jun‐ichiro zu Andos Überraschung. 
»Passt es Ihnen morgen?« 
»Ich bin morgen mit einem Kollegen zum Golf verabredet. Aber ich 
denke, bis 19 Uhr müsste ich wieder zu Hause sein.« 
»Gut.  Dann  komme  ich  morgen  so  gegen  19  Uhr.«  Ando  notierte 
sich den Termin mit einem dicken Ausrufezeichen. 
Unruhig  begab  er  sich  am  folgenden  Tag  zur  verabredeten  Zeit 
nach Kanda in den Bezirk Sarugaku. Nicht viele Familien schienen in 
dem  Hochhaus  zwischen  den  zwei  Bürokomplexen  zu  wohnen.  Die 
meisten  Räume  wurden  vermutlich  an  Unternehmen  vermietet.  Da 
heute  Sonntag  und  das  Viertel  wie  ausgestorben  war,  umgab  eine 
ruhige, fast unheimliche Atmosphäre das Haus. 
Nachdem Ando geklingelt hatte, dröhnte eine tiefe Männerstimme 
durch die Fernsprechanlage. »Wer ist da?« 
»Mitsuo Ando. Wir haben gestern telefoniert.« 
Mit einem Summen öffnete sich die Tür. Hastig lief Ando die Trep‐
pen  hinauf.  In  legerer  Freizeitkleidung  trat  Jun‐ichiro  ihm  entgegen. 
Erstaunt  blickte  Ando  in  ein  rundliches,  kindlich‐niedliches  Gesicht. 
Die Stimme am Telefon hatte eher auf einen schlanken, etwas naiven 
Menschen schließen lassen. Jun‐ichiro spielte im Leben seiner Brüder 
sicher  eine  Vorbildrolle.  Immerhin  war  er  bei  einem  bekannten 
Verlag  tätig.  Alle  drei  Geschwister  hatten  Berufe  ergriffen,  in  denen 
Worte  von  zentraler  Bedeutung  waren.  Es  war  durchaus  denkbar, 
dass  Jun‐ichiro  auf  die  berufliche  Entwicklung  seiner  Brüder  einen 
nicht  unwesentlichen  Einfluss  genommen  hatte.  Auch  Ando  hatte 
sich an seinem älteren Bruder orientiert, der Biologielehrer an einem 
Gymnasium war. 
Jun‐ichiro  holte  die  Kiste  mit  Asakawas  persönlichen  Habselig‐
keiten  aus  einem  Kabuff.  »Nur  zu.  Werfen  Sie  einen  Blick  rein.«  Er 
schob den Karton zu Ando. 
»Ja, gern.« 
Zunächst nahm Ando den Laptop und notierte Herstellername und 
Typenbezeichnung.  So  ein  verdammter  Mist,  dachte  er.  Das  Gehäuse 
des Computers war durch den Unfall stark beschädigt worden, allein 
das Aufklappen schien eine fast unüberwindbare Hürde, die er dann 
aber  doch  nehmen  konnte.  Er  versuchte,  den  Computer  zu  starten, 
aber  es  rührte  sich  nichts.  Als  Nächstes  untersuchte  er  das 
Diskettenlaufwerk.  Siehe  da,  eine  blaue  Diskette  klemmte  darin. 
Nervös drückte Ando auf ›Eject‹. Der Computer spuckte die Floppy 
aus.  Ando  führte  innerlich  ein  Freudentänzchen  auf.  Zwar  war  die 
Datenscheibe ohne Etikett und damit auch ohne Inhaltsbeschreibung, 
doch  Ando  war  sich  ziemlich  sicher,  dass  er  genau  das  gefunden 
hatte, wonach er gesucht hatte. 
»Ich  würde  gern  wissen,  was  auf  der  Diskette  abgespeichert  ist. 
Haben Sie einen Computer?« 
»Da muss ich leider passen. Mein Gerät ist nicht kompatibel.« 
»Hätten Sie etwas dagegen, wenn ich die Diskette für ein paar Tage 
mitnehme?« 
»Kein Problem.« 
»Ich schicke sie Ihnen, sobald ich eine Kopie angefertigt habe.« 
»Was  ist  denn  so  Spannendes  auf  der  Diskette?«  Jun‐ichiro  schien 
Andos Aufregung bemerkt zu haben. Nun war auch seine Neugierde 
entflammt. 
»Das weiß ich nicht«, antwortete Ando kopfschüttelnd. 
»Ich  wäre  Ihnen  sehr  verbunden,  wenn  Sie  mir  die  Diskette  bald 
zurückgeben  würden.«  Vielleicht  lag  es  ja  am  Beruf,  aber  Jun‐ichiro 
hatte  plötzlich  Feuer  gefangen.  Vielleicht  bereute  er  es  inzwischen 
sogar schon, dass er Ando die Diskette für ein paar Tage mitgab. 
Freudestrahlend  ließ  Ando  den  Datenträger  in  seine  Jacketttasche 
gleiten. Beflügelt durch das erste Erfolgserlebnis, durchwühlte er nun 
auch  noch  die  anderen  Sachen  im  Karton.  Eine  schwarze  Boston‐
Tasche  ...  Zwar  war  die  Wahrscheinlichkeit,  das  Videoband  in  der 
Tasche  zu  finden,  relativ  gering,  aber  trotzdem  wollte  er  sie  sich 
genauer ansehen. 
»Hätten Sie etwas dagegen, wenn ich einen Blick in die Reisetasche 
werfe?«,  fragte  er  höflich.  Schließlich  gehörte  es  sich  nicht,  in  der 
Tasche einer Fremden herumzuwühlen. 
»Ich glaube nicht, dass sie dort etwas Besonderes finden werden.« 
Lächelnd  reichte  Jun‐ichiro  ihm  die  Tasche.  Ando  betete  zu  Gott, 
dass  er  darin  das  mysteriöse  Video  fand,  doch  mehr  als  ein  paar 
Kleider  und  Windeln  traten  nicht  zu  Tage.  Vermutlich  steckte  das 
Band tatsächlich noch in dem Videorekorder. 
Aber  immerhin  hatte  er  die  Diskette.  Das  war  zumindest  ein  An‐
fang. Kaum hatte Ando Jun‐ichiros Wohnung verlassen, ließ er seinen 
Glücksgefühlen freien Lauf und stieß einen lauten Schrei aus. Gleich 
morgen früh würde er sich bei seinen Kollegen erkundigen, ob einer 
von ihnen einen kompatiblen Rechner besaß. 
 

 
Ando  machte  einen  Abstecher  in  die  Pathologie.  Als  er  Miyashita 
sah  und  ihn  gerade  auf  sich  aufmerksam  machen  wollte,  entdeckte 
dieser ihn. »Du kommst wie gerufen. Ich würde gern deine Meinung 
hören.« 
Mit einem Blatt Papier in der Hand winkte Miyashita Ando zu  sich 
herüber. Neben ihm stand Ueda, ein Kollege aus dem Biochemischen 
Institut.  Ando  konnte  sich  das  Lachen  kaum  verkneifen,  als  er  die 
beiden untersetzten Gestalten nebeneinander sah. Sie gaben ein Bild 
für  die  Götter  ab.  Die  Ähnlichkeit  war  verblüffend  —  beide  waren 
kaum größer als einen Meter sechzig, brachten jedoch sicher achtzig 
Kilo auf die Waage. Die Länge der Beine, der Rumpf, das Gesicht, die 
Stimme,  ja  sogar  ihr  Geschmack  in  Bezug  auf  Kleidung  schienen 
identisch zu sein. 
»Ihr  würdet  als  Zwillingsbrüder  durchgehen  ...«  Grinsend  ging 
Ando auf die beiden zu. 
»Was  fällt  Ihnen  ein  ...  Werfen  Sie  uns  nicht  in  einen  Topf.«  Die 
Stirn  runzelnd,  versuchte  Ueda,  ein  grimmiges  Gesicht  zu  ziehen. 
Tatsächlich  aber  machte  es  ihm  nicht  das  Geringste  aus,  mit  seinem 
zwei  Jahre  älteren  Kollegen  Miyashita  verglichen  zu  werden.  Das 
hatte  einen  ganz  simplen  Grund:  Miyashita  war  ein  ausgesprochen 
liebenswürdiger, witziger Kerl, der von allen gemocht wurde. Zudem 
waren seine wissenschaftlichen Leistungen hoch angesehen. Vor ihm 
lag eine glänzende Zukunft — er hatte gute Aussichten auf einen der 
heiß begehrten Professorenposten. 
»Immer das gleiche Gesülze, wie ähnlich wir uns doch sähen ... Das 
habe  ich  jetzt  bestimmt  schon  zum  hundertsten  Mal  gehört.  Wie 
lästig! Ich habe eine glänzende Idee: Wie wäre es, wenn du mal etwas 
abspecken  würdest?«,  witzelte  Miyashita,  während  er  auf  Uedas 
dicken Bauch klopfte. 
»Wenn  ich  eine  Diät  machen  soll,  musst  du  mitmachen.  Ich  quäle 
mich doch nicht allein ab.« 
»So ein Blödsinn. Wenn wir beide schlank und rank wie eine Tanne 
werden, hat das Ganze doch keinen Sinn.« 
Miyashita reichte Ando das Blatt Papier, mit dem er die ganze Zeit 
in  der  Luft  herumgewedelt  hatte.  Auf  einen  Schlag  machte  auch 
Ando eine ernste Miene. Es waren die Ergebnisse der DNA‐Sequen‐
zierung,  bei  der  die  Erbinformation  des  Virus  durch  die  Ermittlung 
der Basenfolge entschlüsselt worden war. 
Die DNA war die Erbsubstanz aller Lebewesen — von einigen Vi‐
ren abgesehen, bei denen die Erbinformation in der RNA gespeichert 
war  —  und  befand  sich  im  Zellkern  jeder  Zelle.  Sie  war  aus  zwei 
schraubenförmig umeinander gewundenen Strängen aufgebaut, zwi‐
schen  denen,  ähnlich  den  Sprossen  einer  Strickleiter,  etwa  hundert‐
tausend parallele Verbindungen angeordnet waren. Man konnte sich 
dieses  Gebilde  folglich  am  besten  als  doppelte,  in  sich  gewundene 
Leiter  vorstellen.  Die  beiden  Längsstränge  bestanden  abwechselnd 
aus  dem  Zuckermolekül  Desoxyribose  und  einer  Phosphatgruppe. 
Die Quersprossen der Strickleiter setzten sich aus vier verschiedenen 
Basen  zusammen:  Adenin  (A),  Thymin  (T),  Guanin  (G)  und  Cytosin 
(C). Betrachtete man die genetische Information als Text, so entspra‐
chen  die  Basen  den  Buchstaben  des  Alphabets.  Die  Reihenfolge  der 
einzelnen  Basen  am  DNA‐Strang  bildete  die  Wortfolge  des  ›geneti‐
schen Textes‹. 
Jeweils drei aufeinander folgende Basen in der DNA kodierten für 
eine Aminosäure (Triplett); zum Beispiel war dem Triplett AAC nach 
den Regeln des genetischen Kodes die Aminosäure Asparagin zuge‐
ordnet,  bei  GCA  war  es  die  Aminosäure  Alanin.  Diese  wiederum 
dienten als Bausteine für die lebenswichtigen Proteine. Es gab insge‐
samt  zwanzig  verschiedene  Aminosäuren,  die  an  den  Ribosomen 
einer Zelle gemäß dem Bauplan der DNA in einer festgeschriebenen 
Abfolge wie zu einer Kette aneinandergehängt wurden, um Proteine 
zu bilden. 
TCTCTATACCAGTTGGAAAATTAT  ...  So  in  etwa  konnte  man 
sich  die  Abfolge  der  Nukleotide  innerhalb  der  DNA  vorstellen. 
Übersetzte  man  diese  Buchstabenabfolge  auf  der  Grundlage  des 
genetischen  Kodes,  bei  dem  ein  Condom,  ein  Basistriplett,  für  eine 
der  zwanzig  protinogenen  Aminosäure  stand,  ergab  sich  folgende 
Aminosäurensequenz: TCT = Serin (Ser), CTA = Leucin (Leu), TAC = 
Tyrosin  (Tyr),  CAG  =  Glutamin  (Gin),  TTG  =  Leucin  (Leu),  GAA  = 
Glutamin (Glu), AAT = Asparagin (Asn), TAT = Tyrosin (Tyr). 
Ando schaute sich die ausgedruckten Ergebnisse noch einmal an: 
 
... ... ... ... ... ... ... ... ... GTTTAAAGCA 
TTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTA
TTGGACGC 
TATCATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAA
CAATTTG 
CAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAA
CGAGGGT 
TTATGATAGTTTGCTCTTACTATGCCTCGTAATTCCTTTTGGC
GTTATGT 
ATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGAT
GAATCTTT 
CTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTACGTA
GATTTT 
TCTTCCCAACGTCCTGACTGGGATTTCGACACAAATGGAA 
GAA GAATATC 
GTTATATTCCTCCTCCTCAACAACAACGCTTGGTATAATCGCT
GGGGGTC 
AAAGATGAGTGTTTTTAGTATATT ... ... ... ... ... ... 
 
Ando  wandte  sich  Miyashita  zu.  Nur  bestimmte  Sequenzabfolgen 
waren gekennzeichnet. Welche Bedeutung steckte dahinter? »Was hat 
es  mit  den  beiden  markierten  Basenfolgen  auf  sich?«,  erkundigte  er 
sich. 
Miyashita forderte Ueda mit einem Blick auf zu antworten. 
»Das ist ein Stück von Ryujis DNA.« 
»Und?« 
»Diese  merkwürdige  Basenfolge  konnte  nur  bei  Ryuji  festgestellt 
werden. Die anderen Leichen wiesen diese Besonderheit nicht auf.« 
»Sie sprechen von dem fett markierten Teil, oder?« 
»So ist es.« 
Ando starte auf die markierte Buchstabenabfolge: 
ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA 
Nachdenklich  verglich  er  sie  mit  der  anderen  fett  gedruckten  Se‐
quenzabfolge;  sie  waren  identisch.  Unter  den  weniger  als  tausend 
Basen  schien  es  zwei  Abschnitte  mit  derselben  Buchstabenfolge  zu 
geben. 
Ando blickte Ueda fragend an. Er konnte sich keinen Reim darauf 
machen. 
»Welchen  Teil  der  Virus‐DNA  man  auch  herausgreift  und  ana‐
lysiert, es ist immer diese eine merkwürdige Abfolge enthalten.« 
»Wieviel sind es?« 
»Basen?« 
»Ja.« 
»Zweiundvierzig.« 
»Zweiundvierzig ... Das heißt, vierzehn Tripletts; nicht gerade viel.« 
»Ich  habe  allerdings  keinen  Schimmer,  ob  das  irgendeine  Be‐
deutung hat«, sagte Ueda, den Kopf leicht zur Seite neigend. 
»Merkwürdig,  oder?«,  mischte  sich  Miyashita  ins  Gespräch  ein. 
»Diese  auf  den  ersten  Blick  völlig  unscheinbare  Basenfolge  wurde 
nur  in  Ryujis  Blut  nachgewiesen.  Das  macht  mich  stutzig.  Es  muss 
irgendeinen  Grund  haben.«  Ratlos  zuckte  Miyashita  die  Achseln. 
»Was  meinst  du?«  Neugierig  beobachtete  er  Andos  Reaktion.  Ein 
Wissenschaftler freute sich normalerweise, wenn er auf ein unlösbar 
scheinendes Problem stieß. 
»Ich bin wirklich überfragt...« 
Schweigend blickten sich die drei Männer an. Ando hielt das Blatt 
mit den Ergebnissen der DNA‐Analyse noch immer in der Hand. 
Eine  unsichtbare  Kraft  lenkte  seine  Augen  wieder  auf  die  Basen‐
folge. Er nahm einen starken Impuls wahr. Hier verbarg sich irgend‐
etwas  ...  Tausende  Gedanken  schossen  ihm  durch  den  Kopf.  Viel‐
leicht hatte das Virus die Basenfolge ja kopiert? Oder war das nur Zu‐
fall? Denkbar wäre auch, dass sich das Virus, nachdem es sich in der 
Wirtszelle  eingenistet  hatte,  veränderte.  Resultat  war  die  Vierzehn‐
Triplett‐Basenfolge in jedem DNA‐Abschnitt. Aber war das in der Re‐
alität überhaupt möglich? Wenn ja, was würde es de facto bedeuten? 
Noch  immer  herrschte  Stille  im  Raum.  In  Gedanken  verloren, 
schien jeder der drei Mediziner nach Antworten zu suchen. 
Schließlich brach Miyashita das Schweigen. »Ando, du bist doch si‐
cher nicht ohne Grund vorbeigekommen. Was hat dich hergeführt?« 
Die Untersuchungsergebnisse zu der Virus‐DNA hatten Ando so in 
ihren  Bann  geschlagen,  dass  er  sein  eigentliches  Anliegen  fast  ver‐
gessen  hätte.  »Stimmt.  In  der  Tat  bin  ich  aus  einem  anderen  Grund 
gekommen  ...«  Er  zog  einen  Zettel  aus  der  Brieftasche.  »Ich  wollte 
euch  fragen,  ob  ihr  zufällig  das  gleiche  Laptop‐Modell  habt.«  Lang‐
sam  las  Ando  Herstellernamen  und  Gerätebezeichnung  vor.  Da  das 
gesuchte  Gerät  als  sehr  leistungsfähig  galt  und  zudem  ein  Topseller 
war,  war  nicht  ausgeschlossen,  dass  die  wissenschaftlichen  Einrich‐
tungen damit ausgestattet waren. 
»Muss es unbedingt genau dieses Modell sein?« 
»Ich denke, ein Gerät vom gleichen Hersteller tut es auch. Es muss 
nur  kompatibel  sein.«  Mit  der  linken  Hand  hielt  Ando  die  Diskette 
hoch.  »Ich  möchte  die  auf  dieser  Diskette  gespeicherten  Daten 
ausdrucken und eine Kopie ziehen.« 
»Es sind also keine MS‐DOS‐Daten?« 
»Ich glaube nicht.« 
Ueda  schlug  sich  mit  der  Hand  auf  einen  Schenkel.  Er  schien  eine 
Idee  zu  haben.  »Ich  glaube,  ein  Mitarbeiter  unseres  Instituts  ...  Wie 
war  doch  sein  Name?  Ah,  Taneda.  Ich  glaube,  er  hat  so  einen 
Laptop.« 
»Ob er mir den wohl mal für ein paar Tage leihen könnte?«, fragte 
Ando. 
»Ich denke, das geht klar. Er ist Doktorand bei uns und hat gerade 
sein Examen hinter sich gebracht.« 
Taneda war also ganz frisch am Institut. Sicher würde er Ueda eine 
Bitte nicht ausschlagen. 
»Entschuldigen Sie die Umstände.« 
»Kein  Problem.  Wie  sieht  es  aus,  wollen  Sie  gleich  mit  mir 
kommen? Taneda müsste jetzt im Büro sein.« 
Ohne zu zögern, nahm Ando dieses Angebot an. Er konnte es kaum 
noch  erwarten,  einen  ersten  Blick  auf  den  Bericht  von  Asakawa  zu 
werfen. 
»Dann lassen Sie uns gehen.« 
Ando  steckte  die  Diskette  wieder  in  seine  Jacketttasche,  winkte 
Miyashita  kurz  zu  und  machte  sich  mit  Ueda  auf  den  Weg  zum 
Biochemischen Institut. 
 

 
Schweigend  gingen  Ando  und  Ueda  den  dunklen  Flur  der  Medi‐
zinischen  Fakultät  entlang.  Die  rechte  Hand  in  der  Tasche  seines 
Jacketts vergraben, umklammerte Ando die Diskette. All seine Hoff‐
nungen  lagen  darauf.  Vielleicht  würde  sie  etwas  Licht  in  die  Sache 
bringen. Zu seiner Verwunderung hatte weder Miyashita noch Ueda 
gefragt,  was  es  mit  der  Diskette  auf  sich  habe.  Das  passte  eigentlich 
so gar nicht zu den beiden. Dabei hätte er nicht einmal ein Geheimnis 
daraus  gemacht.  Aber  auf  die  Nase  binden  wollte  er  ihnen  diese 
verrückte  Geschichte  nun  auch  wieder  nicht.  Ihr  Pech,  dachte  er. 
Miyashita  hätte  sich  sicherlich  sofort  an  seine  Fersen  geheftet,  wenn 
er auch nur die leiseste Ahnung gehabt hätte, dass die Diskette einen 
Bericht  über  die  mysteriösen  Todesfälle  beinhaltete.  Mann,  wäre  der 
vor Neugierde geplatzt. Selbst schuld ... 
Natürlich  war  nicht  auszuschließen,  dass  etwas  ganz  anderes  auf 
der  Diskette  abgespeichert  war.  Noch  hatte  er  den  Inhalt  ja  nicht 
gesehen. Aber Ando war sich ziemlich sicher, dass er die richtige Dis‐
kette gefunden hatte. Er spürte es instinktiv. Aus der Datenscheibe in 
seine Hand schien Energie zu strömen. 
Ueda stieß die Tür des Biochemischen Instituts auf. Ando blieb im 
Türrahmen  stehen.  »Taneda,  hast  du  mal  eine  Minute  Zeit?«,  rief 
Ueda einem jungen, hageren Mann zu. 
»Ja, was gibtʹs?« 
Taneda  wirbelte  in  seinem  Drehstuhl  herum.  Mit  aufgerissenen 
Augen  blickte  er  zu  Ueda,  machte  aber  keinerlei  Anstalten,  sich  zu 
erheben. Lächelnd ging Ueda auf ihn zu. »Sag mal, benutzt du gerade 
deinen Computer?« 
Ueda legte einen Arm um Tanedas Schulter. 
»Nein. Wieso?« 
»Hervorragend!  Das  passt  gut.  Der  Kollege  würde  ihn  gern  für 
einen Moment benutzen.« Ueda zeigte auf Ando. 
»Ich  hoffe,  ich  mache  Ihnen  keine  Umstände.  Ich  würde  mir  nur 
gern  kurz  die  Daten  auf  der  Diskette  anschauen.  Leider  ist  mein 
Gerät  nicht  kompatibel.«  Ando  wedelte  mit  der  Diskette  in  der  Luft 
herum, während er zu Ueda und Taneda trat. 
»Kein  Problem.  Nur  zu,  Sie  können  meinen  Computer  gern 
benutzen.« 
»Was dagegen, wenn ich mir die Datei gleich anschaue?« 
»Bitte, gern.« 
Ando  fuhr  den  Computer  hoch.  Das  Startmenü  öffnete  sich. 
Gespannt schob er die Diskette ins Laufwerk und öffnete den 
Explorer.  Dann  klickte  er  auf  ›Diskette‹,  um  die  gespeicherten 
Daten herunterzuladen. Auf dem Monitor erschien: 
 
File: Ring 1  199X. 2. Oktober
File: Ring 2  199X 4. Oktober
File: Ring 3  199X  7. Oktober 
File: Ring 4  199X 12. Oktober
File: Ring 5  199X 15. Oktober
File: Ring 6  199X 17. Oktober
File: Ring 7  199X 19. Oktober
File: Ring 8  199X 20. Oktober
File: Ring 9  199X 21. Oktober

 
»Ring, Ring, Ring ...« Ando starrte fassungslos auf die File‐Namen. 
Wie in Trance murmelte er: »Ring ...« 
Was  hatte  das  zu  bedeuteten?  ›Ring‹  —  das  war  doch  ...  Er  selbst 
hatte  die  Zahlenkombination  auf  der  Zeitungsecke  geknackt.  Dass 
dieses Wort ausgerechnet auf der Diskette als Dateiname auftauchte, 
versetzte ihm einen gewaltigen Schock. 
»Ist alles in Ordnung mit Ihnen? Sie sehen so blass aus.« 
Ueda  blickte  besorgt  in  das  kreideweiße  Gesicht  Andos.  Dieser 
konnte nur den Kopf schütteln. Für den Bruchteil einer Sekunde hatte 
es ihm die Sprache verschlagen. 
Das war kein Zufall. Asakawa dokumentierte die Ergebnisse seiner 
Nachforschungen  über  die  mysteriöse  Serie  von  Todesfällen,  gab 
dem Vorgang den Namen ›Ring‹ und speicherte den Bericht in neun 
Dateien ab ... 
Welche Erklärung steckte dahinter? 
Das  alles  träume  ich  wahrscheinlich  nur.  Gleich  wache  ich  auf,  und  der 
Albtraum  ist  vorbei.  Ando  konnte  und  wollte  nicht  glauben,  dass  ein 
Zusammenhang  zwischen  dem  von  ihm  entschlüsselten  Kode‐Wort 
und  dem  Asakawa‐Bericht  bestand.  Der  tote  Ryuji  hatte  ihm  eine 
Nachricht  geschickt  ...  Das  ging  nun  wirklich  über  Andos  Vorstel‐
lungskraft hinaus. Ryuji hatte ihm mitteilen wollen, dass dieser Ring‐
Bericht  existierte?  Ando  hatte  das  Gefühl,  dass  ihm  die  Geschichte 
langsam über den Kopf wuchs. 
Ryujis Gesichtsausdruck nach der Autopsie erschien vor Andos gei‐
stigem Auge. Ein leichtes Lächeln hatte seine Mundwinkel umspielt. 
Die Züge seines kantigen Gesichts hatten verraten, dass es ein ironi‐
sches Lächeln war. Selbst in seinem Zustand hatte er sich noch über 
Ando lustig gemacht. 
Plötzlich  erschien  ihm  Yoshinos  Geschichte  gar  nicht  mehr  so  un‐
glaubwürdig.  Vielleicht  hatte  der  Journalist  ja  tatsächlich  die  Wahr‐
heit  gesagt,  und  es  existierte  ein  Video,  das  über  eine  so  immense 
Kraft verfügte, dass es töten konnte ... 
 

 
Der  Drucker  spukte  gemächlich  ein  paar  Blatt  Papier  aus.  Ando 
nahm sie voller Erwartung aus der Halterung, machte es sich bequem 
und begann zu lesen. 
Die ersten Seiten hatte er im Nu durch. Er wartete ungeduldig auf 
die nächsten Ausdrucke. Dieses verdammte Ding. Warum dauerte das 
nur so lange? Er wurde allmählich wütend. Mittlerweile hatte er eine 
so große Faszination an dem Fall entwickelt, dass er endlich Antwor‐
ten  wollte.  Was  hatte  Asakawa  herausgefunden?  Er  verfluchte  den 
lahmen Drucker; zwei bis drei Minuten pro Seite, das ging Ando ent‐
schieden  zu  langsam.  Andererseits  war  ihm  viel  daran  gelegen,  den 
Bericht  zur  Sicherheit  auch  in  ausgedruckter  Form  vorliegen  zu  ha‐
ben. Also blieb ihm nichts weiter übrig, als sich in Geduld zu üben. 
Zu  gern  hätte  Ando  den  Report  in  Uedas  Büro  an  der  Universität 
ausgedruckt.  Doch  dies  hatte  sich  schnell  als  irrwitzige  Idee  ent‐
puppt. Nachdem das geheimnisvolle Dokument auf dem Bildschirm 
erschienen  war,  hatte  Ando  zu  seinem  Erstaunen  festgestellt,  dass 
Asakawa  über  hundert  Seiten  geschrieben  hatte.  Es  wäre  eine 
Zumutung gewesen, die Kollegen damit zu belästigen und ihnen ihre 
wertvolle Zeit zu stehlen. Also war Ando mit dem Laptop unter dem 
Arm aus Uedas Büro marschiert. 
Unterwegs  hatte  er  sich  einen  Snack  zur  Stärkung  gekauft.  Wäh‐
rend er aß, hatte er sich die ersten einundzwanzig Seiten der Repor‐
tage zu Gemüte geführt. Zu seiner Enttäuschung brachte ihn die Lek‐
türe  allerdings  kein  Stück  weiter.  Die  Fakten  hatte  er  bereits  letzten 
Freitag  von  Yoshino  erfahren,  ihnen  da  jedoch  noch  keine  große 
Bedeutung  beigemessen.  Ein  billiger  Dreigroschenroman  —  nach 
mehr hatte die Geschichte in seinen Ohren nicht geklungen. Anderer‐
seits wusste er aber auch, dass es eine große Rolle spielte, wie und wo 
man an Informationen gelangte. Vielleicht hatte es an der Atmosphä‐
re in dem Cafe gelegen, dass er Yoshinos Worte wenig glaubwürdig 
fand.  Als  er  jetzt  den  Asakawa‐Bericht  mit  genauen  Orts‐  und  Zeit‐
angaben las, wirkte die Geschichte wesentlich realistischer. Asakawa 
schrieb in einem nüchtern‐objektiven Stil, ohne den für viele Journali‐
sten  typischen  Sensationalismus.  Andos  Zweifel  ließen  allmählich 
nach. Es schien sich nicht um irgendein Lügenmärchen zu handeln. 
Vier  junge  Menschen  waren  am  5.  September  unter  mysteriösen 
Umständen  in  Tokio  ums  Leben  gekommen.  Todesursache:  plötzli‐
ches Herzversagen. Asakawa witterte eine heiße Story und begann zu 
recherchieren.  Was  steckte  hinter  dieser  rätselhaften  Todesserie?  Er 
war  geneigt,  einer  wissenschaftlichen  Theorie  Glauben  zu  schenken. 
Seine Vermutung war, dass sich ein Virus dahinter verbarg. 
Er  hatte  den  richtigen  Riecher  gehabt.  Die  Leichenobduktionen 
erhärteten  diesen  Verdacht;  bei  allen  Verstorbenen  war  ein  dem 
Pockenerreger  ähnliches  Virus  im  Blut  nachgewiesen  worden.  Das 
bedeutete, dass die vier jungen Leute irgendwo und irgendwann zu‐
sammen  gewesen  sein  mussten.  Asakawa  hatte  es  sich  zur  Aufgabe 
gemacht herauszufinden, wo sie sich angesteckt haben konnten, und 
aufweiche Weise das Virus übertragen wurde. 
Nach  einigen  Recherchen  hatte  er  endlich  den  Ort  ausfindig  ge‐
macht. Eine Woche, bevor die vier Jugendlichen starben, am 29. Au‐
gust, hatten sie gemeinsam im Pazifikland in Süd‐Hakone eine Nacht 
in einem kleinen Ferienhäuschen, der Blockhütte B‐4, verbracht. 
Auf  Seite  zweiundzwanzig  beschrieb  Asakawa  seine  Fahrt  nach 
Süd‐Hakone,  also  zu  dem  Ort,  wo  das  Übel  seinen  Anfang  ge‐
nommen hatte. Zunächst fuhr er mit dem Hochgeschwindigkeitszug 
bis Atami. Am Bahnhof mietete er einen Leihwagen und machte sich 
auf den Weg zum Pazifikland. Heftiger Regen prasselte vom schwar‐
zen  Himmel,  und  dicke  Tropfen  hämmerten  gegen  die  Windschutz‐
scheibe.  Da  es  bereits  dunkel  war  und  Asakawa  die  Gegend  nicht 
kannte,  musste  er  sich  beim  Fahren  umso  mehr  konzentrieren.  Er‐
schwerend  kam  hinzu,  dass  die  Straßen  auf  dem  letzten  Wegstück 
eng und steil waren und die Kurven finster. Endlich erreichte er das 
Pazifikland.  Es  war  acht  Uhr  abends.  Eigentlich  hatte  er  die  Block‐
hütte B‐4 schon ab Mittag gemietet, aber egal, Hauptsache er war da. 
Hier also haben die vier jungen Leute die Nacht verbracht ... Bei diesem 
Gedanken  wurde  Asakawa  unbehaglich  zumute.  Was  würde  ihn 
erwarten?  Die  Jugendlichen,  die  in  B‐4  übernachtet  hatten,  waren 
exakt  eine  Woche  nach  ihrem  Aufenthalt  im  Blockhüttendorf  eines 
merkwürdigen  Todes  gestorben.  Damit  nicht  genug:  Todesuhrzeit 
und ‐ursache waren bei allen Leichen mit geringfügigen Abweichun‐
gen identisch. Asakawa versuchte, sich bewusst zu machen, welchen 
Gefahren er sich aussetzte. Die Wahrscheinlichkeit, dass ihm das glei‐
che Schicksal widerfuhr, war nicht gerade gering. Da brauchte er sich 
nichts  vorzumachen.  Doch  sein  Reporterinstinkt  und  seine  Wissens‐
gier  waren  größer  als  seine  Ängste.  Fest  entschlossen,  der  Sache  auf 
den Grund zu gehen, holte er sich beim Verwalter den Schlüssel für 
die geheimnisvolle Hütte. 
Dort  nahm  er  jeden  Winkel  genaustens  unter  die  Lupe,  doch  er 
konnte nichts Auffälliges feststellen. Es war eine stinknormale Block‐
hütte aus Holz. Da gab es nur eines: Er musste herausfinden, was die 
vier  Jugendlichen  hier  gemacht  hatten.  Das  Gästebuch  ...  vielleicht 
lieferte es irgendwelche Hinweise. Während er die Einträge der vier 
jungen  Menschen  las  und  noch  über  den  Sinn  der  Worte  nachgrü‐
belte, hatte er plötzlich eine Eingebung: Sie hatten sich vermutlich ein 
Video angesehen. 
Asakawa verließ die Blockhütte und stieß kurz darauf die Tür des 
Verwalterbüros  auf.  Dort  ließ  er  seinen  Blick  über  ein  Regal  mit 
Videokassetten schweifen. Ein Video weckte sein Interesse. Es steckte 
im  Gegensatz  zu  allen  anderen  in  keiner  Schutzhülle.  Nicht  einmal 
ein Etikett klebte darauf. Asakawa wusste zwar nicht, ob es das war, 
wonach  er  suchte,  aber  er  lieh  sich  den  Streifen  für  den  Abend  aus. 
Insgeheim  setzte  er  große  Hoffnungen  darauf,  dass  auf  der  Video‐
kassette der Schlüssel verborgen war, mit dem er das Rätsel der vier 
Todesfälle  lösen  konnte.  Ahnungslos  schob  er  wenig  später  die 
Kassette in den Rekorder. Das Band begann zu laufen. 
Es offenbarte sich ihm eine Welt der absoluten Finsternis. Asakawa 
beschrieb die erste Szene mit folgenden Worten: 
 
Auf  dem  pechschwarzen  Bildschirm  flackerte  ein  kleiner,  stecknadel‐
kopfgroßer  Lichtpunkt  auf.  Dann  wurde  der  Punkt  nach  und  nach  größer, 
sprang von rechts nach links, um  schließlich in der  linken Ecke zu verhar‐
ren. Der Lichtpunkt löste sich in verästelte Linien auf, zu einem zerfetzten 
Knäuel, dessen Fäden wie Würmer über die Mattscheibe krochen ... 
 
Ando  hob  nachdenklich  den  Kopf.  Irgendwo  hatte  er  diese  Bilder 
schon  einmal  gesehen.  Das  Glühwürmchen  auf  der  schwarzen 
Mattscheibe ... der sich wie ein Pinsel in verästelte Linien auflösende 
Lichtpunkt... Es war noch nicht lange her. 
Plötzlich  erinnerte  er  sich.  Er  hatte  die  beschriebene  Szene  auf 
einem Videoband in Mais Apartment gesehen! Die Kassette hatte im 
Rekorder gesteckt. Auf dem Etikett hatte so etwas wie Frank Sinatra, 
Liza  Minelli  gestanden,  aber  wie  sich  dann  herausstellte,  stimmten 
Inhalt und Titel nicht überein. Die Sequenzen in den ersten Sekunden 
des  Videos  passten  haargenau  auf  Asakawas  Beschreibung.  Ver‐
blüffend! 
Schon damals hatte Ando der abrupte Szenenwechsel nach einigen 
Sekunden  gewundert,  von  der  anfangs  schwarzen  Mattscheibe  zu 
einem  hellen  Bildhintergrund.  Jetzt  konnte  er  es  sich  erklären.  Um 
den ursprünglich aufgenommenen Film zu löschen, hatte sich jemand 
die  Mühe  gemacht,  das  Band  mit  Sendungen  aus  dem  Fernsehpro‐
gramm zu überspielen. 
Ando reimte sich das Ganze wie folgt zusammen: Mai war in Ryujis 
Zimmer  vermutlich  zufällig  auf  das  mysteriöse  Video  gestoßen.  Ge‐
mütlich setzte sie sich zu Hause vor die Mattscheibe und schaute sich 
den  Film  an.  Irgendetwas  veranlasste  sie,  das  Video  zu  überspielen. 
Nur die ersten Sekunden blieben auf dem Band. Sicherlich gab einen 
triftigen Grund für ihr Verhalten. Das rätselhafte Videoband aus der 
Hütte B‐4 schien durch mehrere Hände gegangen zu sein, bis es zum 
Schluss bei Mai gelandet war. 
Ando  versuchte,  seine  Gedanken  zu  ordnen.  Halt,  das  kann  nicht 
sein.  Die  in  B‐4  und  in  Mais  Apartment  gefundenen  Videos  waren 
nicht identisch. Laut Asakawas Bericht hatte die von ihm im Ferien‐
dorf  entdeckte  Kassette  weder  eine  Schutzhülle,  noch  war  sie  mit 
einem Etikett versehen. Doch auf dem Videoband in Mais Wohnung 
klebte  eines.  Was  bedeutete  das?  Endlich  dämmerte  es  Ando:  Mais 
Kassette  musste  eine  Kopie  des  in  der  Blockhütte  B‐4  gefundenen 
Originalfilms enthalten. 
Das Video wurde überspielt, gelöscht ... ging durch mehrere Hände 
... wie ein Virus, das sich verbreitete und vermehrte, gleichzeitig aber 
auch  veränderte.  Einerseits  war  das  Video  ein  Gegenstand,  anderer‐
seits hatte es aber auch so etwas wie eine Seele. 
Abstruse Gedanken schossen Ando durch den Kopf. Vielleicht steht 
das rätselhafte Verschwinden Mais ja mit dem mysteriösen Video in irgend‐
einem  Zusammenhang  ...  Nicht  auszumalen  ...  Der  Gedanke  ließ  Ando 
nicht los. Mai war seit Tagen wie vom Erdboden verschluckt. Keiner 
hatte  sie  gesehen,  keiner  wusste,  wo  sie  stecken  könnte.  Sie  war 
weder  in  ihrem  Apartment,  noch  bei  ihren  Eltern.  Die  Vorlesungen 
hatte sie seit gut einer Woche sausen lassen. Andererseits war in der 
Presse aber auch nicht über den Fund einer Leiche berichtet worden. 
Was  war  nur  mit  ihr  passiert?  Vielleicht  war  ihre  Leiche  nur 
deshalb noch nicht entdeckt worden, weil sie verwesend im Dickicht 
eines  fernen  Waldes  lag?  Andos  Herz  verkrampfte  sich.  Sie  ist  doch 
noch so jung! 
Aber der wahre Grund waren seine Gefühle für Mai... 
Das  Geräusch  des  Druckers  riss  Ando  in  die  Realität  zurück.  Er 
beschloss,  sich  nicht  verrückt  zu  machen,  sondern  ruhig  Blut  zu 
bewahren,  bis  er  den  Bericht  zu  Ende  gelesen  hatte.  Dann  blieb 
immer noch Zeit, um sich die schlimmsten Szenarien auszumalen. 
 

 
Ando  las  die  nächsten  Seiten.  Sie  enthielten  eine  detaillierte 
Beschreibung  der  Szenen  auf  dem  mysteriösen  Video,  das  —  so 
unglaublich  es  auch  klingen  mochte  —  Menschenleben  auf  dem 
Gewissen haben sollte. Asakawas Schreibstil war so unmittelbar, dass 
Ando sich des Gefühls nicht erwehren konnte, das Gelesene selbst zu 
erleben. 
Er  sah  einen  Fernseher  vor  sich.  Verzerrte  Bilder  flackerten  auf. 
Offensichtlich begann jetzt der Videofilm. 
 
Auf  dem  monochromen  Bildschirm  platzte  etwas  Scharlachrotes. 
Ein bedrohliches Grollen war zu vernehmen. Das Rot explodierte und 
kroch  wie  eine  zähflüssige  Masse  über  die  Mattscheibe.  Im  Hinter‐
grund war schwach die Silhouette eines Berges zu erkennen. Das war 
offensichtlich ein Vulkanausbruch. Die aus dem Schlund des Vulkans 
ausgespiene  Lava  schlängelte  sich  durch  enge  Schluchten  ins  Tal 
hinunter. Ein schwarzer Schleier umhüllte den abendlichen Himmel. 
Das Grollen der Erde wurde immer lauter, bis der ganze Bildschirm 
von  Lava  ausgefüllt  zu  sein  schien.  Auf  einen  Schlag  wechselte  die 
Szenerie. Jetzt tauchte vor einem weißen Hintergrund das japanische 
Schriftzeichen für ›Berg‹ auf. Kurz darauf verschwand es wieder. Es 
folgte  ein  weiterer  unvermittelter  Szenenwechsel.  Zwei  rollende 
Würfel auf dem gewölbten Boden einer Bleischüssel waren zu sehen. 
In  der  nächsten  Szene  erschien  zum  ersten  Mal  ein  Mensch.  Eine 
alte Frau mit einem faltigen Gesicht saß auf Tatami‐Matten. Sie starr‐
te  mit  leerem  Blick  geradeaus  und  brabbelte  in  einem  fremdartigen 
Dialekt  vor  sich  hin.  Ihre  Worte  waren  kaum  zu  verstehen.  Doch  es 
schien,  als  sagte  sie  etwas  über  die  Zukunft  eines  Menschen  —  es 
klang nach Wahrsagerei. Sie schien zur Vorsicht zu raten und warnte 
vor etwas. 
Ein  neugeborenes  Baby  schrie.  Es  gab  keinerlei  Kontinuität  zwi‐
schen  den  Szenen,  nur  unvermittelte  Wechsel,  dennoch  wirkte  alles 
beabsichtigt. 
Das Neugeborene verschwand. Auf der Mattscheibe waren hunder‐
te nicht zu unterscheidende menschliche Gesichter zu sehen, die sich 
wie bei einer Zellteilung immer weiter vermehrten. Sie wichen nach 
und  nach  in  die  Tiefe  des  Raumes  zurück,  und  je  kleiner  die  Köpfe 
wurden,  desto  mehr  Gesichter  waren  zu  sehen.  Sie  drückten  Hass 
und  Feindseligkeit  aus,  und  aus  dem  Stimmengewirr  erhoben  sich 
die  Wörter  ›Lügner‹  und  ›Betrüger‹.  Mittlerweile  schienen  es  mehr 
als  tausend  Gesichter  zu  sein.  Sie  glichen  nur  noch  schwarzen 
Partikeln, die nach und nach den ganzen Bildschirm füllten. 
In  der  nächsten  Sequenz  tauchte  ein  Fernseher  auf.  Er  stand  auf 
einem Holztischchen — ein Fernseher in einem Fernseher. Es war ein 
altmodisches  Modell.  Der  Bildschirm  begann  zu  flackern.  Auf  der 
Mattscheibe  erschien  das  Schriftzeichen  für  ›sada‹.  Erneuter 
Szenenwechsel. 
Schlagartig  tauchte  das  markante  Gesicht  eines  Mannes  auf.  Er 
keuchte,  während  sein  Körper  sich  rhythmisch  bewegte.  Schweiß 
rann  ihm  über  das  Gesicht.  Hinter  dem  Mann  war  der  schwarze 
Schatten  von  Bäumen  zu  erkennen;  ein  Wald  schien  in  der  Nähe  zu 
sein.  Speichel  lief  dem  Mann  aus  dem  Mund,  seine  Augen  waren 
blutunterlaufen. In seinem Blick lag etwas Gefährliches. Es waren die 
Augen  eines  Mörders.  Ein  schriller  Schrei  begann  aufzusteigen.  Zur 
gleichen  Zeit  tauchte  die  nackte  Schulter  des  Mannes  auf;  aus  einer 
klaffenden  Wunde  spritzte  Blut.  Von  irgendwoher  war  nun  das 
Schreien  eines  Kindes  zu  vernehmen.  Plötzlich  wurden  die  Ränder 
des  Bildschirms  schwarz,  bis  sich  für  Sekunden  absolute  Finsternis 
ausbreitete. Inmitten der Dunkelheit tauchte ein Vollmond auf. Faust‐
große Klumpen einer unbestimmbaren Substanz lösten sich von ihm 
und prallen hier und dort mit einem dumpfen Geräusch auf. 
Auf der Mattscheibe erschienen die Worte: 
 
Wer  diese  Bildersieht,  ist  dazu  verdammt,  exakt  eine  Woche  nach  diesem 
Augenblick  zu  sterben.  Wenn  du  nicht  sterben  willst,  musst  du  den 
Anweisungen genau folgen ... 
 
Ein  radikaler  Szenenwechsel  vollzog  sich.  Auf  dem  Bildschirm  er‐
schien ein bekannter Werbespot. Die Unterbrechung kam im wichtig‐
sten  Moment.  Nach  ungefähr  dreißig  Sekunden  war  der  Film  zu 
Ende. Es breitete sich wieder diese unheimliche Finsternis, die einem 
den  Atem  raubende  mysteriöse  Atmosphäre  aus.  Letzte  Spuren  sich 
auflösender  Worte  waren  zu  erkennen.  Mit  ein  paar  Störgeräuschen 
endete das Band. 
Asakawa spulte das Band zurück und spielte die Szenenfolge noch 
einmal  ab.  Eine  unverständliche  Szene  nach  der  anderen  zog  vor 
seinen  Augen  vorüber.  Begriffen  hatte  er  nur  zwei  Dinge:  Jeder 
Betrachter  dieses  Videos  starb  in  exakt  einer  Woche.  Und  aus‐
gerechnet  die  Stelle,  wo  erklärt  wurde,  wie  man  diesem  Schicksal 
entrinnen  konnte,  war  mit  einem  Werbespot  überspielt  worden. 
Vermutlich  hatten  die  vier  jungen  Leute  den  alles  entscheidenden 
Part  des  Videos  aus  Jux  und  Tolerei  gelöscht.  Wie  hätten  sie  auch 
ahnen können ... 
Hektisch holte Asakawa seine Tasche aus dem Schrank, stopfte das 
Video hinein und verließ fluchtartig die Holzblockhütte B4. 
 
Ando schluckte. Mit aufgerissenen Augen starrte er auf die Seiten. 
Asakawas  Bericht  hatte  ihn  für  zwanzig  Minuten  in  die  Welt  des 
mysteriösen  Videos  entführt.  Es  war,  als  hätte  er  das  Band  mit  ei‐
genen  Augen  gesehen.  Zwar  hatte  Asakawa  sich  nur  des  Mediums 
Wort  bedient,  aber  er  besaß  die  außergewöhnliche  Fähigkeit,  die 
Sinne  des  Lesers  anzusprechen.  Die  Gesichter  der  Menschen,  die 
Landschaft  —  alles  war  Ando  absolut  real  vorgekommen.  Er  fühlte 
sich erschöpft. Die Panik Asakawas hatte sich auf ihn übertragen. Er 
war so ausgelaugt, dass er eine kurze Unterbrechung brauchte. 
Doch die Pause verstärkte seinen Wissensdurst nur noch mehr. Was 
passierte  dann?  Ando  platzte  fast  vor  Neugierde.  Er  trank  einen 
Schluck  Tee,  nahm  den  Bericht  wieder  in  die  Hand  und  verschlang 
eine Seite nach der anderen. 
Nachdem Asakawa wieder in Tokio war, kontaktierte er zuerst sei‐
nen alten Freund Ryuji  und berichtete ihm von dem Video. Er hatte 
nicht den Mut, das Ganze allein durchzuziehen. Ethisch gesehen war 
es zwar falsch, jemanden in diese Sache zu verwickeln, doch Asaka‐
was  Selbsterhaltungstrieb  war  größer  als  seine  Gewissensbisse  und 
Zweifel.  Wollte  er  seine  Haut  retten,  war  er  auf  die  Hilfe  eines  ver‐
lässlichen  Freundes  angewiesen.  Ryuji  schien  da  genau  die  richtige 
Person zu sein. Wahrscheinlich gab es außer ihm niemanden, der sich 
das Video ansehen würde, ohne auch nur mit der Wimper zu zucken. 
Er  war  einer  jener  Menschen,  die  sogar  beim  Weltuntergang  in  der 
ersten Reihe säßen. 
Asakawa hatte außerdem seinen Kollegen Yoshino um Hilfe gebe‐
ten, aber der war nicht lebensmüde genug, um sich das Video anzu‐
sehen.  Zwar  sagte  man  Journalisten  eine  immense  Neugierde  nach, 
aber  allein  die  Möglichkeit,  nach  dem  Anschauen  des  Videos  auf 
elende  Weise  das  Zeitliche  zu  segnen,  hatte  Yoshino  abgeschreckt. 
Verständlicherweise  wollte  er  sein  Leben  nicht  riskieren,  nur  um 
seine Wissbegier zu befriedigen. 
Ryuji war anders. Nachdem Asakawa ihm von dem ominösen Band 
erzählt hatte, waren seine ersten Worte gewesen: »Lass uns zuerst das 
Video  ansehen.«  Zu  Hause  bei  Asakawa  hatte  Ryuji  sich  das  Video 
dann ganz entspannt angeschaut, als wäre es ein gewöhnlicher Spiel‐
film gewesen. Bevor er ging, bat er Asakawa um eine Kopie. 
 
Das  Wort  ›Kopie‹  ließ  Ando  schlagartig  aufblicken.  In  seinem  Ge‐
hirn ratterte es. Das Originalvideo hatte Asakawa aus der Blockhütte 
mitgebracht;  es  war  die  ganze  Zeit  über  in  seinem  Besitz  gewesen 
und hatte garantiert im Unfallwagen in dem Videorekorder gesteckt. 
Danach  war  es  in  die  Hände  von  Asakawas  Bruder,  Jun‐ichiro, 
gefallen.  Dieser  Idiot  hatte  es  mitsamt  Videorekorder  auf  den  Müll 
geschmissen. 
Dann  gab  es  noch  die  Kassette  in  Mais  Apartment.  Die  ersten 
Sekunden auf dem Band stimmten haargenau mit den von Asa‐kawa 
geschilderten  Szenen  überein.  Ob  das  vielleicht  die  Kopie  war,  die 
Asakawa für Ryuji gezogen hatte? Das wäre zumindest plausibel. Die 
breiten  schwarzen  Buchstaben  auf  dem  Etikett  ließen  auf  die  Hand‐
schrift  eines  Mannes  schließen,  vermutlich  die  von  Asakawa.  Für 
Ryujis Kopie hatte er aller Wahrscheinlichkeit nach eine alte Kassette 
überspielt,  auf  der  die  auf  dem  Etikett  angekündigte  Musiksendung 
gewesen  war.  Irgendwie  musste  das  Band  dann  in  Mais  Hände 
gelangt sein. 
So ergab alles einen Sinn. 
Aber  wann  war  Mai  mit  diesem  gefährlichen  Video  in  Berührung 
gekommen?  Woher  hatte  sie  es?  Ihm  gegenüber  hatte  sie  nichts 
erwähnt. Sie musste mehr oder weniger zufällig daraufgestoßen sein. 
Nichts  ahnend  hatte  sie  es  sich  vermutlich  angesehen.  Es  blieb  also 
festzuhalten,  dass  dieses  mysteriöse  Videoband  mindestens  in 
zweifacher Ausführung existierte. 
Ando las weiter. 
 
Ryuji  nahm  die  Kopie  des  Originalvideos  mit  nach  Hause.  Sie 
mussten so schnell wie möglich die Zauberformel herausfinden, nur 
so  bestand  Hoffnung,  dem  lauernden  Tod  irgendwie  zu  entgehen. 
Deshalb hatten sie beschlossen, zunächst der Frage nachzugehen, wie 
diese unheimliche Kassette in die Blockhütte B‐4 gelangt sein könnte. 
Daran schloss sich auch schon die nächste Frage an: Wer hatte die Bil‐
der  aufgenommen?  Eine  erste  Vermutung  war,  dass  jemand  eine 
Videokamera  benutzt  und  das  Band  dann  in  der  Hütte  vergessen 
hatte.  Asakawas  Nachforschungen  bestätigten  diese  Annahme  aller‐
dings nicht. 
Vor den Jugendlichen hatte eine aus Yokohama stammende Familie 
die Hütte gemietet. Sie hatten eine Videokassette mit dabei, weil ihr 
Sprössling  eine  Kindersendung  aufnehmen  wollte,  während  die 
Eltern  sich  einen  Dokumentarfilm  zu  Gemüte  führten.  Mit  anderen 
Worten,  sie  hatten  eine  leere  Kassette  mitgebracht,  diese  dann  aber 
vergessen. Ihr Aufenthalt endete nur drei Tage vor der  Ankunft der 
späteren Todesopfer. Die entscheidende Frage war: Wo kamen diese 
Bilder  her,  wenn  der  Junge  eine  ganz  normale  Fernsehsendung 
aufgezeichnet hatte? 
Die  ursprüngliche  These  war  ja  gewesen,  dass  irgendjemand  die 
Aufnahmen  mit  einer  Videokamera  gemacht  und  in  die  Blockhütte 
mitgenommen hatte. Aber da der Videorekorder mit der eingelegten 
Kassette  auf  Aufnahme  eingestellt  war,  mussten  die  unglaublichen 
Bilder  ausgestrahlt  worden  sein  wie  sonst  die  Fernsehsendungen. 
Jemand  schien  die  Sendefrequenz  manipuliert  zu  haben.  Dass  dies 
möglich  war,  hätte  Asakawa  sich  in  seinen  kühnsten  Träumen  nicht 
vorgestellt. Aber es ging offenbar. 
Den  vier  jungen  Leuten  war  wahrscheinlich  langweilig  gewesen, 
und da hatten sie gesagt: He, warum schauen wir nicht ein bisschen fern? 
Als  sie  das  Gerät  einschalteten,  wurden  sie  auf  das  Video  aufmerk‐
sam und sahen es sich an. Die letzten Worte auf dem Band hatten sie 
vermutlich  als  Schwachsinn  abgetan,  denn  es  war  nach  ihrer  Rück‐
kehr  nicht  zu  erkennen  gewesen,  dass  sie  sich  irgendwie  bedroht 
gefühlt oder versucht hätten, die Zauberformel zu finden. Sie dachten 
sicherlich,  irgendjemand  hätte  sich  einen  üblen  Scherz  erlaubt. 
Schließlich  landete  das  Video  im  Büro  des  Verwalters,  und  dort 
entdeckte Asakawa es. 
Aber wer konnte eine Sendefrequenz illegal benutzt haben? Irgend‐
ein Freak? Nur — woher kam die Ausstrahlung? Das waren die Frau‐
gen, die wieder aufdrängten. Asakawa fiel die Aufgabe zu, weiter zu 
recherchieren.  Allerdings  ereignete  sich  in  der  Zwischenzeit  etwas 
Tragisches. Seine Frau und seine Tochter sahen sich das Video wäh‐
rend seiner Abwesenheit an. Nun ging es nicht mehr nur um sein Le‐
ben, sondern um das seiner Familie. Ein Grund mehr, sich hinter die 
Sache zu klemmen, dachte Asakawa. 
Mittlerweile  hatte  Ryuji  eine  faszinierende  Entdeckung  gemacht. 
Immer  und  immer  wieder  hatte  er  sich  das  Band  angesehen  und 
versucht,  es  auf  irgendeine  Weise  zu  analysieren,  bis  er  auf  die 
geniale  Idee  gekommen  war,  das  Video  in  einzelne  Sequenzen  zu 
unterteilen. Diese stellte er dann in einer Tabelle dar. Und siehe da, es 
war tatsächlich eine Struktur zu erkennen. Insgesamt waren es zwölf 
Szenen, die sich grob in zwei Kategorien aufteilen ließen, und zwar in 
abstrakte und realistische. Erstere glichen mentalen Szenen, die man 
als abstrakte Gedankenlandschaften hätte bezeichnen können. In den 
realistischen  Szenen  hingegen  tauchten  real  existierende  Dinge  auf: 
der  Vulkanausbruch  oder  das  markante  Gesicht  des  Mannes.  Der 
stecknadelgroße Lichtpunkt auf der pechschwarzen Mattscheibe war 
der ersten Kategorie zuzuordnen. 
Aber da war noch etwas. Für winzige Augenblicke wurde die Matt‐
scheibe  gelegentlich  dunkel.  Ließ  man  das  Band  mit  normaler  Ge‐
schwindigkeit laufen, war der Bruch kaum wahrnehmbar, doch wenn 
man  die  Sequenz  Bild  für  Bild  analysierte,  war  es  möglich,  extrem 
kurze Intervalle totaler Finsternis zu entdecken. Allerdings fiel dieser 
›schwarze  Vorhang‹  nur  bei  den  realistischen  Szenen.  Bei  den  ande‐
ren,  abstrakten  Bildern  gab  es  diese  Momente  absoluter  Dunkelheit 
nicht. Was hatte das für eine Bedeutung? Warum geschah dies nur in 
den realistischen Szenen und nicht in den imaginären? 
Ryuji  wusste  nicht,  was  das  bedeuten  könnte,  aber  seine  Intuition 
brachte ihn auf einen Gedanken: Wir haben es hier mit der Trägheit des 
Auges zu tun, sagte er. Wenn man sich die Bilder ansah, hatte man das 
Gefühl  einer  unglaublichen  Unmittelbarkeit,  als  wäre  man  selbst 
Bestandteil dieser Szenen. Der schwarze Vorhang, der den Bildschirm 
kurzfristig  in  Finsternis  tauchte,  war  der  Moment,  in  dem  sich  das 
Auge schloss — ein Lidschlag. Von geringfügigen individuellen Un‐
terschieden  abgesehen,  gab  es  bei  Frauen  fünfzehn  Lidschläge  pro 
Minute. Dank Ryuji waren sie der Lösung einen wesentlichen Schritt 
näher  gekommen.  Das  Resultat  seiner  Analyse  war  erschreckend, 
aber auch faszinierend. 
Das Videoband war nicht mit einer Kamera aufgenommen worden, 
sondern durch den Einsatz der menschlichen Sinne. 
 
Dieser  Teil  des  Asakawa‐Berichtes  war  für  Ando  völlig  unglaub‐
würdig. Was für ein Schwachsinn — ein Video, das durch die Sinnesorgane 
einer  Frau  aufgenommen  wurde!  Das  ist  doch  lächerlich.  Er  fand  diese 
Theorie derart absurd, dass er absolut nicht verstand, wie man auch 
nur  einen  Gedanken  daran  verschwenden  konnte.  Hätte  es  sich  um 
Filmmaterial  gehandelt,  okay,  dann  hätte  man  eine  solche  Möglich‐
keit vielleicht noch in Betracht ziehen können. Aber hier ging es um 
ein Video. Allein technisch war das undenkbar. Zwar war Ando von 
Ryujis  These  zutiefst  beeindruckt,  doch  hatte  er  große  Zweifel  an 
ihrer  Richtigkeit.  Dennoch  beschloss  er,  kein  vorzeitiges  Urteil  zu 
fällen, und las weiter. 
 
Falls die Bilder auf dem Video tatsächlich vom Sinnesapparat einer 
bestimmten  Frau  zusammengetragen  worden  waren,  dann  war  der 
nächste Schritt herauszufinden, wer diese Person war und wonach sie 
sich  gesehnt  haben  könnte.  Das  war  der  Schlüssel  zu  der 
Zauberformel. Ryuji und Asakawa machten sich nach Kamakura auf. 
Ziel war die Tetsuzo‐Miura‐Gedenkhalle. 
Professor  Miura  hatte  Parapsychologie  studiert.  Die  bescheidene 
Gedenkhalle war seinen wissenschaftlichen Untersuchungen auf dem 
Gebiet  übersinnlicher  Phänomene  gewidmet.  Akribisch  hatte  er  alle 
Personen  mit  übernatürlichen  Kräften  in  ganz  Japan  ausfindig 
gemacht  und  ihre  Fähigkeiten  dokumentiert.  Ryuji  hatte  Asakawa 
hergebracht, weil er eine realistische Chance sah, dass sie hier fündig 
würden. Es gab nur sehr wenige Menschen mit übersinnlichen Fähig‐
keiten, die ohne jede technische Hilfe Bilder auf einen Fernsehschirm 
hätten  projizieren  können.  Ryujis  Theorie  zufolge  hatten  sie  es  an‐
scheinend mit so einer Person zu tun. Er konnte sich nicht vorstellen, 
dass ein solcher Fall dem Professor durch die Lappen gegangen war. 
Tetsuaki  Miura,  der  Sohn  des  verstorbenen  Professors,  gewährte 
ihnen einen Blick in das Archiv in der Annahme, dass ihnen die Lust 
schnell vergehen würde, wenn sie erst einmal die vollgestopften Re‐
gale gesehen hatten. Das war an seinem Blick zu erkennen. In der Tat 
konnte  Asakawa  seinen  Augen  kaum  trauen.  Ein  gewaltiger  Akten‐
berg ragte vor ihnen auf. Eine unfassbare Flut von Dokumenten war‐
tete  —  es  schienen  Tausende  zu  sein.  Doch  Ryuji  ließ  sich  nicht  ab‐
schrecken.  Ihn  brachte  bekanntermaßen  nichts  so  schnell  aus  der 
Ruhe. Asakawa hingegen war nahe dran, den Verstand zu verlieren. 
Aber  was  blieb  ihnen  übrig?  Eine  bessere  Idee  hatte  er  auch  nicht. 
Schließlich  musste  er  einräumen,  dass  sie  eine  realistische  Chance 
hatten. Zumindest war es das Einzige, das sie im Moment tun konn‐
ten.  Von  der  ablaufenden  Zeit  getrieben,  begannen  sie,  sich  durch 
den  riesigen  Aktenberg  zu  wühlen  und  ein  Dokument  nach  dem 
anderen  durchzusehen.  Stunde  um  Stunde  verging,  doch  dann 
durchbrach  Ryuji  die  Stille  im  Archiv  mit  einem  schrillen  Schrei: 
»Treffer!« Er war fündig geworden. 
Der  Name  der  verdächtigen  Frau  lautete  Sadako  Yamamura.  Sie 
kam aus Sashikiji auf der Insel Oshima. 
Auf  dem  Umschlag  stand  eine  Notiz.  Sie  hatte  im  Alter  von  zehn 
Jahren Fragmente ihres Namens ›Yama‹ — ›Berg‹ — und ›Sada‹ auf 
einen  Film  projiziert.  Angeheftet  war  eine  Fotografie,  auf  der  auf 
schwarzem  Hintergrund  in  Weiß  das  japanische  Schriftzeichen  für 
›Yama‹ leuchtete. Es war das gleiche Zeichen, das sie auf dem Video 
gesehen hatten. Auch ›Sada‹ kam darin vor. 
Sie  waren  sich  nun  ganz  sicher.  Sadako  Yamamura  war  die 
Richtige. 
Am nächsten Morgen nahmen Asakawa und Ryuji das Schnellboot 
nach Oshima, um ihrem Verdacht nachzugehen. Natürlich war nicht 
sicher,  dass  Sadako  Yamamura  tatsächlich  hinter  der  ganzen  Sache 
steckte,  aber  es  war  möglich.  Sie  hofften,  die  Szenen  auf  dem  Video 
besser deuten zu können, wenn sie etwas über Sadakos Kindheit oder 
Charakter erfahren würden. Ein Versuch war es wert. Sie wollte dem 
Betrachter des Videos Angst, ja Todesangst einjagen. Dahinter steckte 
sicher eine Absicht. Vielleicht wollte sie, dass man etwas Bestimmtes 
für sie tat. 
Ryuji hatte da so eine Vorahnung. Er hatte sich schon gedacht, dass 
sie  womöglich  nicht  mehr  unter  den  Lebenden  weilte.  Dann  müssen 
wir eruieren, wonach sich diese Person gesehnt hat, als sie noch lebte, sagte 
er.  Sie  gingen  mittlerweile  davon  aus,  dass  die  Zauberformel,  die 
ihnen  das  Leben  retten  würde,  eine  Aufforderung  enthielt,  etwas 
Bestimmtes zu tun. 
Auf  Oshima erhielten sie von der regionalen Zweigstelle von Asa‐
kawas Zeitung Unterstützung. Eine richtige Redaktion gab es auf der 
Insel  zwar  nicht,  stattdessen  wurden  Insulaner  als  Lokalreporter 
beschäftigt. Während sie Kontakt zu Yoshino in der Hauptredaktion 
in  Tokio  hielten,  fanden  Ryuji  und  Asakawa  allmählich  heraus,  was 
Sadako Yamamura für ein Mensch gewesen war. 
Sadako Yamamura war 1947 auf Oshima geboren worden und das 
Kind  von  Shizuko  Yamamura  und  Ino  Heihachiro,  einem  Psycholo‐
gieprofessor  gewesen.  Heihachiro  hatte  in  Shizuko  einen  Menschen 
mit  verblüffenden  übersinnlichen  Visionen  entdeckt.  Sie  wurde  sein 
Studienobjekt, und er war so fasziniert, dass er seine ganze Aufmerk‐
samkeit  der  Erforschung  übersinnlicher  Kräfte  zu  widmen  begann. 
Die  beiden  sorgten  für  kräftigen  Wirbel  in  der  Boulevardpresse,  da 
sie  wissenschaftliche  Erklärungen  für  übernatürliche  Fähigkeiten  zu 
liefern  schienen.  Die  Massenmedien  lobten  Shizuko  und  Heihachiro 
in  den  Himmel,  und  ihr  Leben  verlief  anfangs  unter  einem  glück‐
lichen Stern. 
Doch  es  gab  auch  Gegner.  Eine  Gruppe  renommierter  Wissen‐
schaftler  ließ  Zweifel  laut  werden  und  bezeichnete  das  Ganze  hart‐
näckig  als  Schwindel  und  Scharlatanerie.  Allmählich  schlug  die 
öffentliche Meinung um und wandte sich gegen Shizuko und Heiha‐
chiro. Daraufhin bot Heihachiro den Medien eine öffentliche Demon‐
stration von Shizukos außergewöhnlichen übernatürlichen Kräften an 
—  ein  parapsychologisches  Experiment,  das  die  Öffentlichkeit  über‐
zeugen sollte. 
Doch  Shizuko  versagte.  Heftig  zitternd  brach  sie  zusammen.  Die 
fehlgeschlagene  Demonstration  hatte  folgenreiche  Konsequenzen. 
Heihachiro flog von der Universität, und Shizukos Verfolgungswahn 
nahm  zu.  Alles  schien  den  Bach  hinunterzugehen.  Heihachiro  er‐
krankte schließlich an Tuberkulose. Unterdessen verschlechterte sich 
Shizukos  psychische  und  emotionale  Verfassung  weiter,  bis  sie  sich 
eines  Tages  verzweifelt  in  den  Krater  des  Vulkans  Miharayama 
stürzte — Selbstmord. 
Nachdem  ihre  Mutter  sich  umgebracht  hatte,  wurde  Sadako  von 
Verwandten  aufgenommen.  Im  folgenden  Jahr,  als  sie  in  die  vierte 
Klasse  ging,  prophezeite  sie,  dass  der  Miharayama  ausbrechen 
werde.  Dadurch  wurde  sie  in  der  Schule  regelrecht  berühmt.  Denn 
pünktlich an dem Tag, den Sadako vorausgesagt hatte, brach der Vul‐
kan  aus.  Oft  baten  Insulaner  sie,  ihnen  die  Zukunft  vorauszusagen, 
aber  sie  lehnte  immer  ab.  Nach  der  erfolgreichen  Prophezeiung  des 
Vulkanausbruchs setzte Sadako ihre übernatürlichen Fähigkeiten, die 
sie  von  ihrer  Mutter  geerbt  zu  haben  schien,  nie  wieder  ein.  Nach 
ihrem Abschluss an der Oberschule ging sie nach Tokio. Sie trat einer 
Theatergruppe bei und wollte Filmschauspielerin werden. 
Niemand auf der Insel wusste, was aus Sadako geworden war. Asa‐
kawa rief Yoshino an und bat ihn herauszufinden, wohin sie gegan‐
gen  war  und  was  sie  gemacht  hatte,  nachdem  sie  sich  der  Theater‐
gruppe Spielfreude angeschlossen hatte. Denn das war momentan ihr 
einziger Anhaltspunkt auf der Suche nach ihr. 
Yoshino  machte  sich  sogleich  auf  den  Weg  nach  Yotsuya,  um  der 
Theatergruppe einen Besuch abzustatten. Die Fährte war uralt, es war 
keine leichte Aufgabe. Fünfundzwanzig Jahre waren vergangen, seit 
Sadako an diesem Theater gespielt hatte. Die Frage war, ob sich von 
den Mitgliedern der Truppe überhaupt noch jemand an sie erinnern 
würde; falls nicht, würde dieser Teil der Nachforschungen im Sande 
verlaufen,  und  die  zweite  Hälfte  des  Lebens  dieser  Frau  mit  den 
erstaunlichen  Fähigkeiten  würde  sich  in  geheimnisvollem  Dunkel 
verlieren. 
Aber  es  kam  anders.  Tatsächlich  erinnerte  sich  eines  der  Grün‐
dungsmitglieder der Truppe, Shin Arima, an Sadako Yamamura. Sie 
schien  tiefen  Eindruck  auf  ihn  gemacht  zu  haben.  Arima  nannte  sie 
›unheimlich‹, als Yoshino ihn nach Sadakos Charakter fragte. Es gab 
einen  guten  Grund,  warum  er  sich  nach  so  langer  Zeit  noch  an  sie 
erinnerte: Arima hatte beobachtet, wie Sadako Bilder auf die Bildröh‐
re eines Fernsehers projizierte. Sie schien unheimliche, übernatürliche 
Kräfte zu besitzen. Ihre Fähigkeiten gingen weit über die ihrer Mutter 
hinaus.  Erst  hatte  Arima  nicht  verstanden  —  er  dachte,  sie  schaute 
lediglich  fern.  Aber  dann  bemerkte  er,  dass  der  Fernseher  nicht 
eingestöpselt war. 
Ihn überkam ein kalter Schauer. Die Begebenheit hatte ihn offenbar 
so  beeindruckt,  dass  er  nach  all  den  Jahren  noch  detailliert  darüber 
berichten konnte. Er hatte noch die Bewerbungsunterlagen von Sada‐
ko  und  zeigte  sie  Yoshino.  Dem  Lebenslauf  waren  zwei  Schwarz‐
weißfotografien  angeheftet,  ein  Porträt  und  eine  Ganzkörperauf‐
nahme.  Yoshino  war  einigermaßen  verblüfft,  denn  Sadako  sah  ganz 
anders aus, als er sie sich nach Arimas Schilderung vorgestellt hatte. 
Sie  hatte  ein  bezaubernd  hübsches  Gesicht,  war  von  makelloser 
Schönheit, die sich mit Worten nicht beschreiben ließ. 
Schließlich  konnte  Yoshino  aber  leider  nicht  in  Erfahrung  bringen, 
wohin  Sadako  verschwunden  war,  nachdem  sie  die  Theatergruppe 
verlassen hatte. Es war keine Spur von ihr zu entdecken. Er schickte 
ein Fax mit Foto zu dem Kontaktmann auf Oshima, um Asakawa und 
Ryuji vor Ort über seine Recherchen auf dem Laufenden zu halten. 
Der  Schock  hätte  nicht  größer  sein  können,  als  Asakawa  das  Fax 
von  Yoshino  erhielt  und  daraus  entnehmen  musste,  dass  sie  nicht 
weiterkamen.  Sie  steckten  in  einer  Sackgasse.  Doch  wenn  sie  nicht 
herausfanden, was aus Sadako geworden war, würden sie den myste‐
riösen  Fluch  nie  entschlüsseln.  Seine  Hoffnung  schlug  in  Verzweif‐
lung um. Die ganze Welt schien sich zu verdüstern. 
Da  hatte  Ryuji  einen  Geistesblitz:  Im  Grunde  genommen  war  es 
egal,  ob  sie  Sadakos  Spur  in  der  richtigen  Chronologie  verfolgten. 
Wer sagt denn, dass wir das Mittel gegen den Fluch finden, wenn wir ihren 
Lebensweg rekonstruieren? Asakawa erinnerte sich noch genau an diese 
Worte.  Sie  hatten  ihn  ein  wenig  getröstet.  Die  entscheidende  Frage 
war: Warum war das Ganze in der Blockhütte Nummer B‐4 passiert? 
Warum  ausgerechnet  im  Ferienklub  Pazifik  in  Süd‐Hakone?  Sie 
beschlossen,  sich  auf  den  Ort  zu  konzentrieren,  wo  das  Übel  seinen 
Anfang  genommen  hatte.  Vielleicht  würde  es  ihnen  auf  diese  Weise 
gelingen, die Hintergründe aufzudecken. 
Das  Pazifikland  in  Süd‐Hakone  war  erst  vor  ein  paar  Jahren  er‐
richtet worden. Man konnte nicht ausschließen, dass sich dort früher 
andere Einrichtungen befunden hatten. Asakawa kontaktierte Yoshi‐
no  erneut  und  bat  ihn,  Nachforschungen  anzustellen,  was  sich  auf 
dem  Grundstück  in  Süd‐Hakone  befunden  hatte,  bevor  der  Ferien‐
klub gebaut worden war. 
Am  frühen  Morgen  des  folgenden  Tages  ratterte  das  Faxgerät  er‐
neut. Es spuckte die Informationen aus, die Yoshino in der Zwischen‐
zeit herausgefunden hatte. Dem Bericht zufolge hatte früher ein Sana‐
torium  für  Tuberkulosekranke  auf  dem  Grundstück  gestanden. 
Yoshino hatte sogar einen Grundriss auftreiben können. 
Darüber  hinaus  hatte  er  den  Lebenslauf  eines  gewissen  Shirotaro 
Nagao  geschickt,  Arzt  für  Innere  Medizin  und  Kinderheilkunde  mit 
einer eigenen Klinik in Atami. Dr. Nagao war jetzt siebenundfünfzig 
Jahre alt. Fünf Jahre lang, von 1962 bis 1967, hatte er in der Einrich‐
tung  in  Süd‐Hakone  gearbeitet.  Sie  wussten  zwar  nicht,  warum  Yo‐
shino den Lebenslauf gefaxt hatte, aber wahrscheinlich dachte er, das 
sie  damit  zumindest  einen  Ansprechpartner  hätten,  an  den  sie  sich 
mit Fragen über die Anstalt wenden konnten. 
Asakawa  und  Ryuji  entschlossen  sich  kurzfristig,  Dr.  Nagao  einen 
Besuch  abzustatten.  Sie  nahmen  ein  Schnellboot  nach  Atami.  An 
diesem Tag war genau eine Woche vergangen, seit Asakawa sich das 
Video  in  der  Blockhütte  des  Ferienklubs  angeschaut  hatte.  Ihm 
blieben  nur  noch  ein  paar  Stunden  bis  zum  Ablauf  der  Frist.  Am 
selben Abend um zweiundzwanzig Uhr würde ihn der Tod ereilen — 
es sei denn, sie fanden bis dahin den Schlüssel für das Rätsel. Ryujis 
Zeit würde am darauffolgenden Tag ablaufen, ebenfalls um zweiund‐
zwanzig  Uhr.  Asakawas  Frau  und  kleine  Tochter  würden  übermor‐
gen  gegen  elf  Uhr  morgens  sterben.  Viel  Hoffnung  hatte  Asakawa 
nicht, dass alles gut ausgehen würde. Aber zum Glück behielt zumin‐
dest  einer  von  ihnen  einen  kühlen  Kopf.  Auf  Ryuji  war  in  dieser 
Hinsicht Verlass. 
In  Atami  angekommen,  nahmen  sie  sich  einen  Mietwagen.  Der 
Panik  nahe,  rasten  sie  zu  Dr.  Nagaos  Klinik.  Asakawa  ging  immer 
wieder  derselbe  Gedanke  durch  den  Kopf:  Wenn  sie  von  dem  Arzt 
nichts in Erfahrung bringen konnten, waren sie erledigt. Jetzt war es 
zu  spät,  um  bei  ihren  Nachforschungen  einen  anderen  Weg  einzu‐
schlagen. Sie hofften, dass Nagao ihnen irgendetwas Hilfreiches mit‐
teilen würde, sei es auch nur eine noch so winzige Information. Aber 
es kam anders: Sie erhielten eine ganze Flut von Informationen. Nie 
hätten Asakawa und Ryuji sich träumen lassen, dass dieses Gespräch 
so fruchtbar sein würde. 
Sie  betraten  das  Krankenhaus.  Beim  ersten  Blick  auf  das  Gesicht 
von  Dr.  Nagao  entfuhr  beiden  ein  überraschter  Ausruf.  Ryuji  und 
Asakawa war sofort klar, dass Nagao ihnen etwas über Sadako wür‐
de sagen können. Er war der Mann, dessen Gesicht man in der letzten 
Szene  des  Videos  sah  —  schweißüberströmt,  keuchend  und  mit 
blutunterlaufenen Augen hatte Sadako es dargestellt. An der bloßen 
Schulter hatte er eine Verletzung, aus der Blut spritzte. Der Mann vor 
ihnen  war  zwar  um  einiges  älter  und  beinahe  kahlköpfig,  aber  es 
stand  außer  Zweifel,  dass  in  dem  Video  sein  Gesicht  zu  sehen  war. 
Sadako  hatte  es  aus  unmittelbarer  Nähe  betrachtet.  In  ihren  Augen 
war  es  das  Gesicht  eines  Mannes  mit  grausamen,  mörderischen 
Absichten gewesen. 
Ryuji bearbeitete Nagao intensiv und quetschte die dunkle Vergan‐
genheit aus ihm heraus. Wie betäubt vor Entsetzen erfuhren sie, was 
sich damals, vor fünfundzwanzig Jahren, zugetragen hatte. 
Am fraglichen Tag war es sehr heiß gewesen. Nagao hatte für eine 
kurze Zeit in einer geschlossen Isolierstation tief in den Bergen gear‐
beitet und sich dort in einem unachtsamen Moment mit Pocken infi‐
ziert.  An  jenem  Tag  zeigten  sich  die  ersten  Symptome  der  Erkran‐
kung.  Er  hatte  Fieber  und  Kopfschmerzen,  doch  ihm  kam  nicht  in 
den  Sinn,  dass  er  sich  mit  den  Pocken  angesteckt  haben  könnte.  Er 
hatte es als gewöhnliche Grippe abgetan und machte wie immer seine 
tägliche Visite bei den Patienten. Während einer kurzen Verschnauf‐
pause  im  schattigen  Park  vor  dem  Sanatorium  traf  er  auf  Sadako 
Nakamura. Sie kam oft hierher, um ihren kranken Vater zu besuchen. 
Da  sie  das  Theaterspielen  aufgegeben  hatte,  schien  sie  viel  Zeit  zu 
haben. 
Nagao  war  von  Sadakos  strahlender,  verführerischer  Schönheit 
überwältigt. Er setzte sich neben sie und sprach sie an. Während sie 
über  dieses  und  jenes  plauderten,  hatte  er  plötzlich  das  sonderbare 
Gefühl, als würde irgendein Etwas von ihm Besitz ergreifen und die 
Kontrolle  über  seinen  Körper  übernehmen.  Er  legte  einen  Arm  um 
Sadako  und  überredete  sie,  ein  schattigeres  Plätzchen  aufzusuchen, 
um die Unterhaltung fortzusetzen. Er führte sie durch das Unterholz 
des  Waldes  zu  einer  kleinen  Lichtung.  Dort  stand  ein  verwaistes 
Bauernhaus.  Hinter  dem  Gemäuer  gab  es  einen  alten  Brunnen.  Von 
einer  zügellosen  Begierde  getrieben,  warf  Nagao  Sadako  zu  Boden 
und verging sich an ihr... 
Sie  wehrte  sich  heftig  und  biss  ihn  in  die  rechte  Schulter.  Blut 
spritzte  aus  der  Wunde.  Irgendwann  bemerkte  er,  dass  sich  sein 
Körper  dem  Rhythmus  ihrer  Bewegungen  angepasst  hatte.  Als  es 
vorbei  war  und  er  einen  letzten  Blick  auf  ihren  wohlgeformten 
Körper  warf,  entdeckte  er  unter  den  Haaren  ihrer  Scham  zwei  voll 
entwickelte Hoden. Wenn er kein Arzt gewesen wäre, hätte er seinen 
Augen  nicht  getraut,  aber  ihm  waren  solche  Fälle  bekannt.  Es  gab 
eine kleine Gruppe von Menschen, die diese Besonderheit aufwiesen. 
Äußerlich wirkten sie wie Frauen. Sie hatten Brüste und eine Vagina, 
allerdings oft keine Eileiter. Außerdem verfügten sie über den norma‐
len  männlichen  XY‐Chromosomensatz  und  konnten  keine  Kinder 
gebären.  Aus  irgendeinem  Grund  waren  solche  Menschen  häufig 
außergewöhnlich attraktiv. 
Erneut  überkam  Nagao  ein  starker  Impuls.  Er  warf  sich  abermals 
auf  den  schönen,  abnormen  Körper  Sadakos,  legte  beide  Hände  um 
ihren  schmalen  Hals  und  drückte  mit  ganzer  Kraft  zu.  Dann  hob  er 
sie  hoch  und  schleppte  sie  zu  dem  Brunnen.  Die  Leiche  fiel  in  den 
dunklen  Abgrund  hinunter  und  wurde  von  der  feuchten  Erde 
verschluckt. Um sicherzugehen, warf Nagao Steine und Erde in den 
Brunnen, damit sie für immer verschwunden bliebe. 
Nachdem Nagao sein Geständnis beendet hatte, legte Asakawa ihm 
eine  Skizze  von  dem  früheren  Gelände  in  Süd‐Hakone  vor  und  bat 
ihn, ihnen zu zeigen, wo in etwa der Brunnen war. Der Arzt zögerte 
eine  Weile,  zeigte  dann  jedoch  mit  dem  Finger  auf  die  betreffende 
Stelle.  Der  Brunnen  muss  ungefähr  hier  gewesen  sein,  sagte  er.  Es  be‐
stand kein Zweifel: Das war genau die Stelle, an der inzwischen die 
Blockhütte  B‐4  stand.  Ryuji  und  Asakawa  machten  sich  sofort  nach 
Süd‐Hakone auf. 
Dort  angekommen,  begannen  sie,  den  alten  Brunnen  zu  suchen. 
Asakawa  war  mittlerweile  hochgradig  nervös.  Sobald  sie  ihn 
entdeckt  hätten,  wollten  sie  die  sterblichen  Überreste  von  Sadako 
Yamamura herausholen — so war ihr Plan. Er versuchte, nicht daran 
zu  denken,  was  für  ein  grausiger  Akt  ihnen  bevorstand.  Mit  dem 
Nerven völlig am Ende, stieß er ziellos die Schaufel in irgendwelche 
Erdhügel,  bis  Ryuji,  der  emotional  wesentlich  stärker  war,  ihn  zu‐
rückhielt. Der Brunnen musste nahe bei den Hütten gewesen sein. 
Und tatsächlich, als sie unter die Terrasse von B‐4 krochen und mit 
der  Taschenlampe  herumleuchteten,  konnten  sie  einen  schwarzen 
Hügel  erkennen.  Bei  genauerer  Betrachtung  sahen  sie,  dass  es  ein 
Haufen  Steine  war,  die  offenbar  einmal  eine  Mauer  gebildet  hatten. 
Darauf lag ein Deckel aus Zement. Aber das Erstaunliche daran war, 
das  sich  genau  über  diesem  Haufen  das  Wohnzimmer  befand.  So, 
wie  es  aussah,  standen  genau  über  der  Brunnenöffnung  der  Fernse‐
her und der Videorekorder. Asakawa begriff, dass Sadako Yamamura 
direkt unter ihm gelegen hatte, als er sich das Video vor einer Woche 
angeschaut hatte. Damit war auch die Frage geklärt, warum es ausge‐
rechnet hier entstanden war. 
Ryuji und Asakawa versuchten zunächst, den Zementdeckel herun‐
terzuziehen. Unter größter Kraftaufwendung rutschte der Deckel mit 
einem  ohrenbetäubenden  Kreischen  Zentimeter  für  Zentimeter  zur 
Seite.  Schließlich  gelang  es  ihnen,  den  Brunnen  zu  öffnen.  Aus  der 
Tiefe schien eine kühle, übel riechende, giftige Ausdünstung empor‐
zusteigen und umklammerte sie mit eisigem Griff. Die Dunkelheit im 
Brunnen  war  so  undurchdringlich,  dass  sie  das  Gefühl  hatten,  sie 
würden hinuntergezogen, wenn sie sich nicht fest hielten. 
Es war klar, was als Nächstes zu tun war. Asakawa wusste, dass er 
in den dunklen, feuchten Brunnen hinunterkriechen musste. Er hatte 
keine andere Wahl, als hinabzusteigen und die sterblichen Überreste 
von Sadako Yamamura herauszuziehen ... 
Was  Sadako  mit  dem  Gedankenvideo  bezweckt  hatte,  schien  ein‐
deutig  zu  sein:  Sicherlich  hatte  sie  sich  verzweifelt  danach  gesehnt, 
aus dieser schrecklichen Dunkelheit befreit zu werden ... 
Das war die Lösung. Der Fluch würde gebannt sein, sobald sie Sa‐
dakos  Leiche  aus  dem  engen  Brunnen  herausgeholt,  einen  Gedenk‐
gottesdienst  abgehalten  und  sie  in  ihre  Heimatstadt  zurückgebracht 
hatten,  damit  sie  ein  ordentliches  Begräbnis  erhielt.  Dann  wäre  ihre 
herumwandernde  Seele  endlich  frei  und  könnte  zur  Ruhe  kommen. 
Natürlich  hatten  sie  keine  Gewissheit,  aber  zumindest  standen  die 
Chancen nicht schlecht, dass der Fluch, der durch das Video verbrei‐
tet worden war, dadurch aufgehoben wurde. Das musste die Zauber‐
formel  auf  dem  Video  gewesen  sein.  Zu  Asakawas  Erleichterung 
machte Ryuji den Anfang und stieg in die Tiefe des Brunnens hinab. 
Doch  auch  Asakawa  kam  nicht  darum  herum.  Den  Tod  im  Nacken 
und  unfähig,  einen  klaren  Gedanken  zu  fassen,  kletterte  auch  er  in 
die  unheimliche  Finsternis  hinunter.  Wer  würde  im  Angesicht  des 
Todes  nicht  alles  versuchen,  um  sich  zu  retten?  Abwechselnd  kro‐
chen  sie  in  den  Brunnenschacht,  schaufelten  den  kalten  Schlamm 
vom Grund des Bodens in Eimer, wühlten im lehmigen Wasser nach 
Sadakos  Knochen.  Aber  sie  fanden  nichts  ...  Offenbar  waren  viel 
Erdreich  und  Sand  in  den  Brunnen  gefallen,  bevor  er  geschlossen 
worden war. 
Doch  plötzlich  ertastete  Asakawa  etwas  Großes,  Rundes  —  den 
Schädel  von  Sadako.  Es  war  kurz  nach  zweiundzwanzig  Uhr.  Seine 
Frist  war  vor  wenigen  Minuten  abgelaufen.  Doch  er  lebte  noch.  Es 
war vorbei! Während Ryuji bereits vor Freude jubelte, war Asakawa 
noch immer wie in Trance. Er konnte es einfach nicht glauben. 
Am folgenden Tag machte Asakawa sich mit den sterblichen Über‐
resten von Sadakos Leiche nach Oshima auf, um sie ihren Verwand‐
ten  zu  übergeben.  Ryuji  kehrte  nach  Tokio  in  seine  Wohnung  in 
Higashi Nakano zurück. Er musste einen Artikel zu Ende schreiben. 
Wir  haben  das  Geheimnis  gelüftet.  Der  Fluch  ist  auf  gehoben!,  dachten 
sie stolz. 
 

 
Ando machte eine kurze Pause. Mit dem Bericht in der Hand eilte 
er zum Fenster. Er öffnete es, um die schwere, stickige Luft herauszu‐
lassen. Die Szene, wie Ryuji und Asakawa an einem Seil in den dunk‐
len,  nach  Fäulnis  stinkenden  Brunnen  hinabgekrochen  waren,  hatte 
er mit angehaltenem Atem gelesen. Er fühlte sich, als wäre er selbst in 
diesen  grausigen,  kaum  einen  Meter  breiten  Schacht  hinunterge‐
stiegen. Platzangst hatte ihn übermannt. Diese furchtbare Enge ... die 
Finsternis  ...  Er  brauchte  frische  Luft.  Unter  seinem  Fenster  wiegten 
sich  die  dunklen  Bäume  des  Meiji‐Parks  im  Wind.  Das  Papier 
raschelte. Nur noch eine Seite, dann endeten Asakawas Notizen. Just 
in  diesem  Moment  spukte  der  Drucker  geräuschvoll  die  letzte  Seite 
aus. Das Blatt war zur Hälfte weiß. 
Ando las: 
 
21. Oktober, Sonntag 
Die Verbreitung des Virus 
Die  Lösung  des  Rätsels  lautet:  Ziehe  eine  Kopie  und  zeige  das  Video 
jemand anderem. 
 
Damit  endete  Asakawas  Bericht.  Dies  waren  seine  letzten  stich‐
punktartigen Aufzeichnungen. 
Am  21.  Oktober  hatte  Asakawa  den  Unfall  auf  der  Autobahn 
gehabt.  Einen  Tag  zuvor  war  Ryujis  Leiche  obduziert  worden,  und 
Ando war Mai Takano in der Gerichtsmedizin begegnet. 
Obwohl  Asakawas  Geschichte  hier  endete,  konnte  Ando  sie  fort‐
setzen.  Asakawa  hatte  die  Überreste  Sadakos  am  19.  Oktober  ihren 
Verwandten auf der Insel Oshima übergeben, in dem festen Glauben, 
der Fluch wäre damit endgültig aufgehoben. Aber es war noch lange 
nicht  vorbei.  Diese  bittere  Erkenntnis  blieb  ihm  nicht  erspart,  als  er 
nach Tokio zurückkam. Sein bester Freund Ryuji war tot. Während er 
auf Oshima im Hotel an seinem Bericht über den Vorfall schrieb, war 
Ryuji in seinem Apartment eines grausamen Todes gestorben. 
Asakawa  erhielt  die  Schreckensnachricht  von  Mai.  Entsetzt  begriff 
er, dass ihre Theorie falsch gewesen war. Der Fluch war nicht besiegt. 
Er  trieb  weiterhin  sein  Unwesen  und  würde  womöglich  noch  viele 
weitere  Menschenleben  kosten.  Sadakos  Wunsch  war  es  offensicht‐
lich nicht gewesen, dass jemand ihre sterblichen Überreste barg und 
sie  ein  Begräbnis  erhielt.  Doch  was  in  Gottes  Namen  hatte  sie  ge‐
wollt? Und warum lebte Asakawa noch und Ryuji nicht? 
Asakawa zermarterte sich den Kopf, um Antworten auf diese Frau‐
gen zu finden. Die Frist seiner Frau und seiner Tochter lief am näch‐
sten  Morgen  um  elf  Uhr  ab.  Ihm  blieben  nur  noch  wenige  Stunden, 
um  den  Schlüssel  zur  Lösung  finden.  Wenn  er  nichts  unternahm, 
würde er seine Familie verlieren. Die entscheidende Frage war: War‐
um war er noch am Leben? Daraufgab es nur eine plausible Antwort. 
Irgendwann  im  Laufe  der  vergangenen  Woche  hatte  er  den  Fluch 
aufgehoben,  ohne  es  zu  merken.  Es  musste  irgendetwas  gewesen 
sein,  das  Ryuji  nicht  getan  hatte.  Asakawa  zerbrach  sich  vermutlich 
die  ganze  Nacht  lang  den  Kopf  darüber  —  und  begriff  plötzlich.  Er 
hatte  eine  Kopie  von  dem  Video  angefertigt  und  es  Ryuji  gezeigt! 
Rein zufällig war er dem Geheimnis des Fluchs auf die Spur gekom‐
men. Es ging um die Verbreitung des Videos. Offenbar war es Sada‐
kos  Wunsch  gewesen,  dass  sich  das  Video  wie  ein  Virus  immer 
weiter verbreitete. 
Endlich, so dachte Asakawa, hatte er das Rätsel gelöst. 
Schenkte  man  seiner  Theorie  Glauben,  kam  im  Grunde  nur  das 
Pockenvirus in Frage. Shirotaro Nagao, der Mann, der Sada‐ko Yama‐
mura  kurz  vor  ihrem  Tod  vergewaltigt  hatte, war  der  letzte  Japaner 
gewesen,  von  dem  bekannt  war,  dass  er  sich  mit  Pocken  infiziert 
hatte. Es bestand kein Zweifel daran, dass Sadako den Pockenerreger 
in sich getragen hatte, als sie starb. 
In  Sadako  Yamamura  vereinten  sich  der  Hass  einer  Frau  auf  die 
Gesellschaft, die ihre Eltern in den Tod getrieben hatte, und der Hass 
des  Pockenvirus  auf  die  menschliche  Intelligenz,  die  es  ausgerottet 
hatte. Diese beiden Formen des Hasses kehrten nun in unerwarteter 
Gestalt  in  die  Welt  zurück.  Das  Virus  versuchte,  sich  durch  die 
besonderen Kräfte Sadakos zu vermehren. Allerdings konnte es sich 
in  Form  des  Videos  nicht  von  allein  verbreiten.  Es  brauchte  die 
helfende Hand eines Menschen, der es vervielfältige. Die Formel, die 
einen vor dem Tod bewahrte, lautete vermutlich: 
 
Fertige eine Kopie des Videos an und zeige sie jemand anderem. 
 
Aus Asakawas Perspektive ergab das alles einen Sinn. Er hatte das 
Video  aus  der  Blockhütte  mitgebracht,  eine  Kopie  gezogen  und  den 
Film  Ryuji  gezeigt.  Ohne  es  zu  merken,  hatte  er  damit  das  Video 
verbreitet.  Ryuji  hatte  nichts  Dergleichen  getan.  Das  musste  die 
Lösung des Rätsels sein — davon war Asakawa überzeugt. 
Erleichtert nahm er einen Videorekorder und fuhr los. Er brauchte 
das Video nur zweimal zu kopieren — einmal für seine Frau, einmal 
für seine Tochter — und die Kopien zwei anderen Menschen vorzu‐
spielen. Dazu benötigte er den zweiten Rekorder. Die Menschen, die 
das  Video  gezeigt  bekämen,  würden  die  Beute  eines  Löwen,  aus 
dessen  Klauen  es  kein  Entrinnen  gab.  Es  war  ein  Teufelskreis:  Man 
musste das Video kopieren und einer anderen Person zeigen. Das Vi‐
rus würde sich wie eine Epidemie rasant ausbreiten; innerhalb kürze‐
ster  Zeit  gäbe  es  in  Japan  nur  noch  Träger  des  Virus,  und  es  würde 
die Landesgrenzen überschreiten. 
Asakawa  mochten  Zweifel  an  seinem  Vorhaben  geplagt  haben  — 
immerhin  war  er  im  Begriff,  eine  Seuche  in  die  Welt  zu  setzen,  die 
den  Untergang  der  Menschheit  bedeuten  konnte.  Aber  das  Pflicht‐
bewusstsein und die Liebe gegenüber seiner Frau und Tochter waren 
stärker als alle Warnungen seines Verstandes. Für ihn war in diesem 
Moment  wahrscheinlich  nur  eines  wichtig  gewesen:  Er  wollte  seine 
Familie retten, egal um welchen Preis. 
Doch diese Hoffnung erwies sich als Illusion — während der Fahrt 
starben seine Frau und seine Tochter. 
Ando  konnte  gut  verstehen,  dass  Asakawa  zusammengebrochen 
war.  Der  Verlust  seiner  geliebten  Frau  und  Tochter  musste  für  ihn 
unendlich schmerzhaft gewesen sein. 
Aber es gab wohl noch einen Grund für seine momentane geistige 
Verwirrtheit: die Frage nach dem Warum. Was war geschehen? War 
er  denn  dem  Geheimnis  um  Sadakos  Fluch  nicht  auf  die  Schliche 
gekommen?  Er  war  sich  absolut  sicher  gewesen,  dass  er  die  Lösung 
gefunden  hatte!  Aber  er  hatte  sich  getäuscht,  und  das  hatte  seiner 
Familie das Leben gekostet. In seine Trauer mischte sich Wut. Immer 
wieder fragte er sich: warum? 
Warum lebe ich noch? 
Ando  legte  den  Bericht  beiseite  und  lauschte  auf  die  Stimmen  in 
seinem Inneren. 
Glaubst du diese verrückte Geschichte? 
Er neigte den Kopf zur Seite. 
Ich weiß nicht recht. 
Einerseits klang die Geschichte wie ein Märchen, andererseits hatte 
er Ryujis Leiche obduziert und das seltsame Geschwür auf der Herz‐
kranzgefäßwand  gesehen.  Sieben  Menschen  waren  einem  myste‐
riösen  Tod  zum  Opfer  gefallen,  und  die  Todesursache  war  bei  allen 
identisch gewesen. Zudem war bei allen Leichen ein dem Pockenerre‐
ger ähnliches Virus im Blut nachgewiesen worden. 
Plötzlich sah Ando Mais entzückend hübsches Gesicht vor sich. Wo 
war sie nur? Dieser starke Impuls, den er in ihrem Apartment gespürt 
hatte  ...  Er  hatte  das  Gefühl  gehabt,  dass  dort  eine  unergründliche, 
übermenschliche Macht am Werk war, die einem die Haare zu Berge 
stehen ließ, sobald man einen Fuß in die Wohnung setzte. Ein furch‐
tbarer Gedanke schoss ihm durch den Kopf. 
Vermutlich hatte sich das Virus weiterverbreitet... Ob es noch mehr 
Opfer gab? 
Je länger er über die Angelegenheit nachdachte, desto mehr Fragen 
drängten sich ihm auf. Er fuhr den Computer herunter und schenkte 
sich  ein  großes  Glas  Whisky  ein.  Ohne  die  Wirkung  des  Alkohols 
würde er heute nicht einschlafen können. 
 

 
Auf dem Weg zur Pathologie ging Ando beim Biochemischen Insti‐
tut  vorbei,  um  Taneda  den  Laptop  zurückzugeben.  Die  Ausdrucke 
von Asakawas Bericht unter dem Arm, betrat er Miyashitas Büro. 
Miyashita saß konzentriert an seinem Schreibtisch und schien über 
etwas  nachzugrübeln.  Als  Ando  den  Bericht  vor  ihn  auf  den  Tisch 
knallte, fuhr er erschrocken hoch. 
»Kannst du das bitte lesen?« 
Mit aufgerissenen Augen blickte Miyashita Ando an. »Jetzt sofort?« 
»Es liegt mir viel daran, deine Meinung zu hören.« 
Miyashita griff nach dem Ausdruck. »Nicht gerade wenig.« 
»Ja, aber dafür ist es spannender als ein Krimi. Wenn du erst einmal 
angefangen  hast  zu  lesen,  kannst  du  nicht  mehr  aufhören,  das 
garantiere ich dir.« 
»Das ist aber nicht irgendein Roman von dir, oder? Für so was habe 
ich nämlich wirklich keine Zeit.« 
»Nein, es ist Asakawas Bericht über die mysteriöse Todesserie.« 
»Asakawa? Der Asakawa?« 
»Ja.« 
Neugierig blätterte Miyashita in den Seiten. »Hm.« 
»Sag mir Bescheid, wenn du es gelesen hast.« 
Als  Ando  gerade  aufstehen  wollte,  hielt  Miyashita  ihn  am  Arm 
zurück. »Warte einen Augenblick.« 
»Was gibtʹs?« 
»Du bist doch fit im Kode‐Raten.« Das Kinn auf die Hand gestützt, 
klopfte Miyashita mit dem Stift auf das vor ihm liegende Blatt Papier. 
»Na  ja,  so  kann  man  es  nicht  sagen  ...  Während  meines  Studium 
war  das  ein  netter  Zeitvertreib  zwischen  den  Vorlesungen,  mehr 
nicht.« 
»Hm.« Miyashita klopfte weiter mit dem Stift auf das Papier. 
»Wieso fragst du?« 
»Schau dir das hier mal an. Ich brüte schon die ganze Zeit darüber, 
aber  irgendwie  komme  ich  nicht  weiter.«  Miyashita  schob  Ando  ein 
Blatt  hin,  auf  dem  viele  kleine  blaue  Pünktchen  zu  sehen  waren. 
Ando  begriff  sofort,  worum  es  ging.  Dies  waren  die  ausgedruckten 
Ergebnisse  der  DNA‐Sequenzierung  des  Virus,  das  in  Ryujis  Blut 
gefunden worden war. Erst gestern hatte Miyashita sie ihm gezeigt. 
»Ich  komme  einfach  nicht  davon  los.  Die  merkwürdige  Buch‐
stabenabfolge lässt mir keine Ruhe.« 
Ando nahm das Blatt und hielt es sich dicht vors Gesicht. In die Ad‐
Random‐Basenfolge  hatte  sich  eine  Wiederholung  eingeschlichen  — 
eine Art Random im Ad‐Random. 
 
ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA 
 
Diese  Zweiundvierziger‐Basenfolge  kam  unerklärlicherweise  in  je‐
dem  DNA‐Abschnitt  vor.  Das  war  in  der  Tat  sehr  ungewöhnlich. 
»Bist du sicher, dass nur Ryujis Virus diese Besonderheit aufweist?« 
»Ja,  ganz  sicher.  Nur  in  Ryujis  Blut  haben  wir  neben  der  Virus‐
DNA  auch  diese  seltsamen  zweiundvierzig  Basen  entdeckt.«  Miya‐
shita  starrte  Ando  noch  immer  mit  großen  Augen  an.  »Findest  Du 
das nicht merkwürdig?« 
»Das ist schon seltsam ...« 
Das  Klopfen  von  Miyashitas  Stift  brach  ab.  Ando  schluckte.  Er 
konnte sich nicht daran erinnern, Miyashita von der Zeitungsecke mit 
dem  sechsstelligen  Kodewort,  die  aus  Ryujis  Bauch  herausgeschaut 
hatte,  erzählt  zu  haben.  Doch  erstaunlicherweise  schien  Miyashita 
ebenfalls von einem Kode auszugehen. »Angenommen, wir haben es 
tatsächlich mit einem Kode zu tun — von wem sollte er sein?« 
»Natürlich von Ryuji.« 
Ando  kniff  beide  Augen  fest  zusammen.  Das,  was  er  selbst  nicht 
hatte glauben wollen, sprach Miyashita wie selbstverständlich aus. 
»Aber Ryuji ist tot. Ich selbst habe ihn obduziert.« 
»Das  tut  jetzt  nichts  zur  Sache.  Versuch  lieber,  den  Kode  zu  ent‐
schlüsseln«, entgegnete Miyashita ruhig. 
Wenn  sie  von  einem  Kode  ausgingen,  würde  das  bedeuten,  dass 
sich die Zweiundvierziger‐Basenfolge in Worte fassen ließ. Die sechs 
Zahlen  auf  der  Zeitungsecke  —  1,  7,  8,  1,  3,  6  —  ergaben  das  Wort 
›Ring‹.  Ob  sich  auch  hinter  den zweiundvierzig  Basen  eine  wichtige 
Botschaft  verbarg?  Aber  es  war  schier  unvorstellbar,  dass  Ryuji,  der 
schon  längst  im  Reich  der  Toten  weilte,  eine  Mitteilung  in  seine 
Gewebeprobe eingeschleust hatte! 
Ando zitterte am ganzen Leib. Er hatte das Gefühl, dass er sich wie 
Asakawa  in  einen  endlosen,  dunklen  Tunnel  hineinbegeben  hatte, 
aus dem es kein Entkommen gab. Als er die Zweiundvierziger‐Basen‐
folge  gestern  gesehen  hatte,  war  sein  erster  Gedanke  gewesen:  ein 
Kode.  Aber  er  hatte  den  Gedanken  sofort  verdrängt,  weil  sonst  sein 
Glaube an die Wissenschaft zerstört gewesen wäre und er nicht mehr 
gewusst hätte, woran er glauben sollte. Davor hatte er Angst. 
»Ich  lasse  dir  die  Ausdrucke  hier.  Schau  dir  den  Bericht  in  Ruhe 
an.« 
Miyashita  war  ein  Vollblutwissenschaftler.  Wie  würde  er  auf  eine 
Geschichte  reagieren,  die  sich  jeglicher  wissenschaftlicher  Logik 
entzog? 
»Okay, und du musst den Kode entschlüsseln«, sagte Miyashita. 
 
 
 
 
 
 

 
 

 
Die Kellnerin wies Miyashita und Ando einen Fensterplatz zu. Ein 
fantastischer Blick auf den Schreinpark bot sich ihnen. Aber auch das 
schmackhafte  und  preiswerte  Essen  verlieh  dem  Restaurant  im 
obersten Stock des Klinikums einen besonderen Reiz. Ohne lange zu 
fackeln, bestellten beide das Mittagsmenü und einen Kaffee. 
»Ich  habe  ihn  gelesen«,  sagte  Miyashita  nach  einer  kleinen 
Kunstpause. 
»Und was hältst du davon?« Ando beugte sich gespannt vor. 
»Das  ist  nichts  für  zarte  Seelen.  Wenn  ich  ehrlich  sein  soll,  ich  bin 
geschockt.« 
»Glaubst du diese abgefahrene Geschichte denn?« 
»Das spielt keine Rolle. Tatsache ist, dass Namen, Todeszeitpunkte 
und so weiter nicht aus dem Reich der Fantasie stammen. Die Fakten 
stimmen mit denen im Polizeiprotokoll und Autopsiebericht überein. 
Du  hast  die  Aufzeichnungen  selbst  gesehen.  Ich  konnte  absolut 
keinen Widerspruch feststellen.« 
Was  Miyashita  sagte,  war  richtig.  Sie  hatten  sämtliche  Unterlagen 
über die vier Jugendlichen, die eine Woche nach ihrem Aufenthalt in 
Süd‐Hakone gestorben waren, durchgeackert. Die Daten in Asakawas 
Bericht entsprachen ausnahmslos der Realität. 
Daran gab es nichts zu rütteln. Und dennoch ... Das Ganze entzog 
sich  jeglicher  Logik.  ›Hass‹  und  ›übersinnliche  Kräfte‹  ...  Miyashita 
war mit Leib und Seele Pathologe. Warum waren ihm nicht die Haare 
zu Berge gestanden? Ando hatte mit einer anderen Reaktion gerech‐
net. 
»Du glaubst das also einfach so.« 
»So simpel ist es nun auch wieder nicht. Aber die Wissenschaft hat 
auf viele fundamentale Fragen noch immer keine Antwort gefunden: 
Wie  ist  das  Leben  entstanden?  Wie  vollzieht  sich  die  Evolution? 
Zufällig,  oder  läuft  sie  nach  bestimmten  Mustern  in  einer  festge‐
schriebenen  Richtung  ab?  All  diese  Fragen  sind  offen.  Zwar  gibt  es 
verschiedene  Thesen,  aber  keine  konnte  bisher  nachgewiesen 
werden. Nimmt man die Struktur eines Atoms ist sie nicht nur bild‐
lich  gesprochen  ein  miniaturisiertes  Sonnensystem.  Leben,  das  auf 
einer  höheren  Bewusstseinsebene  liegt,  zu  deuten  und  zu  begreifen, 
heißt  immer,  dass  Glaube  und  Vorstellungen  des  Forschers  mit  im 
Spiel  sind.  Descartes  postulierte  eine  strikte  Trennung  von  Körper 
und Seele als Voraussetzung aller Lösungsversuche. Doch Denkwei‐
sen, Emotionen und Glaube schleichen sich unweigerlich bei jeder In‐
terpretation nicht rational erklärbarer Dinge ein. Menschen, die glau‐
ben, die Wissenschaft hätte für alles eine Erklärung parat, sind naiv.« 
Sicherlich  war  die  Wissenschaft  nicht  allwissend,  das  sah  Ando 
genauso. Doch ganz so kritisch wie Miyashita war er nicht. Wenn ein 
Wissenschaftler die Wissenschaft zu stark anzweifelte, was blieb ihm 
dann noch? »Du bist aber extrem kritisch.« 
»Ich  habe  es  vielleicht  nie  erwähnt,  aber  ich  bin  Spiritualist. 
Shikisokuzeku,  kusokuzeshiki  —  wenn  du  glaubst,  da  ist  etwas,  ist  da 
nichts.« 
Ando  hatte  keinen  blassen  Schimmer,  worauf  Miyashita  hinaus 
wollte. Aber egal, für Endlosdiskussionen über Philosophie war nun 
wirklich nicht der geeignete Zeitpunkt. »Haben sich dir keine Fragen 
aufgedrängt, als du Asakawas Bericht gelesen hast?« 
»Fragen? Mir sind tausende Fragen durch den Kopf geschossen ...« 
Miyashita  gab  Milch  und  Zucker  in  seinen  Kaffee  und  rührte  ener‐
gisch um. Mit geröteten Wangen musterte er Ando. »Die erste Frage 
war:  Warum  lebt  Asakawa  noch?  Er  hat  das  Video  doch  auch  gese‐
hen.« Er nippte an seinem Kaffee. 
»Daraufgibt  es  nur  eine  plausible  Antwort.  Irgendwann  in  diesen 
Tagen hat er die Zauberformel entdeckt.« 
»Die Zauberformel?« 
»Na, die alles entscheidenden Wörter am Ende des Videos, die die 
Rettung versprechen. Irgendwer hat sie gelöscht.« 
»Du  meinst  den  Teil  des  Videos,  wo  der  Betrachter  aufgefordert 
wird, etwas Bestimmtes zu tun?« 
»Asakawa  muss  das  Rätsel  des  Fluchs  gelöst  haben,  ohne  es  zu 
merken...« 
»Aber was könnte er getan haben?« 
»Am Ende von seinem Bericht steht: ›Die Verbreitung des Virus — 
Die Lösung des Rätsels lautet: Ziehe eine Kopie und zeige das Video 
jemand anderem.« 
Nun  legte  Ando  die  Karten  auf  den  Tisch  und  erzählte  Miyashita 
von  dem  mysteriösen  Videorekorder  im  Unfallwagen  und  der  Kas‐
sette, die er in Mais Apartment gefunden hatte. 
Miyashita  hörte  gespannt  zu.  »Also  doch!  Da  haben  wir  den 
Beweis!  Asakawa  war  davon  überzeugt,  dass  der  Fluch  aufgehoben 
wird, wenn man eine Kopie zieht und das Video einer anderen Per‐
son vorspielt.« 
»Daran besteht nicht der geringste Zweifel.« 
»Also  trägt  Asakawa  am  Morgen  des  Unfalltages  einen  Videore‐
korder ins Auto und fährt los. Aber wohin? Hast Du eine Idee?« 
»Irgendwohin,  wo  es  zwei  Menschen  gibt,  denen  er  das  Video 
zeigen  wollte.  Selbst  wenn  er  für  eine  Minute  Gewissensbisse  hatte, 
waren alle ethischen Grundsätze schnell über den Haufen geworfen. 
Er  wollte  das  Leben  seiner  Frau  und  seiner  Tochter  um  jeden  Preis 
retten.« 
»Das  mag  ja  sein.  Aber  trotzdem  zeigt  man  so  ein  gefährliches 
Video doch nicht mal eben so irgendeiner fremden Person.« 
»Ich  glaube,  er  dachte  an  seine  Schwiegereltern.  Seine  eigenen  El‐
tern können wir ausschließen. Mit Asakawas Vater habe ich vor kur‐
zem gesprochen. Der ist noch quietschfidel.« 
»Vielleicht  liegst  du  mit  deiner  Vermutung  sogar  richtig.  Du  hast 
schon  recht,  was  würde  man  nicht  alles  tun,  um  das  Leben  seiner 
Tochter und Enkelin zu retten?« 
»Wir müssen herausfinden, wo Asakawas Schwiegereltern wohnen, 
dann  können  wir  die  Polizei  vor  Ort  fragen,  ob  sie  noch  am  Leben 
sind.« 
Asakawa  hatte  zwei  Kopien  des  tödlichen  Videos  gezogen  und  es 
dann womöglich seinen Schwiegereltern gezeigt. Falls sie es ebenfalls 
weitergegeben hatten, hatte es in der näheren Umgebung vermutlich 
weitere Todesfälle gegeben. Die Zeit drängte! 
»Um es so auszudrücken«, sagte Miyashita, »auf deinem Seziertisch 
werden  sich  noch  mehr  von  diesen  merkwürdigen  Leichen  ein‐
finden.« 
Ein  eisiger  Schrecken  durchzuckte  Ando.  Er  dachte  an  Mai.  Alles 
sprach dafür, dass auch sie sich das Video angeschaut hatte. Sie war 
nun  schon  seit  über  zwei  Wochen  wie  vom  Erdboden  verschluckt. 
Schauder  durchliefen  ihn,  als  er  daran  dachte,  dass  er  womöglich 
bald  Mais  Leiche  obduzieren  musste.  Dieser  schöne  Körper  auf  sei‐
nem Seziertisch, das wäre furchtbar ... 
»Aber  Asakawa  lebt«,  sagte  Ando  leise.  In  seiner  Stimme  lag  ein 
Funken Hoffnung, an den er sich klammerte. 
»Das  mag  ja  sein.  Aber  ...  Er  hat  genau  das  getan,  was  das  Video 
verlangt.  Warum  in  Gottes  Namen  sind  also  seine  Frau  und  seine 
Tochter gestorben? Das ist die entscheidende Frage.« 
»Anders ausdrückt: Warum hat es Asakawa nicht erwischt?« 
»Ich habe keinen blassen Schimmer. Aber überleg mal. Selbst wenn 
ein  Pockenvirus  hinter  all  dem  steckt,  wovon  wir  ja  momentan 
ausgehen,  ist  das  kein  Widerspruch  zu  dem  Spruch  auf  dem  Video. 
Das Ziel ist dasselbe: Vermehrung und Verbreitung.« 
»Bis zu Ryujis Tod passt alles. Das Problem ist der Tod von Asaka‐
was  Frau  und  Kind.  Damit  lösen  sich  alle  unsere  Theorien  in  Luft 
auf.« 
»Hm.  Ob  Asakawa  vielleicht  doch  daneben  liegt  und  die  Ver‐
vielfältigung und Verbreitung des Videos den Fluch nicht aufheben?« 
»Ich  bin  mit  meiner  Weisheit  wirklich  am  Ende.«  Ando  wusste 
nicht mehr, wo ihm der Kopf stand. Immerhin waren durchaus meh‐
rere  Möglichkeiten  denkbar.  Die  plausibelste  war,  dass  der  Zauber‐
spruch  anders  lautete.  Aber  es  war  auch  nicht  ausgeschlossen,  dass 
beim Kopieren des Videos Probleme auftraten. Vielleicht spielte es ja 
gar  keine  Rolle,  ob  man  das  Geheimnis  lüftete  oder  nicht  —  das 
Video  tötete  alle  Menschen,  die  es  sahen.  Aber  wenn  das  so  wäre, 
warum lebte Asakawa dann noch? Sie steckten in einer Sackgasse. 
Eine Weile herrschte Schweigen, weil Ando und Miyashita sich auf 
das  Essen  konzentrierten.  Dann  nahm  Miyashita  das  Gespräch 
wieder  auf.  »Das  ist  vielleicht  ein  Dilemma«,  seufzte  er,  während  er 
mit der Gabel in seinem Essen herumstocherte. 
»Was?« 
»Wenn  es  dieses  Video  tatsächlich  gibt,  würde  ich  es  mir  nur  zu 
gern  ansehen.  Aber  es  gibt  keine  Überlebensgarantie.  Das meine  ich 
mit ›Dilemma‹ ... Eine Woche ist nun wirklich etwas zu kurz.« 
»Zu kurz? Wofür?« 
»Um die Antwort herauszufinden. Aus wissenschaftlicher Perspek‐
tive wäre Folgendes denkbar: Die auf dem Video reproduzierten Bil‐
der üben einen gewissen Stimulus auf das Gehirn aus, versetzen den 
Betrachter  in  einen  bestimmten  seelischen  Zustand.  Dadurch  wird 
das Virus geboren.« 
»›Geboren‹  ist  wohl  nicht  das  richtige  Wort.  Die  durch  die  Bilder 
freigesetzte  Energie  bewirkt  unter  gewissen  Bedingungen  eine 
genetische Veränderung der Zellen, und dadurch entsteht das Virus.« 
»Ich  denke  dabei  an  das  Aids‐Virus.  Die  meistverbreitete  Form, 
HIV‐I,  wurde  von  afrikanischen  Schimpansen  auf  den  Menschen 
übertragen.  Woher  das  Schimpansenvirus  SIV  kam,  ist  bisher  nicht 
restlos geklärt. Genetische Studien belegen, dass es aus zwei verschie‐
denen Viren entstanden ist, die von unterschiedlichen Affenarten auf 
die  Schimpansen  übertragen  wurden.  Im  Laufe  der  Zeit  entstand  in 
den  Schimpansen  eine  Hybridform  der  beiden  SIV‐Viren,  die  später 
auf den Menschen übertragen wurde und zu HIV‐I mutierte.« 
»Ich würde zu gern wissen, was der Auslöser war.« 
»Ich  denke,  es  hat  was  mit  der  Psyche  zu  tun.«  Miyashita  beugte 
sich so weit vor, dass er fast Andos Gesicht berührte. 
Stress  verursachte  Löcher  in  der  Magenwand  ...  Seit  jeher  war 
bekannt,  dass  der  psychische  Zustand  eines  Menschen  einen  ent‐
scheidenden  Einfluss  auf  seinen  Körper  hatte.  Miyashita  und  Ando 
waren in dieser Hinsicht derselben Meinung. 
Vermutlich wurde bei dem Anblick des Videos ein bestimmter psy‐
chischer  Zustand  ausgelöst.  Aufgrund  dieses  Einflusses  veränderte 
sich  die  DNA  im  Körper,  das  Virus  wurde  geboren.  Es  führte  zu 
einem  Tumor  an  den  Gefäßwänden  der  Herzarterie,  der  innerhalb 
von einer Woche in rasantem Tempo wuchs, bis er schließlich so groß 
war,  dass  er  die  Blut‐  und  Sauerstoffzufuhr  zum  Herzen  blockierte. 
Ähnlich  wie  bei  Krebs  veränderte  das  Virus  nur  die  Zellen  in  der 
DNA, schien aber nicht übertragbar zu sein. 
»Bist du nicht auch scharf darauf, das Video zu sehen?« Miyashita 
schien sich vor Neugierde kaum noch zurückhalten zu können. 
»Schon, aber...« 
»Wir müssen das Video finden.« 
»Vergiss  das  lieber  gleich  wieder.  Wenn  man  die  Finger  davon 
lässt, kann man sich auch nicht verbrennen. Willst du krepieren wie 
Ryuji?« 
»Wo  du  gerade  von  Ryuji  sprichst  ...  Konntest  du  den  Kode  ent‐
schlüsseln?« 
»Noch  nicht.  Ich  weiß  nicht  recht  ...  Selbst  wenn  wir  es  mit  einem 
Geheimsprachenkode  zu  tun  haben  sollten,  zweiundvierzig  Basen 
sind  zu  wenig.  Wie  man  es  auch  dreht  und  wendet,  ich  kann  mir 
nicht  vorstellen,  dass  die  wenigen  Buchstaben  einen  sinnvollen  Satz 
ergeben.« Das war eine Ausrede, denn Ando befürchtete, dass er sich 
die  Zähne  an  den  Zahlen  ausbeißen  würde.  Jeder  Versuch  musste 
schon im Ansatz scheitern. 
»Du kannst ja den Feiertag dafür nutzen.« 
Erst  jetzt  erinnerte  sich  Ando  daran,  dass  morgen  der  ›Tag  der 
Arbeit‹  war.  Am  Samstag  hatte  er  ebenfalls  frei.  Das  bedeutete:  drei 
freie  Tage  hintereinander.  Was  für  ein  schrecklicher  Gedanke!  Seit 
Takanoris Tod hatte er nie mehr das Bedürfnis nach Freizeit verspürt. 
Im Gegenteil, er hatte immer alles getan, um sie zu vermeiden. Es gab 
nichts  Schlimmeres  für  ihn,  als  einsam  und  verlassen  zu  Hause  zu 
hocken.  Ein  Albtraum!  Allein  der  Gedanke  daran  deprimierte  ihn 
zutiefst. 
»Okay,  ich  werd  mich  noch  mal  dransetzen«,  antwortete  er  mit 
gespielter  Lässigkeit.  Zwar  ließen  sich  mit  der  Entschlüsselung  des 
Kodes  die  schier  endlosen  freien  Tage  totschlagen,  doch  seine  Stim‐
mung  würde  das  nicht  bessern.  Immerhin  hatte  ihm  ein  Toter  den 
Geheimkode  zukommen  lassen  ...  Aber  vielleicht  würde  es  ihn  ein 
bisschen  befriedigen,  wenn  er  das  Rätsel  löste.  »Ich  gebe  dir  am 
Montag Bescheid, was ich herausbekommen habe.« 
Damit war es versprochen. Innerhalb von drei Tagen musste er den 
Kode knacken. 
»Ich  verlasse  mich  voll  und  ganz  auf  dich.«  Zufrieden  klopfte 
Miyashita Ando auf die Schulter. 
 

 
Gleich nach dem Mittagessen rief Ando bei der Juristischen Fakul‐
tät  der  Medizinhochschule  J  in  Utsunomia  an.  Er  hatte  herausge‐
funden,  dass  Asakawas  Schwiegereltern  in  derselben  Präfektur  — 
Tochigi  —  in  Ashikaga  lebten.  Sollten  sie  auch  unter  mysteriösen 
Umständen  ums  Leben  gekommen  sein,  wären  ihre  Leichen  mit 
hundertprozentiger Sicherheit an der Universität J obduziert worden. 
Ein Assistenzprofessor nahm ab. Höflich erkundigte Ando sich, ob 
gegen  Ende  des  vergangenen  Monats  Leichname  mit  der  Diagnose 
›Herzinfarkt  durch  Verschluss  eines  Herzkranzgefäßes‹  seziert 
worden waren. 
Die  Frage  schien  den  Professor  zu  irritieren.  Ohne  zu  antworten, 
fragte  er:  »Entschuldigen  Sie,  aber  ich  verstehe  Ihr  Anliegen  nicht 
ganz ...« 
Mittlerweile wiesen sieben Leichen in der Kanto‐Region die besagte 
Todesursache  auf,  wobei  nicht  auszuschließen  war,  dass  es  weitere 
dieser mysteriösen Fälle gab, erklärte Ando dem Professor. Natürlich 
vermied  er  bei  seinen  Ausführungen,  die  parapsychologischen 
Aspekte des Asakawa‐Berichts zu erwähnen. Er beschränkte sich auf 
die medizinischen Fakten. 
»Beziehen Sie alle Institute in Kanto in Ihre Nachforschungen ein?« 
Der  Professor  schien  nach  Andos  Erklärung  noch  stärker  befremdet 
zu sein. 
Ando antwortete: »Nein, das beabsichtige ich nicht.« 
»Ich verstehe nur nicht ... Warum wenden Sie sich ausgerechnet an 
uns?« 
»Weil die Wahrscheinlichkeit hier am größten ist.« 
»Sie meinen die Wahrscheinlichkeit, dass in der Gegend um Utsu‐
nomiya eine Leiche mit dieser Diagnose gefunden wird?« 
»Nein, in Ashikaga.« 
»In  Ashikaga?«  Der  Professor  verstummte  abrupt.  Ando  konnte 
seine Anspannung förmlich spüren. »Ich bin sprachlos. Woher wissen 
Sie  ...?  Tatsächlich  wurde  in  Ashikaga  am  28.  Oktober  ein  älteres 
Ehepaar  tot  aufgefunden.  Einen  Tag  später  habe  ich  die  Autopsie 
durchgeführt.« 
»Können Sie sich an den Namen des Ehepaares erinnern?« 
»Ich  glaube,  der  Nachname  war  Oda.  Den  Vornamen  des  Mannes 
habe ich nicht mehr im Kopf, aber die Frau hieß Setsuko.« 
Das  konnte  nicht  sein  ...  Andos  Vorahnung  war  bittere  Realität 
geworden.  Die  beiden  Menschen,  deren  Leichen  in  Ashikaga  gefun‐
den  worden  waren,  waren  Asakawas  Schwiegereltern.  Er  hatte  also 
mit  seiner  These  richtig  gelegen.  Asakawa  war  am  21.  Oktober 
vormittags  mit  dem  Mietwagen  nach  Ashikaga,  in  den  Heimatort 
seiner Frau, gefahren. Dort hatte er das Video zweimal kopiert — ein‐
mal  für  seine  Frau  und  einmal  für  seine  Tochter  —  und  es  seinen 
Schwiegereltern gezeigt. Zur Beruhigung hatte er ihnen erzählt, dass 
nichts passieren könne, solange sie das Band innerhalb einer Woche 
kopierten und einer anderen Person vorspielten. Egal, ob sie ihm die 
Geschichte abkauften oder nicht, sie folgten seinem Wunsch. Immer‐
hin standen das Leben ihrer Tochter und ihrer Enkelin auf dem Spiel. 
Asakawa  musste  geglaubt  haben,  dass  er  die  rettende  Lösung 
gefunden  hatte.  Doch  es  kam  anders.  Auf  dem  Heimweg  verlor  er 
Frau und Tochter, eine Woche später auch noch die Schwiegereltern. 
»Sicher  waren  sie  angesichts  der  Leichen  ziemlich  erstaunt,  nicht 
wahr?« Ando stellte sich die verwirrten Blicke des Personals vor, als 
gleich  zwei  dieser  merkwürdigen  Leichen  auf  ihrem  Seziertisch 
landeten. 
»Das kann man wohl sagen ... Die Todeszeit war nahezu identisch. 
Sogar  einen  Abschiedsbrief  haben  sie  hinterlassen.  Deshalb  sind  wir 
zunächst  davon  ausgegangen,  dass  sie  gemeinsam  Selbstmord 
begangen  haben.  Das  gibtʹs  ja  ab  und  zu.  Doch  als  wir  die  Leichen 
öffneten,  konnten  wir  weder  Giftspuren  noch  andere  Hinweise 
entdecken, die diese These bestätigt hätten. Stattdessen diagnostizier‐
ten  wir  bei  beiden  einen  Tumor  in  den  Herzkranzgefäßen.  Was  für 
eine Überraschung ...« 
»Einen Augenblick ...«, unterbrach Ando den Professor. 
»Ja?« 
»Haben Sie eben einen Abschiedsbrief erwähnt?« 
»So ist es. Es sind allerdings nur ein paar Zeilen ... Er wurde neben 
den Toten gefunden.« 
Irritiert fragte Ando sich, weshalb Asakawas Schwiegereltern einen 
Abschiedsbrief verfasst haben mochten. »Können Sie mir sagen, was 
darinstand?« 
»Einen Moment bitte.« 
Der  Professor  legte  den  Hörer  beiseite.  Nach  wenigen  Sekunden 
meldete  er  sich  wieder.  »Leider  kann  ich  den  Brief  auf  die  Schnelle 
nicht finden. Ist es Ihnen recht, wenn ich ihn Ihnen per Fax schicke?« 
»Das wäre sehr freundlich.« 
Nachdem Ando ihm seine Faxnummer genannt hatte, beendeten sie 
das Gespräch. Nervös saß Ando am Schreibtisch und starrte auf das 
Faxgerät.  Währenddessen  versuchte  er,  die  neuen  Informationen  in 
sein Hypothesengebäude einzuflechten, doch das war aussichtslos. Er 
war  innerlich  viel  zu  aufgewühlt  und  konnte  keinen  klaren  Gedan‐
ken fassen. Seine ganze Konzentration richtete sich ausschließlich auf 
das Faxgerät. 
Plötzlich  vernahm  er  ein  leises  Rattern.  Das  Fax  begann,  ein  Blatt 
auszuwerfen. Ando sprang auf und rannte zu dem Gerät. Wieder am 
Schreibtisch, las er: 
 
Universität K, z. Hd. Herrn Ando 
Wie  versprochen,  schicke  ich  Ihnen  hiermit  die  Zeilen,  die  das  Ehepaar 
Oda hinterlassen hat. Wenn Sie etwas herausgefunden haben, lassen Sie es 
mich bitte wissen. 
Universität J, Yokotta 
 
Den  Sätzen  des  Professors  folgten  die  handgeschriebenen  Zeilen 
von  Asakawas  Schwiegereltern,  die  mit  ihrer  Unterschrift  versehen 
waren. 
 
Wir haben uns der  Verantwortung gestellt. Es ist vernichtet.  Die Gefahr 
ist  jetzt  gebannt.  Also  kein  Grund  zur  Sorge.  Wir  sind  müde,  sehr,  sehr 
müde. Bitte kümmere dich um Yoshimi und Noriko. 
Am Morgen des 28. Oktober 
Toru und Setsuko Oda 
 
Zweifellos waren diese Zeilen kurz vor dem Tod der Odas nieder‐
geschrieben  worden.  Yoshimi  und  Noriko  waren  vermutlich  ihre 
anderen Töchter. 
Doch an wen war dieser Abschiedsbrief gerichtet? 
Wir haben uns der Verantwortung gestellt. Es ist vernichtet. ›Vernichtet‹ 
— das bedeutete sicherlich, dass sie das gefährliche Video ein für alle 
Mal aus der Welt geschafft hatten. Ando versuchte, sich vorzustellen, 
was in den Köpfen der beiden vorgegangen sein mochte, als Asaka‐
wa sie mit einer derart absonderlichen, unfassbaren Geschichte kon‐
frontierte.  Selbst  wenn  sie  sie  anfangs  nicht  geglaubt  hatten:  Späte‐
stens mit dem Tod ihrer Tochter und ihrer Enkelin musste ihnen auf‐
gegangen sein, dass er Recht hatte. Nur in einem hatte er nicht Recht: 
Der grausame Fluch wurde offensichtlich nicht automatisch gebannt, 
indem man eine Kopie des Videos zog und diese einer anderen Per‐
son  zeigte.  Ihr  Lebenswille  musste  angesichts  ihres  Verlustes  erlo‐
schen  sein.  Nach  der  schmerzhaften  Beerdigung  warteten  sie,  ohne 
das  Video  vervielfältigt  zu  haben,  gemeinsam  auf  den  Tod  ...  Doch 
zuvor  hatten  sie  den  todbringenden  Film  zerstört,  sofern  man  ihren 
Worten in dem Abschiedsbrief Glauben schenken konnte. 
Aber auf welche Weise haben die Odas das Videoband vernichtet? Haben 
sie es gelöscht und anschließend als Gefahrengut entsorgt? 
Vielleicht hatten sie es auch einfach im Garten vergraben ... 
Ando beschloss, erst einmal davon auszugehen, dass die beiden Ko‐
pien nicht mehr existierten. Sorgfältig rekonstruierte er dann ein wei‐
teres Mal den Weg des mysteriösen Videos auf einem Blatt Papier: 
›Geboren‹ wurde das teuflische Video in Süd‐Hakone in der Block‐
hütte. Asakawa, der das Band an sich genommen hatte, zog eine Ko‐
pie für Ryuji Takayama. Irgendwie gelangte dessen Exemplar in Mais 
Hände.  Doch  abgesehen  von  den  ersten  Sekunden  war  es  komplett 
überspielt  worden.  Asakawas  Exemplar  —  das  Original,  das  sich  in 
dem  Videorekorder  im  Unfallwagen  befand  —  kam  zu  seinem  Bru‐
der Jun‐ichiro, der von der Polizei alle persönlichen Gegenstände aus 
dem  Auto  erhalten  hatte.  Schließlich  landete  es  mitsamt  dem  defek‐
ten  Videorekorder  auf  dem  Müll.  Die  beiden  Kopien  des  Originals, 
mit deren Hilfe Asakawa Frau und Tochter retten wollte, wurden von 
seinen Schwiegereltern, den Odas, vernichtet. 
Und das bedeutete: Das aus Hass auf die Gesellschaft entstandene 
Video  Sadako  Yamamuras  war  endgültig  von  dieser  Welt  ver‐
schwunden. 
Ando  starrte  auf  seine  Notizen.  Seit  seinem  Erscheinen  Ende 
August hatte das Video neun Menschenleben gefordert. Zwei Monate 
später  war  es  wieder  von  der  Bildfläche  verschwunden.  Das  bestä‐
tigte die Tatsache, dass im letzten Monat keine weiteren Todesopfer 
zu  beklagen  gewesen  waren.  Ando  überlegte.  Offenbar  spielte  es 
keine Rolle, ob man das Video vervielfältigte oder nicht. Unterstellte 
man, dass es alle, die es sahen, in den Tod riss, unabhängig davon, ob 
es  innerhalb  einer  Woche  kopiert  wurde  oder  nicht,  war  sein 
Untergang vorprogrammiert. 
Damit  dürfte  die  schreckliche  Todesserie  beendet  sein.  Solange  es 
keine Kopie gab, bestand auch keine Gefahr, dass weitere Menschen 
elend  Zu  Grunde  gingen.  Doch  eine  Frage  blieb:  Warum  lebte 
Asakawa noch? 
Und wo zum Teufel steckte Mai? 
Theoretisch  schien  der  Fluch  besiegt  zu  sein.  Das  Video  existierte 
nicht mehr, konnte niemanden mehr töten. 
Doch Ando spürte, dass es noch nicht vorbei war. So einfach würde 
sich der Fluch nicht austilgen lassen. 
 

 
Ando  hatte  sich  am  Morgen  vom  Bibliothekspersonal  einen 
Spindschlüssel  geben  lassen.  Auf  dem  Weg  zu  den  Schließfächern 
befreite er sich von seinem Jackett. Diese Hitze ... Verwunderte Blicke 
folgten  ihm.  Es  war  Winter,  doch  Ando  sah  aus,  als  befände  er  sich 
im  Sommerurlaub.  Er  entnahm  seiner  Aktentasche  Block  und  Stift, 
die  restlichen  Sachen  verschwanden  im  Spind.  Zwischen  den  Seiten 
des  Schreibblocks  steckte  das  Blatt  mit  der  Basenfolge  des  in  Ryujis 
Blut nachgewiesenen Virus. 
Seitdem  grübelte  er  im  Lesesaal  der  Bibliothek  an  einem  Fenster‐
tisch über den Kode nach, mit dem festen Vorsatz, ihn zu entziffern. 
Doch  jeder  Blick  auf  die  chaotische  Sequenz  ließ  seine  Zuversicht 
schwinden.  Falls  er  das  Geheimnis  nicht  lüftete,  wären  alle  ihre 
Bemühungen umsonst gewesen. Aber was war die Alternative? Drei 
unendlich  lange  Tage,  einsam  und  verlassen  zu  Hause  ...  Nein!  Da 
war es besser, sich an dem Kode die Zähne auszubeißen. 
Während seines Studiums hatte Ando eine Menge Bücher über die 
Kunst des Kode‐Entzifferns verschlungen. Wo waren sie bei den vie‐
len  Umzügen  nach  Studium,  Hochzeit  und  Scheidung  abgeblieben? 
Er  hatte  sie  bis  heute  nicht  vermisst,  weil  sein  Interesse  an  diesem 
›Spiel‹  im  Laufe  der  Jahre  erlahmt  war.  Doch  jetzt  hätte  er  sie 
dringend  gebraucht.  Um  einen  Geheimkode  zu  entziffern,  benötigte 
man Bücher — und aus diesem Grund hatte er sich in der Bibliothek 
verschanzt. 
Mittlerweile war es über zehn Jahre, seit er sich mit den Methoden 
von  Kodierung  und  Dekodierung  auseinandergesetzt  hatte,  und  er 
hatte vieles vergessen. Um sich die Grundlagen wieder vor Augen zu 
führen,  nahm  er  eine  Einführung  ins  Thema  zur  Hand.  Während  er 
sich  Seite  für  Seite  durcharbeitete,  überlegte  er,  in  welche  Kategorie 
die  Basenfolge  passen  könnte.  Insgesamt  gab  es  —  grob  gesprochen 
— drei Geheimschlüsselarten: 1. Sätze oder Wörter wurden in mathe‐
matische Formeln oder Zahlen kodiert; 2. Die Reihenfolge der Buch‐
staben wurde verändert; 3. In einen Satz wurden zusammenhanglose 
Phrasen  zwischen  einzelne  Wörter  gesetzt.  Die  Zahlenkombination 
auf  dem  Zeitungsfetzen,  der  aus  Ryujis  Körper  hervorgelugt  hatte, 
war ein Beispiel für einen Kode der ersten Kategorie. 
Folgte  man  der  These,  dass  die  Nukleotidsequenz  des  pocken‐
ähnlichen Virus tatsächlich ein Kode war, dann ließ er sich ebenfalls 
der ersten Kategorie zuordnen. Die vier Basen A, T, G, C konnten für 
einen Buchstaben oder ein Wort stehen. 
Ruckartig hob Ando den Kopf. Der ursprüngliche Sinn eines Kodes 
war es, Informationen an eine bestimmte Person zu übermitteln, ohne 
dass eine andere Person diese Informationen ebenfalls erhielt ... Unter 
diesem  Aspekt  hatte  er  es  noch  gar  nicht  betrachtet.  Während  des 
Studiums  war  das  Kode‐Raten  für  ihn  nur  ein  vergnügliches  Spiel 
gewesen,  mehr  nicht.  Doch  jetzt  war  es  wichtig,  sich  den  ursprüng‐
lichen Zweck der Verschlüsselung bewusst zu machen. 
Er  beschloss,  mit  so  viel  Logik  wie  möglich  an  die  Sache  heran‐
zugehen. Wenn der Sinn eines Kodes also darin bestand, einer dritten 
Person  bestimmte  Botschaften  vorzuenthalten,  dann  musste  er  so 
geschickt aufgebaut sein, dass nur der Adressat seine Existenz wahr‐
nahm. Ando hatte von Anfang an das Gefühl gehabt, dass die sich in 
jedem  DNA‐Abschnitt  wiederholende  Zweiundvierziger‐Basenfolge 
eine  Art  Geheimsprachenschlüssel  war.  Doch  warum?  Woraus 
resultierte dieses Gefühl? 
Er  überlegte.  Eine  Wiederholung  bestimmter  Nukleotidsequenzen 
kam zwar recht selten vor, war aber auch nicht völlig ausgeschlossen. 
Das konnte es also nicht gewesen sein. Es musste an etwas anderem 
gelegen  haben.  Vermutlich  hing  es  mit  dem  Erlebnis  mit  der 
Zeitungsecke  in  Ryujis  Bauch  zusammen.  Wenn  er  es  sich  recht 
überlegte  ...  Vielleicht  steckte  hinter  dem  Ring‐Kode  tatsächlich  eine 
doppelte Bedeutung. Fest stand, dass Ryuji ihn auf den Ring‐Bericht 
hatte hinweisen wollen. Doch Ando wurde das Gefühl nicht los, dass 
eine  weitere  Botschaft  Ryujis  im  Spiel  war.  Vielleicht  wollte  er  ihm 
auf diese Weise auch mitteilen, dass er von nun an wichtige Informa‐
tionen in kodierter Form schicken würde, damit Ando sie nicht über‐
sah.  Dabei  bediente  Ryuji  sich  der  einfachsten  Methode,  nämlich 
Wörter  durch  Zahlen  zu  ersetzen.  Ando  konnte  sich  des  Eindrucks 
nicht  erwehren,  dass  Ryuji  im  Verborgenen  immer  noch  die  Fäden 
spann. 
Wie auch immer: Nur in seinem Blut war die seltsame, sich wieder‐
holende Zweiundvierziger‐Basensequenz nachgewiesen worden. Das 
alles sprach eindeutig für die These, dass es sich tatsächlich um einen 
Geheimkode handelte. Zwar war Ryuji tot, sein Körper eingeäschert, 
doch die Gewebeprobe war der diesseitigen Welt erhalten geblieben. 
Zahlreiche Zellen mit Ryujis DNA, die sein genetisches Profil enthiel‐
ten, existierten noch. 
Die DNA übermittelt Ryujis Willen; sie spricht an seiner Stelle ... Was für 
ein absurder Gedanke! Ich drehe ja völlig durch. 
Aber  wenn  sich  die  Nukleotidsequenz  nun  doch  dekodieren  ließ 
und eine Nachricht übermittelte ... Theoretisch konnte aus der Gewe‐
beprobe  die  DNA  extrahiert  und  damit  ein  Klon  Ryujis  produziert 
werden. 
Warum  hatte  er  seine  Botschaft  ausgerechnet  in  die  Virus‐DNA 
hineingeschleust? Bei genauerem Nachdenken lag der Grund auf der 
Hand.  Als  Mediziner  hatte  Ryuji  gewusst,  dass  man  den  Kode  nie 
entdecken würde, wenn er in der DNA gesunder Zellen enthalten ge‐
wesen wäre. Es war viel klüger, ihn in die DNA des Virus zu schleu‐
sen, das von außen in den Organismus eingedrungen war. Immerhin 
hatte  der  unbekannte  Erreger  zu  einer  mysteriösen  Todesserie  ge‐
führt. Es stand außer Frage, dass die Virus‐DNA mit dem Sequenzer 
analysiert und die Basenfolge ermittelt werden würde. 
Ando  war  wieder  einmal  verblüfft  über  Ryujis  Weitsicht.  Damit 
seine Nachricht auch wirklich ankam, hatte er nur die Virus‐DNA so 
verändert, dass man förmlich darüber stolpern musste. 
Plötzlich waren Andos Zweifel verflogen. Hinter der Zweiundvier‐
ziger‐Abfolge  steckte  eine  verschlüsselte  Information.  Die  ursprüng‐
liche  Bedeutung  von  Kodes  spielte  keine  Rolle.  Es  gab  schlicht  nur 
diese Möglichkeit, um mit der Welt zu kommunizieren. Das Buchsta‐
benalphabet  der  DNA  bestand  lediglich  aus  vier  verschiedenen  Zei‐
chen — A, T, G, C. Da blieb nur eines: die Abfolge der Basen so ge‐
schickt  zu  verändern,  dass  sie  nach  der  Dekodierung  die  Nachricht 
offenbarte. 
Noch vor wenigen Minuten war Ando nahe dran gewesen, alles in 
die Ecke zu werfen. Doch jetzt sah er Licht am Ende des Tunnels. Ja, 
er  würde  den  Geheimkode  entschlüsseln!  Seine  Zuversicht  war 
zurückgekehrt. Ich werde das Geheimnis lüften!, schwor er sich. 
Wenn Ryuji Ando mit dieser Basenfolge tatsächlich etwas hatte mit‐
teilen wollen, musste die Entschlüsselung leicht sein. Es bestand kein 
Grund dafür, den Kode unnötig schwierig zu gestalten. Andos erste 
Aufgabe  war  es,  die  verschiedenen  Lösungsmethoden  zu  eruieren. 
War  der  Einstieg  von  Erfolg  gekrönt,  dann  war  auch  die  verschlüs‐
selte Information bald ermittelt. Umgekehrt galt das Gleiche: Ging er 
es  von  der  falschen  Seite  an,  würde  das  Geheimnis  womöglich  nie 
enthüllt werden. 
Ando sah sich die Basenfolge noch einmal an. 
 
ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA 
 
Das  erste  Problem  lag  darin,  die  Trennlinien  zu  ziehen.  Wie  viele 
Zeichen könnten ein Wort oder einen alphabetischen Buchstaben ko‐
dieren? Fieberhaft überlegte Ando, ob er den Schnitt nach zwei oder 
drei  Basen  machen  sollte.  Schließlich  entschied  er  sich  für  die  erste 
Variante. 
 
AT GG AA GA AG AA TA TC GT TA TA TT CC TC CT
CC TC AA CA AC AA 
 
Legte  man  die  These  zugrunde,  dass  innerhalb  dieses  Vierer‐›Al‐
phabets‹ jeweils zwei Buchstaben eine Einheit bildeten, ergaben sich 
vier  mal  vier  verschiedene  Paare,  also  sechzehn.  Ando  ging  davon 
aus,  dass  die  sechzehn  Basenpaare  jeweils  für  einen  alphabetischen 
Buchstaben standen. Allerdings tauchte damit ein neues Problem auf: 
In welcher Sprache war der Kode geschrieben? 
Das  japanische  Silbenalphabet  Hiragana  bestand  aus  fast  fünfzig 
Zeichen. Sechzehn Paare erschienen hier zu wenig. Im Vergleich dazu 
umfassten  das  französische  und  englische  Alphabet  sechsundzwan‐
zig,  das  italienische  zwanzig  Buchstaben.  Die  alles  entscheidende 
Frage war: Welche Sprache lag dem Kode zugrunde? 
Ando glaubte die Antwort zu wissen. Die Zahlenkombination 1, 7, 
8, 1, 3, 6 auf dem Zeitungsfetzen hatte dekodiert das englische Wort 
ring  ergeben.  Seine  Intuition  sagte  ihm,  dass  vermutlich  auch  dieses 
Mal Englisch die Basis war. 
Zerlegte  man  die  Zweiundvierziger‐Basenfolge  in  Zweier‐Einhei‐
ten,  ergaben  sich  einundzwanzig  Paare.  Darunter  waren  vier  AA‐
Gruppen,  jeweils  drei  TA‐  und  TC‐Gruppen  sowie  zwei  CC‐
Gruppen. Insgesamt zählte Ando dreizehn verschiedene Paare. Diese 
Zahl  notierte  er  sich.  Nervös  schlug  er  die  Seite  mit  der  Tabelle  auf, 
die  Auskunft  über  die  Verwendungshäufigkeit  jedes  Buchstabens  in 
einem englischen Satz gab. 
Die  sechsundzwanzig  Buchstaben  des  englischen  Alphabets  wur‐
den  naturgemäß  in  unterschiedlicher  Häufigkeit  verwendet.  A,  E 
oder  T  tauchten  häufig  auf,  während  Q  oder  Z  selten  vorkamen,  im 
Durchschnitt  ein‐  bis  zwei  Mal  pro  Satz.  Eine  Statistik  zeigte  exakte 
Zahlen. Demnach setzte sich ein Satz mit einundzwanzig Buchstaben 
durchschnittlich aus zwölf verschiedenen Lettern zusammen. 
Ando hätte fast erleichtert gejubelt. Dieser Wert, zwölf Buchstaben 
pro Satz, lag dicht an der von ihm ermittelten Zahl Dreizehn! Es be‐
stand also eine realistische Chance, dass sich bei der korrekten Posi‐
tion der Buchstaben ein sinnvoller englischer Satz ergab. 
Trotzdem  zog  er  auch  eine  weitere  Variante  in  Betracht,  indem  er 
die Zweiundvierziger‐Sequenz in Dreier‐Gruppen unterteilte: 
 
ATG GAA GAA GAA TAT CGT TAT ATT CCT CCT CCT
CAA CAA CAA 
 
Jetzt zählte er vierzehn Gruppen. Allerdings ließen sich nur sieben 
verschiedene  Kombinationen  definieren:  ATG,  GAA,  TAT,  CGT, 
ATT, CCT, CAA. Der Statistik im Kode‐Buch zufolge kamen in einem 
Satz  mit  vierzehn  Buchstaben  ungefähr  neun  verschiedene  Lettern 
vor. Damit bestand auch hier keine allzu große Differenz. 
Während  Ando  die  Buchstaben  betrachtete,  fiel  ihm  auf,  dass  sich 
einzelne  Gruppen  ziemlich  häufig  wiederholten:  GAA,  CCT,  CAA 
kamen  jeweils  dreimal  und  TAT  zweimal  vor.  Aber  das  war  noch 
nicht alles. Die sich wiederholenden Gruppen waren nicht sporadisch 
verteilt,  sondern  reihten  sich  jeweils  aneinander,  zumindest  im  Fall 
von  GAA,  CCT  und  CAA.  Steckte  dahinter  eine  besondere 
Bedeutung,  oder  war  das  Zufall?  Ando  wusste  es  nicht.  Doch  wenn 
er wie bisher davon ausging, dass eine Gruppe einen alphabetischen 
Buchstaben  kodierte,  bedeutete  dies,  dass  eine  Letter  in  einem  Wort 
dreimal aufeinander folgte. Zwar hätte Ando spontan viele Vokabeln 
nennen  können,  in  denen  zwei  gleiche  Buchstaben  nacheinander 
kamen,  aber  drei?  Denkbar  war  natürlich,  dass  lediglich  die  letzten 
zwei  Buchstaben  eines  Wortes  mit  dem  Anfangsbuchstaben  des 
nächsten identisch waren, wie beispielsweise too old, will link etc. 
Ando zog ein englisches Buch aus dem Regal und begann zu zäh‐
len,  wie  viele  derartige  Phrasen  vorkamen.  Es  waren  gerade  einmal 
ein oder zwei Fälle auf fünf bis sechs Seiten zu entdecken. Das brach‐
te ihn einen Schritt weiter. Die Wahrscheinlichkeit, dass in einem Satz 
mit  vierzehn  Buchstaben  drei  gleiche  Buchstaben  aufeinander  folg‐
ten,  war  gleich  null.  Dies  legte  den  Schluss  nahe,  dass  der  Schnitt 
nach jeweils zwei Basen zu erfolgen hatte. 
 
AT GG AA GA AG AA TA TC GT TA TA TT CC TC CT
CC TC AA CA AC AA 
 
AA‐Paare  gab  es  insgesamt  vier.  Dahinter  musste  also  ein  häufig 
verwendeter Buchstabe stecken. Ando warf erneut einen Blick auf die 
Liste.  Welcher  Buchstabe  kam  in  einem  englischen  Satz  statistisch 
gesehen am häufigsten vor? Das E. Also ging er zunächst davon aus, 
dass  AA  für  E  stand.  Mehr  als  einmal  tauchten  auch  die  Paare  TA 
und TC auf. Zudem folgte nach AA einmal TA und nach TC einmal 
AA.  Das  war  eine  wichtige  Erkenntnis.  Denn  nicht  nur  die  Verwen‐
dungshäufigkeit  von  Buchstaben,  sondern  auch  ihre  Kombinationen 
spielten  eine  Rolle.  Hier  gab  es  ebenfalls  Muster.  Ando  machte  sich 
abermals in der Statistik schlau. 
Da  auf  ein  E  recht  oft  ein  A  folgte,  beschloss  er,  TA  mit  A 
gleichzusetzen. Der gleichen Logik folgend, wäre TC dann ein T. CC 
könnte demnach für N stehen. Somit ergab sich: 
 
. . E . . E A T . A A . N T . N T E . . E 
 
Jetzt  glaubte  Ando,  Ansätze  eines  englischen  Satzes  zu  erkennen. 
Unter  Berücksichtigung  der  Beziehung  von  Vokalen  und  Konso‐
nanten füllte er die Lücken. Das Ergebnis war: 
 
S H E R D E 
A T Y A A L 
N T I N T E C M E 
 
Zwar  ließen  sich  die  ersten  drei  Buchstaben  als  she  für  ›sie‹  lesen, 
aber  wie  man  es  auch  betrachtete,  es  ergab  keinen  sinnvollen  Satz. 
Ando  tauschte  E,  A,  T  und  N  miteinander  aus  und  testete,  seiner 
Intuition folgend, verschiedene Möglichkeiten. Doch irgendwie hatte 
alles keinen Sinn. Da kam ihm eine Idee. Er notierte jeden Buchstaben 
auf ein Kärtchen und fügte sie wie bei einem Puzzle aneinander. 
 
T H E Y W E R B O R R L N B I N B E C M E 
 
They  were  born  ...,  kam Ando  als  Erstes  in  den Kopf.  Zwar  traf  das 
den Nagel nicht exakt auf den Kopf, aber so ungefähr passte es. ›Sie 
wurden  geboren‹  ...  Keine  Frage,  das  ergab  einen  Sinn.  Trotzdem 
kamen ihm Zweifel. Sollte das etwa der Anfang von Ryujis Botschaft 
sein? Fieberhaft probierte er weiter. 
Dann hielt er inne. Wenn ich jetzt einen Computer hätte, wäre das Rätsel 
im  Handumdrehen  gelöst.  Der  dritte,  sechste,  achtzehnte  und  einund‐
zwanzigste  Buchstabe  waren  identisch.  Der  siebte,  zehnte  und  elfte 
ebenfalls, genau wie der achte, vierzehnte und siebzehnte sowie der 
dreizehnte  und  sechzehnte.  Insgesamt  bestand  der  Satz  aus  einund‐
zwanzig Buchstaben. Gäbe man diese Werte in  einen Computer ein, 
würde  er  die  verschiedenen  Möglichkeiten  errechnen  —  und  im  Nu 
hätte  man  die  Lösung.  Doch  da  tauchte  ein  weiteres  Problem  auf. 
Vermutlich  würde  der  Rechner  nicht  nur  eine,  sondern  mehrere 
Antworten  ausspucken.  Zweifellos  gab  es  viele  sinnvolle  Sätze  mit 
einundzwanzig Buchstaben. Das machte die Sache wiederum schwie‐
rig.  Woher  sollte  er  wissen,  welche  von  den  vielen  Möglichkeiten 
Ryujis Nachricht war? 
Eine Sackgasse. 
Mit  der  flachen  Hand  klopfte  er  sich  gegen  die  Stirn.  Während 
seiner Studiumszeit hatte er vor Ideen nur so gesprüht und hätte den 
Kode  sicherlich  in  zwei  bis  drei  Minuten  entschlüsselt.  Es  galt  also, 
die grauen Zellen wieder zu aktivieren. 
Während Ando über den Zahlen gebrütet hatte, war die Zeit verflo‐
gen. Ein Blick auf die  Uhr ließ  ihn mit Erstaunen feststellen, dass es 
bereits kurz vor eins war. Da sein Magen knurrte, beschloss er, eine 
kleine Pause einzulegen und sich in der Cafeteria im vierten Stock zu 
stärken. Das war jetzt genau das Richtige. Vielleicht kam ihm ja beim 
Essen die zündende Idee, wie es schon öfter geschehen war. 
Es  darf  nur  eine  Antwort  geben  ...  Wie  in  Trance  murmelte  er  diese 
Worte immer wieder vor sich hin, während er zur Cafeteria ging. 
 

 
Beim Essen sah Ando immer wieder aus dem Fenster. Kinder spiel‐
ten  im  Park,  schaukelten  und  wippten  fröhlich.  Weil  es  mittlerweile 
nach 13 Uhr war, leerte sich die Cafeteria, die bis vor ein paar Minu‐
ten  noch  voller  Menschen  gewesen  war,  allmählich.  Ando  hatte  das 
Blatt  mit  der  Basenfolge  des  Virus  neben  sein  Tablett  gelegt,  konnte 
sich  aber  nicht  darauf  konzentrieren.  Immer  wieder  wanderte  sein 
Blick nach draußen. Jedes Mal, wenn ein kleiner Junge von ungefähr 
fünf Jahren vorbeirannte, folgte Ando ihm wie hypnotisiert mit dem 
Blick. Minutenlang fixierte er den Jungen geistesabwesend. 
Vor zwei Jahren hatte auch er mit seinem Sohn hier gespielt. Es war 
ein Sonntagnachmittag gewesen, und Ando war plötzlich eingefallen, 
dass  er  dringend  Material  für  eine  Fachtagung  benötigte.  Da  sie  in 
unmittelbarer  Nähe  der  Bibliothek  waren,  beschloss  er  hineinzuge‐
hen.  Doch  am  Eingang stand:  Zutritt  unter  13  Jahren  nicht gestattet. 
Dann eben nicht! Schließlich konnte er seinen Sohn nicht allein drau‐
ßen lassen, während er selbst in der Bibliothek herumlief. Stattdessen 
ging er mit Takanori in den kleinen Park. Sein Sohn stürmte auf die 
Schaukel zu und kreischte dann vor Freude, als Ando ihn von hinten 
anschob.  Die  Schaukel  bewegte  sich  heute  genau  wie  damals  über 
dem gelb leuchtenden Laub. Da die Fenster geschlossen waren, hörte 
er  keine  Stimmen,  und  auch  das  Gesicht  des  schaukelnden  Kindes 
blieb  Ando  verborgen.  Doch  in  seinen  Ohren  hallten  die  Freuden‐
schreie seines dreijährigen Sohnes. 
Jedes Mal, wenn Ando an dem Park vorbeikam, stiegen Erinnerun‐
gen an diese kurzen, glücklichen Momente in ihm auf. Zwar wusste 
er, dass es an der Zeit war, die Vergangenheit endlich hinter sich zu 
lassen, aber das war weiß Gott nicht einfach. Doch was brachte es, im 
Selbstmitleid zu baden? 
Er nahm den Stift zur Hand und wandte sich wieder der Basenfolge 
zu.  Es  half  nichts,  er  musste  wohl  noch  einmal  von  vorn  anfangen. 
Erneut  rief  er  sich  die  verschiedenen  Entschlüsselungsmethoden  ins 
Gedächtnis.  Eine  nach  der  anderen  prüfte  er  in  Gedanken  auf  ihre 
Brauchbarkeit.  Beim  geringsten  Zweifel  verwarf  er  sie.  Das  war  die 
einzige Möglichkeit, sich der Lösung zu nähern. 
Doch  plötzlich  wurde  ihm  klar,  dass  er  eine  Technik  voreilig  über 
Bord  geworfen  hatte.  Die  Anagram‐Methode  könnte  vielleicht  doch 
ein Weg sein, schoss es ihm durch den Kopf. Mit neuer Energie kehr‐
te er in den Lesesaal der Bibliothek zurück und zog den Zettel mit der 
Aufteilung in Dreier‐Gruppen hervor: 
 
ATG GAA GAA GAA TAT CGT TAT ATT CCT CCT CCT
CAA CAA CAA 
 
Vielleicht,  dachte  er,  war  er  von  der  falschen  Prämisse  ausgegan‐
gen.  Seiner  ursprünglichen  Hypothese  zufolge  standen  jeweils  drei 
Basen  für  einen  Buchstaben  des  Alphabets.  Das  Problem  dabei  war, 
dass  dann  aufgrund  der  Positionen  von  GAA,  CCT,  CAA  derselbe 
Buchstabe  in  einem  Wort  oder  einer  Phrase  dreimal  hintereinander 
kommen musste. Deshalb hatte Ando diese Methode verworfen. Nun 
versuchte  er  etwas  anderes:  Vielleicht  lag  des  Rätsels  Lösung  darin, 
nicht  einen  Satz  zu  bilden,  sondern  bestimmte  Buchstaben 
herauszufinden,  die  es  dann  wie  bei  einem  Kreuzworträtsel  zu 
ordnen galt. 
 
OOOOEEEBBDDTPNHR 
 
Ando  konzentrierte  sich.  Nach  einigen  Versuchen  entnahm  er  die‐
sem Gebilde folgenden englischen Satz: Bob opened the door. 
Ja,  das  ist  tatsächlich  eine  Möglichkeit,  die  Buchstaben  zu  lesen!  Er  war 
im  Begriff  weiterzumachen,  hielt  aber  plötzlich  inne.  Nein,  das 
konnte  es  nicht  sein.  Diese  Methode  wäre  viel  zu  zeitaufwändig  ... 
erst den verschiedenen Gruppen den richtigen alphabetischen Buch‐
staben  zuzuordnen,  dann  die  Reihenfolge  festzulegen  ...  Problema‐
tisch  war  zudem,  dass  eine  eindeutige  Kodierung  ausgeschlossen 
war. Es würden sich einfach zu viele Wörter bilden lassen, die alle für 
sich einen Sinn ergaben. Wie sollte er da das einzig richtige Lösungs‐
wort  herausfischen?  Ohne  einen  Anhaltspunkt,  eine  Art  Schlüssel, 
würde das Ganze ins Uferlose gehen. 
Da kam ihm eine Idee: Vielleicht lieferten ja die Zahlen 1, 7,8, 1, 3, 6, 
die  das  englische  Wort  ring  ergaben,  einen  Hinweis,  nach  welcher 
Methode die Buchstaben zu ordnen waren. Es war zum Verzweifeln! 
Denn selbst wenn er herausfände, nach welcher Vorgehensweise die 
Reihenfolge  festzulegen  wäre,  würde  das  bei  Weitem  nicht  ausrei‐
chen.  Das  A  und  O  der  ganzen  Unternehmung  war,  zunächst  die 
richtigen Buchstaben zu ermitteln. 
Erneut war er in einer Sackgasse gelandet. 
Es muss einen anderen Weg geben! Ich muss meine Vorgehensweise noch 
mal ändern. Die ganze Zeit hatte er sich darauf konzentriert, dass zwei 
oder  drei  Basen  jeweils  für  einen  Buchstaben  standen.  Vielleicht 
stimmte das gar nicht? 
Die  Antwort  muss  eindeutig  sein.  Und  der  Lösungsweg  darf  nicht  zu 
kompliziert sein. 
Ratlos starrte er auf die Basenfolge. In diesem Moment nahm er die 
Silhouette  einer  Frau  wahr,  die  vor  ihm  saß  und  in  einem  Buch  las. 
Langes  pechschwarzes  Haar  bedeckte  ihren  schmalen  Rücken.  Ihr 
Gesicht ähnelte dem Mais. 
Wo  mag  Mai  jetzt  sein?  Sorgen  verdunkelten  Andos  Miene.  Ob  mit 
ihr alles in Ordnung ist? Will Ryuji mir mit diesem Kode vielleicht mittei‐
len,  wo  Mai  ist?  Kaum  war  der  Gedanke  aufgetaucht,  als  Ando  ihn 
auch  schon  idiotisch  fand.  Er  grinste  sarkastisch.  Ich,  der  Held,  rette 
Mai vor einem schrecklichen Schicksal — was für eine infantile Vorstellung! 
Irgendwie  kam  ihm  plötzlich  alles  albern  vor.  Was  machte  er  hier 
eigentlich?  Vielleicht  war  die  Zweiundvierziger‐Basensequenz,  die 
sich aus irgendeinem Grund in die Virus‐DNA eingeschlichen hatte, 
gar  kein  Kode.  Andos  Ehrgeiz  war  mit  einem  Schlag  erloschen.  Im 
Grunde  genommen  hatte  er  sich  doch  nur  in  diese  Sache  verbissen, 
um  die  freien  Tage  totzuschlagen.  Eine  sinnlose  Beschäftigung,  die 
ihn darüber hinaus auch noch ermüdet hatte. 
Die  Sonne  stand  wieder  ein  Stück  tiefer.  Die  Härchen  auf  Andos 
Armen  schimmerten  golden  im  Lichtschein.  Er  spürte,  dass  er  sich 
nicht  mehr  konzentrieren  konnte,  und  beschloss,  sich  ein  Plätzchen 
im Schatten zu suchen. Vielleicht würde das ein wenig helfen. 
Doch  er  wurde  nicht  fündig.  Viele  der  Studenten,  die  scheinbar  in 
ihre  Bücher  vertieft  waren,  hingen  erschöpft  auf  ihren  Stühlen.  Alle 
wirkten  müde.  Resignierend  kehrte  Ando  zu  seinem  Tisch  zurück. 
Noch einmal bemühte er sich, seine Gedanken zu sammeln. 
Eine  Theorie,  eine  Theorie  ...,  murmelte  er  vor  sich  hin.  Es  muss  eine 
mathematische Funktion sein. 
Nachdenklich  richtete  er  sich  auf.  Die  aus  drei  Basen  zusammen‐
gesetzten Gruppen standen jeweils für einen Buchstaben ... Das ergab 
aber  keine  Funktion  im  Sinne  von  y=f(x).  Es  musste  eine  eindeutige 
Dekodierung möglich sein! 
Plötzlich kam Ando eine Idee. Das ist es! Seine Müdigkeit war wie 
weggeblasen.  Die  Aussicht,  der  Lösung  näher  gekommen  zu  sein, 
gab ihm neue Energie. Er sprang auf und lief  zu dem Regal mit der 
naturwissenschaftlichen Literatur. Dort griff er nach einem Fachbuch 
über  Molekularbiologie.  Hastig  blätterte  er  die  Seiten  durch.  Aus 
seinen Poren trat Schweiß, seine Handflächen waren feucht, und sein 
Herz raste. Was er jetzt brauchte, war ein Überblick darüber, welche 
Dreiergruppen  von  Basen  für  die  verschiedenen  Aminosäuren 
kodierten. 
Endlich fand er ihn. Er legte das Blatt mit der Basensequenz neben 
das  Buch.  Jeweils  drei  definiert  aufeinander  folgende  Basen  in  der 
DNA  standen  für  eine  Aminosäure  (Triplett).  Insgesamt  gab  es 
zwanzig verschiedene Aminosäuren. Weil vier verschiedene Basen in 
der DNA vorkamen, ergaben sich vierundsechzig (43) Tripletts. Diese 
vierundsechzig  verschiedenen  Basentripletts  ließen  sich  den  einzel‐
nen Aminosäuren zuordnen. Auf der Grundlage des genetischen Ko‐
des  übersetzte  Ando  die  ihm  vorliegende  Buchstabenabfolge  in 
Aminosäuren. 
 
ATG (Met) GAA (Glu) GAA (Glu) GAA (Glu) TAT (Tyr)
CGT (Arg) TAT (Tyr) ATT (Ile) CCT (Pro) CCT (Pro)
CCT (Pro) CAA (Gln) CAA (Gln) CAA (Gln) 
 
Einer Intuition folgend, nahm er jeweils den ersten Buchstaben der 
Aminosäuren und schrieb alle auf ein Blatt Papier. 
 
MGGGTATIPPPGGG 
 
Das  ergab  absolut  keinen  Sinn,  dachte  er  frustriert.  Aber  irgendei‐
nen Sinn musste die Wiederholung bestimmter Tripletts doch haben! 
Oder war das vielleicht nicht der springende Punkt? Ando überlegte 
erneut.  Dann  strich  er  von  den  sich  dreimal  wiederholenden 
Buchstaben jeweils zwei weg. 
 
MG..TATIP..G.. 
 
Nein, auch das war es nicht! Trotzdem nahm seine Erregung weiter 
zu.  Irgendwie  hatte  er  das  Gefühl,  dass  er  der  Lösung  schon  sehr 
nahe war. 
Die  folgenden  Aminosäuren  —  Glu,  Pro,  Gin  —  kamen  jeweils 
dreimal vor. Ando änderte die Reihenfolge: 
 
Met Glu (drei) 
Tyr 
Arg 
Tyr 
He 
Pro (drei) 
Gin (drei) 
 
Über  eine  Minute  lang  starrte  er  auf  diese  Reihe.  Dann  begriff  er 
plötzlich.  Endlich!  Er  stieß  einen  Freudenschrei  aus.  Das  war  die 
Lösung! 
Mit  den  Wiederholungen  bestimmter  Basenpaare  hatte  Ryuji  ihm 
sagen wollen, dass der dritte Buchstabe der Abkürzungen genommen 
werden musste. 
 
Met 
Glu (drei)  
Tyr  
Arg  
Tyr  
Ile 
Pro (drei)  
Gln (drei) 
 
Die Antwort lautete ›Mutation‹! 
Ando  triumphierte.  Doch  nun  ergab  sich  ein  neues  Problem. 
›Mutation‹  war  ein  biologischer  Begriff.  Welche  Bedeutung  steckte 
dahinter?  Wie  war  er  zu  interpretieren?  Er  hatte  nicht  die  geringste 
Idee. 
Ryuji, was willst du mir damit sagen? 
 

 
Ando  stand  in  der  Bibliothekshalle  vor  einem  Telefon.  Aufgeregt 
wählte  er  Miyashitas  Nummer.  Es  bestand  zwar  nur  wenig  Hoff‐
nung,  ihn  zu  erreichen,  aber  einen  Versuch  war  es  wert.  Heute  war 
der Erste der drei Feiertage, vielleicht traf er ihn doch noch zu Hause 
an.  Und  tatsächlich,  Miyashita  nahm  den  Hörer  ab.  Aufgewühlt 
berichtete Ando, dass er das Geheimnis gelüftet hatte. 
Miyashita schien sich gerade in der Essecke aufzuhalten. Im Hinter‐
grund  war  das  Geklapper  von  Geschirr  zu  hören.  Vermutlich  war 
seine  Frau  beim  Kochen.  Auch  die  Tochter  tollte  irgendwo  herum. 
Miyashita  hielt  zwar  ganz  offensichtlich  die  Muschel  aus  Rücksicht 
auf Ando zu, aber die warme, heimische Atmosphäre klang dennoch 
durch den Hörer. 
»He,  das  ist  ja  großartig!  Du  bist  ein  Genie!  Wusste  doch, dass  ich 
mich  auf  dich  verlassen  kann.  Und,  was  hast  du  rausbekommen?« 
Miyashitas Worte dröhnten laut und unangenehm in Andos Ohr, da 
er die Telefonmuschel zu nah an den Mund hielt. 
»Es ist kein Satz, sondern ein Wort.« 
»Nun halt mich nicht so hin, sag schon: welches Wort?« 
»›Mutation‹.« 
»›Mutation‹  ...«  Miyashita  murmelte  das  Wort  immer  wieder  vor 
sich hin. 
»Hast  du  eine  Ahnung,  was  das  bedeuten  könnte?«,  fragte  Ando 
gespannt. 
»Hm, ich weiß nicht. Hast du eine Idee?« 
»Nein. Ich habe mir auch schon den Kopf darüber zerbrochen, bin 
aber  noch  zu  keinem  Ergebnis  gelangt.  Um  ehrlich  zu  sein,  ich  bin 
total ratlos.« 
»Möchtest  du  nicht  vorbeikommen,  dann  können  wir  uns  in  Ruhe 
darüber unterhalten?« 
Miyashita  wohnte  in  Kitaterao  im  Bezirk  Tsurumi  in  einem  sehr 
hübschen,  exklusiven  Apartmenthaus.  Mit  der  U‐Bahn  brauchte 
Ando ungefähr eine Stunde. »Ja, wenn es dir recht ist.« 
»Sobald  du  am  Bahnhof  angekommen  bist,  melde  dich.  Ich  kenne 
eine gemütliche Kneipe, da können wir uns bei einem Gläschen Bier 
unterhalten.« 
Miyashitas  kleine  Tochter  schien  diese  Worte  aufgeschnappt  zu 
haben.  Laut  protestierend  schrie  sie:  »Papa,  du  darfst  nicht 
weggehen.« Es klang so, als würde sie an Miyashita hochspringen. Er 
bedeckte den Hörer kurz mit der Hand. Vermutlich ermahnte er sie, 
leise  zu  sein.  Doch  seine  Worte  schienen  nichts  zu  fruchten.  Ando 
konnte  hören,  wie  er  von  einem  Raum  in  den  nächsten  lief, 
offensichtlich  um  in  Ruhe  zu  Ende  telefonieren  zu  können.  Obwohl 
die Initiative zu dem Treffen von  Miyashita ausgegangen war, hatte 
Ando ein schlechtes Gewissen. Er fühlte sich, als hätte er etwas ver‐
brochen,  ja  jemandem  Schaden  zugefügt.  Zugleich  stiegen  Neidge‐
fühle  in  ihm  auf,  weil  er  den  Verlust  seiner  Familie  noch  nicht  ver‐
wunden hatte. 
»Treffen wir uns doch an einem anderen Tag«, schlug er vor. 
Aber  Miyashita  lehnte  das  entschieden  ab.  »Nein!  Du  willst  mich 
doch  wohl  nicht  allen  Ernstes  so  lange  schmoren  lassen.  Ich  brenne 
vor  Neugierde  und  will  noch  heute  erfahren,  wie  du  den  Kode 
entschlüsselt hast. Also, ruf bitte kurz an, sobald du ausgestiegen bist. 
Ich hole dich dann ab.« 
Bevor Ando etwas entgegnen konnte, hatte Miyashita schon einge‐
hängt. Er dachte an die familiäre Atmosphäre, die im Hintergrund zu 
hören gewesen war. Sie hatte ihn zutiefst berührt. Seufzend verließ er 
die Bibliothek und machte sich auf den Weg zur JR‐Station. 
 
Erst vor acht Tagen hatte Ando dieselbe Bahn genommen. Damals 
war sein Ziel jedoch ein anderes gewesen: Mais Apartment. Nach der 
Kitashinagara‐Station  verließ  der  Zug  den  Tunnel  und  wurde  zur 
Hochbahn.  Auf  beiden  Seiten  erstreckte  sich  ein  endloses  Meer  von 
hell  erleuchteten  Häusern  und  Straßen.  Es  war  Ende  November,  18 
Uhr.  Ando  blickte  zur  Bucht  von  Tokio  hinüber.  Jenseits  des  Kanals 
konnte er die Lichter der Betonhäuser von Yashio schimmern sehen. 
Wegen  des Feiertages waren  allerdings  nur  ein  paar  Lichtpunkte  zu 
erkennen. Er war immer noch nicht im Hier und Jetzt angelangt. Sei‐
ne Augen irrten nervös in alle Richtungen. Verzweifelt versuchte er, 
eine Art Zeichen zu erkennen. Seine Gedanken drehten sich fortwäh‐
rend um Kodes. Schließlich stach ihm ein Hochhaus ins Auge, dessen 
funkelnde Lichter dem Schriftzeichen »Yu« ähnelten. Natürlich hatte 
das keine tiefere Bedeutung. 
Mutation ... 
In die Abenddunkelheit blickend,  murmelte Ando das Wart unab‐
lässig vor sich hin. Er hoffte auf eine Eingebung. Was hatte Ryuji ihm 
nur mitteilen wollen? 
Weit in der Ferne vernahm er das dumpfe Dröhnen eines Schiffes. 
Im selben Moment fuhr der Zug in den nächsten Bahnhof ein. Minu‐
ten vergingen, ohne dass sich die Türen wieder schlossen. Vermutlich 
wartete man auf den Schnellzug. Erst wenn der abgefahren war, wür‐
de es auch bei ihnen weitergehen. Ando blickte aus dem Fenster, um 
den Namen der Station zu entziffern. Er war ihm noch gut in Erinne‐
rung. Erst acht Tage waren verstrichen, seit er sich in dieser Gegend 
in Mais Apartment aufgehalten hatte. Ando suchte das Haus mit den 
Augen.  Es  lag  irgendwo  in  der  Geschäftsstraße,  nicht  weit  entfernt 
von  der  U‐Bahn‐Station.  Als  er  vor  einer  Woche  aus  Mais  Fenster 
gesehen  hatte,  hatte  er  den  Keihinkyuko‐Bahnhof  sehen  können, 
sogar die Menschen auf den Bahnsteigen waren deutlich zu erkennen 
gewesen. Er müsste das Haus also von hier aus sehen können. 
Aber  er  entdeckte  es  nicht.  Kurz  entschlossen  sprang  er  aus  dem 
Zug, lief bis an das äußere Ende des Bahnsteigs und lehnte sich über 
die  Brüstung.  Jetzt  sah  er  die  Geschäftsstraße,  die  sich  Richtung 
Osten erstreckte. Ah, da war es. Endlich hatte Ando das sechsstöckige 
Haus erspäht, in dem Mai wohnte. 
Der  Schnellzug  aus  Shinagawa  fuhr  ein.  Wenn  er  die  Station 
verlassen  hatte,  würde  seine  Bahn  weiterfahren.  Ando  blieb  nicht 
mehr viel Zeit. Einen letzten Blick auf das Fenster in der dritten Etage 
werfend,  drehte  er  sich  um.  Just  in  diesem  Moment  ertönte  das 
Abfahrtssignal  seines  Zuges.  Rasch  warf  Ando  einen  Blick  auf  seine 
Armbanduhr. Es war kurz nach sechs. Vermutlich saß Miyashita mit 
seiner  Familie  gemütlich  beim  Abendessen.  Er  würde  nur  die  Fami‐
lienharmonie  zerstören,  wenn  er  zu  früh  kam,  dachte  er.  Also  ent‐
schied  er  sich,  einen  Zug  später  zu  nehmen.  Die  U‐Bahn  fuhr  ohne 
ihn ab. 
Vom  Bahnsteig  aus  blickte  Ando  abermals  auf  die  Fenster  im 
dritten Stockwerk des Wohnhauses. Wenn ihn seine Erinnerung nicht 
trog, hatte Mais Apartment die Nummer 303. Demnach musste es die 
dritte  Wohnung  von  rechts  sein.  Doch  in  keinem  Fenster  der  Etage 
brannte Licht. 
Mai  scheint  immer  noch  nicht  zurück  zu  sein.  Was  ist  nur  mit  ihr 
passiert?  Der  letzte  Funken  Hoffnung  war  wie  eine  Seifenblase 
zerplatzt ... 
Ando wollte gerade zur Mitte des Bahnsteiges zurückgehen, als er 
ein schwachblaues Flimmern bemerkte, das aus dem dritten Zimmer 
von rechts kam. Jetzt sehe ich schon Dinge, die gar nicht existieren. Oder 
war  es  vielleicht  doch  keine  Sinnestäuschung?  Er  schaute  genauer  hin. 
Nein, da war in der Tat etwas. Er hatte sich nicht geirrt. In der Dun‐
kelheit wirkte es wie ein hellblaues Band, das ähnlich einer Fahne aus 
dem  Fenster  wehte.  Mal  flackerte  der  schwache  Schein  auf,  dann 
verschwand er wieder. Ando lehnte sich noch weiter über die Sicher‐
heitsbrüstung. Was war das für ein Licht? Aus der Entfernung war es 
unmöglich, diese Frage zu beantworten. 
Plötzlich  verspürte  er  das  brennende  Verlangen,  noch  einmal  in 
Mais  Wohnung  zu  gehen.  Zwanzig  Minuten,  länger  würde  es  nicht 
dauern.  Dann  träfe  er  vermutlich  gerade  zur  rechten  Zeit  bei  Miya‐
shita ein. Damit war es beschlossene Sache. Ando verließ den Bahn‐
hof und lief raschen Schrittes die Geschäftsstraße hinunter. 
Vor ihm ragte das Apartmenthaus auf. Ein Blick zum Fenster in der 
dritten  Etage  genügte  ihm,  um  zu  begreifen,  was  er  von  der  Station 
aus gesehen hatte. Das schwachblau flackernde Band entpuppte sich 
als Gardine, die aus dem Balkonfenster wehte. In ihrem Weiß reflek‐
tierte  das  blaue  Neonlicht  der  Mietwagenfirma  gegenüber.  Verwun‐
dert  starrte  Ando  nach  oben.  Wie  konnte  das  sein?  Er  hatte  das 
Fenster  doch  geschlossen,  als  er  in  Mais  Wohnung  gewesen  war.  In 
diesem Punkt war er sich hundertprozentig sicher. Auch die Gardine 
hatte er zur Seite geschoben. 
Noch etwas anderes irritierte Ando. Es war irgendwie unheimlich. 
Ein mulmiges Gefühl breitete sich in seiner Magengegend aus, wäh‐
rend  er  darüber  nachdachte.  Heute  Abend  wehte  kein  Lüftchen  — 
wieso flatterte dann aber der weiße Vorhang? Woher kam die Brise? 
Es  war  kein  Wind  zu  spüren  oder  zu  hören,  und  die  Blätter  in  den 
Bäumen, die die Straße säumten, raschelten nicht. Und doch bewegte 
sich  der  Vorhang.  Gespenstisch!  Warum  bemerkte  das  keiner  der 
Passanten  auf  der  Straße?  Niemand  schien  sich  daran  zu  stören. 
Dabei  war  der  Anblick  fast  surreal.  Doch  offensichtlich  nahm  nur 
Ando diese seltsame Atmosphäre wahr. 
Vielleicht  wird  der  Luftzug  künstlich  erzeugt,  durch  einen  Ventilator  ... 
Aber ... Ando platzte fast vor Neugier. 
Entschlossen,  der  Sache  auf  den  Grund  zu  gehen,  betrat  er  die 
Lobby. Vom Hausmeister keine Spur,  und aus seiner Wohnung war 
nichts zu hören. Vermutlich war er mit seiner Familie über die Feier‐
tage verreist. 
Mit  dem  Fahrstuhl  fuhr  Ando  in  die  dritte  Etage  hoch.  Langsam 
ging er auf die Wohnungstür mit der Nummer 303 zu. Je näher er ihr 
kam,  desto  kleiner  wurden  seine  Schritte.  Seine  innere  Stimme  riet 
ihm,  sein  Vorhaben  nicht  in  die  Tat  umzusetzen.  Du  solltest  lieber 
sofort  umkehren,  flüsterte  sie  ihm  zu.  Aber  Andos  Neugier  besiegte 
seine  Ängste.  Trotzdem  sah  er  sich gründlich  um.  Die  Tür  am  Ende 
des  Flurs  war  einen  Spalt  breit  geöffnet,  eine  Feuertreppe  gab  es 
auch.  Über  die  Treppe  konnte  er  im  Notfall  also  fliehen  ...  Zwar 
wusste  er  eigentlich  nicht,  was  ihm  eine  solche  Furcht  einjagte, aber 
seine  Gedanken  drehten  sich  nur  um  eine  Frage:  Wie  komme  ich  hier 
wieder raus, wenn ... Es konnte nicht schaden, in Bezug auf die Flucht‐
wege Bescheid zu wissen. 
Ando blickte auf das rote Klingelschild neben der Tür Nummer 303 
mit  Mais  Namen.  Den  Zeigefinger  schon  in  Richtung  Klingel  bewe‐
gend, hielt er plötzlich inne. Vorsichtig blickte er sich um. Als er die 
Gewissheit  hatte,  dass  er  im  Treppenhaus  allein  war,  legte  er  das 
rechte Ohr an die Tür. Konzentriert horchte er, ob sich im Apartment 
etwas  bewegte.  Doch  es  war  mucksmäuschenstill.  Er  konnte  weder 
das Geräusch eines Ventilators noch sonst einen Laut hören. 
»Mai?« Ohne die Klingel zu betätigen, klopfte Ando an die Tür und 
rief verhalten ihren Namen. Keine Antwort ... 
Mai  hat  sich  das  mysteriöse  Video  bestimmt  angeschaut  ...  Inzwischen 
war Ando davon überzeugt. Doch zwei Fragen gingen ihm nicht aus 
dem  Kopf.  Warum  war  die  ursprüngliche  Aufzeichnung  gelöscht 
worden, und vor allem: Wer hatte sie überspielt? Er vermutete, dass 
die Bilder zwei Tage vor seinem Besuch gelöscht worden waren, also 
etwa fünf Tage nach Mais Verschwinden. Aber wer steckte dahinter? 
Und welche Absicht hatte diese Person damit verfolgt? 
Plötzlich stiegen die Erinnerungen an die grauenvollen Minuten in 
Mais  Apartment  in  ihm  auf.  Diese  Atmosphäre  ...  das  Gefühl,  als 
berührte  er  etwas  ...  die  Hand  auf  seiner  Haut  ...  das  Geräusch  auf‐
prallender Wassertropfen ... der Eindruck, als würde ihn etwas an der 
Wade streifen ... 
Ein kalter Schauer lief ihm über den Rücken, und er entfernte sich 
rasch ein paar Schritte von der Tür.  Verzweifelt suchte er nach Ant‐
worten.  Die  vier  Exemplare  des  Videos  waren  zerstört.  Theoretisch 
müsste  die  mysteriöse  Todesserie  also  beendet  sein.  Vermutlich 
würde man auch Mais Leiche bald finden. Dieser Gedanke versetzte 
ihm  einen  Stich  ins  Herz.  Vor  diesem  Tag  hatte  er  furchtbar  Angst. 
Egal, was er jetzt auch unternahm — was geschehen war, war gesche‐
hen.  Ando  beschloss  zu  gehen.  Er  wollte  nur  weg  von  hier.  Warum 
überfiel  ihn  stets  diese  panische  Angst,  sobald  er  in  die  Nähe  von 
Mais Apartment kam? 
Nervös  hämmerte  er  auf  die  Aufzugtaste,  um  den  Fahrstuhl  zu 
holen.  Mutation,  Mutation  ...  Gebetsmühlenartig  murmelte  er  dieses 
Wort  vor  sich  hin,  in  der  Hoffnung,  sich  dadurch  ablenken  zu  kön‐
nen.  Seine  Nerven  waren  zum  Zerreißen  gespannt.  Wo  bleibt  der 
verdammte Fahrstuhl? 
In diesem Moment hörte er das Knarren einer Tür. Er erstarrte vor 
Angst. Aus dem Augenwinkel sah er, dass sich die Tür von 303 einen 
Spalt  geöffnet  hatte.  Das  rote  Namensschild  unter  der  Klingel  gab 
ihm  Gewissheit.  Kein  Zweifel,  das  war  die  Wohnungstür  von  Mais 
Apartment!  Halb  verrückt  vor  Angst  betätigte  Ando  die  Fahrstuhl‐
taste erneut. 
Plötzlich  trat  ein  Mensch  aus  Mais  Wohnung.  Ando  stellte  sich 
schon auf einen Kampf ein, als er sah, dass es eine Frau war ... Eine 
Frau  in  einem  olivefarbenen  Sommerkleid.  Ohne  von  ihm  Notiz  zu 
nehmen,  schloss  sie  die  Tür  ab.  Ando  riskierte  einen  knappen  Blick 
auf ihr Profil. Sie trug zwar eine Sonnenbrille, doch so viel war sicher: 
Das war nicht Mai Takano. 
Warum in Gottes Namen ließ seine Anspannung nicht nach? Wovor 
fürchtete  er  sich  so?  Es  gab  eigentlich  gar  keinen  Grund  durchzu‐
drehen. Und trotzdem hätte er am liebsten die Flucht ergriffen. 
Endlich! Die Fahrstuhltüren öffneten sich. In Panik stürzte Ando in 
den Aufzug und drückte auf eine Taste. Doch vor lauter  Aufregung 
hatte er die ›Tür öffnen‹‐Taste erwischt. So ein Mist! Rasch betätigte er 
den  richtigen  Knopf.  Dabei  betete  er  zu  Gott,  dass  sich  die  Türen 
schnell schlossen. Er atmete schon auf, als plötzlich eine weiße Hand 
zwischen die sich schließenden Türen griff. Sie öffneten sich wieder. 
Vor Ando stand die Frau. Die Sonnenbrille verdeckte einen Teil ihres 
Gesichts, doch er schätzte sie auf etwa fünfundzwanzig Jahre. Ohne 
ein  Wort  zu  sagen,  betrat  sie  den  Fahrstuhl  und  stellte  sich  neben 
Ando. Dann drückte sie auf ›E‹. 
Ando  bewegte  sich  Zentimeter  für  Zentimeter  nach  hinten,  bis  er 
mit  dem  Rücken  gegen  die  Wand  stieß.  Wer  bist  du?,  dachte  er  ein 
ums andere Mal. 
Ein merkwürdiger, äußerst unangenehmer Geruch stach ihm in die 
Nase. Er stammte nicht von einem Parfüm. Stirnrunzelnd hielt er den 
Atem  an.  Der  Geruch  ähnelte  dem  frischen  Blutes.  Prüfend  betrach‐
tete  er  die  mysteriöse  Unbekannte.  Sie  hatte  halblanges  schwarzes 
Haar. Ihre Hand, mit der sie sich an der Wand abstützte, war kreide‐
weiß, der Nagel des Zeigefingers abgebrochen. Obwohl Winter war, 
trug sie nur ein leichtes Kleid und keine Strümpfe. 
Und  noch  etwas  fiel  Ando  auf.  An  den  Beinen  hatte  sie  große 
schwarze  Flecken.  Ihm wurde  immer  unbehaglicher  zumute,  und  er 
begann, am ganzen Leib zu zittern. 
In dem engen Fahrstuhl allein mit dieser Frau ... 
Die  Sekunden  zogen  sich  quälend  in  die  Länge.  Erst  als  der  Lift 
endlich  im  Erdgeschoss  hielt,  wagte  Ando  wieder  zu  atmen.  Die 
Türen öffneten sich, und schon war die Frau verschwunden. 
Ando schätzte sie auf etwa einen Meter sechzig. Sie hatte eine sehr 
weibliche Figur. Das Kleid, das ungefähr zehn Zentimeter über ihren 
Knien endete, lag eng an ihrem Körper und betonte ihren knackigen 
Po.  Außerdem  ließ  es  ihre  schönen,  schlanken  Beine  zur  Geltung 
kommen. 
Ando stand wie angewurzelt in der Lobby und starrte ihr hinterher. 
Nachdem er sich wieder gefangen hatte, machte er sich auf den Weg 
zur U‐Bahn‐Station. 
 

 
Ando wartete vor einer Bank auf Miyashita. Eine himmlische Ruhe 
umgab  ihn,  weil  die  Menschentrauben  fehlten,  die  sich  sonst  durch 
die engen Straßen schoben. Das war der Unterschied zwischen einem 
Feiertag  und  einem  Werktag.  Ungeduldig  blickte  er  auf  auf  eine 
dunkle Gasse. Sicher würde Miyashita aus dieser Richtung kommen. 
Vor  seinem  geistigen  Auge  sah  Ando  immer  wieder  die  seltsame 
junge  Unbekannte,  die  plötzlich  aus  Mais  Apartment  getreten  war, 
als wäre ihr Anblick in  sein Gehirn eingebrannt und ließe sich nicht 
löschen. 
Wie ein Schlafwandler war Ando von Mais Wohnhaus zum Bahn‐
hof gelaufen. Während der Fahrt hierher hatte er nur allmählich die 
Fassung wiedererlangt. 
Wer ist diese Frau nur?, fragte er sich ein ums andere Mal. Eigentlich 
gab  es  nur  eine  plausible  Antwort:  Sie  war  die  Schwester  von  Mai. 
Vermutlich  hatte  sie,  von  Sorgen  geplagt,  nach  Mai  gesucht.  In  der 
Hoffnung, irgendeinen Hinweis auf deren Verbleib zu finden, war sie 
zu ihrem Apartment gefahren. Immerhin hatte Ando mit ihrer Mutter 
über  das  plötzliche  Verschwinden  Mais  gesprochen.  Vielleicht  hatte 
sie sich doch Sorgen gemacht und mit ihrer zweiten Tochter darüber 
gesprochen. Dann wäre das Auftauchen der Frau nicht weiter spekta‐
kulär oder verdächtig. 
Aber ihre Aura ... Eine düstere, ja gespenstische Atmosphäre hatte 
sie  umgeben,  und  das  ließ  Ando  an  seiner  Hypothese  zweifeln.  Er 
hatte  Höllenängste  ausgestanden,  während  er  mit  ihr  im  Fahrstuhl 
war, und doch nicht ohne Grund so heftig reagiert. Sie ist kein Wesen 
von dieser Welt. Ein übersinnliches ... Phantom vielleicht? Nein, das war 
ausgeschlossen.  Sie  hatte  schließlich  einen  menschlichen  Körper. 
Wenngleich ihre Aura auf etwas anderes schließen ließ. 
Ein kleines Licht bewegte sich zwischen den dunklen Häusern auf 
Ando zu. 
»Hallo, Ando.« 
Erst  jetzt  erkannte  Ando  Miyashita.  Mit  einem  Affenzahn  kam  er 
auf ihn zugeradelt. Er brachte das Rad mit einer Vollbremsung kurz 
vor Ando zum Stehen. Heftig schnaufend stützte er sich auf den Len‐
ker. Es dauerte eine Weile, bis er ein Wort herausbrachte. Mivashita 
war  beleibt  und  deshalb  schnell  außer  Atem.  Aus  diesem  Grund 
bewegte  er  sich  gewöhnlich  nur  langsam.  Doch  heute  hatte  er  sich 
wahrlich  selbst  übertroffen.  Getrieben  von  einer  unsäglichen  Neu‐
gierde,  hatte  er  sich  auf  das  Fahrrad  seiner  Frau  geschwungen  und 
war so schnell wie möglich hergeradelt. 
»Wie  der  Blitz«,  sagte  Ando  spontan.  Er  war  davon  ausgegangen, 
mindestens  zehn  Minuten  warten  zu  müssen.  Mit  der  Pünktlichkeit 
nahm Miyashita es nicht so genau. 
Miyashita  stellte  das  Fahrrad  am  Bahnhof  ab.  Gemeinsam  gingen 
sie  in  ein  belebtes  Kneipenviertel.  Allmählich  hatte  sich  Miyashitas 
Atmung  wieder  normalisiert.  »Mutation  ...  Ich  habe  da  so  eine 
Ahnung«, sagte er. 
»Was steckt deiner Meinung nach dahinter?« 
»Lass uns erst ein Bierchen trinken.« 
Kurz darauf betraten sie eine Kneipe namens ›Ochsenzunge‹. Noch 
im  Stehen  bestellte  Miyashita  zwei  Bier  und  gebratene  Ochsen‐
zungen. Er schien den Besitzer des Lokals gut zu kennen. Nach einem 
kurzen Smalltalk suchten sie sich ein ruhiges Plätzchen in der Ecke. 
Dann quetschte Miyashita Ando über den Kode aus, den sie in der 
Virus‐DNA  von  Ryuji  entdeckt  hatten.  Im  Schnellverfahren  erklärte 
Ando,  wie  er  vorgegangen  war,  doch  Miyashita  unterbrach  ihn. 
Genug  der  Worte,  meinte  er,  es  bestehe  kein  Zweifel,  der  gewählte 
Lösungsansatz sei der einzig richtige. 
»Mutation,  ohne  Frage,  das  ist  es.  Eine  andere  Lösung  lässt  deine 
Methode  nicht  zu«,  sprudelte  es  aus  ihm  heraus.  Freundschaftlich 
klopfte er Ando auf die Schulter. »Es gibt eine Analogie. Fällt dir da 
nichts ein?« 
»Eine Analogie?« 
Miyashita  zog  einen  Zettel  aus  der  Tasche,  auf  dem  eine  einfache 
Skizze  zu  sehen  war.  »Na,  dämmert  es  jetzt?«,  sagte  er,  während  er 
Ando das Blatt reichte. 
Auf  der  Zeichnung  war  der  Replikationsprozess  der  DNA  ab‐
gebildet.  Zunächst  wurde  die  DNA‐Doppelhelix  entspiralisiert  und 
mit  Hilfe  eines  Enzyms,  Helicase  genannt,  gespalten.  Es  lagen  nun 
zwei Einzelstränge vor. Einer diente als Matrize für den zu syntheti‐
sierenden  komplementären  Gegenstrang  —  das  hieß,  die  replizierte 
DNA bestand jeweils aus einem alten und einem neu synthetisierten 
komplementären Einzelstrang. Nach Abschluss der Replikation wur‐
den  also  zwei  DNA‐Einzelstränge  in  etwas  unterschiedlicher  Weise 
wieder  zu  einem  Doppelstrang  ergänzt.  Aus  einem  DNA‐Molekül 
waren zwei entstanden. 
»Ja und? Was willst du mir damit sagen?«, fragte Ando. 
»Denk  doch  mal  an  die  Vorgänge  bei  der  Evolution.  Die  Ent‐
wicklung neuer Arten und Rassen.« 
Viele  Fragen  zum  Prozess  der  Evolution  waren  noch  immer  un‐
beantwortet.  Nur  wenige  andere  naturwissenschaftliche  Theorien 
hatten eine derart heftige Diskussion in Gang gebracht wie die Evolu‐
tionstheorie.  Vor  allem  hinsichtlich  des  Schöpfungsglaubens  vieler 
Religionen  gab  es  nach  wie  vor  scheinbar  unüberbrückbare  Kontro‐
versen.  Die  heutige  Evolutionstheorie  war  von  Charles  Darwin  be‐
gründet  und  von  einer  Vielzahl  von  Biologen  und  anderen  Wissen‐
schaftlern weiterentwickelt worden. Sie war mittlerweile weitgehend 
als grundlegendes naturwissenschaftliches Forschungsergebnis aner‐
kannt, auch wenn einige Details noch nicht vollständig erklärt waren. 
In  jüngster  Zeit  hatte  vor  allem  die  Molekularbiologie  neue 
Einsichten  gebracht.  Nach  ihrem  aktuellen  Erkenntnisstand  lag  die 
Ursache  einer  Evolution  in  der  spontanen  oder  künstlich  erzeugten 
Veränderung im Erbgefüge — mit anderen Worten: in der Mutation. 
»Die  Mutation  ist  eine  treibende  Kraft  der  Evolution«,  antwortete 
Ando. 
»Genau.  Mutationen  sind  der  Auslöser  der  Evolution.  Aber  wie 
kommt  es  zu  einer  Mutation?  Das  ist  der  entscheidende  Punkt.« 
Nachdem  Miyashita  einen  Schluck  Bier  getrunken  hatte,  zog  er 
seinen  Kugelschreiber  aus  der  Hemdtasche  und  schrieb:  Entstehung 
einer Mutation. 
Ando wollte gerade zu einer Antwort ansetzen, da fügte Miyashita 
noch etwas hinzu. Neugierig blickte Ando auf die Skizze. 
»Der  Kopierprozess,  der  zur  Reproduktion  der  genetischen  Struk‐
tur der DNA notwendig ist, ist zwar allgemein sehr genau, aber den‐
noch passieren gelegentlich Kopierfehler, welche die genetischen In‐
formationen ändern — und voila: wir haben eine Mutation. Denkbar 
sind Änderungen in der Anzahl, Anordnung oder in der molekularen 
Sequenz  von  Genen.  Die  Folgen  der  genetischen  Veränderungen 
betreffen  dabei  allerdings  nicht  nur  die  Zelle,  in  der  die  Mutation 
stattfindet, sondern auch deren Nachkommen : Die Mutation wird in 
allen  künftigen  Generationen  kopiert  werden,  weil  die  ›falschen‹ 
Basenpaare  ebenso  repliziert  werden  wie  die  ›richtigen‹.  Diesen 
Mechanismus verstehst du doch? Das ist mir spontan durch den Kopf 
geschossen.« 
Mit  dem  Stift  auf  die  Skizze  tippend,  hatte  Miyashita  seine  Erklä‐
rungen  wie  ein  Lehrer  hervorgebracht.  Für  Ando  war  diese  Materie 
weiß  Gott  nicht  fremd.  Es  gab  zudem  künstliche  Mutationen,  bei‐
spielsweise  durch  elektromagnetische  Strahlung  wie  Radioaktivität 
oder  UV‐Strahlung.  Doch  im  Allgemeinen  gingen  die  Biologen 
inzwischen  davon  aus,  dass  alle  Mutationen  auf  zufällige,  spontane 
Veränderungen  der  DNA  zurückzuführen  waren.  Zwar  bestätigten 
alle,  dass  der  DNA‐Replikationsprozess  bemerkenswert  genau  war, 
doch  man  wusste  auch,  dass  Kopierfehler  nicht  ausgeschlossen  wa‐
ren.  Und  je  nach  dem,  wie  konstant  und  häufig  die  Veränderungen 
waren, konnten sie zu neuen Arten und Rassen führen. 
»Da gibt es eine Analogie ...«, flüsterte Miyashita Ando ins Ohr. 
Und endlich fiel auch bei Ando der Groschen. In der Tat, Miyashita 
hatte recht. »Die Kopie des Videos!«, platzte es aus Ando heraus. 
»Endlich  hast  duʹs  begriffen.  Mann,  du  stehst  heute  ja  auf  der 
Leitung!  Aber  egal...  Findest  du  nicht  auch,  dass  da  Parallelen 
bestehen?«  Gierig  stopfte  Miyashita  sich  gleich  zwei  gebratene 
Ochsenzungen in den Mund. Dann spülte er mit Bier nach. 
Währenddessen  versuchte  Ando,  seine  Gedanken  zu  ordnen.  Er 
ließ  sich  von  Miyashita  den  Stift  geben,  drehte  das  Blatt  um  und 
fertigte eine Mindmap an. Das war immer eine gute Methode, um die 
Gedanken zu sortieren. Dann begann er, den Fall zu rekonstruieren. 
Am 26. August war das Video urplötzlich aufgetaucht, und zwar in 
Süd‐Hakone,  genauer  in  der  Blockhütte  B‐4  des  Ferienressorts 
Pazifikland. Dort übernachteten am Abend des 29. August vier junge 
Leute,  die  zufällig  auf  das  Band  stießen.  Aus  Jux  und  Tollerei  über‐
spielten sie die entscheidende Botschaft am Ende des Videos, die die 
Rettung versprach, mit einer Werbesendung. So wurde die Informa‐
tion  ›Ziehe  eine  Kopie  und  zeige  das  Video  jemand  anderem‹ 
gelöscht. Dies war ein zufälliges, spontanes Ereignis, das einen Fehler 
auslöste,  der  die  Informationen,  die  in  den  Bildern  —  der  DNA  des 
Videos  —  verschlüsselt  waren,  änderte.  Diese  Mutation  wurde  bei 
der Vervielfältigung des Bandes von Kazuyuki Asakawa mitkopiert. 
In  dieser  Hinsicht  bestand  eine  eindeutige  Analogie  zwischen  dem 
DNA‐Replikationsprozess  und  dem  Kopieren  des  Videos.  Hinzu 
kam, dass gerade die gelöschte Botschaft auf dem Band eine Schlüs‐
selfunktion für den Kopierprozess hatte. Das war auch in der Genetik 
so.  Wenn  es  zu  Störungen  des  Transkriptionsfaktors  in  der  DNA 
kam, führte dies leicht zu Mutationen. 
Ando  legte  den  Stift  beiseite.  »Alles  schön  und  gut  —  aber  ein 
Video ist kein lebender Organismus.« 
Als hätte Miyashita auf diese Frage gewartet, antwortete er wie aus 
der  Pistole  geschossen:  »Wenn  dich  jemand  fragen  würde,  wie  du 
›Leben‹ definierst, was würdest du antworten?« 
Genau  definierbar  war  Leben  nicht,  aber  es  ließ  sich  anhand 
bestimmter  Merkmale  umschreiben.  Zwei  entscheidende  Kriterien 
waren  die  ›Fähigkeit  zur  Selbstreproduktion‹  und  ›Isola‐tionsbar‐
rieren‹,  was  bedeutete,  dass  alle  lebenden  Organismen  auf  einen 
bestimmten Raum konzentriert und von einer Hülle umgeben waren, 
die  sie  gegenüber  der  Außenwelt  abschlossen.  Am  Beispiel  einer 
Zelle ließ sich das deutlich machen. Die Reproduktion erfolgte durch 
die DNA, für die Abgrenzung von der Außenwelt sorgte die Eiweiß‐
hülle.  Ando  versuchte,  diese  Definition  von  Leben  auf  das  Video 
anzuwenden. Das zweite Wesensmerkmal war auch hier vorhanden: 
Es hatte eindeutig eine Hülle. Aber wie war es mit der Fähigkeit zur 
Selbstreplikation? Nein, darüber verfügte es ganz eindeutig nicht. 
»Ein Video besitzt nicht die Fähigkeit zur Reproduktion.« 
»Und?«, zischte Miyashita ungeduldig. 
»Es ähnelt einem Virus.« Fast hätte Ando einen Schrei ausgestoßen. 
Viren waren bei strenger Auslegung der Definition von Leben keine 
lebenden Organismen. Sie besaßen die Fähigkeit zur Selbstreplikation 
nicht, bestanden aber aus einer Proteinhülle und einem Genom. Aus 
dieser Perspektive betrachtet, ließen sich Viren als Grenzfälle bezeich‐
nen  —  sie  standen  zwischen  Leben  und  Nicht‐Leben.  Um  sich  ver‐
mehren zu können, waren sie vollständig auf die Stoffwechselleistun‐
gen lebender Zellen, so genannten Wirtsorganismen, angewiesen. 
Auch  das  verhängnisvolle  Video  bedurfte  einer  helfenden  Hand, 
um  sich  zu  vermehren.  Dabei  machte  es  sich  die  Ängste  der  Men‐
schen zunutze, in dem es drohte, all diejenigen zu töten, die das Band 
nicht innerhalb einer Woche vervielfältigten. 
»Aber  ...«  Nein,  diese  Hypothese  war  sicher  falsch.  Ando  wollte 
und  konnte  sie  nicht  akzeptieren.  Die  Folgen  wären  zu  furchtbar. 
Nicht auszumalen! 
Und  wenn  sie  doch  stimmte?  Dann  würde  eine  verheerende 
Katastrophe über die Menschheit hereinbrechen. 
»Aber das Video existiert nicht mehr.« Erneut versuchte Ando sich 
einzureden,  dass  kein  Anlass  zur  Sorge  bestand.  Selbst  wenn  das 
Video Eigenschaften eines Virus aufgewiesen hätte — es war vernich‐
tet. Keines der vier Exemplare existierte noch, und somit konnten sie 
auch kein Unheil mehr anrichten. Die Gefahr war gebannt. 
»Ja, da hast du recht. Das Video ist zweifellos ein für alle Mal von 
dieser  Welt  verschwunden.  Aber  es  gehörte  der  alten  Spezies  an«, 
sagte  Miyashita,  an  seiner  Bierflasche  nippend.  Schweißperlen 
standen auf seiner Stirn — der Alkohol. 
»Der alten Spezies?« 
»Überleg doch mal. Das Video mutierte. Während es immer wieder 
kopiert  wurde,  kam  es  zur  Evolution.  Eine  neue  Art  entstand.  Nur 
wissen wir noch nicht, wo sie sich versteckt hat. Ich habe da so eine 
böse Vorahnung.« 
Ohne ein Wort herauszubringen, saß Ando sekundenlang mit halb‐
offenem  Mund  vor  Miyashita.  Jetzt  brauchte  er  etwas  Hochprozen‐
tiges.  Doch  er  war  außer  Stande,  etwas  zu  sagen.  Der  Schock  hatte 
ihn  vollkommen  gelähmt.  Miyashita  las  ihm  den  Wunsch  von  den 
Augen ab. Mit zwei erhobenen Fingern rief er »Whisky, bitte«. 
Kaum  hatte  die  Bedienung  den  Whisky  gebracht,  griff  Ando  mit 
zitternden  Händen  nach  dem  Glas  und  leerte  es  mit  einem  Zug. 
Miyashita,  dem  Andos  Erregung  nicht  entgangen  war,  sagte:  »Das 
Videoband  ist  durch  ein  zufälliges  Ereignis  verändert  worden.  Die 
Mutation, die immer wieder mitkopiert wurde, führte zur Evolution, 
zur Entstehung einer neuen Art. Ryuji hat die Basenfolge seiner DNA 
benutzt, um uns dieses Wort aus dem Totenreich zu übermitteln. Ich 
glaube wirklich nicht, dass es eine andere Interpretationsmöglichkeit 
gibt. Oder hast du eine andere Auffassung davon, wie man Mutation 
wissenschaftlich erklärt?« 
Natürlich  nicht.  So  viel  Whisky  Ando  auch  in  sich  hineinschüttete, 
heute  konnte  er  ihm  nichts  anhaben.  Statt  betrunkener  zu  werden, 
wurde er immer klarer im Kopf. 
Vielleicht liegt Miyashita richtig ... Allmählich begann Ando, Miyashi‐
tas These zu akzeptieren. Immerhin hatte Ryuji ihnen mit dem Wort 
›Mutation‹ etwas sagen wollen. Es war eine Warnung gewesen. Ja, so 
musste es sein. 
»Wir dürfen uns jetzt nicht beruhigt auf die faule Haut legen. Es ist 
noch lange nicht vorbei, nur weil die Videos endlich zerstört wurden. 
Wir müssen handeln. Die durch Mutation neu entstandene Rasse ist 
ganz in der Nähe. Das spüre ich«, sagte Miyashita. 
Ando  dachte  an  das  Aids‐Virus.  Vor  einigen  hundert  Jahren  hatte 
es  keine  Bedrohung  für  den  Menschen  dargestellt.  Es  war  zunächst 
nicht  übertragbar  gewesen  und  hatte  deshalb  keine  negativen  Aus‐
wirkungen  auf  den  Homo  sapiens  gehabt.  HIV  war  ursächlich  eine 
genetische  Variante  des  so  genannten  Simian  Immunodeficiency 
Virus, kurz SIV, gewesen, das afrikanische Affen und Menschenaffen 
in  sich  trugen.  Im  Laufe  der  Zeit  entstand  in  den  Schimpansen  eine 
Hybridform der beiden SIV‐Viren, die später auf den Menschen über‐
tragen werden konnte und zu HIV‐I mutierte. Plötzlich stellte es eine 
immense Bedrohung für den Menschen dar. 
Wenn  das  im  Fall  des  Videos  ...  Ando  scheute  sich  davor,  den  Satz 
weiterzudenken.  Noch  immer  versuchte  er,  sich  vom  Gegenteil  zu 
überzeugen.  Es  gab  in  der  Geschichte  der  Menschheit  durchaus 
Viren, die Millionen Todesopfer gefordert hatten, dann aber in einen 
harmlosen  Erreger  mutiert  waren.  Wissenschaftliche  Erkenntnisse 
zeigten, dass sich neunzig Prozent der Mutationen auf den Phänotyp 
des Lebewesens in keiner Weise auswirkten; sie waren harmlos. 
Aber wie Ando es auch drehte und wendete, die Realität sah anders 
aus. Die erste Mutation des Virus hatte sich definitiv schädlich ausge‐
wirkt.  Alle  Menschen,  die  das  Video  gesehen  hatten,  waren  tot.  Die 
einzige Ausnahme stellte Asakawa dar — ihm hatte das Virus nichts 
anhaben  können.  Wie  das  Verschwinden  von  Mai  in  das  Ganze 
passte, konnte Ando zu diesem Zeitpunkt noch nicht sagen. 
»Warum lebt Asakawa noch?«, fragte er Miyashita erneut. 
»Das ist der entscheidende Punkt. Wir müssen herausfinden, in was 
sich  das  Videoband  verwandelt  hat.  Etwas  anderes  bleibt  uns  nicht 
übrig.« 
»Es gibt noch eine Person, die eine Ausnahme ist.« 
Ando berichtete von Mai, und wie Ryujis Kopie des Originalvideos 
in ihre Hände gelangt war. Kurz nachdem sie es sich angesehen hatte, 
war sie verschwunden — vor nun schon drei Wochen. 
»Mit  anderen  Worten,  wir  haben  immerhin  zwei  Personen,  die, 
obwohl sie sich das Video angesehen haben, nicht gestorben sind.« 
»Asakawa liegt zwar im Koma, aber er lebt. Doch ob Mai noch lebt, 
das weiß nur Gott.« 
»Wir können nur beten, dass es so ist.« 
»Warum ist dir das so wichtig?«, fragte Ando. 
»Mann,  du  bist  heute  aber  schwer  von  Begriff.  Das  liegt  doch  auf 
der Hand: Zwei Fälle sind besser als einer.« 
Das leuchtete Ando ein. Falls Mai noch lebte und Gemeinsamkeiten 
zwischen ihrem Fall und dem Asakawas bestanden, würde die Ant‐
wort vermutlich ans Tageslicht kommen. 
Doch  Ando  wünschte  sich  nicht  nur  aus  diesem  Grund,  dass  Mai 
noch am Leben war. 
 
 
 
 
 
 

 
 

 
26.  November,  Montagnachmittag.  Ando  hatte  gerade  ein  kleines 
Kind obduziert, das tot in einem Fluss gefunden worden war. Zurück 
in seinem Büro, fiel ihm ein, dass der Autopsiebericht noch geschrie‐
ben werden musste. Ihm gegenüber saß, wie ein Häufchen Elend, der 
Vater des Jungen. Am liebsten hätte Ando ihn sofort nach der Sektion 
weggeschickt,  aber  es  waren  noch  einige  Fragen  zu  klären  —  Name 
und  Geburtsdatum  des  Kindes,  wie  war  es  zu  dem  Unfall  gekom‐
men?, etc. Doch der Vater war außer Stande, auch nur einen einzigen, 
zusammenhängenden  Satz  zu  formulieren.  Immer  wieder  starrte  er 
gedankenverloren  aus  dem  Fenster.  Am  Boden  zerstört  und  in  sich 
zusammengefallen,  kauerte  er  kraftlos  auf  dem  Stuhl,  unfähig,  sich 
auf das Gespräch zu konzentrieren. Ando erfasste tiefes Mitgefühl. 
Draußen auf dem Gang entstand plötzlich Unruhe. Stimmengewirr 
durchdrang  den  Flur  der  Gerichtsmedizin.  Offensichtlich  schienen 
die Assistenten Vorbereitungen für eine weitere Autopsie zu treffen. 
Da  Ando  noch  beschäftigt  war,  würde  sie  sein  Kollege  Dr.  Naka‐
yama,  der  im  selben  Büro  saß,  durchführen.  Ohne  es  zu  wollen,  be‐
kam Ando einige Informationen mit: Nach Angaben der Polizei hatte 
man  eine  Leiche  im  Entlüftungsschacht  eines  alten  Gebäudes 
gefunden. Die hektischen Schritte von Polizei und Personal hallten im 
Flur wider. 
»Die Leiche der Frau ist jetzt da.« 
Als Ando die Stimme des Assistenten wahrnahm, durchzuckte ihn 
ein  eisiger  Schauer.  Ruckartig  fuhr  er  hoch.  Ikeda,  der  Assistent, 
stand  im  Türrahmen,  den  Blick  auf  Dr.  Nakayama  gerichtet.  Doch 
aus unerklärlichen Gründen fühlte Ando sich angesprochen. 
»Danke.  Machen  Sie  mit  den  Vorbereitungen  weiter.  Ich  komme 
gleich«, entgegnete Nakayama. 
Nakayama,  Andos  älterer  Kollege,  war  zwei  Jahre  länger  am 
Institut als er. Um seine Existenz zu sichern, hatte er außerdem eine 
Anstellung  am  Gerichtsmedizinischen  Seminar  der  Medizin‐
hochschule J. 
Ikeda  hatte  das  Büro  eben  verlassen,  als  ein  Polizist  eintrat.  Nach 
höflichen Begrüßungsfloskeln nahm er neben Nakayama Platz. 
Scheinbar  unbeirrt  wandte  sich  Ando  wieder  dem  Vater  des  von 
ihm  obduzierten  Jungen  zu.  Aber  er  konnte  sich  nicht  auf  ihn  kon‐
zentrieren  —  immer  wieder  drangen  Gesprächsfetzen  an  sein  Ohr, 
die  ihn  beunruhigten.  Der  Polizist  schien  Dr.  Nakayama  gerade  zu 
berichten,  aufweiche  Weise  die  Leiche  gefunden  worden  war. 
Schließlich  legte  Ando  seinen  Stift  beiseite  und  spitzte  konzentriert 
die Ohren. Immer wieder vernahm er: die unbekannte junge Frau ... 
»Warum ist sie auf das Dach des Gebäudes gestiegen?«, erkundigte 
sich Nakayama. 
»Gute Frage ... Vielleicht wollte sie Selbstmord begehen«, vermutete 
der Polizist. 
»Hat  man  einen  Abschiedsbrief  oder  irgendetwas  in  der  Art  ge‐
funden?« 
»Nein, bis jetzt nicht.« 
»Hm,  im  Entlüftungsschacht...  Da  hätte  sie  natürlich  niemand 
gehört, selbst wenn sie aus vollem Hals um Hilfe gerufen hätte.« 
»Da haben Sie Recht. Wenn es ein Wohngebiet gewesen wäre, aber 
so ...« 
»In welcher Gegend hat sich die Tragödie zugetragen?« 
»In  einem  alten  dreizehnstöckigen  Haus  in  der  Wanganstraße  in 
Higashioi, Bezirk Shinagawa.« 
Ando  hob  ruckartig  den  Kopf.  Er  glaubte  seinen  Ohren  nicht  zu 
trauen.  Das  war  ganz  in  der  Nähe  von  Mais  Apartment  an  der  Kei‐
hinkyuko‐Linie.  Hinter  dem  Wohngebiet  befand  sich  die  Wangan‐
straße  mit  Lagerhäusern  und  Bürokomplexen.  Die  unbekannte  junge 
Frau ... auf dem Dach eines alten Gebäudes in der Wanganstraße ... Immer 
wieder gingen Ando diese Worte durch den Kopf. Eine schreckliche 
Vorahnung  bemächtigte  sich  seiner.  Abrupt  beendete  er  das 
Gespräch mit dem Vater des Jungen. »Vielen Dank für Ihre Geduld. 
Falls ich noch Fragen habe, setze ich mich mit Ihnen in Verbindung.« 
Rasch machte er sich ein paar abschließende Notizen. Das Gespräch 
zwischen  seinem  Kollegen  und  dem  Polizisten  hatte  ihn  so  aufge‐
wühlt, dass er den Vater nach Hause geschickt hatte, ohne alle erfor‐
derlichen Details erfragt zu haben. Zur Not gab es ja ein Telefon. 
Er legte den Autopsiebericht beiseite. In diesem Moment verließen 
Dr.  Nakayama  und  der  Polizist  das  Büro.  Ando  folgte  ihnen  und 
klopfte  Nakayama  auf  die  Schulter,  während  er  den  Polizisten 
begrüßte. »Ist die Identität der Frau bekannt?«, fragte er, während sie 
gemeinsam den Flur zum Seziersaal entlanggingen. 
»Nein.  Sie  hatte  weder  einen  Ausweis  noch  sonst  irgendwelche 
Papiere bei sich«, antwortete der Polizist. 
»Auf wie alt schätzen Sie sie?« 
»Oh,  sie  ist noch  ziemlich  jung,  vielleicht  um  die  Zwanzig.  Als  sie 
noch lebte, war sie sicher ausgesprochen hübsch.« 
Vielleicht  um  die  zwanzig  ...  So  alt  wie  Mai.  Ando  hatte  das  Gefühl, 
als drückte ihm jemand den Hals zu. »Ist Ihnen etwas Besonderes an 
ihr aufgefallen?« 
Ein  einziger  Blick  auf  die  Leiche  hätte  Ando  Klarheit  verschafft. 
Doch  bevor  er  sich  diesem  schrecklichen  Moment  stellen  konnte, 
musste er sich Gewissheit verschaffen, um vorbereitet zu sein. Noch 
immer  flackerte  in  ihm  ein  Fünkchen  Hoffnung,  dass  sich  seine 
Vermutung nicht bewahrheiten würde. 
»Warum  interessiert  Sie  der  Fall  so?«,  fragte  Nakayama  mit  einem 
anzüglichen  Grinsen.  »Eine  schöne  junge  Frau  ...  hat  das  etwa  Ihr 
Interesse geweckt?« 
»Aber nein. Wofür halten Sie mich? Es gibt einen anderen Grund«, 
erwiderte  Ando  mit  ernster  Miene.  Nun  verdüsterten  sich  auch 
Nakayamas Gesichtszüge. 
»Ah,  da  fällt  mir  ein  ...  In  der  Tat  war  da  etwas  Merkwürdiges. 
Darüber wollte ich sowieso mit Ihnen sprechen, Dr. Nakayama.« 
»Was denn?« 
»Die Frau trug keine Unterwäsche.« 
»Keine  Unterwäsche?  Sie  meinen,  weder  einen  BH  noch  einen 
Slip?« 
»Sie hatte keinen Slip an.« 
»War ihre Kleidung zerrissen, als man sie fand?« 
Nakayama  hatte  anscheinend  den  gleichen  Gedanken  gehabt  wie 
Ando. Auch ihm war als Erstes durch den Kopf geschossen, dass die 
Frau Opfer eines Sexualverbrechens geworden sein könnte. 
»Ihre Sachen war vollkommen in Ordnung. Es gab kein Anzeichen 
für eine Vergewaltigung.« 
»Können Sie beschreiben, was sie anhatte?« 
»Einen Jeansrock mit Kniestrümpfen ... Sie trug ein T‐Shirt, darüber 
eine Sportjacke. Insgesamt war sie schlicht gekleidet, so möchte ich es 
mal ausdrücken.« 
Mitten  im  November?  Ob  die  Frau  das  Haus  immer  ohne  Slip 
verließ? 
»Also,  in  meinen  Ohren  klingt  die  ganze  Geschichte  höchst  merk‐
würdig. In einem Entlüftungsschacht eines alten Gebäudes ...«, sagte 
Ando, den jedoch eine andere Frage quälte. 
»Ja,  seltsam.  Der  Schacht  war  drei  Meter  tief,  bei  einer  Breite  von 
etwa  einem  Meter.  Gewöhnlich  sind  derartige  Schächte  mit  einem 
Gitterrost abgedeckt. Aber ein Teil des Rostes war durchgebrochen.« 
»Mit anderen Worten: Sie ist in das Loch gefallen?« 
»So sieht es jedenfalls aus.« 
»Wie  wahrscheinlich  ist  es  Ihrer  Meinung  nach,  dass  man  ver‐
sehentlich in diesen Schacht fällt?« 
»Ich schätze die Gefahr als sehr gering ein. Hinzu kommt, dass die 
Tür zum Dach verriegelt war.« 
»Aber wie ist sie dann auf das Dach gekommen?« 
»Ich  nehme  an,  sie  hat  die  Nottreppe  an  der  Hauswand  benutzt. 
Eine andere Möglichkeit sehe ich nicht.« 
Ale  möglichen  Gedanken  schwirrten  Ando  durch  den  Kopf.  Was 
wollte diese Frau nur an so einem Ort ... »Um noch mal auf die Unterwä‐
sche  zurückzukommen:  Könnte  es  sein,  dass  sie  den  Slip  im  Entlüf‐
tungsschacht  ausgezogen  hat?«  Der  Schacht  war  drei  Meter  tief. 
Stürzte man hinein, verletzte man sich unweigerlich. Vielleicht hatte 
die Frau den Slip verwendet, um eine blutende Wunde abzubinden. 
»Wir haben die ganze Gegend danach durchforscht. Aber weder im 
Schacht  noch  auf  dem  Dach  oder  in  der  Umgebung  haben  wir  den 
Slip gefunden.« 
»In der Umgebung?«, hakte Nakayama nach. 
»Nun, wir wollten auf Nummer Sicher gehen. Eine unserer Thesen 
war,  dass  sie  den  Slip  mit  einem  Gegenstand  beschwerte  und  ins 
Freie  schleuderte.  Hilfeschreie  waren  ja  vergebens,  niemand  auf  der 
Straße hätte sie gehört. Da blieb ihr vielleicht nur diese Möglichkeit, 
um Aufmerksamkeit zu erregen. Aber wir haben den Gedanken bald 
verworfen.« 
»Warum?« 
»Selbst wenn ihr gelungen wäre, den Slip nach draußen zu werfen, 
wäre er am Dachgitter abgeprallt.« 
Für Ando war von Anfang an klar gewesen, warum das nicht funk‐
tionieren  konnte.  Es  war  eine  Frage  des  Winkels.  »Das  bedeutet,  sie 
muss das Haus ohne Unterwäsche verlassen haben ... Das ist die nahe 
liegendste, wenn auch am wenigsten nachvollziehbare Erklärung.« 
»Wir werden erst einmal von dieser These ausgehen.« 
Vor dem Obduktionssaal blieben alle drei stehen. 
»Dr. Ando, kommen Sie mit uns?«, fragte Nakayama. 
»Nur kurz.« 
Eine bessere Antwort war Ando spontan nicht eingefallen. Er wollte 
sich  Gewissheit  verschaffen.  Falls  die  mysteriöse  Leiche  nicht  Mai 
Takano war, könnte er beruhigt gehen. Doch falls sie es war ... Nicht 
auszudenken  ...  Jedenfalls  würde  er  die  Autopsie  dann  Nakayama 
überlassen und sich irgendwo verkriechen. 
Er  vernahm  das  vertraute  Geräusch  fließenden  Wassers.  Am  lieb‐
sten hätte er auf dem Absatz kehrtgemacht und die Flucht ergriffen. 
Das  flaue  Gefühl  in  der  Magengegend  wurde  immer  stärker.  Er  zit‐
terte  am  ganzen  Leib,  seine  Nerven  waren zum  Zerreißen gespannt. 
In Gedanken flehte er immer wieder: Bitte lass es nicht Mai sein! 
Nakayama betrat den Seziersaal, gefolgt von dem Polizisten. Ando 
blieb  stehen.  Alle  Ängste  beiseite  schiebend,  ließ  er  seinen  Blick  für 
den  Bruchteil  einer  Sekunde  über  die  nackte  Leiche  auf  dem 
Seziertisch wandern. 
 

 
Ando hatte eine Vorahnung gehabt, doch als er die Leiche nun sah, 
erstarrte  er  entsetzt.  Zögernd  näherte  er  sich  der  Toten.  Der  Ohn‐
macht nahe, betrachtete er das fahle Gesicht. Er wollte es nicht wahr‐
haben ... In Mais einst so schönem Haar klebte getrockneter Schlamm. 
Ein Fuß war merkwürdig verbogen, ihre Haut schimmerte aschgrau. 
Vermutlich  hatte  sie  sich  den  Knöchel  gebrochen.  Anzeichen  von 
Gewalt,  wie  Würgemale  am  Hals  oder  äußere  Verletzungen,  waren 
nicht  zu  erkennen.  Der  Tod  musste  vor  ungefähr  neunzig  Stunden 
eingetreten  sein,  denn  die  Leichenstarre  hatte  sich  inzwischen 
vollkommen gelöst. 
Ando  sah  die  duftende,  bezaubernde  Mai  vor  sich,  wie  er  sie  vor 
drei  Wochen  erlebt  hatte.  Wie  gern  hätte  er  ihren  wohlgeformten 
Körper, ihre sanfte Haut berührt. Doch seine Wunschträume würden 
nie in Erfüllung gehen. Diese blaugraue Haut, der abgemagerte Körper ... 
Schockiert nahm Ando den raschen physischen Verfall dieser einst so 
attraktiven  Frau  wahr,  für  die  er  so  viel  empfunden  hatte.  Er  ertrug 
den Anblick nicht länger. Bittere Wut stieg in ihm auf. 
»Verdammt, warum nur?«, platzte es aus ihm heraus. 
Der  Polizist  und  Nakayama  blickten  ihn  an.  »Kennen  Sie  die  Tote 
etwa?«, fragte der Polizist erschrocken. Ando nickte. 
»Das  ist  ja  ...«  Da  Nakayama  nicht  wusste,  in  welcher  Beziehung 
Ando  zu  der  Verstorbenen  gestanden  hatte,  sprach  er  ihm  sein  Bei‐
leid nicht aus. 
»Kennen Sie ihren Namen und ihre Adresse?«, erkundigte sich der 
Polizist vorsichtig. Bei allem Taktgefühl war doch seine Erleichterung 
zu spüren. Immerhin blieb ihm nun viel Arbeit erspart. 
Ohne  zu  antworten,  zog  Ando  sein  Adressbuch  aus  der  Tasche. 
Dort  hatte  er  vor  noch  gar  nicht  so  langer  Zeit  die  Adresse  und 
Telefonnummer  von  Mais  Eltern  notiert.  Er  schrieb  die  Daten  auf 
einen Zettel und reichte ihn dem Polizisten wortlos. 
»Ein  Irrtum  ist  ausgeschlossen?«,  fragte  der  Polizist  mit  fast 
übertriebener Höflichkeit. 
»Es besteht kein Zweifel. Diese Frau ist Mai Takano.« 
Kaum  hatte  Ando  diese  Worte  ausgesprochen,  verschwand  der 
Polizist aus dem Obduktionssaal, vermutlich um die Familie zu ver‐
ständigen. Ando stellte sich vor, wie das Telefon bei Mais Eltern klin‐
gelte. Die Mutter nahm ab und erfuhr vom Tod ihrer Tochter. Andos 
Herz verkrampfte sich, Mais Mutter tat ihm unendlich Leid. Wie groß 
musste ihr Schmerz sein! 
Ando  hielt  es  nicht  eine  Sekunde  länger  im  Seziersaal  aus.  Gleich 
würde sich ein entsetzlicher, unbeschreiblicher Gestank breitmachen, 
wenn  Nakayama  das  Skalpell  angesetzt  hatte,  Organ  für  Organ 
herausnahm  ...  Egal  wie  schön  der  Körper  eines  Menschen  zu  Leb‐
zeiten  gewesen  war,  in  diesem  Zustand  blieben  nur  noch  ekelhafte 
Ausdünstungen  ...  Das  war  nun  einmal  das  Schicksal  aller  Lebe‐
wesen.  Doch  Ando  wollte  Mai  so  in  Erinnerung  behalten, wie  er  sie 
kennen gelernt hatte. 
»Ich gehe jetzt«, stieß Ando erstickt hervor. 
»Möchten  Sie  der  Autopsie  nicht  beiwohnen?«,  fragte  Nakayama, 
während  sich  ein  merkwürdiger  Ausdruck  auf  seinem  Gesicht 
abzeichnete. 
»Ich habe noch etwas zu erledigen. Bitte unterrichten Sie mich nach 
der Autopsie über Ihre Diagnose.« 
»In Ordnung.« 
Ando legte eine Hand auf Nakayamas Schulter und sagte mit leiser 
Stimme: »Bitte achten Sie auf die Herzkranzgefäße. Vergessen Sie auf 
keinen Fall, davon eine Gewebeprobe zu entnehmen.« 
Verwundert  blickte  Nakayama  Ando  an.  »Hatte  die  Frau  denn 
Herzprobleme?« 
Ando blieb ihm die Antwort schuldig und sagte nur: »Ich bitte Sie 
inständig ...« 
Andos  Blick  verriet  Nakayama,  dass  er  ihn  in  arge  Nöte  bringen 
würde, wenn er weitere Fragen stellte. Er nickte zweimal. 
 

 
Ando  wartete  im  Büro  vor  Nakayamas  Schreibtisch  auf  das  Ende 
der  Autopsie.  Schließlich  erschien  sein  Kollege.  Bevor  er  sich  Ando 
zuwandte, schrieb er den Obduktionsbericht. »Dieser Fall scheint Sie 
ja  über  alle  Maßen  zu  interessieren  ...«,  sagte  er,  während  er  die 
letzten Wörter zu Papier brachte. 
»Ja, das stimmt.« 
»Möchten  Sie  einen  Blick  in  den  Autopsiebericht  werfen?« 
Nakayama schob ein paar Blätter zu Ando hinüber. 
»Es  genügt,  wenn  Sie  mir  die  wichtigsten  Ergebnisse  kurz 
schildern.« 
»Gern. Also zunächst einmal... Sie haben sich mit Ihrer Vermutung 
im Hinblick auf die Todesursache getäuscht. Mai Takano ist nicht an 
einem Herzinfarkt infolge Verstopfung eines Herzgefäßes gestorben.« 
Verblüfft dachte Ando: Was bedeutet das nun wieder? 
Mai  hat  sich  das  Video  offensichtlich  doch  nicht  angesehen.  Denkbar  ist 
aber  auch,  dass  der  Tumor  in  ihren  Herzgefäßen  einfach  noch  nicht  groß 
genug war. 
»Haben  Sie  kein  Geschwür  in  einem  der  Herzkranzgefäße  fest‐
gestellt?«, hakte Ando nach. 
»Ich konnte nichts Dergleichen entdecken.« 
»Nicht einmal einen Hinweis darauf?« 
»Natürlich ist es noch zu früh, um endgültige Aussagen zu treffen. 
Ich  fürchte,  Sie  müssen  sich  noch  ein  wenig  gedulden,  bis  die 
Ergebnisse der Gewebeprobeanalyse vorliegen.« 
»Wie lautet Ihre Diagnose?« 
»Ich glaube, sie ist erfroren. Ihr Körper war stark geschwächt.« 
»Und wie sieht es mit Verletzungen aus? Irgendetwas Auffälliges?« 
»Der  linke  Knöchel  ist  gebrochen.  Außerdem  hat  sie  ein  paar 
Schrammen  an  den  Ellenbogen.  Diese  Verletzungen  muss  sie  sich 
beim Sturz in den Schacht zugezogen haben.« 
Mit  eigener  Kraft  hatte  Mai  sich  nicht  aus  dem  Schacht  heraus‐
ziehen  können.  Vermutlich  hatte  sie  Regenwasser  getrunken,  wäh‐
rend sie verzweifelt auf Rettung hoffte. »Wie lange wird sie wohl in 
dem  Schacht  noch  gelebt  haben?«  Ando  richtete  die  Frage  mehr  an 
sich selbst. Voller Mitgefühl stellte er sich vor, wie Mai allein, hilflos, 
verängstigt  und  dem  Tod  geweiht  in  diesem  dunklen,  muffigen 
Schacht kauerte. Wie verzweifelt musste sie gewesen sein. Arme Mai! 
»Ungefähr zehn Tage.« 
Ihr Magen und Darm waren vollkommen leer, sie hatte kaum noch 
Körperfett. 
»Zehn Tage ...« Ando öffnete seinen Kalender. Falls Mai tatsächlich 
noch zehn Tage nach dem Sturz gelebt hatte und nun seit fünf Tagen 
tot  war,  dann  musste  sie  ab  dem  10.  November  verschwunden 
gewesen  sein.  Allerdings  war  Ando  mit  ihr  für  den  9.  November 
verabredet  gewesen.  An  diesem  Tag  war  sie  aber  schon  nicht  mehr 
ans Telefon gegangen. Im Briefkasten steckte noch die Zeitung vom 8. 
November.  Alles  deutete  daraufhin,  dass  sich  das  tragische  Ereignis 
zwischen dem 8. und 9. November abgespielt hatte. 
Ando kreuzte beide Tage im Kalender an. 
Was ist wohl an den fraglichen Tagen passiert? 
Am  15.  November  war  er  in  Mais  Apartment  gewesen.  Der  Au‐
topsie  zufolge  hatte  sie  zu  dieser  Zeit  bereits  hilflos  in  dem  Schacht 
gekauert. Sie hatte eine Jacke und einen Rock an, aber seltsamerweise 
keinen Slip. Ando konnte sich absolut nicht vorstellen, warum Mai in 
dieser Kleidung auf das Dach des Gebäudes gestiegen war. Tatsache 
war,  dass  sie  seit  einigen  Tagen  nicht  in  ihrem  Apartment  gewesen 
war,  davon  hatte  er  sich  ja  selbst  überzeugt.  Trotzdem  war  eine  ge‐
wisse menschliche Wärme in der Wohnung zu spüren gewesen. Diese 
Atmosphäre ... Wer war das nur? 
»Und ...« Nakayama schien sich an etwas Wichtiges zu erinnern. 
»Ja?« 
»Sie standen ihr doch ... nahe.« 
»Das wäre zu viel gesagt. Ich habe sie nur zweimal getroffen.« 
»Hm. Wann haben Sie sie denn das letzte Mal gesehen?« 
»Ende letzten Monats.« 
»Also ungefähr zwanzig Tage vor ihrem Tod.« 
Ando spürte, dass Nakayama ihm etwas mitteilen wollte. Doch aus 
irgendeinem Grund redete er um den heißen Brei herum. Er signali‐
sierte  ihm  mit  ernster  Miene,  dass  er  ruhig  mit  der  Sprache  raus‐
rücken konnte. 
»Sie war schwanger ... Wussten Sie das?« 
»Wen meinen Sie mit ›sie‹?« 
»Mai Takano natürlich.« 
Nakayama  war  erstaunt  über  Andos  Fassungslosigkeit.  »Wussten 
Sie es etwa nicht? Aber sie war doch schon im neunten Monat!« 
»Im neunten Monat?« Ando verschlug es die Sprache. An die Decke 
starrend,  versuchte  er,  sich  an  Mais  Körper  zu  erinnern.  Sowohl  bei 
ihrem  Treffen  in  der  Gerichtsmedizin  als  auch  ein  paar  Tage  später 
im Cafe hatte sie figurbetonte Kleider getragen. Sie war sehr schlank 
gewesen. Gerade ihre schmale Taille hatte ihm so gefallen. Aus einem 
unerklärlichen  Grund  hatte  er  sogar  das  Gefühl  gehabt,  dass  Mai 
noch Jungfrau war. 
Hatte  sie  einen  Bauch  gehabt?  Im  neunten  Monat...  Selbstverständlich 
hatte er sie nicht so genau gemustert. Je mehr er darüber nachdachte, 
desto  unsicherer  wurde  er.  Aber  nein,  es  war  unmöglich,  dass  Mai 
kurz  vor  der  Niederkunft  gestanden  hatte!  Außerdem  hatte  er  doch 
gerade erst ihre Leiche gesehen, und die hatte einen flachen Bauch. 
»Das  ist  unmöglich.  Mai  kann  auf  keinen  Fall  kurz  vor  der 
Niederkunft gewesen sein«, stieß Ando hervor. 
»Es gibt Frauen, denen man nicht anmerkt, dass sie hochschwanger 
sind.« 
»Das ist es nicht. Ich habe doch gerade ihre Leiche gesehen.« 
»Was? Oh.« Allmählich dämmerte es Nakayama, dass sie aneinan‐
der vorbeigeredet hatten. »Der Gebärmuttermund war weit geöffnet. 
Sie war leicht verletzt, vermutlich passierte das, als der Mutterkuchen 
herauskam.  In  der  Vagina  waren  noch  Sekretspuren.  Nun,  und  zu 
guter  Letzt  entdeckte  ich  einen  kleinen  Knoten  in  der  Vagina.  Ver‐
mutlich war das die Nabelschnur.« 
Das  kann  doch  nicht  wahr  sein!,  dachte  Ando.  Andererseits  war  es 
ausgeschlossen, dass sich ein hervorragender Pathologe wie Nakaya‐
ma in diesem Punkt irrte. Was er gesagt hatte, legte den Schluss nahe, 
dass Mai ein Kind zur Welt gebracht hatte, bevor sie in dem Schacht 
starb. 
Ando  dachte  folgendes  Szenario  durch:  7.  November,  Mai  bekam 
plötzlich Wehen. Rasch fuhr sie ins Krankenhaus. Dort gebar sie ein 
Kind. Vermutlich blieb sie für fünf, sechs Tage in der Klinik. Am 12. 
oder  13.  November  wurde  sie  entlassen.  Eine  These  wäre,  dass  Mai 
eine  Totgeburt  gehabt  hatte.  Verzweifelt  wegen  dieses  Schicksals‐
schlags  begab  sie  sich  auf  das  Dach  des  alten  Gebäudes,  was  den 
Absturz in den Schacht zur Folge hatte ... 
Vom  zeitlichen  Ablauf  her  war  dieses  Szenario  nicht  unmöglich. 
Falls  sie  eine  Totgeburt  gehabt  hatte,  würde  das  auch  erklären,  wa‐
rum  sie  so  plötzlich  verschwunden  war.  Es  wäre  auch  nicht  beson‐
ders unnatürlich gewesen, dass sie das vor ihrer Mutter geheim hielt. 
Aber aus irgendeinem Grund glaubte Ando nicht an diese Theorie. 
Mais Bauch war nicht im Geringsten gewölbt gewesen, als er sie das 
letzte  Mal  gesehen  hatte.  Er  erinnerte  sich  noch  genau  an  die  erste 
Begegnung mit ihr in der Gerichtsmedizin. Sie hatte Ryujis aufgefun‐
den  und  war  dann  zu  Ando  gebeten  worden,  um  zu  schildern,  was 
sich  ereignet  hatte.  Er  erinnerte  sich  daran,  als  wäre  es  erst  gestern 
geschehen ... Sie betrat das Zimmer ... Als sie sich eben setzen wollte, 
taumelte  sie  leicht  und  stützte  sich  mit  einer  Hand  auf  dem  nahen 
Tisch  ab.  Ein  fahles  Grau  hatte  das  Weiß  ihrer  Haut  verdrängt.  »Es 
tut  mir  Leid.  Es  ist  nur  ...«,  murmelte  Mai  verlegen.  Ando  verstand 
sofort — sie hatte ihre Periode. 
Doch  dann  konnte  sie  zu  diesem  Zeitpunkt  unmöglich  schwanger 
gewesen  sein.  Ausgeschlossen,  dass  sie  in  diesem  Monat  ein  Kind 
geboren  hatte.  Denn  bei  einer  Schwangerschaft  blieb  die  Regel 
gewöhnlich aus. 
Ob ich sie vielleicht missverstanden habe? 
Dabei war Ando sich so sicher gewesen. Nicht einen Moment lang 
hatte  er  an  seiner  ›Diagnose‹  gezweifelt.  Doch  je  länger  er  darüber 
nachdachte ... 
Er stand auf. 
»Hätten  Sie  etwas  dagegen,  wenn  ich  mir  den  Autopsiebericht 
kopiere?« Er wollte sich den Bericht zu Hause in Ruhe durchlesen. 
»Nein, natürlich nicht.« 
»Ich habe noch eine Bitte«, sagte Ando. »Sie haben doch sicher eine 
Blutprobe entnommen?« 
»Selbstverständlich.« 
»Könnte ich davon etwas bekommen?« 
»Wenn Sie nicht viel brauchen, dürfte es kein Problem sein.« 
Ando  wollte  Mais  Blut  unbedingt  auf  das  pockenähnliche  Virus 
testen.  Sollte  es  sich  darin  nachweisen  lassen,  wäre  bewiesen,  dass 
auch Mai sich das Video angeschaut hatte. Dann wäre wenigstens ge‐
klärt, ob Mais furchtbares Ende mit dem Video zusammenhing oder 
mit  etwas  anderem,  beispielsweise  einer  Schwangerschaft.  Im  Mo‐
ment blieb ihm nur eines übrig: möglichst viele Fakten zu sammeln. 
Falls  irgendeine  Verbindung  zwischen  Mais  Tod  und  dem  Video 
bestand,  würden  die  Ergebnisse  der  Analysen  vielleicht  helfen,  die 
Bedeutung der Mutation zu verstehen ... 
 

 
Kurz darauf erreichte Ando eine weitere Hiobsbotschaft. Nicht nur, 
dass man Mais Leiche entdeckt hatte — nun war auch Kazuyuki Asa‐
kawa  tot.  Offensichtlich  hatte  sich  sein  Zustand  so  verschlechtert, 
dass er vom Shinagawa‐Saisei‐Kran‐kenhaus in die Universitätsklinik 
S verlegt werden musste. Kurz darauf wurde er von seinem schreckli‐
chen Schicksal erlöst. Ando war erschüttert. Aus irgendeinem Grund 
hatte er nicht damit gerechnet, dass Asakawa so schnell sterben wür‐
de.  Nach  Auskunft  des  verantwortlichen  Arztes  hatte  er  eine  Infek‐
tion bekommen und war dann wie ein sehr, sehr alter Mensch sanft 
entschlafen. An seinem geistigen Zustand hatte sich bis zum Schluss 
nichts geändert. 
Ando fuhr sofort zur Uni‐Klinik S, um mit dem Pathologen zu spre‐
chen. »Es geht um die Obduktion von Kazuyuki Asakawa ... Ich wäre 
Ihnen sehr dankbar, wenn Sie die Herzkranzgefäße auf ein Geschwür 
untersuchen  würden.  Ich  habe  die  Vermutung,  dass  die  tatsächliche 
Todesursache  darin  begründet  liegt.  Bitte  untersuchen  Sie  auch  das 
Blut auf einen Virus, einen pockenähnlichen Erreger«, bat Ando den 
Arzt höflich. Bevor er sich verabschiedete, wiederholte er die wichtig‐
sten Punkte eindringlich. Die Verbreitung des Virus musste gestoppt, 
das Böse aufgehalten werden. 
Auf dem Weg zur U‐Bahn überkam Ando plötzlich Wut. Hätte Asa‐
kawa  sich  doch  erholt!  Verzweifelung  und  Frustration  brachen  aus 
ihm heraus. Asakawa hatte wichtige Informationen mit ins Grab ge‐
nommen. Er war die Schlüsselfigur in diesem Fall gewesen. Nur ein 
paar Minuten ... Was hätte Ando dafür gegeben, wenn er nur ein paar 
Minuten mit ihm hätte sprechen können. Dann hätte er jetzt vielleicht 
gewusst,  was  er  unternehmen  musste,  um  dem  Schrecken  ein  Ende 
zu setzen. Doch nun war jegliche Hoffnung verloren. 
Ob  Asakawas  Tod  natürlich  war  oder  vielleicht  doch  vorprogram‐
miert? Dieselbe Frage stellte Ando sich in Bezug auf Mai. Beide wa‐
ren  körperlich  extrem  geschwächt  gewesen,  als  sie  dem  Todesengel 
in  die  Augen  geblickt  hatten.  Asakawa  war  nur  noch  ein  menschli‐
ches Wrack, Mai wegen des Sturzes in den Entlüftungsschacht völlig 
entkräftet. Wenn er es sich recht überlegte, gab es durchaus Paralle‐
len zwischen beiden Fällen. 
Ando  fasste  einen  Entschluss.  Ganz  in  der  Nähe  war  Mais  Leiche 
gefunden worden. Bis heute konnte er nicht verstehen, was sie in die‐
se Gegend verschlagen hatte. Was in aller Welt hatte sie nur auf das 
Dach  des  alten  Gebäudes  getrieben?  Vielleicht  fand  er  es  heraus, 
wenn  er  selbst  hinaufstieg  und  sich  etwas  umsah  —  je  eher,  desto 
besser. Noch waren die Spuren frisch. 
Mit schnellen Schritten kehrte er zur Nakahara‐Straße zurück. Dort 
winkte  er  ein  Taxi  heran.  Von  hier  aus  waren  es  höchstens  zehn 
Minuten zu besagtem Gebäude. 
Unterwegs hielten sie kurz an einer Straßenecke, damit Ando einen 
kleinen Blumenstrauß kaufen konnte. Vor dem Lagerhaus des Spedi‐
tionsunternehmens  T  verließ  er  das  Taxi.  Hier  irgendwo  musste  es 
sein. In der Gerichtsmedizin hatte Ando lediglich den Namen dieser 
Firma  aufgeschnappt,  nicht  aber  die  Nummer  des  Hauses,  in  dem 
Mai  gestorben  war.  Sein  einziger Anhaltspunkt  war,  dass  es  südlich 
des Lagerhauses der Spedition lag. 
Ando blickte nach oben. Kein Zweifel, dort war es. Der Feuertreppe 
nach zu urteilen, hatte das Gebäude dreizehn Stockwerke. Rasch eilte 
er  auf  den  Haupteingang  zu,  doch  dann  hielt  er  plötzlich  inne. 
Nachdenklich ging er ein paar Schritte zurück. Welchen Weg mag Mai 
wohl  genommen  haben,  um  auf  das  Dach  zu  kommen?  Es  lag  nahe,  dass 
sie  mit  dem  Fahrstuhl  hochgefahren  ist.  Aber  was  war  mit  der 
Feuertreppe? 
Die  entscheidende  Frage  war,  zu  welchem  Zeitpunkt  Mai  her‐
gekommen  war.  Spät  am  Abend  war  der  Eingang  abgeschlossen.  In 
diesem Fall gab es nur eine Möglichkeit: die Außentreppe. 
Eingehend musterte Ando die sich in dem schmalen Spalt zwischen 
diesem  und  dem  nächsten  Gebäude  nach  oben  windende  Treppe. 
Gleich  auf  der  ersten  Etage  hinderte  eine  Stahltür  am  weiteren  Auf‐
stieg. Ob sie abgeschlossen war? Rasch erklomm Ando die ersten Stu‐
fen.  Wie  vermutet  war  die  Tür  verschlossen  —  eine  normale  Sicher‐
heitsvorkehrung,  um  Eindringliche  abzuwehren.  Eine  wirkliche 
Hürde stellte die Tür jedoch nicht dar. Sie war gerade mal einen Me‐
ter  achtzig  hoch  und  für  einen  sportlichen  Menschen  kein  Problem. 
Ando  erinnerte  sich,  dass  Mai  während  ihrer  Schulzeit  Hundert‐
meterlauf betrieben hatte. Für sie dürfte es ein Klacks gewesen sein, 
über das Hindernis zu klettern. 
Die Tür zum Gebäude war ebenfalls abgeriegelt. Ando stieg wieder 
hinunter.  Kurz  darauf  betrat  er  die  Lobby  des  Komplexes.  Das  Me‐
tallschild  neben  den  Fahrstühlen  gab  Aufschluss,  welche  Firmen  im 
Haus residierten. Erstaunlicherweise schienen die Büroräume nur zur 
Hälfte  vermietet  zu  sein.  Das  Gebäude  wirkte  verwaist.  Keine  Men‐
schenseele  war  auf  den  Gängen  zu  sehen.  Eine  gespenstische 
Atmosphäre herrschte in dem Haus. 
Mit dem Lift fuhr Ando in die dreizehnte Etage. Die Gänge waren 
nur schwach beleuchtet. Den Aufgang zum Dach suchend, wanderte 
er in dem düsteren, verlassenen Flur herum. Doch er konnte ihn nicht 
finden.  Also  musste  er  wohl  oder  übel  die  Feuertreppe  nehmen. 
Kaum hatte er die Tür einen Spalt breit geöffnet, blies ihm ein eisiger, 
rauer Meereswind ins Gesicht. Das Pfeifen des Windes klang wie auf 
schauerliche  Weise  geisterhaft.  Fröstelnd  schlug  Ando  den  Kragen 
seiner  Jacke  hoch.  Erst  jetzt  bemerkte  er,  dass  sich  die  Bucht  von 
Tokio ganz in der Nähe befand. 
Das  Gebäude  hatte  eine  merkwürdige  Form,  die  erst  ersichtlich 
wurde,  wenn  man  im  dreizehnten  Stock  nach  draußen  ging.  Hier 
schien der Komplex etwas schmaler zu sein, so dass den Flur eine Art 
Terrasse  umgab.  Auf  dieser  Fläche  war  die  Feuertreppe  befestigt. 
Wenn man sie ungefähr drei Meter hinaufkletterte, kam man auf das 
Dach. 
Ando versuchte, sich in Mais Lage hineinzuversetzen. Die Blumen 
zwischen  die  Zähne  geklemmt,  erklomm  er  zaghaft  Sprosse  für 
Sprosse. 
Warum  musste  sie  unbedingt  diese  Leiter  hinaufsteigen?  Was  wollte  sie 
nur auf dem Dach? Eines stand jedenfalls fest: Sie war nicht hergekom‐
men, um sich hinunterzustürzen. Dazu war dieses Gebäude denkbar 
ungeeignet  —  der  Körper  würde  zwei,  drei  Meter  tiefer  auf  der 
›Terrasse‹  aufschlagen.  Wenn  man sich  unbedingt  den  Hals  brechen 
wollte,  wäre  es  klüger,  es  von  der  dreizehnten  Etage  aus  zu  ver‐
suchen. 
Außer  Atem  erreichte  Ando  das  Dach.  Was  mochte  sich  hier 
abgespielt haben? Beklommenheit stieg in ihm auf. 
Ein merkwürdiges Dach. Es war mit Aluminiumblechen bedeckt, ver‐
mutlich um zu verhindern, dass sich Regenwasser ansammelte. Hier 
und  da  blätterte  bereits  die  Farbe  ab,  die  aufgetragen  worden  war, 
damit sich der Rost nicht durchfraß. In der Mitte befanden sich zwei 
kleine  Aufsätze.  Metallene  Geräusche  durchbrachen  die  Stille,  als 
Ando über  das Dach ging. Der Boden unter seinen Füßen gab leicht 
nach.  Er  fühlte  sich  nicht  besonders  sicher.  Zu  nah  an  den  Rand 
würde er nicht gehen, das war zu gefährlich. 
Er entdeckte zwei kleine Vorsprünge, stellte sich darauf und sah in 
die  Ferne.  Majestätisch  lag  die  Stadt  vor  ihm.  Seine  Blicke  verloren 
sich in einem Meer von Lichtern. Es war zwar erst kurz vor 17 Uhr, 
doch  in  dieser  Jahreszeit  waren  die  Tage  kurz,  die  Sonne  ging  früh 
unter.  Hinter  dem  Kanal  sah  er  die  Station  der  Keihinkyuko‐Linie. 
Ein  roter  Zug  glitt  über  die  Gleise,  ein  Schnellzug  raste  vorbei.  Erst 
vor kurzem war er an diesem Bahnhof gewesen — ganz in der Nähe 
befand  sich  Mais  Apartment.  Jetzt  war  die  Station  in  schwaches 
weißes  Licht  getaucht.  Erstaunlich  wenige  Menschen  warteten  auf 
den Bahnsteigen. 
Ando ließ den Blick zu Mais Apartmentblock wandern. Er lag nur 
wenige  hundert  Meter  entfernt.  Die  Geschäftsstraße,  in  der  er  lag, 
kreuzte  die  Wanganstraße,  die  nach  rechts  abzweigte.  Nach  etwa 
hundert  Metern  stieß  man  dann  auf  das  Gebäude,  auf  dessen  Dach 
Ando gerade stand. 
Warum  war  Mai  ausgerechnet  auf  dieses  Dach  gestiegen?  Es  gab 
genug andere Dächer in der Nähe, ganz zu schweigen von dem ihres 
Apartmenthauses.  Worin  bestand  der  Unterschied  zu  diesem?  Noch 
immer ruhte sein Blick auf dem Haus, in dem sie gewohnt hatte. Auf‐
fällig war, dass es nicht einmal halb so hoch war wie dieses, obwohl 
es  immerhin  sechs  Stockwerke  hatte.  Vermutlich  waren  die  Decken 
niedriger.  In  der  Nähe  befanden  sich  fast  nur  Hochhäuser,  deshalb 
konnte man von den umliegenden Dächern auf das ihre herabblicken. 
Hier  dagegen  befanden  sich  vorwiegend  Lagerhäuser;  niemand 
konnte  beobachten,  was  oben  auf  dem  Dach  vor  sich  ging.  Das  war 
der einzige sichtbare Unterschied. 
Ando verließ den Vorsprung. Vorsichtig ging er zu den zwei Auf‐
sätzen hinüber. Im einen befand sich vermutlich der Maschinenraum 
des Fahrstuhls, im anderen der Entlüftungsventilator. Zudem thronte 
auf dem südlichen Teil des Gebäudes ein Wassertank. 
In  dem  engen,  dunklen  Spalt  zwischen  den  beiden  Kammern  ent‐
deckte  Ando  den  Entlüftungsschacht  —  Mais  Grab.  Langsam  setzte 
er  einen  Schritt  vor  den  anderen  und  blieb  kurz  vor  dem  düsteren 
Loch  stehen.  Der  Gitterrost  war  durchgebrochen.  Wenn  man  nicht 
aufpasste, konnte man leicht in den tiefen, düsteren Abgrund fallen. 
Ando  hielt  einen  gewissen  Sicherheitsabstand.  Der  Schacht  war  ihm 
sowieso  nicht  geheuer  —  immerhin  hatte  man  hier  die  Leiche  von 
Mai  gefunden.  Ängstlich  beugte  er  sich  vor  und  warf  den  Blumen‐
strauß hinein. Dann sprach er ein Gebet für Mai. 
Wäre gestern nicht zufällig ein Techniker gekommen, um den Fahr‐
stuhl zu überprüfen, hätte man Mais Leiche vermutlich nie gefunden. 
Plötzlich war es dunkel, das Dach in Finsternis getaucht. Der Wind 
peitschte  bedrohlich,  fast  Unheil  verkündend  durch  den  Spalt  zwi‐
schen den beiden Kammern. Ando zitterte am ganzen Leib. Jetzt be‐
reute er es, dass er nicht schon früher gekommen war, als die Sonne 
noch  am  Horizont  stand.  Doch  selbst  dann  hätte  er  nicht  den  Mut 
aufgebracht,  in  den  Schacht  hineinzusehen.  Allein  die  Vorstellung, 
dass  hier  bis  vor  wenigen  Stunden  Mais  Leiche  gelegen  hatte,  jagte 
ihm  einen  Schauer  über  den  Rücken.  Bei  lebendigem  Leib  in  diesem 
engen,  miefigen  schwarzen  Loch  begraben  ...  Das  Entsetzen,  als  sie  hinun‐
terstürzt... Den Knöchel gebrochen und nicht mehr in der Lage zu stehen ... 
Hilflos  dem  Schicksal  ausgeliefert,  hoch  übersieh  den  schmalen  Streifen 
Himmel ... Ihre Hoffnung auf Rettung nimmt jede Minute, jede Sekunde ein 
wenig mehr ab ... Andos Hals war wie zugeschnürt. 
Aus einer der Kammern dröhnte das laute Geräusch des Fahrstuhl‐
getriebes. Langsam ging Ando zurück, weil er es in dieser Enge nicht 
länger aushielt. Er blickte sich um. Auf den rauen Wänden der Kam‐
mern  reflektierte  das  matte  Abendlicht.  An  einigen  Stellen  war  der 
Putz abgeblättert. Hier lauerte die finstere Welt des Todes. 
Er lief etwas schneller, stieg hastig die Leiter hinunter. Da sich die 
letzte  Sprosse  etwa  einen  Meter  über  dem  Boden  befand,  sprang  er. 
Dabei  stellte  er  sich  nicht  sonderlich  geschickt  an  und  knickte  mit 
dem Fuß um. Fast wäre er gestürtzt. 
Rasch  begab  er  sich  zum  Aufzug.  Von  den  zwei  Fahrstühlen  war 
gerade einer auf dem Weg nach oben. Ando drückte auf die Taste. 
Während er wartete, fragte er sich wieder und wieder: Warum war 
Mai auf das Dach dieses Hauses gestiegen? Ando ging verschiedene 
Szenarien  durch.  Vielleicht  war  sie  vor  jemandem  weggelaufen? 
Nachts waren in dieser Gegend nicht viele Menschen unterwegs. Mai 
schlenderte  die  Straße  entlang,  irgendein  Kerl  sprach  sie  an.  Aus 
Angst,  einem  Triebtäter  begegnet  zu  sein,  flüchtete  sie  die  Außen‐
treppe hinauf. Da sie sehr sportlich war, kletterte sie problemlos über 
die abgeriegelte Tür, in der Hoffnung, dass ihr Verfolger diese Hürde 
nicht nehmen konnte. Doch sie täuschte sich: Er folgte ihr weiter. Ver‐
zweifelt  rannte  sie  nach  oben.  Eine  andere  Möglichkeit  zu  entkom‐
men, hatte sie nicht. Auf der dreizehnten Etage nahm sie die Notleiter 
und kletterte auf das Dach ... 
Seine  Gedanken  wurden  durch  das  Klingeln  des  Fahrstuhls  unter‐
brochen.  Die  Türen  öffneten  sich  —  und  Ando  stand  vor  einer  jun‐
gen, hübschen Frau — der Frau, die aus Mais Apartment gekommen 
war! Er starrte sie an, ohne einen klaren Gedanken fassen zu können, 
als hätte er die Befehlsgewalt über seinen Körper verloren. 
Was macht sie hier? 
Verzweifelt suchte Ando nach einer Antwort. Er wusste, dass seine 
Angst  vor  ihr  nachlassen  würde,  wenn  er  einen  plausiblen  Grund 
fände, weshalb sie hier war. 
Gerade  wollten  sich  die  Türen  schließen,  als  die  Frau  eine  Hand 
ausstreckte  —  keine  abrupte,  sondern  eine  ruhige,  gelassene  Bewe‐
gung. Sie trug einen blaugepunkteten Rock und hatte auch heute kei‐
ne Strümpfe an. In ihrer linken Hand hielt sie einen kleinen Blumen‐
strauß. 
Einen Blumenstrauß ... 
»Wir sind uns doch schon einmal begegnet«, sagte sie. Sie hatte eine 
bezaubernde  Stimme,  deren  Reiz  darin  lag,  dass  sie  recht  tief  war, 
obwohl die Frau sehr zierlich aussah. 
Ando stand mit halboffenem Mund da. Es dauerte eine Weile, bis er 
ein  paar  Worte  herausbrachte.  »Ah  ...  Sie  sind  bestimmt  die  Schwe‐
ster  von  Mai  Takano.«  Er  hoffte,  dass  sie  das  bestätigte,  denn  dann 
wären  alle  Unklarheiten  beseitigt  —  warum  sie  in  Mais  Wohnung 
gewesen war ... auf das Dach dieses Hauses wollte ... einen Blumen‐
strauß in der Hand hielt... 
Doch sie gab keine Antwort, nickte nicht, schüttelte aber auch nicht 
den  Kopf.  Man  konnte  das  als  ja  oder  Nein  interpretieren.  Ando 
entschied sich, es als Ja aufzufassen. 
Inzwischen kam er sich lächerlich vor, weil er Angst vor ihr gehabt 
hatte.  Aber  bei  ihrer  ersten  Begegnung  hatte  sie  wie  ein  übersinn‐
liches  Phänomen  auf  ihn  gewirkt,  eine  dunkle  Macht,  die  nicht  von 
dieser  Welt  stammte.  Doch  jetzt,  nachdem  das  Geheimnis  um  ihre 
Identität  gelüftet  war,  war  auch  ihre  düstere  Aura  verschwunden. 
Ando  fühlte  sich  sogar  auf  eine  gewisse  Weise  von  ihr  angezogen. 
Die  lange,  schmale  Nase,  die  weichen  Gesichtszüge,  die  halbmond‐
förmigen Augen strahlten eine unerhörte Sinnlichkeit aus. 
Die Augen ... 
Damals waren ihm ihre elektrisierenden, bezaubernden Augen ver‐
borgen geblieben, da sie eine Sonnenbrille getragen hatte. Doch heute 
sah er sie, und er hatte das Gefühl, als zögen sie ihn magisch an. Sein 
Herz begann wie wild zu klopfen. 
»Entschuldigen Sie ...«, sagte sie mit erhobener, strenger Stimme. 
Vermutlich  wollte  sie  wissen,  in  welcher  Beziehung  Ando  zu  Mai 
gestanden hatte. »Mein Name ist Ando. Ich arbeite an der Medizini‐
schen  Fakultät  der  Universität  K.«  Damit  hatte  er  allerdings  noch 
nichts über seine Verbindung zu Mai gesagt. 
Die  Frau  verließ  den  Fahrstuhl,  hielt  die  Tür  mit  einer  Hand  auf 
und gab Ando mit den Augen ein Zeichen, dass er einsteigen möge. 
Dabei  strahlte  sie  ein  Selbstbewusstsein  aus,  dass  Widerstand  un‐
möglich  machte.  Ihre  Aufforderung  folgend,  betrat  er  den  Aufzug. 
Abermals standen sie sich gegenüber. 
»Ich werde zu gegebener Zeit auf Sie zurückkommen.« Das waren 
ihre letzten Worte, bevor sich die Fahrstuhltüren schlossen. Hatte sie 
das tatsächlich gesagt? Ja, er hatte sich nicht verhört. 
Während  Ando  mit  dem  Aufzug  nach  unten  fuhr,  überfiel  ihn 
plötzlich  ein  heftiges  sexuelles  Verlangen.  Nachdem  seine  Familie 
zerbrochen  war,  war  Mai  die  erste  Frau  gewesen,  die  wieder  ero‐
tische  Gefühle  in  ihm  geweckt  hatte.  Aber  die  Begierde,  die  er  jetzt 
empfand, übertraf alles. Obwohl er diese Frau nur ein paar Minuten 
gesehen  hatte,  war  ihm  von  ihren  Füßen  bis  zu  den  Augen  jedes 
Detail in Erinnerung geblieben. 
Nur mit Mühe konnte Ando seine sexuellen Gelüste unter Kontrolle 
bringen. Unten auf der Straße winkte er ein Taxi heran und ließ sich 
nach Hause bringen. 
Ihre  letzten  Worte  hallten  in  seinen  Ohren  nach:  Ich  werde  zu  ge‐
gebener Zeit auf Sie zurückkommen. 
Was meint sie damit? Wo wird sie mich aufsuchen? Vermutlich hat sie das 
nur so dahingesagt ... 
Ando bereute es, sie nicht nach ihrer Telefonnummer gefragt zu ha‐
ben. Er hätte nur warten müssen, bis sie wieder unten gewesen wäre. 
Warum  er  es  nicht  getan  hatte,  verstand  er  selbst  nicht.  Es  lag  nicht 
daran, dass er nicht gewollt hätte ... Vielmehr war es ihm nicht möglich 
gewesen. 
Er  hatte  das  Gefühl,  dass  die  Frau  die  Kontrolle  über  sein  Ich 
übernommen hatte. 
 

 
Seit  Mais  Autopsie  war  eine  Woche  vergangen.  Der  Dezember 
brachte  einen  plötzlichen  Wetterumschwung.  Über  Nacht  wurde  es 
bitterkalt. Ando mochte diese Jahreszeit überhaupt nicht, umso mehr 
liebte er den Frühling und den Sommer. Doch nach dem Tod seines 
Sohnes war ihm selbst das gleichgültig geworden. Erst die beißende 
Kälte  am  Morgen  ließ  ihn  realisieren,  dass  bereits  Winter  war.  Auf 
dem Weg zur Universität blieb er mehrfach stehen und überlegte, ob 
es nicht besser wäre, umzukehren und einen warmen Pullover zu ho‐
len. Am Ende siegte seine Faulheit. Außerdem war ihm während des 
Gehens allmählich warm geworden. Von seiner Wohnung in Sangu‐
bashi  konnte  man  bequem  bis  zur  Universitätsklinik  laufen,  es  war 
nicht  allzu  weit.  Da  die  Verkehrsverbindung  miserabel  war,  kam  es 
nicht selten vor, dass Ando zu Fuß ging. Zudem tat etwas Bewegung 
gut.  Eigentlich  hatte  er  auch  heute  laufen  wollen,  doch  unterwegs 
entschied  er  sich  spontan  für  die  Bahn  und  nahm  ab  Yoyogi  die  JR‐
Linie. Er wollte möglichst schnell in seinem Büro sein. 
Am  Vormittag  würde  er  sich  mit  Miyashita  und  Nemoto,  einem 
Experten auf dem Gebiet der Elektronenmikroskopie, die Zellen von 
Ryuji  und  Mai  anschauen.  Er  konnte  es  kaum  erwarten,  das  Virus 
endlich mit eigenen Augen zu sehen. 
Interessanterweise  war  bisher  kein  Fall  bekannt  geworden,  der 
nicht in irgendeiner Weise mit dem Video in Verbindung stand. Auch 
in Mais Apartment hatte Ando eine Kassette gefunden. Zwar war die 
Aufnahme größtenteils überspielt worden, aber sie war zweifellos ein 
Ableger  des  Killervideos,  das  Asakawa  in  B‐4  in  Süd‐Hakone  ent‐
deckt  hatte.  Bestimmt  waren  auch  Mais  Zellen  von  dem  pocken‐
ähnlichen Virus befallen. 
Fast wäre Ando zu weit gefahren. Im letzten Moment sprang er aus 
dem  Zug.  Mit  der  Menschenmenge  drängte  er  sich  durch  den 
Bahnhof.  Gleich  davor  ragte  der  imposante  Bau  des  Universitäts‐
klinikums auf. 
Ando  steckte  den  Kopf  durch  die  Tür.  Mit  knallrotem  Gesicht  sah 
Miyashita ihn an. »Ich habe schon auf dich gewartet.« 
Die ganze letzte Woche über hatten Miyashita und Nemoto bis zum 
Hals  in  den  Vorbereitungen  gesteckt.  Mehrere  Schritte  waren  not‐
wendig,  bevor  die  Zellen  unter  dem  Mikroskop  betrachtet  werden 
konnten.  Vor  allem  die  Probenvorbereitung  war  aufwändig:  die 
Fixierung, um die Probe realistischer darzustellen, die Dehydrierung, 
die Einbettung, um das Gewebe sektionieren zu können, die Auftei‐
lung der Probe in dünne Scheiben und so weiter. Tagelang hatten sie 
sich damit herumgeschlagen. 
Ando hatte ihnen dabei nicht unter die Arme greifen können — das 
alles  lag  außerhalb  seines  Kompetenzbereichs.  Er  hätte  nur  im  Weg 
gestanden. 
Miyashitas glänzende Augen zeigten seine Vorfreude. Sehnsüchtig 
hatte  er  auf  diesen  Moment  gewartet.  Heute  Morgen  waren  die 
letzten Vorarbeiten verrichtet worden. 
»Könnten  Sie  bitte  das  Licht  ausschalten?«,  sagte  Nemoto  zu 
Miyashita. 
»Natürlich«, entgegnete Miyashita und machte die Halogenlampen 
aus.  Die  Erregung  stand  ihm  ins  Gesicht  geschrieben.  Zwar  war  die 
Basenfolge  des  Virus  entschlüsselt,  doch  in  wenigen  Momenten 
würden sie das Killervirus zum ersten Mal sehen. 
Nemoto  begab  sich  in  die  Dunkelkammer.  Mit  geschickten  Hand‐
griffen  steckte  er  die  Probe  in  die  Halterung  des  Elektronenmikro‐
skops. Zwischen Miyashita und Ando fiel kein Wort. Erwartungsvoll 
starrten beide auf den Computerbildschirm, der mit dem Mikroskop 
verbunden  war.  Doch  noch  war  auf  dem  Monitor  nichts  zu  sehen. 
Die Spannung stieg ins Unermessliche. In Gedanken zogen die Bilder 
des Virus bereits an ihren leuchtenden Augen vorbei. 
Nach einer Weile gesellte sich Nemoto wieder zu ihnen. Die letzte 
Lichtquelle wurde ausgeschaltet. Endlich war es so weit. 
Voller  Erwartung  richteten  sich  drei  Augenpaare  auf  den  Bild‐
schirm, auf dem sich die spannende Mikroweit auftat. 
»Wessen Zellen sind das?«, fragte Miyashita erregt. 
»Die von Ryuji Takayama.« 
Als Nemoto die entsprechende Taste betätigte, fixierte der Laser die 
Zelle. Wo hatte sich das Virus nur versteckt? 
»Können Sie das Bild bitte etwas vergrößern?«, fragte Miyashita. 
Nemoto  vergrößerte  das  Bild  um  das  Neuntausendfache.  Die  ab‐
sterbenden  Zellen  reflektieren  in  seinen  Augen.  Das  Zytoplas‐ma 
wies eine blassrötliche Färbung auf. Die anderen Bestandteile waren 
schwarz — sie waren eindeutig beschädigt. 
»Bitte  fokussieren  Sie  das  Zytoplasma  oben  rechts.  Können  Sie  es 
vergrößern?«  Diesmal  spiegelten  sich  die  schwarzen  Flecken  der 
sterbenden Zellen auf Miyashitas Gesicht wider. Es leuchtete wie eine 
harte Bronzemaske. Nemoto vergrößerte das Bild um das Sechzehn‐
tausendfache. »Das reicht noch nicht.« 
Einundzwanzigtausendfach. 
»Stopp!«, sagte Miyashita laut. Er blickte kurz zu Ando hinüber, der 
das  Gesicht  so  dicht  an  den  Bildschirm  brachte,  dass  er  ihn  fast  mit 
der Nase berührt hätte. 
Es wimmelte nur so von Viren. 
Mit der einundzwanzigtausendfachen Vergrößerung erschienen die 
Erreger wie tausende sich bewegende Schlangen. 
Ando lief ein kalter Schauer über den Rücken. Diese Art von Virus 
hatte er noch nie zuvor gesehen. Ekel ergriff ihn. Zwar hatte er auch 
noch  nie  ein  Pockenvirus  unter  dem  Mikroskop  beobachtet,  doch 
immerhin  kannte  er  es  von  Abbildungen  in  Fachbüchern.  Aber  was 
er  hier  zu  Gesicht  bekam,  war  etwas  ganz  anderes.  Die  Form  dieses 
Virus unterschied sich grundlegend von der des Pockenvirus. 
»Ich kann es nicht fassen.« Miyashita atmete tief durch. 
Ando  stellte  sich  Folgendes  vor:  Zunächst  drang  das  Virus  in  den 
Organismus ein, bahnte sich dann einen Weg über den Blutkreislauf 
zu  den  Herzkranzgefäßen  und  verursachte  dort  ein  Geschwür  ... 
Dieser  Vorgang  war  ihm  zwar  nicht  fremd,  doch  konnte  er  beim 
besten Willen nicht nachvollziehen, dass er durch die übernatürlichen 
Kräfte einer Frau ausgelöst worden sein sollte. Allein die Vorstellung, 
dass  dieses  Virus  durch  das  Betrachten  eines  Videos  in  den  Körper 
eindrang,  ließ  ihm  die  Haare  zu  Berge  stehen.  Im  Körper  angekom‐
men, trieb das Virus eine Woche lang sein Unwesen, bis es den Orga‐
nismus schließlich zugrunde richtete. 
Ob  bei  der  Entstehung  der  Erde  auch  eine  Art  Bewusstseinseinwirkung 
mit im Spiel war? Andos Gedanken begannen eben abzuschweifen, als 
Miyashita sagte: 
»Was hältst du von dem Namen ›Ring‹?« 
Ando  blickte  auf  den  Bildschirm.  Sofort  war  ihm  klar,  worauf 
Miyashita  abzielte.  Das  Virus  ähnelte  ...  Manche  Viren  hatten  zwar 
eine  birnenförmige  Gestalt,  aber  die  Mehrheit  erinnerte  an  einen 
Ring.  Ja,  einen  passenderen  Namen  gab  es  nicht.  Da  Miyashita  und 
Ando das Virus entdeckt hatten, konnten sie ihm auch einen Namen 
geben — das Ring‐Virus. 
»Sag schon, wie findest du das?«, hakte Miyashita nach. 
Einen zutreffenderen Namen gab es zwar nicht, aber er jagte Ando 
auf eine gewisse Weise Angst ein. Er dachte daran, wie alles angefan‐
gen hatte — mit den mysteriösen Zahlen 1, 7, 8, 1, 3,6, die auf einem 
Stück Zeitung standen, das in Ryujis Bauch gesteckt hatte. Ein Kode, 
und das Lösungswort ›Ring‹. 
In der Mikroweit gab es durchaus schöne Dinge, doch was sie hier 
sahen, war genau das Gegenteil: widerlich, hässlich. Eine abgrundtief 
finstere  Welt  offenbarte  sich  ihnen.  Andos  Ekel  resultierte  jedoch 
nicht vorwiegend aus der Tatsache, dass das Virus den Menschen auf 
grauenvolle  Weise  angriff,  sondern  weil  er  Schlangen  verabscheute 
— und an Schlangen erinnerte das Virus. Aber auch unvoreingenom‐
mene Menschen hätten diesen Anblick widerwärtig gefunden. 
Bestes  Beispiel  dafür  war  Nemoto.  Obwohl  er  Derartiges  gewohnt 
war,  zitterten  seine  Hände,  während  er  das  Virus  abfotografierte. 
Nachdem er sieben Bilder geschossen hatte, brachte er sie in die Dun‐
kelkammer zur Entwicklung. Anschließend steckte er einen anderen 
Objektträger  in  die  Halterung  des  Elektronenmikroskops.  »Das  sind 
Mai Takanos Zellen.« 
Schnell hatten sie das Virus nach einigen Vergrößerungen auch hier 
entdeckt.  Ohne  Zweifel,  es  war  derselbe  Erreger.  Wie  bei  Ryuji 
wimmelte es nur so davon. 
»Es ist dasselbe Virus«, riefen Ando und Miyashita gleichzeitig. In 
ihren Augen war es mit dem in Ryujis Blut nachgewiesenen Virustyp 
identisch. 
Doch Nemoto entdeckte einen geringfügigen Unterschied zwischen 
beiden.  »Merkwürdig  ...«  Nachdenklich  fasste  er  sich  ans  Kinn  und 
legte den Kopf zur Seite. 
Miyashita hakte nach: »Was ist merwürdig?« 
»Das  kann  ich  nicht  genau  sagen,  ohne  mir  vorher  die  Fotos  in 
Ruhe angesehen zu haben.« Nemoto war nicht der Typ, der aufgrund 
seines ersten Eindrucks Spekulationen aufstellte. Erst mussten Bewei‐
se vorliegen, dann bildete man eine Theorie. Der Unterschied, den er 
bemerkt zu haben glaubte, lag offenbar in der Anzahl der verschiede‐
nen  Typen  des  Virus.  Verglichen  mit  Ryujis  Viren  wies  ein  Großteil 
der  in  Mais  Zellen  nachgewiesenen  eine  andere  Form  auf.  Die  Zahl 
derer,  die  keinen  Ring  darstellten,  war  wesentlich  höher.  Ihre  Form 
erinnerte an einen zerbrochenen Ring — es war fadenförmig. 
Um  seinen  Eindruck  zu  überprüfen,  fokussierte  Nemoto  einen 
fadenförmigen  Erreger.  Der  ›Stein‹  des  Rings  war  der  kleine  Kopf, 
zudem hatte es einen Schwanzanhang. 
Als sie das Virus auf dem Monitor sahen, dachten alle drei an das 
Gleiche. Aber keiner von ihnen brachte es über die Lippen. 
 

 
Nemotos  erster  Eindruck  war  durch  den  Vergleich  der  Fotos 
bestätigt worden. Das in Mais Blut nachgewiesene Virus hatte über‐
wiegend  eine  andere  Form:  Der  Ring  war  in  der  Mitte  ›zerbrochen‹. 
Die  Statistik  besagte,  dass  die  Viren  in  Ryujis  Blut  lediglich  zu  zehn 
Prozent  diesem  Typ  angehörten.  Bei  ihm  überwog  der  ringförmige 
Virustyp — er machte neunzig Prozent aus. Bei Mai war das Verhält‐
nis  fünfzig  zu  fünfzig.  Warum?  Das  musste  eine  besondere  Bedeu‐
tung haben, da war Ando sicher. Deshalb ließ er die Zellen aller Per‐
sonen,  die  durch  das  Betrachten  des  Videos  ums  Leben  gekommen 
waren, mit dem Elektromikroskop untersuchen. 
Die  Ergebnisse  lagen  Anfang  des  neuen  Jahres  vor,  genauer  am 
Freitag  der  ersten  Januarwoche.  Kaum  hatte  man  Ando  dies  mitge‐
teilt, machte er sich auch schon auf den Weg zum Labor. Schnee be‐
deckte den Schreinpark wie ein weißer Schleier. 
Die zahlreichen Fotos miteinander zu vergleichen war ziemlich an‐
strengend.  Doch  Miyashita  gönnte  Ando  keine  ruhige  Minute.  Gna‐
denlos legte er ein Bild nach dem anderen auf den Tisch. 
Ando zog in Gedanken ein Zwischenresümee: Das Video hatte ein‐
schließlich Asakawas und Ryujis elf Menschen getötet. Bei allen war 
das Ring‐Virus im Blut entdeckt worden. Damit stand eindeutig fest: 
Dieser  neue,  noch  nicht  erforschte  Erreger  hatte  ihren  Tod  bewirkt. 
Außerdem hatten sie herausgefunden, dass es zwei verschiedene Ty‐
pen gab: ein fadenförmiges und ein ringförmiges Virus. Ersteres kam 
erstaunlicherweise  nur  bei  Asakawa  und  Mai  zu  einem  hohen  pro‐
zentualen Anteil vor, nämlich zu mehr als fünfzig Prozent. Bei allen 
anderen Toten machte dieser Typus höchstens zehn Prozent aus. Ihre 
Zellen waren hauptsächlich von dem ringförmigen Virus befallen. 
Was bedeutete das? Für Ando gab es nur eine Erklärung. Die Frage 
zwischen  Leben  und  Tod  schien  vom  Charakter  des  Virus  abzuhän‐
gen.  Trat  der  fadenförmige  Virus  zu  einem  bestimmten  Prozentsatz 
auf, entstand kein Geschwür an den Gefäßwänden, und es kam in der 
Folge nicht zu einem Herzinfarkt. Nur, wo  lag die Grenze zwischen 
Leben  und  Sterben?  Darauf  wusste  Ando  keine  Antwort.  Das  stand 
noch in den Sternen. 
Sowohl  Mai  als  auch  Asakawa  hatten  sich  das  mörderische  Video 
angeschaut. Durch  ihre Sinnesorgane war das Virus in ihren Körper 
eingedrungen. Bis zu diesem Punkt unterschieden sie sich nicht von 
den anderen neun Personen. Aber aus irgendeinem Grund vermehrte 
sich nur das fadenförmige Virus explosionsartig, bis es schließlich die 
Zahl der ringförmigen Viren überstieg. Das musste der Grund gewe‐
sen  sein,  weshalb  Mai  und  Asakawa  nicht  an  einem  Herzinfarkt  ge‐
storben  waren.  Doch  warum  war  es  nur  in  ihren  Organismen  zu 
dieser rasanten Vermehrung des fadenförmigen Erregers gekommen? 
Worin hatten sie sich von den anderen unterschieden? 
»Ob es vielleicht am Immunsystem liegt?«, fragte Ando. 
Miyashita  neigte  den  Kopf  leicht  zur  Seite.  »Am  Immunsystem? 
Hm.« 
»Oder ...« Ando brachte es nicht über die Lippen. 
»Oder was?« 
»Oder am Virus selbst.« 
»Ich denke, das trifft schon eher zu«, sagte Miyashita seufzend. Er 
legte  die  Füße  auf  einen  Stuhl.  »Wenn  ich  mir  die  ganze  Sache  jetzt 
noch  mal  durch  den  Kopf  gehen  lasse  ...  Die  vier  Jugendlichen,  die 
das  Video  als  Erste  sahen,  löschten  den  Zauberspruch  aus  Jux  und 
Tollerei. Damit war das Video dem Untergang geweiht. Es musste ei‐
nen neuen Weg finden, um zu überleben. Die Lösung: eine genetische 
Mutation  als  Grundlage  für  die  Evolution.  Bis  hierher  hat  uns  Ryuji 
mit seiner Nachricht auf die Sprünge geholfen. Doch die entscheiden‐
de  Frage  ist:  Welche  Mutation  entstand?  Der  Schlüssel  zur  Antwort 
muss  in  dem  Ring‐Virus  von  Asakawa  und  Mai  liegen  ...  Die  Form 
des Virus hat sicher eine Bedeutung.« 
»Viren dringen von außen in den Organismus eines Menschen ein, 
überfallen  dort  das  Zellgewebe.  Sie  zwingen  es,  neue  Erreger  zu 
erzeugen. Aus eigener Kraft können Viren das nicht.« 
»Das ist richtig.« 
»Manchmal  kommt  es  sogar  zu  einer  explosionsartigen  Vermeh‐
rung.« 
»Dafür gibt es zahlreiche Beispiele: die Pest im Mittelalter in Euro‐
pa. Oder die Spanische Grippe. Wie ein Flächenbrand haben sich die 
Erreger da verbreitet und Millionen Menschen in den Tod gerissen.« 
»Und?«, fragte Miyashita. 
»Denk doch mal nach. Wer innerhalb einer Woche, nachdem er sich 
das  Video  angesehen  hat,  keine  Kopie  zieht  und  sie  einer  anderen 
Person zeigt, stirbt — so hatte Asakawa gefolgert. Aber selbst wenn 
diese  Anweisung  befolgt  wurde  ...  Der  Vermehrungsprozess  würde 
nur sehr langsam vonstatten gehen.« 
»Du hast Recht. Das ist ein wichtiger Gedanke.« 
»Damit wäre doch die eigentliche Intention vollkommen verfehlt.« 
»Willst  du  damit  sagen,  das  dies  nicht  dem  Ziel  eines  Virus  ent‐
spricht?« 
»Du hast es erfasst. Man muss sich immer wieder den wesentlichen 
Charakter  eines  Virus  vor  Augen  halten:  Sein  ›Erfolg‹  hängt  von 
seinem Verbreitungsmechanismus ab.« 
»Drück dich mal etwas genauer aus. Worauf spielst du an?« Miya‐
shita  blickte  Ando  fest  in  die  Augen,  ohne  den  Blick  auch  nur  eine 
Sekunde abzuwenden. 
»Es  ist  nur  so  eine  ...«  Ando  wusste  selbst  nicht  so  recht,  was  er 
eigentlich sagen wollte. Vielleicht sah er die Dinge in einem zu nega‐
tiven Licht. Doch immerhin gab es in der Geschichte der Menschheit 
mehrere Fälle, bei denen die Rasanz, mit der sich ein Erreger ausbrei‐
tete,  katastrophale  Folgen  hatte.  Allgemein  waren  Viren  von  einer 
teuflischen Überlebensstrategie getrieben. 
Ging  man  von  dieser  Hypothese  aus,  war  der  Kopierprozess  des 
Ring‐Virus absolut ineffizient, und das entbehrte jeglicher Logik. Die 
Gefahr,  sofort  wieder  ausgerottet  zu  werden,  war  viel  zu  groß.  Tat‐
sächlich war das Virus ja auch nach nur drei Monaten von der Bild‐
fläche  verschwunden.  Irgendetwas  stimmte  nicht.  Andos  innere 
Stimme sagte ihm, dass es durch Mutation mit verheerender Gewalt 
zurückkommen würde ... Eine schreckliche Vorahnung ergriff ihn. 
Erneut  blickte  er  auf  das  Foto  mit  dem  Ring‐Virus.  Tausende  Ekel 
erregende Viren türmten sich übereinander. Sadako Yamamura hatte 
ihre  genetischen  Informationen  durch  Einsatz  ihrer  übersinnlichen 
Kräfte  in  dieser  Welt  zurückgelassen  —  verschlüsselt  in  dem  Video. 
Ando  hatte  das  Gefühl,  dass  sich  irgendwo  ein  schlimmes  Unheil 
zusammenbraute. Eine Katastrophe raste auf sie zu ... 
Eine groteske Welt. Andere Worte gibt es dafür nicht. Seit Ando Ryujis 
Leiche obduziert hatte, war er in einer bizarren Welt gefangen. Angst 
ergriff  ihn,  wenn  er  daran  dachte,  was  Mai  wohl  geboren  hatte.  Sie 
war bereits seit eineinhalb Monaten tot, und noch immer wussten sie 
nicht,  was sie  zur  Welt  gebracht  hatte.  Sicherlich  kein  süßes,  kleines 
Baby. 
»Nun  mach  nicht  so  ein  Gesicht«,  sagte  Miyashita.  »Du  siehst  das 
alles  viel  zu  negativ.  Wir  wissen  doch  gar  nicht,  ob  tatsächlich  eine 
neue,  gefährliche  Form  entstanden  ist.  Vielleicht  hat  die  Mutation  ja 
auch  zu  einer  harmlosen  Variante  geführt.  Oder  das  mutierte  Virus 
passte nicht in die Umwelt.« 
»Willst  du  damit  andeuten,  dass  die  neue  Art  schon  wieder  aus‐
gerottet sein könnte?« 
»Man kann es zumindest nicht ausschließen.« 
»Du bist wirklich ein Optimist.« 
»Denk an die Spanische Grippe 1918. Sie wütete in vielen Teilen der 
Erde,  und  ein  Jahr  später  war  sie  auf  einen  Schlag  verschwunden. 
Zwanzig  bis  fünfzig  Millionen  Menschen  hatte  sie  getötet.  1977 
entdeckte  man  denselben  Erreger  in  Amerika,  doch  dieses  Mal 
forderte  er  kein  einziges  Todesopfer.  Das  Virus  war  mittlerweile 
völlig harmlos. Es hatte keine negativen Auswirkungen mehr auf den 
Menschen.« 
»Du  meinst,  so  wie  Mutationen  Viren  zu  Killern  machen  können, 
können  sie  andererseits  auch  dazu  führen,  dass  ein  gefährlicher 
Erreger sein bedrohliches Potenzial verliert.« 
Tatsächlich waren nach dem Fund von Mais Leiche keine weiteren 
mysteriösen  Todesfälle  entdeckt  worden.  Zumindest  hatten  die 
Medien  nichts  gebracht.  Ando  hatte  seine  Beziehungen  zur  Polizei 
spielen lassen, war aber bis jetzt bei seiner Recherche auf keine neuen 
Informationen  gestoßen.  Vielleicht  hatte  Miyashita  Recht,  und  das 
neue Virus hatte in dieser Umwelt nicht überleben können. 
»Hast du eine Idee, was uns jetzt noch weiterbringen könnte?« 
Miyashita  wirbelte  in  seinem  Drehstuhl  herum.  »Es  gibt  da  in  der 
Tat  etwas  ...  Um  eines  haben  wir  uns  bisher  noch  nicht  weiter 
gekümmert.« 
»Und zwar?« 
»Wir  wissen  nicht,  wann  und  wo  Mai  Takano  mit  dem  Video  in 
Berührung kam.« 
»Ist das denn so wichtig?« 
»Mich  interessiert  es  schon.  Ich  denke,  es  wäre  durchaus  hilfreich, 
wenn wir zumindest das Datum wüssten.« 
Diese Spur hätte Ando schon viel früher verfolgen sollen, aber die 
Analyse  des  Virus  hatte  ihm  den  letzten  Nerv  geraubt.  Doch  im 
Moment mussten sie sich an jedem Strohhalm festklammern. 
Mai  war  irgendwie  über  Ryuji  an  das  Video  gelangt.  Eine  andere 
Möglichkeit  gab  es  nicht.  Die  entscheidende  Frage  war:  Wann  und 
wo hatte sie es in ihre Finger bekommen? Wenn sie in diesem Punkt 
Klarheit bekamen, würden sie der Lösung der rätselhaften Todesserie 
vielleicht ein Stück näher kommen. 
 

 
Schließlich fand Ando heraus, wo Mai das mysteriöse Video herhat‐
te.  Ein  paar  Tage  nach  Ryujis  Tod  waren  seine  persönlichen  Sachen 
aus seinem Apartment in Higashi Nakano zu seinen Eltern gebracht 
worden. Für Ando war damit klar: Mai konnte das Band nur hier in 
die  Finger  bekommen  haben.  Und  tatsächlich:  Ein  Anruf  bei  Ryujis 
Eltern brachte Gewissheit. 
Ryujis  Mutter  hatte  gleich  Vertrauen  gefasst,  als  sie  hörte,  dass 
Ando ein ehemaliger Kommilitone ihres Sohnes war. Das machte die 
Sache  einfacher.  Unverblümt  fragte  er,  ob  Mai  Takano  vor  einiger 
Zeit bei ihnen gewesen sei. 
»Ja, sie war hier«, antwortete die Mutter. 
Anhand  ihres  Haushaltsbuches,  in  dem  der  Kassenzettel  für  einen 
Kuchen  steckte,  konnte  sie  Ando  sogar  das  genaue  Datum  nennen: 
der 1. November. Er markierte sich den Tag in seinem Kalender. 
»Was  war  der  Grund  für  ihren  Besuch?«,  bohrte  Ando  höflich 
weiter. 
Mai hatte stets Ryujis handgeschriebene Artikel abgetippt und war 
auf  der  Suche  nach  fehlenden  Seiten  des  letzten  Aufsatzes  gewesen, 
erklärte die Mutter. 
Ando ließ sich Verlag und Titel der Zeitschrift geben, in der Ryujis 
wissenschaftliche  Abhandlungen  veröffentlicht  wurden.  Nach  einer 
kurzen  Verabschiedung  legte  Ando  rasch  auf.  Er  wollte  um  alles  in 
der  Welt  vermeiden,  dass  Ryujis  Mutter  sich  nach  Mais  Befinden 
erkundigte ... 
Obwohl  Ando  längst  aufgelegt  hatte,  ruhte  seine  Hand  noch  auf 
dem Telefon. Am 1. November... An diesem Tag hat Mai also das Haus der 
Takayamas  aufgesucht.  Sie  durchstöberte  Ryujis  Sachen  in  der  Hoffnung, 
die Seiten zu finden. Da muss ihr das Video in die Hände gefallen sein. Aus 
irgendeinem Grund übte es eine derartige Anziehungskraft auf sie aus, dass 
sie es mit nach Hause nahm. Wahrscheinlich hat sie es sich noch am selben 
Tag angesehen. 
Ando  ging  zunächst  von  der  Hypothese  aus,  dass  alles  am  1. 
November begonnen hatte. An diesem Tag war das Virus in sie ein‐
gedrungen. Das bedeutete, am 8. November musste mit ihrem Körper 
etwas  Merkwürdiges  passiert  sein.  Ando  war  für  den  9.  November 
mit ihr verabredet gewesen, doch Mai war nicht erschienen und auch 
nicht ans Telefon gegangen. Dafür gab es nur zwei Erklärungen: Sie 
war  zwar  zu  Hause,  aber  in  einem derart  schlechten  Zustand  gewe‐
sen, dass sie sich nicht zum Telefon schleppen konnte. Oder sie hatte 
zu diesem Zeitpunkt bereits in dem Entlüftungsschacht gelegen. 
Die  Autopsie  bestätigte  diese  zweite  These.  Laut  den  Untersu‐
chungsergebnissen war Mai um den 20. November herum gestorben. 
Der Pathologe vermutete, dass sie ungefähr zehn Tage vor ihrem Tod 
in  den  Schacht  gefallen  war,  also  am  8.  oder  9.  November.  Alles 
passte zusammen. 
Ando machte sich auf den Weg zur Bibliothek. In der Zeitschriften‐
ecke  suchte  er  nach  der  Monatsausgabe,  in  der  Ryujis  Artikel  veröf‐
fentlicht worden war. Ohne lange suchen zu müssen, fand er sie. Die 
Zeitschrift ist am 20. November erschienen ... Die letzte Folge von ›Struktur 
des  Wissens‹.  Damit  war  Ando  einen  großen  Schritt  weiter.  Mai  hat 
Ryujis  Artikel  also  noch  überarbeitet  und  dem  Redakteur  der  Zeitschrift 
zukommen lassen. Zwischen dem Betrachten des Videofilms und ihrem 
Tod hatte sie demnach mindestens mit einer Person Kontakt gehabt. 
Ando  rief  bei  dem  Verlag  an  und  vereinbarte  mit  dem  verant‐
wortlichen Redakteur einen Gesprächstermin. 
 
An der Suidobashi‐Station der JR‐Linie stieg Ando aus. Mit schnel‐
len  Schritten  näherte  er  sich  seinem  Ziel.  Nach  ungefähr  fünf  Geh‐
minuten  ragte  das  zehnstöckige  Gebäude  des  S‐Shogo  Verlags  vor 
seinen Augen auf. Am Empfang bat Ando eine Dame, den Redakteur 
der  Monatszeitschrift  Choryu,  Herrn  Kimura,  über  seine  Ankunft  in 
Kenntnis zu setzen. Auf und ab gehend, wartete er nervös auf seinen 
Gesprächspartner. Zu seiner Erleichterung hatte es sich als nicht pro‐
blematisch  herausgestellt,  einen  Termin  zu  bekommen.  Der  Stimme 
am  Telefon  nach  zu  urteilen,  musste  Kimura  um  die  zwanzig  Jahre 
alt  sein.  Andererseits  hatte  er  sich  jedoch  sehr  gewählt  ausgedrückt. 
Dies  ließ  auf  einen  soliden,  charakterstarken  Menschen  schließen. 
Aus diesem Grund stellte Ando sich vor, dass ihm gleich ein junger, 
attraktiver Mann mit moderner Brille entgegenkommen würde. 
Doch  der  Mann,  der  dann  erschien,  entsprach  in  keinster  Weise 
dieser  Vorstellung.  Kimura  hatte  eine  kräftige, untersetzte Figur  mit 
Bauchansatz.  Die  karierte  Hose  mit  Hosenträgern  untermalte  seine 
Fettleibigkeit  noch.  Trotz  der  winterlichen  Kälte  glitzerten  Schweiß‐
perlen auf seinem schütteren Haupt. Wenn man nach dem Aussehen 
ging,  konnte  man  sich  nur  schwer  vorstellen,  dass  dieser  Mann 
Redakteur  einer  intellektuellen  Monatszeitschrift  eines  so  bekannten 
Verlags war. 
»Es  tut  mir  Leid,  dass  ich  Sie  warten  ließ.«  Mit  einem  breiten 
Grinsen  zog  er  eine  Visitenkarte  aus  seiner  Brieftasche.  Über  dem 
Namen  ›Satoshi  Kimura‹  stand  ›Stellvertretender  Chefredakteur‹. 
Kimura  war  wesentlich  älter,  als  Ando  ihn  am  Telefon  geschätzt 
hatte. Er ging wohl auf die Vierzig zu. 
Auch  Ando  überreichte  seine  Visitenkarte.  »Haben  Sie  herzlichen 
Dank, dass Sie sich für mich Zeit genommen haben. Ich weiß, dass Sie 
sehr  beschäftigt  sein  müssen.  Wollen  wir  nicht  in  ein  Cafe  gehen? 
Dort können wir uns in Ruhe unterhalten«, schlug Ando vor. 
»Hier  in  der  Nähe  gibt  es  leider  kein  gutes  Cafe.  Wenn  es  Ihnen 
recht ist, können wir uns in unsere Launch setzen.« 
»Sehr gern.« 
Die Launch befand sich im obersten Stockwerk  des Gebäudes und 
war sehr stilvoll, ja elegant eingerichtet. Hier und da saßen bekannte 
Persönlichkeiten  auf  den  weichen  Sofas.  So  manches  Gesicht  hatte 
Ando schon in Magazinen und Zeitungen gesehen. 
An diesem Ort trafen Schriftsteller und Redakteure zu Gesprächen 
zusammen.  Einige  liefen  mit  einem  Manuskript  unter  dem  Arm 
durch den Raum. 
»Es ist ein Jammer, dass dieser Mensch von uns gegangen ist.« 
Ando war von den berühmten Persönlichkeiten so fasziniert gewe‐
sen, dass er sich hatte ablenken lassen. Doch nun konzentrierte er sich 
wieder  auf  seinen  Gesprächspartner.  Ruhig  blickte  er  Kimura  an. 
»Ryuji  Takayama  war  ein  alter  Studienkollege  von  mir.  Gemeinsam 
haben wir uns durch das Medizinstudium gequält.« 
Ando  verfolgte  mit  diesem  Satz  eine  bestimmte  Intention.  Bisher 
war er immer gut damit gefahren, den Leuten, die mit Ryuji in Kon‐
takt  standen,  von  seiner  persönliche  Beziehung  zu  ihm  zu  erzählen. 
Häufig öffneten sie sich ihm daraufhin. 
»Verstehe. Sie waren also mit Dr. Takayama ...« Kimura warf einen 
Blick auf Andos Visitenkarte. Der Name der Universität, an der Ando 
als  Dozent  tätig  war,  schien  ihm  noch  von  Ryuji  in  Erinnerung  zu 
sein. Dies verriet sein Nicken. 
»Ich habe Ryujis Leiche obduziert.« 
Kimura  machte  große  Augen.  Das  Kinn  nach  vorne  streckend, 
seufzte  er:  »Das  ist  ja  ...«  Er  riskierte  einen  raschen  Blick  auf  Andos 
Finger, die gerade die Kaffeetasse hielten. 
»Doch ich bin nicht gekommen, um mit Ihnen über Ryuji  zu spre‐
chen.« Ando stellte die Tasse ab und legte die Hände auf den Tisch. 
»Worüber dann? Wie kann ich Ihnen helfen?« 
»Ich  würde  Ihnen  gern  einige  Fragen  über  Ryuji  Takayamas 
Studentin Mai Takano stellen.« 
Als  der  Name  Mai  fiel,  erschien  ein  sanftes  Lächeln  auf  Kimuras 
Gesicht. Gespannt beugte er sich vor. »Mai? Was ist mit ihr?« 
Offensichtlich weiß er noch gar nicht, dass sie tot ist. Aber früher oder spä‐
ter  wird  er  es  ohnehin  erfahren.  »Sie  wissen  also  nicht,  dass  Mai  ... 
gestorben ist?« 
Kimura  war  sichtlich  geschockt.  Ein  tiefer,  merkwürdiger  Seufzer 
entrang sich ihm, und seine Miene veränderte sich schlagartig. Seine 
Reaktion  war  so  heftig,  dass  es  fast  grotesk  wirkte.  »Was?  Mai  tot? 
Nein, dass wusste ich nicht. Wie furchtbar!« 
»Sie ist im November in einen Entlüftungsschacht gefallen, aus dem 
sie sich nicht mehr befreien konnte. Dort ist sie gestorben.« 
»Jetzt  verstehe  ich  auch,  warum  ich  sie  die  ganze  Zeit  nicht  er‐
reichen konnte.« 
Ando  empfand  Kimura  gegenüber  plötzlich  große  Sympathie.  Of‐
fensichtlich  schien  er  genauso  zu  empfinden  wie  er.  Zwar  wusste 
Ando nicht, ob Kimura verheiratet war, aber eines stand fest: Er hatte 
Mai gemocht. 
»Können Sie sich noch daran erinnern, wann Sie Mai das letzte Mal 
gesehen haben?«, fragte Ando, bevor Kimura sich seiner Bestürzung 
ganz hingeben konnte. 
»Das muss Anfang November gewesen sein. Ich saß gerade an den 
Vorbereitungen für die Januar‐Ausgabe.« 
»Haben Sie vielleicht das genaue Datum im Kopf?« 
Kimura zog einen Terminkalender aus der Tasche. Nachdem er eine 
Weile  darin  geblättert  hatte,  antwortete  er:  »Es  war  der  2.  Novem‐
ber.« 
Der  2.  November,  also  einen  Tag,  nachdem  Mai  das  Elternhaus 
Ryujis  aufgesucht  hatte.  Aller  Wahrscheinlichkeit  nach  hatte  sie  den 
Videofilm  zu  diesem  Zeitpunkt  bereits  gesehen.  »Entschuldigen  Sie 
diese indiskrete Frage, aber wo haben Sie sich getroffen?« 
»Mai hat mir telefonisch mitgeteilt, dass sie den Artikel fertig habe. 
Daraufhin bin ich zu ihr gefahren.« 
»Zu ihr nach Hause?« 
»Nein,  wir  haben  uns  in  einem  Cafe  nahe  der  U‐Bahn‐Station,  bei 
der sie wohnt, getroffen. Das war immer unser Treffpunkt«, betonte 
Kimura.  Damit  wollte  er  zu  verstehen  geben,  dass  er  nie  das  Apart‐
ment einer allein stehenden Frau aufsuchen würde. 
»Ist  Ihnen  an  Mai  irgendetwas  aufgefallen?  War  sie  anders  also 
sonst?« 
Kimura  blickte  Ando  verwundert  an.  Er  schien  die  Frage  nicht  zu 
verstehen. »Was meinen Sie damit?« 
»Es geht um ihre Todesursache ... In einigen Punkten herrscht noch 
Unklarheit.« 
»Unklarheit?« Kimura verschränkte nachdenklich die Arme. Andos 
Satz schien ihn verunsichert zu haben. 
»Was  auch  immer  ...  Eine  Kleinigkeit  würde  schon  weiterhelfen. 
Wenn  Ihnen  auch  nur  das  Geringste  aufgefallen  ist...«,  sagte  Ando 
freundlich lächelnd, um die Atmosphäre etwas aufzulockern. 
»In der Tat war Mai an diesem Tag etwas anders als sonst...« 
»Das heißt?« 
»Sie war schrecklich blass. Ich weiß nicht, ob ihr übel war, aber sie 
hielt sich die ganze Zeit ein Taschentuch vor den Mund.« 
Ob ihr übel war... Als Ando in Mais Apartment war, hatte er auf dem 
Fliesenboden im Bad Spuren von Erbrochenem entdeckt. »Haben Sie 
Mai gefragt, ob ihr schlecht ist?« 
»Das  musste  ich  nicht.  Sie  hat  mir  gleich,  nachdem  wir  uns  ge‐
troffen hatten, erzählt, dass sie eine furchtbare Übelkeit quälte. Offen‐
sichtlich hatte sie die ganze Nacht an Ryujis Artikel gearbeitet.« 
»Hm, verstehe. Dann war also Schlafmangel der Grund.« 
»So ist es.« 
»Haben  Sie  sonst  über  irgendetwas  gesprochen?  Ich  meine,  außer 
über den Artikel.« 
»Nein.  Ich  hatte  nicht  viel  Zeit.  Wir  sprachen  nur  kurz  über  das 
Buch, und dann bin ich wieder gefahren.« 
»Das Buch? Ryujis Buch?« 
»Ja. Als wir damals über die  Artikelserie sprachen, haben wir  ver‐
einbart, sie nach Erscheinen aller Ausgaben als Buch herauszugeben.« 
»Wann soll es denn erscheinen?« 
»Ab nächsten Monat wird es in den Buchläden erhältlich sein.« 
»Wäre schön, wenn es sich gut verkauft.« 
»Da  gebe  ich  mich  keinen  Illusionen  hin.  Der  Inhalt  ist  weiß  Gott 
keine  leichte  Kost,  obwohl  ich  es  sehr  interessant  finde.  Aber  einen 
›Run‹ auf das Buch können wir wohl ausschließen.« 
Das  Gespräch  hatte  sich  in  eine  andere  Richtung  entwickelt,  als 
Ando geplant hatte, und die Zeit war wie im Flug vergangen — die 
verabredete  Stunde  war  vorbei.  Ando  hatte  zwar  keine  wirklich 
wichtigen  Informationen  von  Kimura  bekommen,  aber  es  bestand 
sicherlich  die  Möglichkeit,  ihn  noch  einmal  zu  treffen.  Dafür  war  es 
wichtig, einen guten Eindruck zu hinterlassen. Also entschied Ando, 
ihn  für  heute  in  Ruhe  zu  lassen  und  nicht  weiterzubohren.  Er  be‐
dankte sich höflich, dann standen sie auf. 
In diesem Moment betraten drei Personen die Launch, zwei Männer 
und  zwischen  ihnen  eine  Frau.  Alle  drei  hatten  markante  Gesichter, 
und Ando erinnerte sich sofort: Die Frau war eine bekannte Roman‐
schriftstellerin. Die Verfilmung eines ihrer Werke hatte sie in ganz Ja‐
pan berühmt gemacht. Ando hatte ihr Gesicht schon oft im Fernsehen 
und auf Titelblättern gesehen. Neben ihr stand der Regisseur, der den 
autobiografischen Roman verfilmt hatte. Andos Interesse galt jedoch 
vor  allem  dem  etwa  vierzigjährigen  zweiten  Mann.  Sein  Name  lag 
ihm  auf  der  Zunge.  Ando  ging  davon  aus,  dass  er  ebenfalls  Schrift‐
steller war, denn auch sein Gesicht kam ihm bekannt vor. 
Als  die  drei  an  ihnen  vorbeigingen,  sprach  Kimura  den  Mann  an. 
»Schön, dass es mit dem Projekt geklappt hat, Asakawa.« 
Asakawa ... 
Jetzt  erinnerte  Ando  sich.  Natürlich,  das  war  der  Bruder  von 
Kazuyuki Asakawa, Jun‐ichiro. Mitte November hatte er ihn in seiner 
Wohnung in Kanda aufgesucht, um sich die Diskette mit dem Ring‐
Bericht  auszuleihen,  die  er  dann  einige  Tage  später  zurückgebracht 
hatte. Ando fiel nun auch wieder ein, dass er auf Jun‐ichiros Visiten‐
karte ›S‐Shobo Verlag‹ gelesen hatte. Ob Kazuyuki Asakawa es wohl 
ermöglicht hatte, dass Ryujis Buch bei diesem Verlag erschien? 
Jun‐ichiro  schien  sich  ebenfalls  an  Ando  zu  erinnern.  Mit  er‐
schrockener Miene wich er ein paar Schritte zurück. 
»Noch einmal vielen Dank für alles.« Ando verbeugte sich vor ihm. 
Doch Jun‐ichiro beachtete ihn kaum. »Wir müssen gehen«, sagte er 
kurz angebunden und manövrierte die Autorin und den Regisseur an 
einen  Tisch.  Aus  irgendeinem  Grund  schien  er  Ando  aus  dem  Weg 
gehen  zu  wollen.  Ando  blickte  noch  einmal  zu  ihm  hinüber,  doch 
Jun‐ichiro  würdigte  ihn  keines  Blickes.  Angeregt  unterhielt  er  sich 
mit dem Filmregisseur. Es war eindeutig: Er mied Ando. 
Verwirrt  suchte  Ando  nach  einer  Erklärung  für  Jun‐ichiros  merk‐
würdiges Verhalten. Wie sehr Ando auch darüber nachdachte, er war 
sich keiner Schuld bewusst. Als er die Diskette zurückgebracht hatte, 
hatte er auch einen höflichen Brief übergeben, in dem er seinen Dank 
zum  Ausdruck  brachte.  Nein,  er  konnte  sich  nicht  daran  erinnern, 
Jun‐ichiro  gegenüber  unhöflich  gewesen  zu  sein.  Dessen  Verhalten 
war ihm unerklärlich. 
Grübelnd verließ Ando mit Kimura die Launch. 
 

 
Zu Hause ließ Ando sich zunächst ein heißes Bad ein. Als sein Sohn 
noch gelebt hatte, hatte er jeden Tag gebadet. Doch jetzt war er oft zu 
faul, für sich allein extra Wasser einzulassen, und duschte lieber. 
Nachdem  Ando  aus  dem  Bad  gekommen  war,  pinnte  er  die  mit 
dem  Elektronenmikroskop  aufgenommen  Fotos  des  Ring‐Virus  an 
die Wand, um sie aus der Distanz betrachten zu können. Da die mei‐
sten  Wände  seiner  Wohnung  mit  Bücherregalen  vollgestellt  waren, 
blieb  nur  die  freie  Fläche  über  dem Bett.  Sie  erinnerte an  eine  große 
Leinwand. Als wären es Röntgenbilder, befestigte Ando Foto für Foto 
an  der  weißen  Wand,  erst  die  siebzehntausendfache  Vergrößerung, 
dann  die  einundzwanzigtausendfache,  schließlich  die  hunderttau‐
sendfache. 
Ohne  den  Blick  abzuwenden,  trat  er  ein  paar  Meter  zurück.  Die 
aufeinander hockenden Ring‐Viren erinnerten an eine Wendeltreppe. 
Konzentriert betrachtete Ando jedes Detail. Vielleicht entdeckte er ja 
etwas, das sie bisher übersehen hatten. 
Er knipste das Licht aus und ließ den Strahl der Taschenlampe über 
die Fotos gleiten. Es sah aus, als würde ein großes Virus über die wei‐
ße  Wand  kriechen.  Bei  der  zweiundvierzigtausendfachen  Vergröße‐
rung  des  fadenähnlichen  Virus  hielt  er  inne.  Das  war  der  Virustyp, 
der  nur  in  Mais  und  Asakawas  Blut  in  großer  Anzahl  vorkam.  Die 
Autopsieergebnisse hatten gezeigt, dass Mais Herz einwandfrei funk‐
tioniert  hatte  —  eine  Verstopfung  oder  Verengung  der  Blutgefäße 
hatte  nicht  vorgelegen.  Bei  Asakawa  hingegen  hatte  sich  ein  kleiner 
Knoten  in  einem  der  Herzkranzgefäße  gebildet,  der  jedoch  nicht  für 
seinen Tod ausschlaggebend gewesen war. Dieser kleine Unterschied 
gab  Ando  Rätsel  auf.  Warum  waren  Mais  Blutgefäße  vollkommen  in 
Ordnung? 
Das fadenförmige Virus schien Mais Herzgefäße nicht attackiert zu 
haben.  Bei  allen  anderen  Personen,  die  das  Video  gesehen  hatten, 
hatte es diesen Bereich befallen. Warum nicht auch bei Mai? War das 
von Bedeutung oder schlicht Zufall? 
Ando zermarterte sich den Kopf über diese Frage. Sie ließ ihn nicht 
los.  Also  noch  mal  von  vorn  ...  Anhand  seines  Kalenders  versuchte 
Ando noch einmal, Mais Aktivitäten von Ende November bis Anfang 
Dezember zu rekonstruieren. Erstmals war er ihr am 20. Oktober be‐
gegnet. Kurz vor Ryujis Autopsie hatte man sie ins Büro der Gerichts‐
medizin  gerufen.  Da  sie  sehr  blass  gewesen  war,  hatte  er  angenom‐
men, sie hätte gerade ihre Menstruation. 
Erneut  betrachte  er  die  Fotos  an  der  Wand,  fokussierte  dann  die 
hunderttausendfache  Vergrößerung  des  fadenförmigen  Virus.  Was 
ging  mir  durch  den  Kopf,  als  ich  es  zum  ersten  Mal  gesehen  habe? 
Habe  ich  nicht  gedacht,  dass  sich  die  Viren  in  Mais  und  Ryujis  Blut 
sehr  ähnlich  sind?  Der  ovale  Kopf,  der  fadenförmige,  gewundene 
Schwanzanhang... 
Doch  die  Viren  hatten  Mais  Herzkranzgefäße  nicht  attackiert,  so 
viel stand fest. 
Was dann? Welchen Teil in ihrem Körper hat das Virus angegriffen? 
Plötzlich  durchzuckte  ihn  ein  Gedanke.  Aufgeregt  schaute  er  noch 
einmal in seinen Kalender. Der 1. November ... An diesem Tag hatte 
Mai sich das Video angesehen — zwölf bis dreizehn Tage nach ihrer 
Menstruation. Ando trat näher an die Wand heran und betrachte das 
Ring‐Virus mit dem Schwanzanhang eingehend. 
Es sieht genauso aus wie ... Samenfäden! 
»Spermien!«, rief Ando entsetzt. 
Der Tag des Eisprungs! 
Zwar  gab  es  geringfügige,  individuelle  Unterschiede,  aber  im  All‐
gemeinen  erfolgte  der  Eisprung  um  den  vierzehnten  Tag  des  Men‐
struationszyklus herum. Das Eibläschen platzte, und die reife Eizelle 
trat aus den Eierstöcken, um vom Eileiter aufgenommen zu werden. 
Dort  blieb  sie  höchstens  vierundzwanzig  Stunden.  Wenn  an  dem 
Abend, als Mai sich das Video angeschaut hat, noch ein Ei im Eileiter war... 
Der Ring‐Virus hat seine Angriffsstrategie geändert — vom Herzkranzgefäß 
zum Eileiter! 
Andos Herz raste. Nach Atem ringend setzte er sich aufs Bett. Was 
er  da  herausgefunden  zu  haben  glaubte,  hatte  ihn  bis  ins  Mark 
erschüttert. 
Nachdem er sich etwas beruhigt hatte, dachte er noch einmal über 
seine Hypothese und die zeitlichen Zusammenhänge nach. Während 
Mai  das  Video  gesehen  hatte,  ereignete  sich  vermutlich  gerade  der 
Eisprung.  Ausgerechnet  in  den  wenigen  Stunden  der  Empfängnis‐
bereitschaft im Monat hatte sie vor dem Videorekorder gesessen. Ver‐
dammt noch mal, warum musstest du dir das Band unbedingt anschauen? 
Jetzt war Ando auch klar, warum Mai eine Ausnahme darstellte: Alle 
anderen weiblichen Frauen waren zu dem Zeitpunkt, als sie sich das 
Video angeschaut hatten, nicht fruchtbar gewesen. 
Und dann ... 
Der  Gedanke  ließ  Ando  die  Haare  zu  Berge  stehen.  Ein  eisiger 
Kälteschauer kroch seine Wirbelsäule hinunter. 
Und  dann  hatten  sich  mehrere  hundert  Millionen  Ring‐Viren  auf 
den Weg zur Eizelle gemacht. Eine Samenzelle drang in Mais Eizelle 
ein,  die  Zellkerne  wanderten  aufeinander  zu,  und  schließlich  ver‐
schmolz  das  Erbgut  des  Virus  mit  dem  von  Mai.  Die  Befruchtung 
fand statt. 
Trotz Evolution hatte das Virus seine Wesensmerkmale offensicht‐
lich  beibehalten.  Die  Eizelle,  in  die  es  eingedrungen  war,  hatte  sich 
innerhalb einer Woche zu einem kompletten Organismus entwickelt. 
Dann  kam  ein  ...  Etwas  aus  ihrem  Körper.  Deshalb  waren  bei  der 
Autopsie von Mais Leiche auch Restspuren eines Geburtsvorgangs zu 
erkennen gewesen. 
Aber was hatte Mai zur Welt gebracht? 
Andos  zitterte  am  ganzen  Leib.  Plötzlich  erinnerte  er  sich  an  die 
Berührung, die er in Mais Wohnung am Bein gespürt hatte. Irgendein 
mysteriöses  Es  ist  dort  gewesen!  Ich  habe  es  eindeutig  am  Bein  gespürt. 
Irgendetwas  sehr Kleines,  das sich versteckt hatte. Ein winziges  Lebewesen 
... 
Vielleicht  befand  es  sich  noch  im  Wachstumsprozess.  Ando  hatte 
keine Ahnung. Nur eines stand fest: Es existierte. 
Ando  bekam  das  Zittern  nicht  unter  Kontrolle.  Er  zog  sich  wieder 
aus. Das Wasser in der Badewanne war noch nicht abgelaufen. 
Hektisch  drehte  er  den  Hahn  auf  und  stellte  achtzig  Grad  Celsius 
ein. Dann tauchte er tief in das heiße Wasser ein. Besorgt streckte er 
anschließend  das  Bein  in  die  Luft  und  betrachtete  es  prüfend.  Er 
berührte seine Haut vorsichtig. Äußerlich hatte sich nichts verändert. 
Doch  das  beruhigte  ihn  nicht.  Rasch  zog  er  das  Bein  an  sich,  setzte 
sich auf und umschloss die Knie mit den Armen. Die Fragen nahmen 
kein  Ende.  Er  wusste  zwar  nun,  was  mit  Mai  geschehen  war,  aber 
Asakawa gab ihm noch immer Rätsel auf. 
Asakawa  ist  doch  ein  Mann!  Hat  er  vielleicht  trotzdem  auch  etwas 
geboren? 
Andos Kehle war wie ausgetrocknet. 
 
 
 
 
 

 
 
 
Am Vormittag rief Miyashita an und fragte, ob sie nicht eine Spritz‐
tour mit dem Auto unternehmen wollten. Heute begannen die Feier‐
tage,  und  da  Ando  an  solchen  Tagen  die  Decke  auf  den  Kopf  fiel, 
nahm  er  das  Angebot  von  Miyashita  gern  an.  Aber  er  spürte,  dass 
etwas  faul war  —  Miyashitas  Stimme  klang  seltsam,  und er  verhielt 
sich auch anders als sonst. Ando wurde das Gefühl nicht los, dass er 
ihm etwas verheimlichte. 
»Wo willst du denn hinfahren?«, fragte er. 
»Ich möchte, das du dich von etwas überzeugst«, antwortete Miya‐
shita  nur.  Sicherlich  gab  es  einen  triftigen  Grund  für  diese  Geheim‐
nistuerei,  dachte  Ando  und  bohrte  nicht  weiter  nach.  Spätestens  im 
Auto würde er es schon erfahren. 
Kurze  Zeit  später  stand  Miyashita  schon  vor  Andos  Haustür. 
Nachdem  sie  losgefahren  waren,  startete  Ando  einen  erneuten 
Versuch. »Nun sag endlich, wohin entführst du mich?« 
»Das wirst du schon sehen. Sei nicht so ungeduldig.« 
Miyashita  hatte  die  Daisankeihin‐Schnellstraße  verlassen  und  fuhr 
nun auf die Yokohama Shindo in Richtung Fuji‐san. Von einer Über‐
nachtung war nicht die Rede gewesen, also würde ihr Ziel nicht allzu 
weit  entfernt  liegen.  Ando  tippte  auf  Odawara  oder  Hakone.  Falls 
Miyashita  die  Izu‐Halbinsel  im  Auge  hatte,  käme  höchstens  Atami 
oder Ito in Frage. Inzwischen hatte Ando Gefallen an der mysteriösen 
Fahrt gefunden. 
Kurz bevor die Straße einspurig wurde, ging es nicht mehr weiter. 
Unzählige Autos reihten sich aneinander, wie so oft an dieser Stelle. 
Heute  war  das  Verkehrsaufkommen  wegen  der  Feiertage  besonders 
hoch.  Ando  packte  die  Gelegenheit  beim  Schopf  und  präsentierte 
Miyashita  seine  neueste  Hypothese  —  dass  Mai  sich  das  Video  in 
einem  Moment  angesehen  hatte,  in  dem  sie  empfängnisbereit 
gewesen war. Vermutlich habe das Ring‐Virus ursprünglich das Herz 
im Visier gehabt, dann aber aufgrund dieser Tatsache seine Strategie 
geändert und sich zu Mais Eileitern auf den Weg gemacht. Bevor sie 
in  den  Entlüftungsschacht  gefallen  sei,  habe  sie  das  Etwas  zur  Welt 
gebracht,  dass  innerhalb  einer  Woche  in  ihrem  Körper  zu  einem 
kompletten  Organismus  herangewachsen  sei.  So  lasse  sich  auch 
erklären, warum Mai keinen Slip anhatte, als man ihre Leiche fand. 
Miyashita hörte sich Andos Theorie geduldig an, während er kon‐
zentriert und geduldig auf die Fahrbahn schaute. Doch sein Gesichts‐
ausdruck und seine Fahrweise standen in einem gewaltigen Kontrast 
—  abrupt  scherte  er  aus  und  überholte  den  vorderen  Wagen  mit 
einem Affentempo. »Ich habe mir auch schon so was in der Richtung 
gedacht,  als  ich  das  in  Mais  Blut  nachgewiesene  Ring‐Virus  unter 
dem Elektronenmikroskop sah.« 
Der  Wagen  hinter  ihnen  hupte,  doch  Miyashita  ließ  sich  nicht  aus 
der Ruhe bringen. »Mir ging die Form des Virus nicht aus dem Kopf 
... Die ganze Zeit habe ich überlegt, woran sie mich erinnert. Dann fiel 
es mir wie Schuppen von den Augen — Samenfäden.« 
»So gingʹs mir auch.« 
»Nemoto hat das Gleiche gesagt.« 
»Dann hatten wir alle drei denselben Gedanken, nur keiner hat ihn 
ausgesprochen.« 
»Ich  bin  sowieso  der  Auffassung,  dass  man  immer  auf  seine  In‐
tuition vertrauen sollte.« Miyashita grinste verschmitzt. 
»He,  pass  doch  auf.  Du  fährst  wie  ein  Verrückter!«  Während  die 
Stoßstange des Wagens vor ihnen immer näher rückte, trat Ando fast 
ein Loch in den Boden. 
»Nun krieg dich mal wieder ein, du Angsthase. Ich passe schon auf, 
dass  uns  nicht  das  gleiche  Schicksal  widerfährt  wie  Asakawa«,  ver‐
suchte  Miyashita,  die  Geschwindigkeit  drosselnd,  Ando  zu  beruhi‐
gen. Doch diesem schlug das Herz bis zum Halse. Es hätte nicht viel 
gefehlt,  und  Miyashita  wäre  dem  Vordermann  reingefahren.  Angst‐
schweiß strömte Ando über das Gesicht. Irgendwie schien Miyashita 
kein  Gefühl  für  den  richtigen  Abstand  zu  haben.  Es  war  wohl  nur 
eine Frage der Zeit, bis er einen Unfall baute. 
»Da wir gerade bei Asakawa sind ... Mir ist immer noch ein Rätsel, 
warum  er  nicht  an  einem  Herzanfall  gestorben  ist.  Hast  du  eine 
Idee?« 
»Also,  eines  steht  fest:  Er  ist  definitiv  ein  Mann.  An  der  Frucht‐
barkeit kann es also kaum gelegen haben.« 
»Aber ich wette mit dir, dass auch mit seinem Körper irgendetwas 
Merkwürdiges passiert ist.« 
»Vielleicht hat das Virus ja einen Ausgang gefunden.« 
»Einen Ausgang?« 
»Na ja, ich meine, einen anderen Weg, um besser zu gedeihen.« 
Nachdem sie die Hodogaya‐Umgehungsstraße hinter sich gelassen 
hatten,  löste  sich  der  Stau  endlich  auf.  Miyashita  fuhr  fort:  »Wir 
müssen  Antworten  finden.«  Sein  Gesichtsausdruck  hatte  sich  mit 
einem Mal verdüstert. 
»Das versteht sich von selbst.« 
»Was  hast  du  eigentlich  über  die  Neujahrsfeiertage  gemacht?«, 
wechselte Miyashita abrupt das Thema. 
»Nichts  Besonderes  ...  vor  dem  Fernseher  gehockt  und  mich  zu 
Tode gelangweilt. Das Übliche ...« 
»Klingt  nicht  gerade  aufregend.  Wir  sind  zu  einem  kleinen,  ab‐
gelegenen  Fischerdorf  in  Süd‐Izu  gefahren.  Dort  haben  wir  uns  in 
einem gemütlichen Gasthaus einquartiert; ein Geheimtipp, findest du 
in  keinem  Reiseführer.  Du  fragst  dich  bestimmt,  was  uns  in  diese 
Einöde  verschlagen  hat.  Ehrlich  gesagt,  habe  ich  mir  einen  kleinen 
Traum  erfüllen  wollen.  Das  Dorf  war  der  Schauplatz  in  meinem 
Lieblingsroman. Es hieß, dass man dort Fata Morganen am Horizont 
sehen könne.« 
Ando  hatte  keine  Ahnung,  wie  die  Geschichte  ausgehen  würde, 
und lauschte gespannt. 
»Mir  ist  bei  diesem  Ausflug  erst  richtig  bewusst  geworden,  wie 
wichtig  eine  Familie  ist.  Tut  mir  Leid,  wenn  ich  dir  zu  nahe  trete  ... 
Mitten  in  der  Nacht  wurde  ich  plötzlich  vom  Tosen  des  Meeres  aus 
dem  Schlaf  gerissen.  Erschrocken  schoss  ich  hoch.  Mein  erster  Blick 
galt meiner Frau und Tochter, die aber friedlich geschlafen haben. In 
diesem Moment wurde mir klar, wie wertvoll eine Familie ist.« 
Ando  wusste  nur  zu  gut,  was  Miyashita  meinte.  An  Neujahr  mit 
der Familie in einem Fischerdorf in Süd‐Izu, wo man Fata Morganen 
sehen konnte ... Allein würde einen sicherlich die Einsamkeit auffres‐
sen, aber mit Frau und Kind hatte es sicherlich etwas Romantisches. 
Ando dachte an sein zerstörtes Leben. 
Doch  Miyashita  ließ  ihm  nicht  viel  Zeit  zum  Grübeln.  »Findest  du 
nicht auch, dass meine Frau ausgesprochen hübsch ist?« 
»Da  muss  ich  dir  zustimmen.«  Bei  diesen  Worten  dachte  Ando 
allerdings  nicht  an  Miyashitas  Frau,  sondern  an  das  bezaubernde 
Gesicht seiner Exfrau, als er ihr zum ersten Mal begegnet war. 
»Ich bin zwar zugegebenermaßen ein Fettwanst und nicht der Hüb‐
scheste, aber sie akzeptiert mich, wie ich bin, es scheint sie nicht ein‐
mal  zu  stören.  Ein  wirklich  besonderer  Mensch!  Hübsch,  gutmütig, 
feinfühlig, gleichzeitig intelligent... An ihr gibt es nichts auszusetzen. 
Ich habe verdammtes Glück im Leben gehabt.« 
Miyashitas  Frau  war  einige  Zentimeter  größer  als  er.  Ihre  feinen 
Gesichtszüge ähnelten denen einer berühmten, sehr beliebten Schau‐
spielerin. In der Tat — wenn man Miyashita neben ihr sah, verwun‐
derte es einen auf den ersten Blick schon, dass sie ihn geheiratet hatte. 
Andererseits  war  er  keine  schlechte  Partie.  Er  hatte  sehr  gute 
Aussichten auf eine Professorenstelle an der Medizinischen Fakultät. 
»Deshalb will ich auch nicht sterben«, sagte Miyashita. »Manchmal 
denke ich, dass ich diese Sache mit dem Virus viel zu leicht genom‐
men habe. Als würde ich mir einen spannenden Krimi ansehen.« 
Im Gegensatz zu Miyashita hatte Ando den Fall sehr ernst genom‐
men. Allerdings fühlte auch er sich wie ein unbeteiligter Beobachter 
des Geschehens. Er hatte sich stets mit dem Gedanken beruhigt, dass 
es  ihn  nicht  erwischen  konnte,  egal,  ob  er  den  Fall  nun  löste  oder 
nicht. Aber allmählich schwante ihm, dass dies vielleicht ein Riesen‐
irrtum war. »Geht mir genauso. Seit wann denkst du so?« 
»Seit Neujahr.« 
»Wegen eurem Urlaub in dem Fischerdorf?« 
»Ich konnte die Fata Morgana nicht sehen.« 
Ando  runzelte  die  Stirn.  Er  verstand  den  Zusammenhang  nicht. 
»Was hat die Fata Morgana damit zu tun?« 
»Bist du schon einmal zum Schauplatz eines Romans gefahren?« 
»Ja, nicht nur einmal.« 
»Und was hast du dabei empfunden?« 
»Nichts Besonderes. Worauf willst du hinaus?« 
»War die Realität anders, als du sie dir vorgestellt hattest?« 
»Wenn ich ehrlich sein soll, es war in den meisten Fällen eher ent‐
täuschend.« 
»Das  heißt,  die  Szenerie  im  Roman  war  weit  entfernt  von  der 
Realität?« 
»Ja,  aber  das  ist  doch  nichts  Besonderes.  Die  Welt  sieht  in  einem 
Roman doch immer anders aus als in Wirklichkeit.« 
»Da magst du Recht haben. Mir ging es ähnlich. Meine Vorstellung 
von dem idyllischen Fischerdorf in Süd‐Izu und die Realität klafften 
weit  auseinander!  Ich  konnte  kaum  Parallelen  feststellen.  Nicht  mal 
die Fata Morgana war zu sehen.« 
Ando  war  sprachlos.  War  Miyashita  so  naiv?  Wie  kam  er  nur  auf 
die  Idee  zu  glauben,  dass  zwischen  Roman  und  tatsächlicher  Welt 
keine  Unterschiede  bestanden?  Eine  Romanwelt,  die  Atmosphäre 
einer Szenerie wurde mit bestimmten stilistischen Mitteln zum Aus‐
druck  gebracht.  Doch  Wörtern  waren  Grenzen  gesetzt.  Selbst  wenn 
der  Autor  eine  realitätsgetreue  Abbildung  beabsichtigte,  würde  nie 
ein exaktes Spiegelbild entstehen. Das gelang nur, wenn man Medien 
wie Fotografien oder Videofilme benutzte. 
»Andererseits, wenn ...« 
Miyashita drehte den Kopf zu Ando, so dass er dessen Gesicht fast 
berührt hätte. 
»He,  schau  auf  die  Straße!  Dabei  kannst  du  auch  erzählen.«  Ernst 
zeigte  Ando  auf  die  Straße.  Das  schien  zu  wirken.  Miyashita 
wechselte auf die langsamere rechte Spur. 
»Weißt du noch, wann du den Ring‐Bericht gelesen hast?« 
Und  ob  ...  Ando  konnte  sich  sehr  genau  daran  erinnern.  Es  war 
einen Tag, nachdem er sich die Diskette von Asakawas Bruder, Jun‐
ichiro,  ausgeliehen  hatte.  »Klar  weiß  ich  das  noch.  Es  war  am  19. 
November.« 
»Ich habe den Bericht nur einmal gelesen. Und du?« 
Auch auf Ando traf das zu. »Warum?« 
»Ich habe da so eine Ahnung ... Seltsamerweise kann ich mich auch 
heute noch an das kleinste Detail erinnern. Manchmal kommt mir aus 
heiterem Himmel eine bestimmte Szene oder ein Gesicht in den Sinn. 
Wie ein Foto, dass man ab und zu mal in die Hand nimmt.« 
Miyashita hatte Recht, die ›Ring‐Welt‹ war sehr visuell dargestellt, 
in Bildern geschrieben. Jede einzelne Szene blieb einem im Gedächt‐
nis hängen, als hätte sie sich an die Zellen des Lesers geheftet. Wenn 
jemand Ando gebeten hätte, diese oder jene Situation zu beschreiben, 
dann hätte es keine Sekunde gedauert, bis er sie aus dem Gedächtnis 
hervorgeholt hätte. 
Aber was bedeutete das? Ando verstand nicht recht, worauf Miyashita 
hinauswollte, und schwieg. 
»Mir  geht  schon  eine  ganze  Weile  ein  Gedanke  durch  den  Kopf: 
Was,  wenn  die  im  Ring‐Bericht  beschriebenen  Landschaften  und 
Gesichter keine Fiktion sind, sondern tatsächlich existieren?« Obwohl 
das,  was  Miyashita  sagte,  von  größter  Bedeutung  sein  konnte, 
strahlte er die gewohnte Ruhe aus. 
Ando  dachte  über  diesen  Punkt  nach.  Wenn  nun  tatsächlich  die 
Ring‐Welt ein originalgetreues Abbild der Realität war, was bedeute‐
te das dann? War es überhaupt möglich? »Und wenn es so wäre ...«, 
stieß Ando heiser hervor. 
»Mir  lässt  das  seit  Tagen  keine  Ruhe.  Ich  muss  der  Sache  auf  den 
Grund gehen.« 
»Ah,  jetzt  verstehe  ich  ...«  Endlich  wusste  Ando,  wohin  die  Fahrt 
ging:  zum  ›Ring‐Schauplatz‹,  also  der  Gegend  von  Süd‐Hakone  bis 
Atami.  Miyashita  wollte  sich  die  Landschaften  ansehen  und  einen 
Eindruck  davon  machen,  inwieweit  die  Ring‐Szenerie  der  Realität 
entsprach.  Jetzt  verstand  Ando  auch,  warum  Miyashita  ihn  dabei 
haben wollte. Vier Augen sahen bekanntermaßen mehr als zwei. 
»Warum  konnte  ich  meine  Klappe  bloß  nicht  halten!  Eigentlich 
wollte ich dir nichts sagen, bis wir da sind. Ich fürchte, dass du jetzt 
voreingenommen an die Sache herangehst.« 
»Mach dir da mal keine Sorgen.« 
»Warst  du  eigentlich  schon  mal  in  diesem  Pazifikland  in  Süd‐
Hakone?«, erkundigte Miyashita sich. 
»Nein, und du?« 
»Ich habe den Namen im Ring‐Bericht zum ersten Mal gesehen.« 
Obwohl Ando noch nie dort gewesen war, sah er, wenn er die Au‐
gen schloss, das auf einem sanften Abhang liegende Blockhüttendorf 
deutlich  vor  sich.  In  der  Hütte  B‐4  hatte  das  Horrorszenario  seinen 
schrecklichen Anfang genommen, und in dem alten Brunnen darun‐
ter hatten sich der Hass der jungen Sadako Nakamura, die vor fünf‐
undzwanzig  Jahren  vergewaltigt  und  hier  vergraben  worden  war, 
und der Hass des Pockenvirus auf die menschliche Intelligenz, die es 
ausgerottet hatte, vereint, um Jahre später mit furchtbarer Grausam‐
keit zurückzuschlagen. 
Und an diesen Ort des Schreckens fuhren sie jetzt ... 
Miyashita  ließ  den  von  Wolken  verhangenen  Hakano‐Berg  rechts 
liegen  und  nahm  die  Manazuru‐Straße  Richtung  Atami.  Laut  Ring‐
Bericht erschien auf der Autobahn in Atami das erste Hinweisschild 
zum  Pazifikland.  Sie  beschlossen,  die  darin  beschriebene  Route  zu 
nehmen. 
Obwohl weder Ando noch Miyashita je in dieser Gegend gewesen 
geschweige  denn  diese  Straße  schon  einmal  gefahren  waren,  hatten 
sie das Gefühl, alles zu kennen. Kazuyuki Asakawa war vergangenes 
Jahr am Abend des 11. Oktobers hier gewesen. Jetzt war es kurz vor 
zwölf Uhr, die Sonne schien. Damals hingegen war das Wetter durch‐
wachsen gewesen. Während der Fahrt zum Pass hinauf war aus den 
dunklen  Wolken  plötzlich  ein  heftiger  Regen  gebrochen,  und  dicke 
Tropfen  hatten  gegen  die  Windschutzscheibe  gehämmert.  Asakawa 
hatte  die  Scheibenwischer  auf  die  höchste  Stufe  gestellt  —  Ando 
erinnerte sich noch genau an diese Szene im Bericht. Obwohl Uhrzeit 
und  Wetter  nicht  übereinstimmten,  sah  Ando  die  in  Finsternis 
gehüllte, verregnete Landschaft von damals vor sich. 
Am  Berghang  tauchte  plötzlich  das  Pazifikland‐Schild  auf.  Ando 
glaubte, es schon einmal gesehen zu haben: eine schlichte weiße Tafel 
mit  schwarzen  Buchstaben  ...  Ohne  zu  zögern,  bog  Miyashita  nach 
links  ab  und  fuhr  zwischen  terrassenförmig  angelegten  Feldern  den 
Berg hoch. 
Angesichts  der  Tatsache,  dass  der  Weg  ziemlich  schmal  und 
holprig  war,  hätte  man  hier  eher  ein  Niemandsland  erwartet  als  ein 
Ferienressort.  Büsche  säumten  den  Weg,  und  ausladende  Zweige 
streiften  den  Wagen.  Das  unangenehme,  kratzende  Geräusch  verur‐
sachte eine Gänsehaut bei Ando. Nach einer Weile sah er hier und da 
Sommerhäuser  am  Straßenrand.  Straßenlaternen  tauchten  auf.  Auch 
die  Asphaltdecke  wurde  plötzlich  besser.  Je  näher  sie  ihrem  Ziel 
kamen, desto vertrauter schien Ando die Szenerie zu sein. 
»Hast du auch das Gefühl, ein Déjà‐vu zu haben?«, fragte er leise. 
»Das wollte ich dich auch gerade fragen.« 
Miyashita  hatte  also  dasselbe  empfunden  ...  Schon  oft  hatte  Ando 
ein Déjà‐vu‐Erlebnis gehabt, doch nicht von einer derartigen Intensi‐
tät  und  Dauer.  Das  starke  Gefühl  des  Vertrautseins,  des  Wiederer‐
kennens  hatte  fast  etwas  Unheimliches  an  sich.  Obwohl  sie  das  Pla‐
teau noch nicht erreicht hatten, konnte Ando schon das Informations‐
zentrum  vor  seinen  Augen  sehen:  ein  modernes  zweistöckiges  Ge‐
bäude mit schwarzer Glasfassade. 
Mit  halboffenen  Mund  starrte  Ando  ungläubig  auf  den  Komplex, 
als sie den großzügigen Parkplatz erreichten. Er entsprach exakt dem 
Bild in seiner Fantasie. Selbst das im Informationszentrum beherberg‐
te  Restaurant  —  alles  kam  ihm  vollkommen  vertraut  vor.  Wenn  es 
nach ihm ginge, könnten sie gleich wieder heimfahren: Die im Bericht 
beschriebene  Landschaft  war  ein  wahrheitsgetreues  Abbild  der 
Realität. 
 

 
Sie  verließen  das  Pazifikland  und  fuhren  die  Manzuru‐Straße  am 
Meer  entlang  in  Richtung  Odawara.  Der  Anblick  des  Ferienressorts 
spukte  noch  in  ihren  Köpfen  herum.  Ab  und  zu  wechselten  sie  ein 
paar Worte, doch nach wenigen Minuten versiegte das Gespräch wie‐
der.  Ein  beklemmendes  Schweigen  legte  sich  über  sie.  Beide  hingen 
ihren  Gedanken  nach.  Die  Schönheit  des  weiten,  klaren  Meeres 
nahmen sie nicht wahr. Vor Andos Augen erschien immer wieder das 
Bild des alten Brunnens unter B‐4, und er glaubte sogar den feuchten, 
nach  Fäulnis  stinkenden  Geruch  wahrzunehmen.  Gleichzeitig  sah  er 
das markante Gesicht eines Mannes. 
 
Abgesehen von Informationszentrum und Restaurant lagen die ver‐
schiedenen Einrichtungen des Pazifiklandes auf einem sanft abfallen‐
den  Hang:  Tennisplatz,  Schwimmbad,  Sportklub,  private  Ferien‐
häuser  ...  Auch  die  Blockhütten  fügten  sich  idyllisch  in  dieses  Bild. 
Blickte  man  über  das  Tal,  sah  man  die  Dächer  der  Gewächshäuser 
golden  in  der  Nachmittagssonne  schimmern.  Ando  und  Miyashita 
hatten das Gefühl gehabt, als würden sie sehr oft hierherkommen. 
Aufgeregt hatten sie die Hütte B‐4 gesucht. Da war sie! Der Ort des 
Grauens  ...  Zaghaft  berührte  Miyashita  den  Türknopf,  doch  wie  er‐
wartet war abgesperrt. Auf allen Vieren kniend warfen sie einen Blick 
unter  die  Terrasse.  Zwischen  den  Pfeilern,  die  die  Hütte  abstützten, 
war ein Sockelbrett herausgerissen. Das war sicher das Werk Ryujis. 
Um unter die Terrasse kriechen zu können, hatte er das Brett entfernt. 
Dann hatten Asakawa und Ryuji mit ganzer Kraft den Zementdeckel 
weggeschoben  und  waren  an  einem  Seil  abwechselnd  in  den  übel 
riechenden,  finsteren  Brunnen  hinuntergeklettert,  um  die  Knochen 
Sadako  Yamamuras  aus  dem  Schlamm  zu  ziehen.  Allein  die  Vor‐
stellung ließ Ando die Haare zu Berge stehen. 
Miyashita  holte  eine  Taschenlampe  aus  dem  Wagen.  Keuchend 
schob er sie durch die Öffnung und leuchtete damit unter der Hütte 
herum.  Mit  zusammengekniffenen  Augen  folgten  beide  dem  Licht‐
strahl. Da war etwas! In Richtung der westlich gelegenen Wand des 
Unterbaus  erkannten  sie  einen  schwarzen  Hügel.  Ein  Haufen  Steine 
...  Offenbar  hatten  sie  einmal  die  Mauer  des  Brunnens  gebildet. 
Daneben  lag  ein  Deckel  aus  Zement.  Exakt  wie  in  Asakawas  Ring‐
Bericht! 
Ando zwängte sich durch die schmale Öffnung und kroch bis zum 
Brunnen vor. Doch er brachte es nicht fertig hineinzuschauen, genau 
wie  er  in  den  Entlüftungsschacht,  Mais  Grab,  nicht  hatte  hinein‐
blicken können. Die Lage aus sicherer Distanz zu überprüfen war das 
Höchste der Gefühle, mehr ging nicht. Dazu fehlte ihm der Mut. Hier, 
in  diesem  finsteren  Loch,  auf  den  kleinen  runden  Ausschnitt  des 
Himmels starrend, hatte Sadako die letzten qualvollen Tage ihres jun‐
gen  Lebens  verbracht.  Auch  Mai  war  elend  in  einem  dunklen  Loch 
gestorben, voller Hoffnung auf den Himmel blickend ... Der Brunnen 
hatte hinter einem verwaisten Bauernhaus gelegen, etwas abseits des 
Sanatoriums. Das alte Gebäude, auf dessen Dach Mai gestiegen war, 
befand  sich  nahe  des  Hafens.  Erst  jetzt  wurde  Ando  die  Analogie 
zwischen den Orten, an denen Sadako und Mai gestorben waren, be‐
wusst — hier ein tiefer, dunkler Brunnen im Wald, moosbeschichtete 
Wände, dort ein tiefer, dunkler Schacht, der Algengeruch des Meeres 
... 
Andos  Herz  raste.  Die  kalte,  lehmige  Erde  klebte  an  seinen  Knien 
und  Ellenbogen,  und  ein  kühler,  faul  riechender  Geruch  schien  ihn 
mit eisigem Griff zu umklammern. Unbewusst hielt er den Atem an. 
Alles,  was  er  wollte,  war,  so  schnell  wie  möglich  wieder  ans  Tages‐
licht zu kommen. 
Doch  nun  zwängte  sich  auch  Miyashita  mit  seinem  dicken  Bauch 
durch  die  Öffnung.  Ando  konnte  es  nicht  fassen.  Miyashita  hatte 
doch  wohl  nicht  allen  Ernstes  vor,  bis  zum  Brunnen  zu  kriechen? 
Wütend  versuchte  er  ihn  von  seinem  Vorhaben  abzubringen.  »Das 
reicht!« 
Abrupt  hielt  Miyashita  in  einer  grotesken  Stellung  inne  und 
überlegte.  »Hast  wohl  Recht«,  sagte  er  schließlich  und  kroch  rück‐
wärts. 
Nachdem  sie  unter  der  Terrasse  hervorgekrochen  waren,  fühlten 
sich  beide  befreit  und  erlöst.  Sie  holten  tief  Luft,  Worte  waren  nicht 
nötig.  Die  im  Bericht  beschriebene  Szenerie  stimmte  erschreckend 
genau mit der Realität überein. 
Dennoch  war  Miyashita  nicht  zufrieden.  Sie  hatten  zwar  jetzt  den 
Beweis,  dass  die  Landschaft  nicht  fiktiv  war,  aber  was  war  mit  den 
Gesichtern  der  beschriebenen  Personen?  »Da  wir  schon  mal  in  der 
Gegend  sind,  sollten  wir  auch  Dr.  Nagao  einen  Besuch  abstatten«, 
schlug er vor. 
Dr. Nagao. Zwar war Ando der Namen entfallen, aber er konnte sich 
noch genau an das Gesicht des Mannes erinnern — beziehungsweise 
er hatte eine konkrete Vorstellung davon, denn er hatte es ja noch nie 
gesehen. Das Bild in seinem Kopf war durch die Lektüre des Asaka‐
wa‐Berichts  entstanden:  kahlköpfig,  siebenundfünfzig  Jahre  alt,  ein 
sehr  ebenmäßiges,  frisches  Gesicht...  Alles  in  allem  ein  kluger  Kopf, 
was sich auch in seiner Redensart widerspiegelte. 
Bis das Pazifikland vor zwanzig Jahren erbaut worden war, hatte es 
auf dem Grundstück ein Sanatorium für Tuberkulosekranke gegeben. 
Nagao, Arzt für Innere Medizin und Kinderheilkunde mit einer eige‐
nen  Klinik  in  Atami,  hatte  in  dieser  Einrichtung  ein  paar  Jahre  lang 
gearbeitet. Sadako Yamamura war oft ins Sanatorium gekommen, um 
ihren  kranken  Vater  zu  besuchen.  Von  einer  zügellosen  Begierde 
getrieben, hatte Nagao Sadako vergewaltigt und ihren Körper in den 
Brunnen  geworfen.  Er  war  der  letzte  Japaner,  der  sich  mit  Pocken 
infiziert hatte. 
Im Ring‐Bericht stand: Das kleine, einstöckige Haus lag nicht weit vom 
Kinomiya‐Bahnhof  entfernt.  Auf  einem  Schild  an  der  Tür  stand:  ›Klinik 
Nagao, Innere Medizin und Kinderheilkunde‹. 
Ryuji hatte Nagao intensiv in die Mangel genommen und aus ihm 
die  dunkle  Vergangenheit  herausgequetscht.  Nun  wollte  sich  Miya‐
shita unbedingt einen Eindruck von diesem Mann verschaffen, vor al‐
lem aber sein Gesicht sehen. Deshalb befanden sie sich jetzt auf dem 
Weg nach Atami. 
Miyashita  parkte  unmittelbar  vor  dem  Krankenhaus.  So  ein  Mist! 
Die  Klinik  war  offenbar  geschlossen.  Die  Vorhänge  waren  zugezo‐
gen, die Tür verriegelt. Nach einer vorübergehenden Schließung we‐
gen  Hausbesuchen  sah  es  allerdings  nicht  aus.  Alles  deutete  darauf 
hin, dass hier schon länger niemand mehr gewesen war. Das Gebäu‐
de  wirkte  verwaist,  an  der  Dachrinne  hingen  Spinnweben,  vor  dem 
Eingang hatte sich Sand angehäuft, den der Wind hergetragen hatte. 
Entweder  waren  Betriebsferien,  oder  Nagao  hatte  die  Praxis  inzwi‐
schen aufgegeben. Hier würden sie ihn wohl nicht finden. 
Als  sie  enttäuscht  zum  Auto  zurückgingen,  bemerkte  Miyashita 
eine  junge  Frau,  etwa  dreißig  Jahre  alt  die  den  schmalen  Pfad  vom 
Atami‐Krankenhaus  herunterkam.  Sie  schob  einen  Rollstuhl,  in  dem 
ein  kahlköpfiger  alter  Mann  kauerte.  Die  ausdruckslosen  Augen 
starrten  ins  Leere.  Es  war  unschwer  zu  erkennen,  dass  er  psychisch 
gestört war. 
Miyashita und Ando entfuhren überraschte Rufe. Sie sahen sich an. 
Dies war ohne Zweifel das im Ring‐Bericht beschriebene Gesicht. Der 
Mann  vor  ihnen  hatte  zwar  stark  abgebaut,  aber  beiden  war  sofort 
klar,  dass  es  nur  Nagao  sein  konnte.  Innerhalb  von  drei  Monaten 
schien er um zwanzig Jahre gealtert zu sein. 
Miyashita  ging  auf  die  Frau  und  den  Mann  im  Rollstuhl  zu.  »Dr. 
Nagao?« 
Der Alte zeigte keine Reaktion. Die Frau, vermutlich seine Tochter, 
hob  den  Kopf,  als  sie  Miyashitas  Worte  vernahm.  Beide  verbeugten 
sich leicht. 
»Wie ist sein Befinden? Hat er sich wieder etwas erholt?« Miyashita 
tat so, als würde er Nagao von früher kennen. 
»Ja,  er  ist  allmählich  auf  dem  Weg  der  Besserung«,  antwortete  sie 
knapp und ging weiter. Letztes Jahr im Oktober hatten Asakawa und 
Ryuji  Nagao  einen  Besuch  abgestattet  und  ein  Geständnis  aus  ihm 
herausgepresst.  Vermutlich  hatte  er  dabei  einen  Schock  erlitten,  von 
dem er sich wohl nie wieder ganz erholen würde. 
Die  Frau  ging  mit  dem  Rollstuhl  an  der  Klinik  vorbei  und  bog 
einige Meter danach auf einen kleinen Weg ab. Ando und Miyashita 
schoss  derselbe  Gedanke  durch  den  Kopf,  während  sie  der  be‐
dauernswerten, im Rollstuhl sitzenden Gestalt nachsahen. Unfassbar! 
Nicht der körperliche und psychische Verfall versetzte sie in Erstau‐
nen,  sondern  die  Tatsache,  dass  sie  auf  den  ersten  Blick  gewusst 
hatten:  Das  ist  Nagao.  Damit  hatten  sie  den  Beweis:  Im  Ring‐Bericht 
waren  nicht  nur  die  geografischen  Begebenheiten,  sondern  auch  die 
Gesichter exakt festgehalten. 
Zufrieden  machten  sie  sich  auf  den  Heimweg.  Ando  musterte 
Miyashita  von  der  Seite.  Er  wirkte  erschöpft.  Sie  waren  früh  aufge‐
brochen, und er war die ganze Zeit gefahren. »Setz mich in Odawara 
ab«, sagte Ando. 
Stirnrunzelnd blickte Miyashita ihn an. »Warum das? Ich fahre dich 
selbstverständlich nach Hause.« 
»Das  wäre  aber  ein  riesiger  Umweg  für  dich.  Von  Odawara  kann 
ich  bequem  mit  dem  Schnellzug  nach  Hause  fahren.  Das  ist  über‐
haupt kein Problem, wirklich.« Miyashita wohnte in Tsunami, Ando 
in Yoyogi; das hätte einen Umweg von einigen Kilometern bedeutet. 
»Also  gut,  wenn  du  darauf  besteht,  dann  lasse  ich  dich  eben  in 
Odawara raus.« 
Erleichterung zeichnete sich auf Miyashitas Gesicht ab. Zwar wollte 
er  seine  Erschöpfung  vor  Ando  nicht  eingestehen,  aber  die  ganze 
Fahrerei  hatte  ihn  sehr  müde  gemacht.  Ihm  fiel  es  nur  schwer, 
›danke‹  zu  sagen  —  ein  typischer  Charakterzug  von  Miyashita.  Er 
zeigte ungern Gefühle. 
Kurz  bevor  sie  den  Bahnhof  erreichten,  sagte  Miyashita  mit  ge‐
dämpfter  Stimme:  »Wenn  die  Feiertage  vorbei  sind,  sollten  wir  uns 
einer Blutuntersuchung unterziehen.« 
Ando war sofort klar, worauf Miyashita anspielte. Ihm war derselbe 
Gedanke gekommen — dass der Beobachter zu einer Figur im tödli‐
chen Spiel geworden war. Beide hatten das Gefühl, dass ihnen diese 
Rolle zukam. Zwar war das teuflische Video ausgerottet worden, und 
sie  hatten  es  sich  nicht  angesehen,  aber  ihre  innere  Stimme  sagte 
ihnen,  dass  sie  sich  deshalb  noch  lange  nicht  in  Sicherheit  wähnen 
konnten.  Beweise  hatten  sie  nicht,  dafür  eine  Vermutung:  Im  Ring‐
Bericht  waren,  ähnlich  wie  in  einem  Videofilm,  bestimmte  Bilder 
originalgetreu wiedergegeben, und das hieß vielleicht, dass allen, die 
ihn  lasen,  ein  ähnliches  Schicksal  drohte  wie  denen,  die  das  Video 
gesehen hatten. 
Ando ging der Gedanke nicht mehr aus dem Kopf, dass ein Fremd‐
körper  in  seinen  Organismus  eingedrungen  sein  könnte.  Allein  die 
Vorstellung,  dass  dieses  Ekel  erregende,  abscheuliche  Virus,  das  er 
noch vor ein paar Tagen unter dem Mikroskop gesehen hatte, durch 
seine Blutbahnen schoss ... Miyashita schien es ähnlich zu gehen. 
Ando war, abgesehen vom Verfasser, Kazuyuki Asakawa, der erste 
Mensch  gewesen,  der  den  Ring‐Bericht  gelesen  hatte,  und  zwar  am 
19. November. Das war vor zwei Monaten gewesen. Bis jetzt konnte 
er  keine  körperlichen  Veränderungen  feststellen.  Aber  wer  weiß,  viel‐
leicht ist die Frist nur länger. Die Mutation des Virus konnte durchaus 
zu  einer  anderen  Inkubationszeit  geführt  haben.  Womöglich  war  er 
auch  ein  Träger  des  Erregers,  der  so  lange  in  ihm  schlummerte,  bis 
jemand oder etwas ihn aktivierte. 
Wie Miyashita gesagt hatte, sie mussten ihr Blut unbedingt auf das 
Virus testen lassen. »Was machen wir bloß, wenn wir infiziert sind?«, 
stieß Ando verzweifelt hervor. 
»Na, bestimmt nicht herumsitzen und Däumchen drehen, bis unse‐
re letzte Stunde geschlagen hat ... Dann müssen wir eben einen Weg 
aus der Katastrophe finden. Was bleibt uns sonst?« 
Sie erreichten den Bahnhofsvorplatz. Ando stieg aus, winkte Miya‐
shita kurz zu und ging dann in die Bahnhofshalle. Verflucht, wie konn‐
te das nur passieren! Ich wurde doch in die Sache hineingezogen, ohne es zu 
wollen! 
Zum  ersten  Mal  verstand  Ando,  wie  Asakawa  sich  gefühlt  haben 
musste.  Darüber  hinaus  ähnelten  sich  die  Konstellationen  Asaka‐
wa/Ryuji  und  Ando/Miyashita.  Er  nahm  wohl  den  Part  Asakawas 
und  Miyashita  den  Ryujis  ein.  Andos  Gesichtsmuskeln  zuckten. 
Beide waren gestorben. Ryujis Leiche hatte er selbst seziert. 
Erschöpft  ließ  er  sich  auf  die  Bank  am  Bahnsteig  fallen.  In  diesem 
Moment  spürte  er  eine  eisige  Kälte  im  Rücken.  So  fühlt  es  sich 
bestimmt an, wenn man als Leiche splitternackt auf dem Seziertisch liegt ... 
Wenn er doch nur wüsste, ob auch er mit dem Virus infiziert war! 
Ungewissheit war oft qualvoller als die Wahrheit, selbst wenn diese 
noch  so  grausam  war.  Die  Unwissenheit  nagte  an  einem  und  führte 
zu absoluter Verzweiflung. Ando tappte im Dunkeln, er wusste nicht, 
ob er sich infiziert hatte. Doch für ihn gab es immer einen Fluchtweg, 
eine  Möglichkeit,  sich  der  Last  zu  entledigen:  das  Bewusstsein,  dass 
sein  Leben  sowieso  nichts  wert  war.  Er  musste  sich  nur  den  Tod 
seines Kindes vor Augen führen. Diese Reue ... Wenn er sich ausrei‐
chend hineinsteigerte, konnte er das Leben sofort loslassen, ohne ihm 
auch nur eine Träne nachzuweinen. 
 

 
Gedankenverloren  blickte  Ando  aus  dem  Zugfenster.  Normaler‐
weise las er in einem Buch, doch heute hatte er keines dabei. Plötzlich 
überfiel ihn eine lähmende Müdigkeit. Ohne dagegen anzukämpfen, 
schloss er die Augen. 
Kurz  darauf  fuhr  er  wie  vom  Blitz  getroffen  hoch.  Kreideweiß 
blickte  er  sich  um.  Sein  Herz  raste.  Wo  bin  ich?  Als  er  die  Füße  aus‐
streckte  und  damit  gegen  den  Sitz  vor  ihm  stieß,  zuckte  er  er‐
schrocken  zusammen.  Im  selben  Moment  drang  das  Klingeln  der 
Bahnschranken an sein Ohr. Beruhigt atmete er auf. Ich bin im Zug. 
Langsam kam er zu sich. Er erinnerte sich, dass er vor zwei Stunden 
in Odawara in den Schnellzug gestiegen war. Die Fahrt nach Süd‐Ha‐
kone schien Ewigkeiten zurückzuliegen. Nur der Anblick des Ferien‐
ressorts  und  das  Gesicht  Nagaos  standen  ihm  noch  deutlich  vor 
Augen. 
Mit beiden Händen fuhr Ando sich über das Gesicht. Dann blickte 
er  wieder  nach  draußen.  Die  abendliche  Stadt  zog  langsam  an  ihm 
vorbei. Da sie bereits im Zentrum von Shinjuku waren, fuhr der Zug 
nur noch mit halber Geschwindigkeit. Erneut ertönte das Klingen der 
Bahnschranken.  Ando  warf  einen  kurzen  Blick  auf  den  Stations‐
namen. Yoyogi Hashiman. 
Das war eine Station vor Sangubashi, wo er wohnte. Leider hielt der 
Schnellzug dort nicht. Er musste bis Shinjuku fahren, dort umsteigen 
und  die  zwei  Stationen  wieder  zurückfahren.  Ab  Yoyogi  Hashiman 
verlief  die  Odakyu‐Linie  parallel  zum  dunkelgrünen  Yoyogi‐Park. 
Langsam  fuhren  sie  durch  Sangubashi.  Gelangweilt  beobachtete 
Ando das Treiben auf dem Bahnsteig. 
Plötzlich  fuhr  er  wie  von  der  Tarantel  gestochen  hoch.  Er  presste 
das Gesicht an die Fensterscheibe. Nein, er hatte sich nicht verguckt. 
Da stand sie, in einem dünnen Blazer, die Augen auf den vorbeifah‐
renden Schnellzug gerichtet. Für den Bruchteil einer Sekunde kreuz‐
ten sich ihre Blicke. 
Aller guten Dinge sind drei ... Das erste Mal war Ando der schönen 
Unbekannten  in  Mais  Apartmenthaus  am  Fahrstuhl  begegnet.  Auch 
das  nächste  Treffen  war  eine  Fahrstuhl‐Begegnung  —  im  obersten 
Stockwerk des Gebäudes, in dem Mais Leiche gefunden worden war. 
In Shinjuku stieg Ando in den Regionalzug um und fuhr die zwei 
Stationen nach Sangubashi zurück. Inzwischen waren zehn Minuten 
vergangen,  seit  er  die  mysteriöse  junge  Frau  gesehen  hatte.  Ob  sie 
wohl  noch  da  war?  Ungeduldig  wartete  er  auf  dem  Bahnsteig.  Die 
Sicht war ihm durch die beiden Züge auf seiner und auf der gegen‐
überliegenden Seite versperrt. Menschenmassen schoben sich an ihm 
vorbei. Irgendwie hatte Ando das Gefühl, dass die hübsche Frau sich 
in den letzten Minuten nicht vom Fleck gerührt hatte ... 
Endlich  ertönte  das  Abfahrtssignal.  Die  Züge  fuhren  aus  dem 
Bahnhof, der ›Vorhang‹ öffnete sich. Unfassbar! Sie stand tatsächlich 
noch da. Erneut ruhten ihre  Augen auf  Ando,  als wollte sie ihm ein 
Zeichen geben. Ando nickte ihr zu. 
Langsam  ging  er  in  Richtung  Ausgang.  Sie  passte  sich  seinem 
Schritt an und ging ebenfalls die Treppe hinunter. Vor den Gates tra‐
fen sie schließlich aufeinander. 
»Jetzt  sind  wir  uns  wieder  begegnet«,  sagte  sie  in  einem  Ton,  als 
wäre es reiner Zufall. 
Doch als Zufall konnte Ando das weiß Gott nicht deuten. Vielleicht 
wusste sie, dass ich den Schnellzug nehmen und an der Sangubashi‐Station 
vorbeifahren würde ... Aber woher hätte sie das wissen sollen? Dennoch 
wurde  Ando  das  Gefühl  nicht  los,  dass  sie  auf  ihn  gewartet  hatte. 
Wie  dem  auch  sei,  er  konnte  sich  ihrer  Attraktivität  nicht  wider‐
setzen,  war  ihr  auf  eine  merkwürdige  Weise  verfallen.  Gemeinsam 
passierten  sie  die  Schranken  und  schlenderten  die  Geschäftsstraße 
entlang. 
 

 
Kaum hatte Ando die Augen aufgeschlagen, als ihn die Frau neben 
ihm im Bett auch schon fragte, ob sie heute nicht gemeinsam in einen 
Film gehen wollten, der letzte Woche im Kino angelaufen war. Natür‐
lich erfüllte er ihr diesen Wunsch. 
Entgegen aller Erwartungen war das Kino trotz des Feiertages nicht 
voll. Vielleicht lag es daran, dass es noch recht früh am Tag war — sie 
waren in die erste Vorstellung gegangen. 
Manchmal  wunderte  Ando  sich  über  das  merkwürdige  Verhalten 
seiner neuen Flamme. Jetzt war wieder so ein Fall. Auf dem Weg zum 
Kino  hatte  sie  sich  noch  an  ihn  geschmiegt;  wie  ein  glückliches  Pär‐
chen waren sie durch die Straßen gelaufen. Doch sobald sie das Kino 
betreten hatten, riss sie sich los und benahm sich plötzlich distanziert. 
Seltsam  war  vor  allem,  dass  sie  sich  nicht  direkt  neben  ihn  setzen 
wollte,  sondern  einen  Platz  zwischen  ihnen  frei  ließ.  Das  Kino  war 
mit großen, bequemen Sesseln ausgestattet, die Gefahr, unangenehm 
dicht  aufeinander  zu  hocken,  bestand  also  nicht.  Ando  war  ihr  Ver‐
halten absolut unerklärlich. Wenn er es sich recht überlegte, war die 
Liste mit Merkwürdigkeiten schier endlos. Eigentlich kannte er diese 
Frau so gut wie gar nicht. Er wusste nur, dass sie Mais ältere Schwe‐
ster war und Masako hieß. 
Obwohl  Ando  auf  die  Leinwand  starrte,  bekam  er  von  dem  Spiel‐
film so gut wie nichts mit. Seine Gedanken waren woanders. Er über‐
legte,  wie  gestern  alles  angefangen  hatte.  An  alle  Details  konnte  er 
sich nicht mehr erinnern. Begegnet war er Masako abends an der San‐
gubashi‐Station.  Aber  wie  sie  zu  ihm  nach  Hause  gekommen  war, 
wusste er nicht mehr. Im Gedächtnis war ihm noch, dass sie zuerst in 
eine kleine Kneipe gegangen waren. Beim Bier hatte er sie nach ihrem 
Namen gefragt. 
»Masako Takano. Ich bin Mais Schwester«, hatte sie geantwortet. 
Masako  war  zwei  Jahre  älter  als  Mai,  hatte  ihr  Studium  an  einer 
Frauenuniversität in Tokio absolviert und arbeitete momentan für ein 
Wertpapierhaus.  Das  war  aber  auch  schon  so  ziemlich  alles,  was 
Ando  von  ihrem  Gespräch  noch  wusste.  Normalerweise  hatte  er  so 
einen  Filmriss  nur,  wenn  er  zu  tief  ins  Glas  geguckt  hatte,  aber  das 
war gestern nicht der Fall gewesen. Doch warum waren seine Erinne‐
rungen dann nur noch fragmentartig vorhanden? Zum Beispiel wuss‐
te  er  auch  nicht  mehr,  von  wem  die  Initiative  ausgegangen  war, 
gemeinsam zu ihm zu gehen. 
Was  bei  ihm  zu  Hause  geschehen  war,  konnte  er  sich  hingegen 
noch  deutlich  in  Erinnerung  rufen.  Zunächst  hatte  Masako eine  Du‐
sche  genommen,  während  er  auf  dem  Bett  saß  und  auf  sie  wartete. 
Duftend  wie  ein  Blume  kam  sie  aus  dem  Bad.  Sie  knipste  das  Licht 
aus  und  legte  sich  in  der  absoluten  Finsternis  sanft  mit  ihrem  wie‐
chen, nackten Körper auf ihn. Mit einer Hand das nasse Haar fest hal‐
tend,  legte  sie  ihren  rechten  Arm  um  Andos  Hals  und  begann  keu‐
chend,  sich  rhythmisch  auf‐  und  abzubewegen.  Er  spürte  ihre  zarte 
Haut  auf  seinem  Gesicht,  so  dass  ihm  das  Atmen  schwer  fiel. 
Leidenschaftlich  umschloss  er  ihren  schmalen  Körper  mit  beiden 
Armen. 
Seit  eineinhalb  Jahren  war  er  das  erste  Mal  wieder  mit  einer  Frau 
intim  gewesen.  Sie  hatte  ihn  unglaublich  elektrisiert  —  drei  Orgas‐
men  hatte  er  gestern  Abend  gehabt.  Das  war  schon  eine  beachtliche 
Leistung  für  einen  Mann  von  fünfunddreißig  Jahren.  Sie  strahlte  ei‐
nen besonderen, erotischen Reiz aus. Aber sie hatten sich in absoluter 
Dunkelheit geliebt. Auch wenn Masako ausgesprochen attraktiv war, 
konnte  er  ihren  Körper  nicht  mit  den  Augen  bewundern.  Es  war 
schon verrückt. So etwas hatte er bisher noch nie erlebt. Masako hatte 
nicht nur das Licht ausgemacht, sondern alles, was irgendwie leuch‐
tete  —  wie  das  Ziffernblatt  des  Weckers  —,  mit  einem  Handtuch 
abdeckt. 
Ando  beobachte  Masako  aus  dem  Augenwinkel.  Ihre  Schönheit 
wurde durch die Dunkelheit im Kinosaal noch untermalt. Ab und zu 
schloss  sie  die  Augen.  Aber  nicht,  weil  sie  müde  war.  Sie  bewegte 
den Mund — offensichtlich sprach sie zu sich selbst. Ando versuchte, 
ein  Wort  aufzuschnappen,  doch  er  konnte  nicht  verstehen,  was  sie 
murmelte. 
Als  er  wieder  auf  die  Leinwand  blickte,  verstand  er:  Masako 
wiederholte die Worte der Hauptdarstellerin. In dem Film ging es um 
die junge, drogenabhängige, wegen Polizistenmordes zu lebenslanger 
Haft verurteilte Nikita, die das Angebot erhielt, für die Regierung als 
Spezialagentin  zu  arbeiten.  Sie  willigte  ein  und  verließ  nach  einer 
gnadenlosen  Ausbildung  das  Gefängnis.  Gerade  führte  sie  ihren 
ersten  Mordauftrag  in  einem  vollbesetzten  Nobelrestaurant  aus.  Sie 
trug einen schwarzen Overall, in ihrer Handtasche eine große Pistole 
und sprach kurze Dialoge. 
Erneut  blickte  Ando  zu  Masako.  In  diesem  Moment  vermischten 
sich  die  Stimmen  von  Nikita  und  Masako.  Zwar  lief  der  Film  auf 
Französisch,  doch  fast  zeitgleich  kamen  die  japanischen  Wörter  aus 
ihrem  Mund  gesprudelt.  Manchmal  war  sie  sogar  schneller  als  die 
Untertitel. Offensichtlich hatte sie den Film schon mehrmals gesehen. 
Auf  einen  Schlag  hörte  Masako  auf  zu  sprechen  und  schlüpfte  aus 
der Rolle Nikitas. Offenbar hatte sie Andos Blicke gespürt. 
Den Rest des Films verfolgte sie schweigend. 
Als  sie  aus  dem  Kino  traten,  kniff  Masako,  ein  Gähnen  unter‐
drückend, beide Augen zusammen und hängte sich bei Ando ein. Es 
war ein schöner, sonniger Wintertag. Ando verspürte das Verlangen, 
ihre  Haut  zu  berühren.  Er  löste  sich  aus  der  Umarmung  und  nahm 
ihre  Hand.  Sie  war  eiskalt,  aber  schon  nach  kurzer  Zeit  passte  sich 
ihre Temperatur an die seiner Hand an. 
Da  heute  der  ›Tag  der  Mündigkeitserklärung‹  war,  kamen  ihnen 
unterwegs  viele  Mädchen  mit  hübschen  Kimonos  entgegen.  Ando 
und  Masako  machten  einen  ausgedehnten  Spaziergang  vom  Yura‐
kusho bis zur Ginza. Neugierig bestaunte Masako die Geschäfte und 
Kaufhäuser  auf  der  Prachteinkaufsstraße.  Manchmal  stieß  sie  sogar 
einen  Seufzer  aus.  Zwar  sprachen  sie  nicht  viel,  aber  sie  verstanden 
sich gut. Glücklich genoss Ando den Bummel mit ihr über die Ginza. 
Vor  einem  Hamburgerrestaurant  an  einer  Ecke  blieb  Masako 
stehen. Konzentriert blickte sie auf das Plakat mit den Menüs. Dabei 
wirkte sie wie ein Teenager. 
»Möchtest du hier essen?«, fragte Ando. 
»Ja, sehr gern.« 
Ando betrat das Lokal, Masako folgte ihm. 
Sie  hatte  einen  ausgezeichneten  Appetit.  Innerhalb  kürzester  Zeit 
hatte sie zwei Hamburger mit Pommes verdrückt. Wieder blickte sie 
auf die Plakate. Nachdem Ando sie eine Weile beobachtet hatte, frag‐
te  er,  ob  sie  noch  etwas  wolle.  Eis!  Sie  schien  es  in  vollen  Zügen  zu 
genießen,  aß  aber  langsam.  Dabei  kleckerte  sie  auf  ihre  Nylon‐
strümpfe  —  ein  weißer  Fleck  mit  Erdbeerstückchen  krönte  ihr  Knie. 
Masako streckte den Zeigfinger aus, wischt das Eis weg und steckte 
den Finger genüsslich in den Mund. Dann zog sie das Bein dicht an 
ihren Körper heran und leckte den Rest mit der Zunge ab, wobei sie 
verführerisch  zu  Ando  aufschaute.  Ihre  Augen  funkelten  herausfor‐
dernd. Ando hielt ihrem Blick stand. Nachdem sie alles säuberlich ab‐
geschleckt hatte, richtete sie sich wieder auf. In dem Strumpf prangte 
ein  kleines  Loch  —  vermutlich  hatte  sie  es  mit  den  Zähnen 
verursacht. 
Erst heute Morgen hatte Ando ihr die Nylons geschenkt. Er hatte es 
nicht  länger  mit  ansehen  können,  dass  sie  bei  dieser  Kälte  mit 
nackten Beinen herumlief. Bevor sie losgefahren waren, hatte er sie in 
einem  kleinen  Laden  nahe  der  U‐Bahn‐Station  erstanden.  Masako 
hatte sie in einer Toilette angezogen. 
Das kleine Loch in der Strumpfhose ließ Masako keine Ruhe. Immer 
wieder strich sie mit ihren schmalen Fingern darüber. 
Ando  konnte  sich  an  diesem  Anblick  nicht  satt  sehen.  Diese  rätse‐
lhafte Frau macht mich ganz verrückt. Sie zieht mich voll und ganz in ihren 
Bann. 
Aber vielleicht war er ja nicht ihrem Charme erlegen, sondern ein‐
fach nur zutiefst verzweifelt. Vermutlich trug er das gefährliche Virus 
in sich, und es begann, allmählich seine Zellen zu attackieren. Warum 
musste er seine Nase auch nur in alles hineinstecken? Hätte ihn doch 
seine  Wissbegier  nicht  so  weit  getrieben  ...  vielleicht  hätte  er  dann 
den  Ring‐Bericht  nie  gelesen.  Wenn  man  in  Todesangst  war,  klam‐
merte man sich an einen anderen Menschen. Wahrscheinlich konnte 
er deshalb von Masako nicht genug bekommen. Er wollte seine letz‐
ten Stunden wenigstens in vollen Zügen genießen. 
Während  seiner  Studienzeit  hatte  er  einen  sehr  interessanten 
Roman gelesen. Die Handlung spielte in einem kleinen Bergdorf. Die 
Protagonistin  ähnelte  in  gewisser  Weise  Masako.  Sie  war  eine  Frau 
von atemberaubender Schönheit, hatte aber eine merkwürdige Art zu 
sprechen  und  verhielt  sich  ungewöhnlich.  Deshalb  hatten  sie  die 
Menschen  im  Dorf  als  verrückt  bezeichnet  und  vertrieben.  Ohne 
Dach über dem Kopf zog sie durch die Wälder, wurde schließlich das 
Spielzeug von lüsternen, liebestollen Männern, die keine Frau hatten. 
Durch  das  Leben  im  Wald  entwickelte  sie  eine  besonders  erotische, 
fast animalische Ausstrahlung. 
Ando hatte immer gedacht, dass eine solche Frau in einer Stadt nie 
zu finden wäre. Und nun saß mitten in Tokio eine vor ihm ... Masako 
umgab etwas Mysteriöses, Undurchdringliches, und zugleich war sie 
atemberaubend  schön  und  sinnlich  —  wenn  auch  natürlich  keine 
Wilde. 
Ando ging die Schlussszene des Romans durch den Kopf. Die schö‐
ne Wilde brachte mitten in den Bergen allein ein Kind zur Welt. Der 
erste Schrei des Neugeborenen hallte lange in ihm nach ... 
Das darf auf gar keinen Fall passieren. 
Er dachte an den vergangenen Abend. Seine sexuelle Erregung war 
so  groß  gewesen,  dass  er  vollkommen  den  Verstand  verloren  zu 
haben schien. Sich der Ekstase hingebend, war er überhaupt nicht auf 
die Idee gekommen, ein Verhütungsmittel zu benutzen. 
Noch  immer  bohrte  Masako  mit  ihrem  Finger  in  dem  Loch  in  der 
Strumpfhose und vergrößerte es dadurch. Ihre strahlend weiße Haut 
schimmerte durch. Das Loch wuchs und wuchs. 
Sanft legte Ando eine Hand auf ihr Knie. »Ich habe vorhin im Kino 
gesehen,  dass  du  die  Sätze  der  Hauptdarstellerin  nachgesprochen 
hast. Warum hast du das getan?« 
Statt zu antworten, sagte sie: »Bitte lass uns in eine Buchhandlung 
gehen.« 
So  war  es  immer.  Bewusst  wich  sie  Andos  Fragen  aus,  indem  sie 
das  Gespräch  auf  ein  anderes  Thema  lenkte.  Lediglich  ihr  Begehren 
brachte  sie  offen  zum  Ausdruck.  Gefangen  von  Masakos  Charme 
konnte Ando ihr jedoch keinen Wunsch ausschlagen. 
Sie  gingen  in  die  größte  Buchhandlung  auf  der  Ginza.  Über  eine 
Stunde  las  Masako  hier  und  dort  im  Stehen.  Ando  schlenderte  zwi‐
schen den Regalen herum, ohne etwas Bestimmtes zu suchen. Zufäl‐
lig entdeckte er neben der Kasse den Katalog des S‐Shogo Verlags, in 
dem die Neuerscheinungen des Monats angeboten wurden. Er nahm 
eines der kostenlosen Exemplare. 
Vielleicht  ist  ja  auch  Ryujis  Buch  in  der  Liste  aufgeführt,  dachte  er. 
Aufmerksam  blätterte  er  Seite  für  Seite  durch.  Doch  bevor  er  den 
Namen  Ryujis  finden  konnte,  zerrte  Masako  ihn  aus  der  Buch‐
handlung. 
»Wenn es dir nichts ausmacht, würde ich mir gern noch einen Kino‐
film ansehen.« Ihre Worte klangen zwar wie eine höfliche Bitte, aber 
es  war  klar,  dass  sie  keine  Widerrede  duldete.  Sie  hatte  Ando  am 
Ärmel gepackt und zog ihn hinter sich her. 
Während Ando den Katalog in seine Jacketttasche steckte, fragte er: 
»Welchen denn?« 
Ohne zu antworten, ging sie weiter. 
»Du  tust  mir  weh«,  jammerte  er,  während  sie  ihn  hinter  sich  her‐
zog. Erst jetzt bemerkte er die Zeitschrift in ihrer Hand. Seit gestern 
hatte sie nicht einen Yen ausgegeben. Wie selbstverständlich hatte sie 
ihn stets und überall zahlen lassen, ohne auch nur die geringsten An‐
stalten zu machen, ihren Teil zu übernehmen. Trotzdem hielt sie nun 
eine  Zeitschrift  in  der  Hand  ...  Vermutlich  hatte  sie  sie  einfach  mit‐
gehen lassen. Ja, ohne Zweifel, denn sonst wäre sie eingepackt. 
Masako hat gestohlen! 
Besorgt blickte Ando sich um. Doch niemand kam ihnen nachgelau‐
fen. Offensichtlich hatte sie die Zeitschrift geschickt aus dem Geschäft 
geschmuggelt. Ob sie es wert war? Wegen dreihundert Yen... 
Zum ersten Mal in seinem Leben hatte Ando das Gefühl, waghalsig 
und mutig zu sein. 
 

 
Ando  hatte  gerade  den  Haustürschlüssel  ins  Schloss  gesteckt,  als 
das  Telefon  klingelte,  aber  er  versuchte  nicht,  rechtzeitig  an  den 
Apparat  zu  gelangen.  Das  brachte  sowieso  nichts.  Sobald  man  die 
Hand  auf  den  Hörer  gelegt  hatte,  verstummte  das  Telefon.  Flüchtig 
warf er einen Blick auf die Uhr — kurz nach acht. Vermutlich war es 
Miyashita. 
Ando  betrat  den  Flur,  schaltete  Licht  und  Klimaanlage  an.  Es  sah 
noch  genauso  chaotisch  aus  wie  heute  Vormittag,  als  sie  das  Apart‐
ment  verlassen  hatten.  Überall  auf  dem  Boden  lagen  Kleidungs‐
stücke.  Offensichtlich  beabsichtigte  Masako,  auch  heute  Nacht  bei 
ihm zu bleiben. 
Sie hatten fast den ganzen Tag im Kino verbracht. Ando fühlte sich 
verspannt. Ein heißes Bad würde jetzt gut tun. Im Vorbeigehen warf 
er sein Jackett über den Garderobenständer. Den Katalog des S‐Shobo 
Verlags legte er auf das Nachttischchen. Dann begab er sich ins Bad. 
Er  krempelte  die  Ärmel  hoch,  spülte  die  Badewanne  aus  und  ließ 
wohl  temperiertes  Wasser  hinein.  Bald  war  der  Raum  von  Wasser‐
dampf  erfüllt.  Vermutlich  wollte  Masako  zuerst  baden.  Ando  ging 
zurück  ins  Zimmer.  Auf  dem  Bett  sitzend,  streifte  Masako  gerade 
ihre Nylons ab. 
»Möchtest du zuerst ein Bad nehmen?« 
Schweigend stand sie auf. In diesem Moment klingelte das Telefon 
erneut. Während Ando den Hörer aufnahm, verschwand Masako im 
Bad. 
Er  hatte  richtig  getippt:  Miyashita.  Vorwurfsvoll  zischte  sein 
Freund durch den Hörer: »Sag mal, wo steckst du denn den ganzen 
Tag?« 
»Ich war im Kino.« 
Miyashita stieß einen überraschten Ruf aus. »Im Kino?« 
»Ja, ich habe mir zwei Filme angeschaut.« 
»Mann, du hast Nerven ... setzt dich unbekümmert in ein Kino und 
guckst  stundenlang  Spielfilme.  Dein  dickes  Fell  möchte  ich  haben«, 
stieß Miyashita empört hervor. »Weißt du, wie oft ich es heute bei dir 
versucht habe?« 
»Ich  kann  doch  nicht  die  ganze  Zeit  zu  Hause  hocken,  nur  weil 
jemand anrufen könnte.« 
»Egal,  nun  habe  ich  dich  ja  endlich  erwischt.  Rate  mal,  wo  ich 
gerade bin.« 
Von wo könnte Miyashita wohl anrufen? Zu Hause war er auf keinen 
Fall. Im Hintergrund waren die Geräusche vorbeifahrender Autos zu 
vernehmen.  Also  rief  er  vermutlich  von  einer  Telefonzelle  auf  der 
Straße  an.  »Du  bist  doch  wohl  nicht  in  der  Nähe  und  willst  vorbei‐
kommen?«  Das  hätte  Ando  im  Moment  nun  gar  nicht  gepasst, 
angesichts einer nackten Frau in seinem Badezimmer. 
»Falsch  geraten!  Keine  Bange,  ich  rücke  dir  schon  nicht  auf  die 
Pelle. Du errätst es ja doch nicht — ich bin im Theater.« 
»Im Theater? Was machst du denn da?«, fragte Ando verblüfft. Ihm 
erst Vorhaltungen zu machen und dann selber sorglos im Theater zu 
sitzen — der hatte wirklich Nerven. 
»Ich bin bei den Leuten von Spielfreude.« 
Spielfreude ... Das war doch die Theatergruppe, der Sadako Yamam‐
ura einmal angehört hatte! »Wie bist du denn an die geraten?« 
»Du  erinnerst  dich  doch  an  gestern,  wie  erstaunt  wir  waren,  dass 
die  Schauplätze  des  Ring‐Berichts  ein  naturgetreues  Abbild  der 
Realität sind.« 
»Und?«  Den  Hörer  zwischen  Ohr  und  Schulter  geklemmt,  ging 
Ando zum Tisch, nahm einen Stift in die Hand und machte sich auf 
dem freien Platz des Verlagskataloges ein paar Notizen. Das half ihm 
immer,  seine  Gedanken  zu  ordnen.  Seit  Jahren  hatte  er  die  Ange‐
wohnheit, sich während des Telefonierens Stichpunkte zu machen. 
»Heute Morgen durchzuckte mich ein Geistesblitz. Mir wurde klar, 
dass wir etwas sehr Wichtiges noch nicht überprüft haben ... Das Ge‐
sicht einer bestimmten Person. Die Sache ließ mir keine Ruhe. Da wir 
ja  in  Tokio  sind,  habe  ich  mich  gleich  dahintergeklemmt  und  bin 
meinem Spürsinn gefolgt.« 
Allmählich  wurde  Ando  ungeduldig.  Was  wollte  ihm  Miyashita 
damit sagen? Konnte er nicht einfach mit der Sprache herausrücken? 
Immer dieses Vorgeplänkel, das brachte einen ja um den Verstand! 
»Spann mich nicht so auf die Folter. Du hast mich jetzt lange genug 
hingehalten, findest du nicht?« 
»Es geht um Sadako Yamamura«, sagte Miyashita. 
»Aber Sadako Yamamura ist 1966 gestorben ...« Ando schwieg. Was 
wollte Miyashita bei der Theatergruppe? Plötzlich begriff er. »Ach so, 
du wolltest ein Foto von ihr sehen.« 
Im Ring‐Bericht stand, dass der Reporter Yoshino von der Zeitung 
M die Gruppe aufgesucht hatte. Einem der Gründungsmitglieder war 
Sadako Yamamura sogar noch im Gedächtnis gewesen. Freundlicher‐
weise  hatte  er  Yoshino  eine  Kopie  ihres  Lebenslaufs  mitgegeben. 
Daran  waren  zwei  Schwarzweiß‐Fotografien  geheftet  gewesen,  ein 
Porträt und eine Ganzkörperaufnahme. 
»Endlich!  Mann,  hast  du  eine  lange  Leitung.  Das  war  die  einzige 
Möglichkeit, um an ein Foto von ihr heranzukommen.« 
Ando  hatte  aufgrund  des  Ring‐Berichts  eine  ziemlich  genaue 
Vorstellung,  wie  Sadako  Yamamura  aussah:  Sie  war  eine  zierliche, 
groß gewachsene Frau. Obwohl sie einen kleinen Busen hatte, war ihr 
Körper von makelloser Schönheit. Sie hatte ein bezaubernd hübsches 
Gesicht,  und  Augen  und  Nase  waren  perfekt  geformt.  Eine  Traum‐
frau, der man sich nicht zu nähern wagen würde, selbst wenn sie vor 
einem stünde. 
»Also, erzähl schon. Hast du ein Foto von ihr bekommen?«, fragte 
Ando. 
Tatsächlich war es Miyashita gelungen, sich eine Fotografie von ihr 
anzusehen.  Ando  vernahm  ein  tiefes  Seufzen  am  anderen  Ende  der 
Leitung. »Aber es ist anders«, sagte Miyashita. 
»Was ist anders?« 
»Ihr  Gesicht.«  Ando  wusste  nicht,  was  er  darauf  antworten  sollte. 
»Wie  soll  ich  es  sagen  ...  Es  war  ein  himmelweiter  Unterschied.  Die 
Frau  auf  dem  Foto  passte  absolut  nicht  zu  meiner  Vorstellung  von 
Sadako. Attraktiv war sie schon, aber ... ach, ich weiß auch nicht. Wie 
soll ich es dir nur erklären? Ich bin schon ganz durcheinander ... Ein 
Freund  von  mir  ist  Künstler,  er  malt  exzellente  Porträts.  Vor  Jahren 
einmal  habe  ihn  gefragt,  welches  Gesicht  für  ihn  eine  besondere 
Herausforderung  darstellen  würde,  weil  es  sich  nur  schwer  nach‐
zeichnen ließ. Daraufhin erklärte er, dass es so ein Gesicht nicht gebe. 
Jedes habe eine Besonderheit, deshalb sei es nicht schwierig, die Rea‐
lität aufs Papier zu bringen. Mit einer Ausnahme: das eigene Gesicht. 
Es sei unmöglich, ein originalgetreues Porträt von sich selbst anzufer‐
tigen,  weil  die  Vorstellung,  die  man  von  sich  selbst  habe,  immer 
durchkomme.  Man  sehe  sich  mit  anderen  Augen,  als  die  Umwelt 
einen  wahrnehme.  Am  Ende  wirke  ein  Selbstporträt  wie  das  Bildnis 
eines Fremden.« 
»Ja und?« Was hat das mit diesem Fall zu tun? 
»Das ging mir nur gerade durch den Kopf. Kann man es nicht auch 
auf das Video anwenden? Wie wir  wissen, wurde es nicht mit Hilfe 
einer  Kamera  aufgezeichnet.  Die  Bilder  entstanden  durch  die  Bewe‐
gungen von Sadakos Augen. Es sind die Bilder, die sie im Kopf hatte. 
Aber ...« 
»Aber was?« 
»...  sowohl  die  Landschaften  als  auch  die  Gesichter  der  anderen 
Personen waren realitätsgetreu.« 
»Ja, aber wir haben das Video doch gar nicht gesehen.« 
»Das  ist  schon  richtig,  aber  der  Ring‐Bericht  ist  sehr  visuell  ge‐
schrieben.  Beim  Lesen  hat  man  das  Gefühl,  vor  einem  Fernseher  zu 
sitzen — so ging es mir zumindest. Die verschiedenen Szenen zogen 
wie in einem Film vor meinem geistigen Auge vorüber.« 
Erneut spürte Ando Wut in sich aufsteigen. Dieses Gerede um den 
heißen Brei hatte er allmählich satt. »Nun komm endlich zum Punkt.« 
Miyashita  holte  tief  Luft.  »Manchmal  überlege  ich,  ob  wirklich 
Kazuyuki Asakawa den Bericht geschrieben hat.« 
Ja, aber wer sollte denn sonst ... 
Für eine Sekunde unterbrach ein Signalton das Gespräch. »Hör zu, 
meine  Telefonkarte  ist  gleich  leer.  Ich  faxe  dir  das  Foto  von  Sadako 
nach Hause, ist das okay?«, fragte Miyashita dann rasch. 
»Ja, kein Problem. Mein Fax hat eine gute Druckqualität.« 
»In ein paar Minuten hast du es. Ich möchte, dass du dir das Foto 
gleich  anschaust.  Es  interessiert  mich  brennend,  ob  du  auch  eine 
andere Vorstellung von ihr hattest, oder ob nur ich danebenlag.« 
 
Abrupt wurde die Verbindung unterbrochen. 
Den Hörer zwischen Kopf und Schulter geklemmt, starrte Ando auf 
das  Telefon.  Plötzlich  verstummte  auch  das  Geräusch  fließenden 
Wassers. Eine tiefe, undurchdringliche Stille breitete sich aus. Nur ein 
leichter  Windzug  ging.  Verwundert  blickte  Ando  zum  Fenster.  Es 
war leicht geöffnet. Durch den schmalen Spalt drang die winterliche, 
trockene Abendluft. Aus der Ferne vernahm er das wilde Hupen von 
Autos, ein barbarischer Ton. Im Zimmer breitete sich feuchte, warme 
Luft aus — der Wasserdampfaus dem Badezimmer. 
Was macht sie nur so lange im Bad? 
Leicht  irritiert  dachte  Ando  noch  einmal  über  Miyashitas  Worte 
nach. Er verstand gut, dass sein Freund nicht den ganzen Tag taten‐
los zu Hause herumsitzen wollte. Ando warf einen Blick auf das Fax‐
gerät. Vermutlich würde es noch ein paar Minuten dauern, bis Miya‐
shita das Foto schickte. 
Um die Zeit totzuschlagen, schaute er sich den Katalog des S‐Shobo 
Verlags  an.  Eine  Liste  aller  Neuerscheinungen  war  auf  der  letzten 
Seite  aufgeführt.  Sein  Interesse  galt  vor  allem  dem  Monat  Februar. 
Nur  einige  wenige  Titel  waren  genannt.  Ando  ging  die  Reihe  von 
oben durch. Tatsächlich wurde er fündig. Ungefähr in der Mitte der 
Aufzählung  stand  unter  Ryujis  Namen:  ›Struktur  des  Wissens‹.  In 
dem  Kommentar  wurde  das  Buch  als  herausragendes  Werk  der 
modernen Philosophie angeboten. Ryujis Buch befand sich zwischen 
einem Liebesroman und einem Essay mit dem Titel ›Ein Blick hinter 
die Kulissen des Fernsehens‹. Dadurch wirkte es noch trockener und 
anspruchsvoller.  Das  letzte  Werk  seines  Freundes  ...  Wie  schwierig  der 
Stoff  auch  sein  mochte,  Ando  würde  es  auf  jeden  Fall  lesen.  Als  er 
gerade  ein  Kreuzchen  neben  die  Ankündigung  setzen  wollte,  geriet 
ein anderes Wort in seinen Blickfang. 
Tausende  Gedanken  schössen  ihm  durch  den  Kopf.  Das  darf  doch 
nicht wahr sein! Entsetzen machte sich in ihm breit. Wie kam das dort 
hin?  Den  Stift  fest  umklammernd,  ließ  Ando  den  Blick  nach  unten 
wandern,  zur  Liste  mit  den  Titeln  der  Neuerscheinungen  im  Monat 
März. Zwar war sie etwas kleiner gedruckt, aber er schien sich nicht 
geirrt zu haben. Es war das dritte Buch von unten ... 
Spätestens  der  Name  des  Autors  beseitigte  die  letzten  Zweifel.  Im 
Katalog stand: 
Neuerscheinungen im März 
... 
... 
The  Ring,  Jun‐ichiro  Asakawa.  Der  Auftakt  einer  atemberaubenden 
Psycho‐Horror‐Saga. 
Ando glitt der Katalog aus den Händen. Jun‐ichiro hat offenbar allen 
Ernstes vor, den Ring‐Bericht zu veröffentlichen. 
Jetzt  erinnerte  Ando  sich  an  die  Begegnung  in  der  Launch  des  S‐
Shobo Verlags. Damals hatte er sich keinen Reim darauf machen kön‐
nen,  warum  Jun‐ichiro  ihm  aus  dem  Weg  gegangen  war.  Jetzt  war 
ihm  klar,  warum.  Jun‐ichiro  hatte  zu  diesem  Zeitpunkt  natürlich 
schon  gewusst,  dass  er  den  von  seinem  Bruder  verfassten  Ring‐
Bericht in  vermutlich  leicht überarbeiteter Fassung als seinen Roman 
herausbringen würde. Es gab nur eine Person, die den wahren Autor 
des Buches kannte: Ando. Aus  Angst, der Schwindel könnte aufflie‐
gen und seine Karriere als Schriftsteller zerstören, hatte er Ando ein‐
fach nicht beachtet, um ihm erst gar nicht die Möglichkeit zu geben, 
es vor allen Leuten ahnungslos herauszuposaunen. 
Ich muss verhindern, dass er das Buch an die Öffentlichkeit bringt, dachte 
Ando entschlossen. Bisher war noch nicht klar, welche Folgen es hat‐
te, den Ring‐Text zu lesen. Trotzdem durfte das Buch auf keinen Fall 
im  März  auf  den  Markt  kommen.  Ando  würde  alles  tun,  um  es  zu 
verhindern. Es war seine Pflicht als Arzt. 
Morgen früh wollten Miyashita und er sich einer Blutuntersuchung 
unterziehen.  Wenn  die  Ergebnisse  vorlagen,  hatten  sie  Gewissheit. 
Doch das konnte ein paar Tage dauern. Was, wenn ihre Befürchtun‐
gen sich bewahrheiteten und die Ergebnisse positiv waren? Wenn sie 
Träger  des  Ring‐Virus  waren?  Dann  würde  das  Erscheinen  des 
Buches  eine  verheerende  Katastrophe  über  die  Menschheit  bringen. 
Mit  teuflischer  Geschwindigkeit  würde  sich  das  Virus  wie  eine  Epi‐
demie in der Gesellschaft ausbreiten. Innerhalb kürzester Zeit gäbe es 
in Japan nur noch Träger des Virus, und es würde sich über die Lan‐
desgrenzen ausbreiten. Vermutlich würden mindestens zehntausend 
Buchexemplare  über  den  Ladentisch  gehen,  vielleicht  sogar  einige 
hunderttausend — das würde bedeuten, zehntausend oder hundert‐
tausend neue Träger des Killervirus. 
Ando  zitterte.  Er  sprang  auf  und  schloss  das  Fenster  zu.  Im  Flur 
entdeckte  er  Masako.  Ein  Handtuch  um  ihren  Körper  gewickelt, 
kramte sie mit einer Hand in ihrer Tasche. Sie schien etwas Bestimm‐
tes zu suchen, vielleicht frische Unterwäsche. 
Erneut klingelte das Telefon. Das musste Miyashitas Fax sein. Ando 
drückte auf ›Start‹. Sekunden später begann das Faxgerät zu rattern. 
Gedankenverloren beobachtete er, wie sich das weiße Blatt Zentime‐
ter für Zentimeter aus dem schwarzen Gehäuse schob. In diesem Mo‐
ment spürte er, dass Masako hinter ihm stand. Er wandte sich um. Sie 
trug  nur  einen  Slip  und  hatte  das  Handtuch  über  die  Schultern  ge‐
worfen. Ihr Gesicht war gerötet. Das Funkeln ihrer dunklen, feuchten 
Augen wirkte besonders reizvoll. Ando spürte das brennende Verlan‐
gen, seine Arme um ihren weichen, halbnackten Körper zu legen und 
ihre  Augen  zu  küssen.  Auf  der  einen  Seite  sanft  wie  ein  Engel,  auf 
der anderen mit einem starken, unbrechbaren Willen ... 
Das  Rattern  des  Faxgerätes  verstummte.  Vorsichtig  riss  Ando  das 
Blatt  ab,  setzte  sich  aufs  Bett  und  betrachtete  das  Papier.  Es  waren 
zwei  Fotos  abgebildet,  ein  Porträt  und  eine  Ganzkörperaufnähme 
von  Sadako.  Er  stieß  einen  lauten  Schrei  des  Entsetzens  aus.  Es 
bestand  nicht  nur  ein  himmelweiter  Unterschied  zwischen  der 
Vorstellung,  die  er  sich  aufgrund  des  Ring‐Berichts  von  Sadako 
gemacht  hatte,  und  dem,  was  er  auf  dem  Foto  sah,  sondern  es  war 
noch  viel  schlimmer:  Die  Frau  auf  den  Fotos,  die  Miyashita  ihm 
gefaxt hatte, war dieselbe, die in diesem Augenblick vor ihm stand. 
Masako war Andos Entsetzen nicht entgangen. Sie riss ihm das Fax 
aus der Hand und warf einen Blick auf die Fotos. All seine Kräfte ent‐
schwanden aus seinem Körper; wie ein kleines Kind, das von seiner 
Mutter gescholten wurde, saß er vor ihr. Alles war eine einzige große 
Lüge  gewesen  —  der  Name  Masako  Takano,  dass  sie  die  ältere 
Schwester von Mai war ... 
»Du bist Sadako Yamamura ... Du warst ...« 
Sie grinste, als amüsierte Andos Fassungslosigkeit sie. 
Plötzlich fiel ein schwarzer Vorhang vor Andos Augen. Zum ersten 
Mal in seinem Leben fiel er in Ohnmacht. 
 

 
Ando hatte das Bewusstsein für ungefähr eine Minute verloren. Der 
Schock  war  einfach  zu  groß  gewesen.  Eine  Frau,  die  seit  fünfund‐
zwanzig Jahren tot war — und er hatte zwei volle Tage mit ihr ver‐
bracht  und  vergangene  Nacht  mehrfach  mit  ihr  geschlafen.  Er  war 
nahe dran, den Verstand zu verlieren. 
Als  er  jetzt  wieder  zu  Bewusstsein  kam,  hatte  er  das  Gefühl,  ver‐
brannte Haut zu riechen. Zu seiner eigenen Verwunderung lag er auf 
dem  Rücken,  obwohl  er  eigentlich  nach  vorn  gekippt  war.  Seine 
Beine hingen über das Bett hinaus. Noch immer war er wie gelähmt 
von dem Schock und unfähig, sich zu bewegen. Ohne die Augen zu 
öffnen,  versuchte  er,  die  Lage  einzuschätzen.  Er  vernahm  das  Ge‐
räusch fließenden Wassers. Ob es aus seinem Bad kam? Es klang eher 
wie  ein  plätschernder  Bergfluss,  der  alle  anderen  Geräusche  der 
abendlichen  Stadt  übertönte.  Weder  die  Autobahn,  noch  Stimmen‐
gewirr auf den Straßen waren zu hören. 
Vorsichtig  öffnete  er  die  Augen  einen  Spalt  breit.  Sein  Apartment 
war  hell  erleuchtet.  Vorsichtig  ließ  er  die  Augen  durch  den  Raum 
wandern.  Die  Luft  schien  rein  zu  sein.  Langsam  richtete  er  sich  auf. 
Niemand war zu sehen. Ein Stein fiel ihm vom Herzen. Er war schon 
gewillt,  das  Ganze  als  eine  Vision,  einen  schrecklichen  Albtraum 
abzutun,  als  das  Geräusch  fließenden  Wassers  plötzlich  abbrach. 
Erschrocken hielt er den Atem an. 
Im  Flur...  Da  war  sie  wieder.  Mit  einem  feuchten  Handtuch  in  der 
Hand kam sie, noch immer splitterfasernackt — abgesehen von dem 
kleinen Slip — auf Ando zu. 
Ando  wollte  laut  schreien,  aber  er  brachte  keinen  Laut  heraus. 
Lächelnd  reichte  Sadako  ihm  das  nasse  Tuch.  Er  stieß  ihren  Arm 
beiseite  und  sprang  auf.  Da  er  noch  immer  wacklig  auf  den  Beinen 
war, lehnte er sich gegen die Wand. 
Sadako  Yamamura  ...  Was  wusste  er  über  diese  Frau  eigentlich?  Sie 
war jene Frau, die vor fünfundzwanzig Jahren in einen dunklen, alten 
Brunnen  geworfen  worden  und  dort  elend  zugrunde  gegangen  war 
... die Gedankenbilder auf ein Video projiziert hatte ... die über außer‐
gewöhnliche,  paranormale  Fähigkeiten  verfügte  ...  die  ein  mensch‐
licher Zwitter war. Ando ließ den Blick nach unten wandern. In dem 
knappen  weißen  Slip  konnte  er  keine  Ausbeulung  erkennen.  Selbst 
wenn  sie  Hoden  haben  sollte,  von  außen  waren  sie  nicht  zu  sehen. 
Auch  war  ihm  gestern  Abend  nichts  Ungewöhnliches  aufgefallen. 
Ando  hatte  sie  mehrfach  berührt.  Andererseits  hatte  er  ihre  Genita‐
lien  nicht  gesehen.  Es  hatte  absolute  Dunkelheit  geherrscht.  Jetzt  be‐
griff er auch, warum sie so viel Wert darauf gelegt hatte, das Zimmer 
zu verdunkeln ... 
Woher  kam  sie?  Was  wollte  sie?  So  viele  Fragen  ...  Er  wollte  ihr 
Antworten  abverlangen,  doch  seine  Energie  reichte  gerade  mal  zum 
Atmen. Wenn er sich nicht konzentrierte, würde er vermutlich gleich 
wieder  umfallen.  Nur  das  nicht!  Dann  wäre  er  ihr  vollends  ausge‐
liefert. Jetzt war er wenigstens in Bezug auf die Körpergröße im Vor‐
teil — er konnte auf sie herabblicken. Das vermittelte ihm das Gefühl, 
zumindest einen letzten Funken Würde zu wahren. 
Fassungslos  starrte  Ando  ihr  ins  Gesicht.  Ihre  Haut  schimmerte 
weiß unter der Neonröhre. Sie bestand definitiv aus Fleisch und Blut. 
Wie ein übersinnliches Phantom wirkte sie nicht gerade. Dennoch ... 
Was konnte er tun, um sich ihr zu entziehen? Darauf gab es nur eine 
Antwort: die Flucht ergreifen. Vor seinen Augen stand ein Gespenst... 
eine  Frau,  die  nach  fünfundzwanzig  Jahren  vom  Tod  auferstanden 
war. 
An  der  Wand  entlang  rutschte  er  Zentimeter  für  Zentimeter  nach 
rechts. Sein Ziel war der Flur. Sadako folgte seinen Bewegungen mit 
den  Augen,  stellte  sich  ihm  aber  nicht  in  den  Weg.  Jetzt  kam  die 
Haustür in sein Blickfeld. Verzweifelt überlegte Ando, ob er sie abge‐
schlossen hatte. Nein, daran hätte er sich erinnert. Vorsichtig entfern‐
te er sich Stück für Stück von Sadako. 
Als etwa zwei Meter zwischen ihnen lagen, rannte er wie der Blitz 
los.  Ohne  sich  umzudrehen,  stürzte  er  hastig  die  Treppen  hinunter. 
Erst  als  er  auf  der  Straße  angekommen  war,  blieb  er  für  einen 
Moment  stehen  und  überprüfte,  ob  ihm  das  Monster  gefolgt  war. 
Nein. Seine Fenster waren nach wie vor hell erleuchtet. Er rannte in 
Richtung Bahnhof weiter. 
Ein eisiger Wind schlug Ando entgegen. Inzwischen war er bis auf 
die  Knochen  durchgefroren.  Ein  bestimmtes  Ziel  hatte  er  nicht.  Es 
musste  nur  hell  und  von  Menschen  besucht  sein.  Die  Hochhäuser 
von Shinjukus waren um diese Uhrzeit nur noch schwarze Schatten; 
selbst an der Sangubashi‐Station schienen kaum noch Menschen un‐
terwegs zu sein. Dennoch hatte Ando das Gefühl, dort sicher zu sein. 
Er verließ die schmale Gasse und betrat die Geschäftsstraße, wo hier 
und dort noch ein Laden geöffnet hatte, trotz des Feiertages. 
Nach wenigen Minuten erreichte er die U‐Bahn Station. Doch als er 
am Automaten einen Fahrschein lösen wollte, stellte er mit Entsetzen 
fest, dass er seine Brieftasche nicht bei sich hatte. Ich werde auf keinen 
Fall umkehren und sie holen. Nein, lebensmüde hin ich nun wirklich nicht. 
Verzweifelt suchte Ando seine Taschen nach Geld ab. Dabei fiel ihm 
sein Führerschein in die Hände. Erst gestern hatte er ihn für die Tour 
mit Miyashita eingesteckt. Glück gehabt! Denn er hatte immer einen 
Notgroschen darin. 
Fünftausend  Yen  ...  Das  war  alles.  Nicht  gerade  viel.  Wo  sollte  er 
heute Abend unterkommen? Damit konnte er sich nicht mal ein Zim‐
mer  in  einer  billigen  Absteige  nehmen.  Es  gab  nur  einen  Menschen, 
den er um Hilfe bitten konnte: Miyashita. 
 

 
Ando  kaufte  sich  ein  Ticket,  dann  suchte  er  eine  Telefonzelle.  Ob‐
wohl er nicht davon ausging, dass Miyashita schon wieder zu Hause 
war, wählte er dessen Nummer. Wie vermutet war er noch nicht zu‐
rück. Klar, er hatte ihn ja erst vor kurzem aus Yotsuya angerufen und 
befand  sich  womöglich  gerade  auf  dem  Heimweg.  Ando  beschloss, 
zu Miyashitas Wohnung in Tsurumi zu fahren. 
Es  war  kurz  nach  einundzwanzig  Uhr.  Ando  drückte  sich  tief  in 
den  Sitz  der  U‐Bahn.  Kaum  hatte  er  die  Lider  geschlossen,  tauchte 
Sadakos Gesicht vor seinem geistigen Auge auf. Noch nie in seinem 
Leben  hatten  sich  seine  Gefühle  einer  Frau  gegenüber  in  so  kurzer 
Zeit derart drastisch verändert. Als er ihr das erste Mal begegnet war, 
hatte ihn ein eisiger Kälteschauer erfasst. Ein übernatürliches Phäno‐
men  ...  Merkwürdigerweise  waren  diese  Ängste  bei  ihrem  nächsten 
Treffen  vollkommen  verflogen  gewesen,  vielmehr  hatte  ihn  ihre  un‐
heimliche Sinnlichkeit angezogen. Und schließlich waren seine Hoff‐
nungen in Erfüllung gegangen ... Er war gerade auf dem besten Weg 
gewesen,  sich  in  sie  zu  verlieben,  als  ihm  klar  geworden  war,  mit 
wem er da geschlafen hatte: mit einer Frau, die vor fünfundzwanzig 
Jahren gestorben war. Er kam sich beinahe wie ein Leichenschänder 
vor. 
Wo  kam  Sadako  nur  her?  War  sie  damals  vielleicht  doch  nicht 
gestorben? Oder war von den Toten auferstanden? War das überhaupt 
möglich? 
Der  Zug  war  wegen  des  Feiertages  relativ  leer,  nur  wenige  Fahr‐
gäste  mussten  stehen.  Ando  saß  einem  Arbeiter  gegenüber,  der  für 
sich allein gleich drei Sitzplätze beanspruchte. Obwohl er die Augen 
weitgehend  geschlossen  hielt,  schlief  er  nicht.  Aus  den  schmalen 
Schlitzen beobachtete er die Mitreisenden. Er hatte trübe Augen, man 
konnte nur schwer sagen, ob sie lebten oder tot waren. Ando wandte 
unangenehm berührt den Blick ab. Doch wohin er auch schaute, alle 
Fahrgäste hatten die bleichen Gesichter von Leichen. Er umfasste mit 
den Händen seine Schultern, um das heftige Zittern zu unterbinden. 
Dankend nahm Ando den Brandy von Miyashita entgegen, ließ den 
ersten  Schluck  die  Kehle  hinunterlaufen  und  trank  dann  den  Rest. 
Allmählich begann er sich von dem Schock zu erholen, wenngleich er 
noch immer zitterte. 
»Wie geht es dir? Ist es jetzt besser?«, fragte Miyashita besorgt. 
»Zumindest lebe ich noch.« 
»Du musst ja völlig durchgefroren sein.« 
Miyashita war noch nicht im Bilde — er führte das Zittern auf die 
Eiseskälte und Andos unpassende Bekleidung zurück. 
»Die Kälte ist nicht das Problem.« 
Miyashita  hatte  Ando  ins  Arbeitszimmer  geführt.  Zusammenge‐
kauert saß dieser auf dem Liegesofa in der Ecke. Hier würde er heute 
Nacht  vermutlich  schlafen.  Nachdem  er  das  zweite  Glas  Brandy 
hinuntergekippt hatte, kam er allmählich zur Ruhe. 
»Was ist passiert?«, fragte Miyashita. 
Nun  erzählte  Ando  in  allen  Einzelheiten,  was  sich  in  den  letzten 
zwei  Tagen  ereignet  hatte.  Kaum  hatte  er  das  letzte  Wort  ausge‐
sprochen, legte er den Kopf auf das Kissen. Dann sagte er matt: »Egal, 
wie sehr ich alles bereue, jetzt ist es zu spät. Die Uhr lässt sich nicht 
mehr zurückdrehen.« 
Andos  Geschichte  hatte  Miyashita  vollkommen  erschüttert.  Zit‐
ternd schütterte Miyashita Brandy in seinen heißen Kaffee und nippte 
daran.  Nachdenklich  sagte  er:  »Die  Frage  ist:  Woher  kommt  diese 
Sadako Yamamura so plötzlich?« Er machte den Eindruck, als wüsste 
er die Antwort bereits. 
»Du hast eine Ahnung, oder? Sag schon, was vermutest du?« 
»Denk doch mal nach. Du weißt die Antwort, da bin ich  mir ganz 
sicher.« 
»Woher denn?«, entgegnete Ando und schüttelte den Kopf. Er war 
den Tränen nahe. 
»Hast du wirklich keine Idee?« 
»Ich sage doch, ich habe nicht den leisesten Schimmer.« 
»Was ist mit Mai Takano? Ich bin davon überzeugt, dass sie Sadako 
in die Welt gesetzt hat.« 
Ando  verschlug  es  den  Atem.  Das  konnte  doch  nicht  sein  ...! 
Fieberhaft suchte er nach anderen Erklärungen, doch in seinem Kopf 
war nur ein großes schwarzes Loch, und er konnte keinen klaren Ge‐
danken fassen. »Mai Takano hat sie in die Welt gesetzt?«, wiederholte 
er nur. 
»Das  Video  ist  durch  die  Willenskraft  von  Sadako  Yamamura 
entstanden.  Als  Mai  sich  das  Band  angesehen  hat,  war  sie  gerade 
empfängnisbereit.  Das  Ring‐Virus  ist  in  ihren  Körper  eingedrungen, 
hat  die  reife  Eizelle  befruchtet  und  dafür  gesorgt,  dass  Sadakos 
Zellkern den von Mai in der Eizelle verdrängt.« 
»Kannst du dich vielleicht etwas deutlicher ausdrücken?« 
»Du erinnerst dich doch an die Ergebnisse der DNA‐Untersuchung 
des mysteriösen Erregers. Demnach stellt unser Killervirus eine gene‐
tische Kombination aus Pocken und einem menschlichen Gen dar.« 
Ando richtete sich auf und griff nach dem Brandyglas. Doch es war 
leer. »Das menschliche Gen ...« 
»Sadakos  Erbinformationen  waren  in  einige  hunderttausend  Teile 
zersplittert.« 
»Das  heißt,  einige  hunderttausend  Ring‐Viren  transportierten  die 
verschiedenen  Gene  von  Sadako  ...  Habe  ich  dich  da  richtig 
verstanden? Das Ring‐Virus hat Sadakos Gene in die einzelnen Zellen 
hineingepackt.« 
Ein  Virus  allein  konnte  die  komplette  DNA‐Information  eines 
Menschen nicht transportieren. Die ›Datei‹ war viel zu groß. Aber die 
menschliche  DNA  ließ  sich  in  einige  hunderttausend  Teile  zerlegen. 
Wenn nun ein Virus jeweils nur einen Teil der DNA transportierte ... 
Unter  dem  Elektonenmikroskop  hatte  es  nur  so  von  Ring‐Viren 
gewimmelt.  Offenbar  waren  sie  mit  Sadakos  Genen  in  Mais  Eizelle 
eingedrungen. 
»Aber  Sadako  Yamamura  ist  vor  fünfundzwanzig  Jahren  ge‐
storben!«, sagte Ando. »Es ist unmöglich, dass ihre Erbinformationen 
plötzlich wieder auftauchen!« 
»Das  ist  der  springende  Punkt.  Warum,  glaubst  du,  hat  sie  ihre 
Gedankenbilder auf das Video projiziert?« 
Die  alles  entscheidende  Frage  war:  Was  hatte  Sadako  Yamamura 
sich in dem Brunnen kurz vor ihrem Tod gewünscht? Ein gewaltiger 
Hass  auf  die  Gesellschaft  hatte  sich  in  ihr  angestaut,  den  sie  auf  die 
Bilder  des  Videos  übertrug.  Damit  wollte  sie  jedem  Menschen,  der 
sich  den  Film  ansah,  eine  Höllenangst  einjagen.  Aber  warum?  Was 
hatte sie davon? Offenbar kam den Bildern noch eine zweite wichtige 
Funktion  zu  —  doch  Ando  hatte  keine  Ahnung,  was  Miyashita  da 
anzudeuten versuchte. 
»Sie war erst neunzehn ...«, half Miyashita nach. 
»Ja, und?« 
»Es liegt doch auf der Hand. Sie wollte noch nicht sterben.« 
»Sie war noch zu jung ...« 
»...  und  deshalb  hat  sie  ihre  gesamte  genetische  Information  und 
Energie zurückgelassen.« 
Ando seufzte, ohne etwas zu sagen. Sie hat die eigenen Gen‐Informa‐
tionen in die Bilder hineinschleust? So verrückt sich das anhören mochte 
— auch Ryuji Takayama hatte seine Basenfolge verändert, um mit der 
Nachwelt  zu  kommunizieren  und  ihr  das  Wort  ›Mutation‹  zu  über‐
mitteln. Dennoch zweifelte Ando daran. Ein Mensch verfügte über so 
viele Gen‐Informationen, dass sie sich doch unmöglich auf einem ein‐
zigen Videoband unterbringen ließen. »Das funktioniert nicht«, sagte 
er.  »Denk  doch  mal  dran,  über  wie  viele  Erbinformationen  ein 
Mensch verfügt.« 
Miyashita  hob  die  Arme  seitwärts  und  streckte  die  Zeigefinger  in 
beide  Richtungen  des  Zimmers.  »Wenn  du  alle  Gegenstände  in 
diesem Raum fest halten müsstest, wie würdest du das anstellen?« 
Miyashitas Arbeitszimmer war nicht sehr groß. Neben dem Sofa be‐
fand  sich  ein  wuchtiger  Schreibtisch.  Darauf  standen  ein  Computer, 
Lexika  und  viele  Bücher.  Die  größte  Herausforderung  wäre  das 
Bücherregal.  Von  literaturwissenschaftlichen  Romanen  bis  hin  zu 
medizinischen  Fachbüchern  füllten  sicher  tausend  Werke  das  Regal. 
Würde man nur Titel und Autor notieren, brauchte man dafür einen 
Tag. 
»Es gibt eine Fülle von Informationen in diesem Raum«, sagte Ando 
nachdenklich. 
Miyashita nahm die Haltung eines Fotografen ein. »Und Klick. Auf 
einem  einzigen  Foto  kann  man  die  Atmosphäre  in  diesem 
Arbeitszimmer einfangen. Nun stell dir eine Abfolge von Bildern vor 
...  Da  lassen  sich  eine  Menge  Informationen  verschlüsseln.  Sadako 
Yamamura  hat  ihre  Gene  als  Kode  auf  das  Video  übertragen  —  das 
ist meine Hypothese.« 
Ando  begriff  zwar,  was  Miyashita  sagte,  wollte  es  aber  noch  nicht 
glauben. »Gib mir eine Minute, um darüber nachzudenken.« 
»In  Ordnung.  Ich  vertrete  mir  inzwischen  die  Beine.«  Miyashita 
verließ das Zimmer. 
Mal abgesehen davon, dachte Ando, ob Miyashitas Hypothese nun 
zutraf  oder  nicht,  eines  stand  fest:  Mai  Takano  war  von  dem  Virus‐
Samen befruchtet worden, und eine Woche später war Sadako Yama‐
mura  wiedergeboren  worden.  Das  waren  Tatsachen.  Doch  was  ihn 
stutzig  machte,  war  die  kurze  Zeit  —  nur  sieben  Tage  —  zwischen 
Befruchtung  und  Geburt.  Das  hieß,  die  Zellteilung  musste  sich  in 
einem  rasanten  Tempo  vollzogen  haben.  Der  Zellkern  enthielt  Nu‐
kleinsäure; nur wenn diese sich über einen bestimmten Wert hinaus 
vermehrte, kam es zu einer Zellteilung. Mit anderen Worten, um die 
Zellteilung  schnell  voranzutreiben,  musste  der  Zellkern  mit  ausrei‐
chend Nukleinsäure versorgt werden. Das Ring‐Virus hatte offenbar 
für diesen Prozess gesorgt. In der Folge war es zu einem unvorstell‐
bar schnellen Wachstumsprozess der Eizelle zu einem ausgewachse‐
nen Embryo gekommen. 
Ando  erinnerte  sich  wieder  an  das  Erlebnis  in  Mais  Apartment. 
Alles hatte daraufhingedeutet, das niemand zu Hause war. Trotzdem 
hatte  er  einen  starken  Impuls  gespürt.  Also  hatte  ihn  sein  Gefühl 
nicht  getäuscht.  Sadako  Yamamura  hatte  sich  vielleicht  irgendwo 
versteckt  —  sie  war  ja  gerade  erst  geboren  worden,  also  noch  sehr 
klein. Es gab viele Verstecke: hinter der Kleiderstange, im Badschrank 
... Ando hatte natürlich nicht überall nachgeschaut. Sein Sturz im Bad 
... Sadako war ja noch ein kleines Mädchen, vermutlich hatte sie über 
ihn  gelacht.  Das,  was  ihn  am  Bein  berührt  hatte,  könnte  ihre  Hand 
gewesen sein. 
Sie  hatte  sich  in  Mais  Apartment  eingenistet  und  war  in  nur  einer 
Woche  unbeobachtet  zur  Frau  herangewachsen  ...  Als  Ando  zum 
zweiten  Mal  vor  der  Wohnung  gestanden  hatte,  war  er  der  voll 
entwickelten Sadako Yamamura begegnet. 
So  ungefähr  musste  es  sich  abgespielt  haben.  Allmählich  ließen 
Andos  Zweifel  an  Miyashitas  Hypothese  nach.  Alles  schien  sich 
ineinander zu fügen. 
Aber wie ging es weiter? Wenn Sadako ähnlich schnell alterte, wie 
sie  herangewachsen  war,  würde  ihre  Lebenserwartung  bei  wenigen 
Wochen  liegen.  Sie  war  im  November  wiedergeboren  worden,  also 
vor etwa zehn Wochen. Doch ihre  Haut war die eines neunzehnjäh‐
rigen  Mädchens.  Bedeutete  das  vielleicht,  dass  sie  nur  bis  zu  dem 
Alter, in dem man sie umgebracht hatte, so schnell herangewachsen 
war,  der  Alterungsprozess  von  nun  aber  wie  bei  anderen  Menschen 
verlief? 
Miyashita  betrat  das  Zimmer  wieder.  »Wir  dürfen  einen  Aspekt 
nicht aus den Augen verlieren: Das Pockenvirus spielt eine Schlüssel‐
rolle.« 
»Das  Pockenvirus  und  Sadako  Yamamura  haben  einen  teuflischen 
Pakt geschlossen.« 
Kurz  bevor  Sadako  Yamamura  gestorben  war,  war  sie  durch  Dr. 
Nagao mit dem Pockenvirus infiziert worden. In dem alten Brunnen 
unter  der  Blockhütte  B‐4  hatten  sich  der  Hass  einer  Frau  auf  die 
Gesellschaft, die ihre Eltern und sie selbst in den Tod getrieben hatte, 
und der Hass des Pockenvirus auf die menschliche Intelligenz, die es 
ausgerottet  hatte,  zu  einer  gewaltigen,  übermenschlichen  Macht 
vereint. 
Beide waren vernichtet worden. Vermutlich war es ihr sehnlichster 
Wunsch gewesen, irgendwann wiedergeboren zu werden. 
»Das  ist  ein  wichtiger  Punkt«,  meinte  Miyashita.  »Sag  mal  ... 
glaubst du wirklich, das Jun‐ichiro Asakawa den Ring‐Bericht veröf‐
fentlichen will?« 
»Daran  besteht  kein  Zweifel.  In  dem  Verlagskatalog  wurde  er  als 
Neuerscheinung angekündigt.« 
»Hm.  Sadako  Yamamura  und  das  Pockenvirus  ...  Wenn  wir  die 
These  weiterverfolgen,  dass  sich  die  DNA‐Stränge  von  Sadako  und 
dem  Pockenvirus  in  dem  Video  vereint  haben,  ist  es  denkbar,  dass 
sich die Doppelhelix irgendwann wieder entspiralisiert und evolutio‐
niert ...« 
Miyashita  hatte  den  Nagel  auf  den  Kopf  getroffen.  Viren  waren 
Grenzfälle  zwischen  Leben  und  Nicht‐Leben.  Noch  immer  stritt  die 
Wissenschaft,  ob  sie  zu  den  lebenden  Organismen  zu  zählen  waren 
oder nicht. Ein Virus bestand im Wesentlichen aus einer Proteinhülle 
und  einem  Genom  und  veränderte  sich  den  Umweltverhältnissen 
entsprechend.  Vor  diesem  Hintergrund  schien  der  Gedanke,  dass  es 
zu einer Buchform mutiert sein könnte, gar nicht mal so abwegig. 
»Das  ist  der  Grund,  weshalb  Kazuyuki  Asakawa  nicht  wegen  des 
Videos gestorben ist.« 
Damit waren sie der Lösung des mysteriösen Rätsels einen gewalti‐
gen Schritt vorangekommen. Es gab also zwei ›Wiedergeburten‹: Sa‐
dako Yamamura und den Ring‐Bericht. Kazuyuki Asakawa und Mai 
Takano waren nicht an einem plötzlichen Herzanfall gestorben, weil 
sie  sie  hervorgebracht  hatten.  Das  Virus,  das  in  Mais  Körper  einge‐
drungen  war,  hatte  sich  in  ihrer  Gebärmutter  eingenistet,  und  das 
Virus,  das  Asakawas  Organismus  befallen  hatte,  war  in  sein  Gehirn 
gewandert.  Den  Ring‐Bericht  hatte  nicht  Kazuyuki  Asakawa  ge‐
schrieben — er war nur das Werkzeug gewesen. Der Befehl war von 
Sadakos DNA gekommen. Deshalb waren Szenerie und Gesichter mit 
einer derartigen Präzision geschildert, wie sie sonst nur mit Hilfe ei‐
ner Videokamera zu erreichen gewesen wäre. Lediglich die Beschrei‐
bungen der Protagonistin, Sadako Yamamura, stimmten nicht mit der 
Realität  überein.  So  ähnlich,  wie  der  Kameramann  bei  einer  Video‐
aufnahme  nicht  mit  auf  den  Film  kam,  hatte  sie  sich  selbst  nicht 
originalgetreu wiedergeben können. 
Ando  und  Miyashita  schwiegen.  Beide  hingen  ihren  Gedanken 
nach. Was folgte wohl als Nächstes? Und was bedeutete das alles für 
die Zukunft der Menschheit? 
Das  Schlüsselwort  lautete:  handeln!  Zunächst  mussten  sie  die 
Veröffentlichung des Ring‐Berichts verhindern. Vermutlich hatte Jun‐
ichiro  Asakawa  keine  Ahnung,  was  er  der  Menschheit  mit  seinem 
Egoismus  anzutun  im  Begriff  war.  Ihn  mussten  sie  als  Erstes  in  die 
Mangel nehmen. Die Frage war nur, ob er ihnen zuhören und, falls ja, 
sich  nach  ihnen  richten  würde.  Man  konnte  kaum  erwarten,  dass 
irgendjemand ihnen diese verrückte Geschichte abkaufte. 
»Lass uns gehen.« Miyashita schlug sich auf die Schenkel und stand 
auf. 
»Gehen? Wohin?« 
»Na, zu dir natürlich.« 
»Aber dieses Monster lauert doch in meinem Apartment!« 
»Deshalb gehen wir hin. Wir werden uns Sadako stellen.« 
Bei  diesem  Gedanken  wurde  Ando  ganz  mulmig  zumute.  »Warte, 
warte ...« Er hatte eigentlich nicht vorgehabt, so bald in die Höhle des 
Löwen zurückzukehren. 
»Wir  haben  keine  Zeit  zu  verlieren.  Siehst  du  das  denn  nicht  ein? 
Wir stecken viel zu tief drin. Wir sind schon lange keine Beobachter 
mehr, sondern Teilnehmer an einem teuflischen Spiel.« 
Miyashita hatte Recht. Sie standen mittendrin. Und was hatte er im 
Gegensatz zu Miyashita schon zu verlieren? 
Miyashita  packte  Ando  am  Arm  und  zog  ihn  hoch.  »Los,  mach 
schon. Vermutlich ist das die letzte Chance, unser Leben zu retten.« 
»Die letzte Chance?« 
»Es  muss  einen  Grund  dafür  geben,  dass  Sadako  Yamamura  dir 
gefolgt ist.« 
»Das glaube ich allerdings auch.« 
»Irgendetwas will sie von dir.« 
»Aber was?« 
»Weiß  ich  auch  nicht.  Aber  wir  werden  es  schon  herausfinden.« 
Plötzlich fiel Ando ein, was sie gesagt hatte, als sie sich zum zweiten 
Mal  begegnet  waren:  »Ich  werde  zu  gegebener  Zeit  auf  Sie  zurück‐
kommen.«  Er  hatte  keinen  blassen  Schimmer,  was  dieses  Monster 
von ihm wollte. Andererseits hatte er auch nicht das Bedürfnis, es in 
Erfahrung zu bringen ... 
 

 
Miyashita  stellte  den  Wagen  in  der  Nähe  des  Yoyogi‐Parks  ab. 
Kaum  waren  sie  ausgestiegen,  wanderten  ihre  Blicke  gespannt  nach 
oben.  Doch  in  keinem  der  Fenster  von  Andos  Apartment  brannte 
Licht. Seit er seine Wohnung fluchtartig verlassen hatte, waren über 
vier  Stunden  vergangen.  Jetzt  war  es  kurz  vor  ein  Uhr  nachts  und 
stockfinster. 
»Ob sie noch da ist?«, fragte Miyashita mit gedämpfter Stimme. 
»Vielleicht  schläft  sie.«  Sie  mussten  in  die  Wohnung,  um  sich 
Gewissheit zu verschaffen. 
»Offensichtlich  braucht  selbst  ein  Monster,  das  durch  seine  eigene 
Kraft  wiedergeboren  wurde,  ein  paar  Stunden  Schlaf«,  bemerkte 
Miyashita trocken. 
Noch  immer  standen  sie  auf  der  menschenleeren  Straße  und 
blickten auf die Fenster in der dritten Etage. 
»Lass  uns  gehen.«  Zielsicher  bewegte  sich  Miyashita  auf  den 
Eingang des Hauses zu. Ando folgte ihm schweigend. Wäre die eisige 
Kälte inzwischen nicht unerträglich geworden, hätte er die Rückkehr 
in seine Wohnung so lange wie möglich hinausgezögert. 
Miyashita schob Ando vor. Vorsichtig drehte dieser den Türgriff. Es 
war nicht abgeschlossen. Voller Angst setzte Ando einen Fuß in den 
Flur.  In  der  Wohnung  schien  sich  niemand  zu  befinden.  Sowohl 
Sadakos Pumps als auch ihre Tasche waren verschwunden. 
Ando betrat das Wohnzimmer und knipste das Licht an. Im Bett lag 
sie auch nicht. Erleichtert ließ er sich darauffallen. Miyashita dagegen 
lief wie ein Detektiv umher und inspizierte jeden Winkel, schaute auf 
dem Balkon nach. 
»Sie scheint nicht mehr hier zu sein«, sagte er schließlich. 
»Wahrscheinlich  hat  sie  sich  ein  anderes  Plätzchen  gesucht«, 
murmelte Ando gleichgültig. 
Ihm war es völlig egal, wo sich Sadako Yamamura gerade aufhielt 
— Hauptsache weit weg von ihm. Er wollte nie wieder etwas mit ihr 
zu tun haben. 
»Hast du eine Idee, wo sie hingegangen sein könnte?« 
»Nein.«  Ando  schüttelte  den  Kopf.  Dabei  fiel  sein  Blick  auf  den 
Tisch vor dem Fenster. War das nicht sein Notizbuch? Das hatte doch 
vorhin nicht dort gelegen. Und warum war es aufgeschlagen? Ando 
konnte  sich  nicht  erinnern,  es  in  letzter  Zeit  benutzt  zu  haben.  Er 
sprang  auf  und  nahm  das  Notizbuch  in  die  Hand.  Dort  stand  eine 
Nachricht  für  ihn  —  eine  Nachricht  von  Sadako  Yamamura.  Stumm 
las er die erste Zeile. Dann reichte er das Notizbuch Miyashita. 
»Was ist das?« 
»Eine Nachricht von Sadako Yamamura.« 
»Oh!« Miyashita begann vorzulesen: 
 
Ando, 
ich muss dir einen höllischen Schrecken eingejagt haben. Um deine Nerven 
nicht weiterzustrapazieren, habe ich mich entschieden, dir nach alter Tradi‐
tion einen Brief zu schreiben. Bitte lies ihn mit kühlem Kopf. 
Inzwischen wirst du das Geheimnis gelüftet haben. Ich habe mich des Kör‐
pers einer anderen Frau bemächtigt und bin wiedergeboren worden. Wie das 
letztendlich funktioniert hat, weiß ich selbst nicht so richtig. 
Oft habe ich mich mit meinem kranken Vater, der Assistenzarzt war, wäh‐
rend meiner Besuche im Sanatorium über Genetik unterhalten. Deshalb bin 
ich  auf  diesem  Gebiet  auch  nicht  ganz  unbedarft.  Für  dich  mag  es  nach 
einem  wissenschaftlichen  Märchen  klingen,  aber  bevor  ich  starb,  habe  ich 
durch  den  Einsatz  meiner  fünf  Sinne  Bilder  auf  ein  Video  projiziert,  die 
verschlüsselt  meine  genetischen  Informationen  enthielten.  Sicherlich  waren 
übersinnliche Kräfte mit im Spiel. Wenn ich heute darüber nachdenke, war 
es gar nicht mal so sehr mein Wunsch, wiedergeboren zu werden. Ich wollte 
lediglich meine genetischen Informationen auf dieser Welt hinterlassen. Der 
Gedanke,  dass  die  Erbanlagen  von  Sadako  Yamamura  an  diesem  dunklen, 
nach  Fäulnis  stinkenden,  erbärmlichen  Ort  zerstört  wurden,  ohne  dass  je‐
mand irgendetwas davon erfahren würde, war mir unerträglich. Das Resul‐
tat  meines  starken  Willens  ...  Du  bist  Spezialist  auf  diesem  Gebiet, 
vermutlich kannst du das viel besser erklären als ich. 
Mein  Körper  ist  zwar  damals  in  dem  schrecklichen,  finsteren  Brunnen 
gestorben, aber meine Seele nicht. Sie ist in den Körper einer anderen Frau 
eingedrungen.  Nach  einigen  Tagen  wurde  mir  mein  Ich  bewusst,  doch  das 
Gesicht,  das  ich  im  Spiegel  sah,  gehörte  nicht  mir.  Zunächst  begriff  ich 
nicht,  was  passiert  war.  Was  bedeutete  das?  Ich  steckte  plötzlich  in  einem 
völlig fremden Körper. Zudem fühlte ich mich wie in einer verkehrten Welt. 
Alles war vollkommen neu: die unbekannte Stadt, moderne Autos, kleine Be‐
tonhäuser, Elektrogeräte ... Als ich einen Blick auf den Kalender warf, stellte 
ich fest, dass fünfundzwanzig Jahre vergangen waren. Ich war vollkommen 
überrascht.  Meine  Seele  war  tatsächlich  aus  meinen  Körper  getreten,  lange 
Zeit umhergewandert, um dann in einen anderen einzudringen. Der Körper, 
den sie sich ausgesucht hatte, gehörte der armen Mai Takano. 
Sie  brachte  mich  auf  die  Welt.  Im  Gleichschritt  mit  der  Entwicklung  der 
befruchteten Eizelle wuchs auch mein Bewusstsein. Allmählich bemächtigte 
ich mich ihrer immer mehr. Kurz vor meiner Wiedergeburt habe ich Mai von 
ihrer Gebärmutter aus vollkommen kontrolliert. Mit meinen kleinen Händen 
klopfte  ich  gegen  ihre  Bauchdecke.  Auch  der  Körper  der  Mutter  gehorchte 
mir inzwischen. 
Der  Tag  der  Geburt  rückte  näher.  Alles  musste  gut  durchdacht  sein. 
Zuerst  fragte  ich  mich,  was  mit  dem  Körper  von  Mai  Takano,  den  ich  mir 
für eine gewisse Zeit geliehen hatte, passieren würde. Ob sie ihr eigenes Ich 
zurückerlangen  würde  ...  Aber  das  konnte  ich  mir  nicht  vorstellen.  Ihr 
Körper  war  im  Grunde  genommen  wie  eine  Puppe.  Nach  der  Geburt  des 
Schmetterlings  lebt  diese  ja  auch  nicht  weiter.  Es  mag  egoistisch  klingen, 
aber ich habe beschlossen, den Körper sterben zu lassen. 
Damit  kam  eine  neue  Frage  auf:  Wo  sollte  ich  wiedergeboren  werden? 
Mais Apartment war als Geburtsstätte ungeeignet. Das Problem war näm‐
lich: was tun mit dem toten Körper? Irgendwie musste ich mich der Leiche 
entledigen.  Selbst  wenn  ich  schnell  heranwachsen  würde,  hätte  die  Leiche 
mindestens eine Woche in der Wohnung herumgelegen ... Der Gestank des 
toten,  verwesenden  Fleisches  wäre  in  jede  Ecke  des  Zimmers  gekrochen, 
hätte sich einen Weg unter den Türschlitzen nach draußen gebahnt ... Doch 
ich brauchte ein Dach über dem Kopf. Deshalb war Mais Wohnung für mich 
ideal. 
Meine Wiedergeburt musste also an einem anderen Ort stattfinden, wo ich 
den  vorübergehend  benutzten  Körper  lassen  konnte,  ohne  dass  man  ihn 
gleich  fand.  Doch  dieser  Ort  durfte  nicht  zu  weit  von  Mais  Apartment 
entfernt  sein,  damit  ich  allein  zurückkam.  Das  Dach  des  alten  Gebäudes 
schien  wie  geschaffen  für  mein  Vorhaben.  Im  Entlüftungsschacht  würde 
man die tote Hülle Mai Takanos nicht so schnell finden. Ich konnte mich in 
Ruhe in ihrem Apartment entwickeln. 
Kurz  vor  der  Niederkunft  traf  ich  die  letzten  Vorbereitungen.  In  einer 
kalten, dunklen Nacht stieg ich auf das Dach des Gebäudes und ließ ein Seil 
in den Schacht. Langsam begab ich mich in die finstere Tiefe. Dabei rutschte 
ich  unglücklicherweise  ab.  Mein  Knöchel  war  zwar  gebrochen,  aber  mit 
meinem  Bauch  war  zum  Glück  alles  okay.  Wenn  jetzt  noch  etwas  schief 
gegangen wäre ... Jedenfalls bin ich nach Plan auf die Welt gekommen. Müh‐
sam kroch ich aus der Gebärmutter durch den Gebärmutterkanal hinaus ins 
Freie.  Mit  Mund  und  Händen  durchtrennte  ich  die  Nabelschnur.  Danach 
rieb  ich  mir  den  Schleim  mit  einem  feuchten  Tuch  ab,  das  ich  mitgebracht 
hatte. Ich bin in den frühen Morgenstunden geboren worden, die Stadt war 
noch  vollkommen  in  Dunkelheit  getaucht.  Als  ich  aus  dem  Schacht  nach 
oben blickte, erschrak ich — dieselbe Perspektive wie in dem Brunnen. 
Es war  eine  Art Zeremonie. Ich dachte, wenn ich mich mit eigener Kraft 
aus dem Loch herausziehen kann, dann bin ich auch in der Lage, mich an die 
Umwelt  anzupassen  und  zu  überleben.  Wenn  ich  es  dagegen  nicht  schaffe, 
würde mein Leben in der neuen Umgebung ohnehin ziemlich schnell wieder 
erlöschen. 
Doch  ich  bestand  die  Probe.  Langsam  kletterte  ich  an  dem  Seil  aus  dem 
Schacht. Der Himmel hellte sich auf, die Menschen erwachten allmählich. In 
diesem  Moment  spürte  ich,  dass  ich  wiedergeboren  war.  Es  war  ein 
unbeschreibliches Glücksgefühl. 
Innerhalb einer Woche reifte ich zu dem Menschen heran, der ich kurz vor 
meinem Tod gewesen war. Erstaunlicherweise konnte ich mich noch an jedes 
Detail  meines  früheren  Lebens  erinnern.  Ich  war  in  Sashikiji,  Oshima,  auf 
der  Izu‐Halbinsel  geboren  worden.  Meine  Mutter  hatte  verblüffende  über‐
sinnliche Visionen und Fähigkeiten gehabt. Von ihr habe ich diese besondere 
Gabe vermutlich geerbt. Als ich ein Kind war, sind wir viel durch die Lande 
gezogen,  haben  mal  hier,  mal  dort  gelebt.  Ich  erinnerte  mich  auch  an  das 
furchtbare  Erlebnis,  als  ich  meinen  Vater  eines  Tages  wieder  einmal  im 
Sanatorium besuchte ... Inzwischen glaube ich, dass Erinnerungen nicht im 
Gedächtnis abgespeichert werden, sondern in den Genen. 
Und noch etwas. Mein Körper hat sich leicht verändert. Äußerlich habe ich 
zwar auch früher wie eine Frau gewirkt, hatte Brüste und eine Vagina. Was 
mir  aber  fehlte,  waren  Eierstöcke.  Zudem  verfüge  ich  nach  wie  vor  über 
männliche  Geschlechtsorgane.  Jetzt  hin  ich  der  perfekte  Zwitter.  Ich  habe 
Eierstöcke,  gleichzeitig  produziere  ich  Spermien.  In  diesem  Punkt  habe  ich 
dank dir Gewissheit. 
 
Miyashita  blickte  Ando  grinsend  an.  Als  wenn  das  nicht  schon  alles 
schlimm genug wäre, muss mich der Kerl jetzt auch noch damit aufziehen!» 
Lies schon weiter«, drängte Ando. 
Doch  Miyashita  beschäftigte  anscheinend  Sadakos  körperliche  Be‐
sonderheit. »Ein perfekter Zwitter ... Wenn diese Frau — aber ›Frau‹ 
ist  vielleicht  nicht  das  richtige  Wort?  Das  muss  man  sich  mal  vor 
Augen halten! Sie ist fähig, ohne Sex Kinder zu zeugen!« 
Normalerweise  kamen  Zwitter  vor  allem  bei  niederen  Lebewesen 
vor.  Typisches  Beispiel  war  der  Regenwurm,  der  zwei  männliche 
Geschlechtsorgane  und  ein  weibliches  besaß.  Einzellige  Lebewesen 
vermehrten  sich  durch  Zellteilung.  Wenn  eine  Selbstbefruchtung 
möglich  war,  würde  über  Generationen  immer  wieder  die  gleiche 
DNA  an  die  Kinder  weitergeben  werden.  Mit  anderen  Worten, 
Sadako Yamamura würde Sadako Yamamura gebären. War so etwas 
in der Realität wirklich möglich? 
»Stell  dir  nur  vor,  wenn  es  dazu  kommen  würde«,  sagte  Ando 
besorgt. 
»Sadako  Yamamura  ist  kein  Homo  sapiens  ...  Sie  ist  eine  neue 
Spezies,  die  durch  Mutation  entstanden  ist.  Wir  erleben  hier  die 
Evolution mit eigenen Augen.« 
Die  größte  Herausforderung  bestand  für  Sadako  darin,  die  neue 
Spezies  ›Sadako  Yamamura‹  zu  stabilisieren.  Ando  versuchte,  sich 
das  am  Beispiel  von  Schafen  zu  vergegenwärtigen.  Angenommen, 
inmitten  von  einigen  tausend  weißen  Schafen  wurde  ein  schwarzes 
geboren.  Wollte  es  sich  vermehren,  hatte  es  zunächst  nur  die 
Möglichkeit,  dies  mit  einem  weißen  Schaf  zu  tun.  Setzte  sich  dieser 
Prozess  über  Jahre  hinweg  fort,  wurde  die  Besonderheit  ›schwarz‹ 
immer  seltener,  bis  sie  schließlich  irgendwann  ausstarb.  Wenn 
andererseits  laufend  weibliche  und  männliche  schwarze  Schafe  zur 
Welt kamen, wurde die Besonderheit ›schwarz‹ immer wieder an die 
jeweils nächste Generation weitergegeben. 
Sadako Yamamura schien dieses Problem für sich bereits gelöst zu 
haben. Sie brauchte die Spezies Mensch nicht, um sich zu vermehren. 
Das  konnte  sie  aus  eigener  Kraft  tun.  Die  spezifischen  Merkmale 
›Sadako‹ würden von Generation zu Generation weitergeben werden. 
Nur waren ihr auch Grenzen gesetzt. Sie besaß zwar die Fähigkeit, 
sich  selbst  zu  vermehren,  doch  der  Prozess  ging  nur  sehr  langsam 
vonstatten,  ähnlich  wie  bei  dem  Videoband.  Damit  bestand  die 
Gefahr,  dass  der  Mensch  der  neuen  Rasse  ›Sadako  Yamamura‹  auf 
die  Pelle  rückte  und  sie  schnell  ausgerottet  war.  Das  Video  war 
bereits  wieder  verschwunden.  Damit  eine  neue  Spezies  überleben 
konnte,  bedurfte  es  einer  explosionsartigen  Verbreitung.  Die  Frage 
war also: Hatte Sadako Yamamura diese Möglichkeit? 
Miyashita unterbrach Andos Gedanken, in dem er weiterlas. 
Das alles ist kein Lügenmärchen. Ich wollte dir mitteilen, was wirklich mit 
mir  passiert  ist.  Warum  ich  das  tun  muss  ...  Ich  möchte,  dass  du  mich 
verstehst. Und wenn du an diesem Punkt angelangt bist, werde ich dich um 
etwas bitten. Du wirst dich sicherlich fragen, warum ausgerechnet du? Weil 
ich fest davon überzeugt bin, dass du ein Experte bist. 
Ah, jetzt kommt‘s! Ando bereitete sich innerlich auf die nächsten Zei‐
len vor. Was, wenn es unmöglich war, ihre Bitte zu erfüllen? Sorgen 
umschatteten seine Mundwinkel. 
Zunächst möchte ich dir ans Herz legen, dich der Erscheinung des Buches 
nicht in den Weg zu stellen. 
Das  ließe  sich  einrichten,  dachte  Ando.  Das  Einzige,  das  er  zu  tun 
hätte, wäre, nichts zu tun. 
Aber es geht nicht nur darum, dass du dich mir nicht entgegenstellst. Ich 
will, dass du mich unterstützt. 
Ob du dir meine Bitte anhörst? Ohne dir Angst einjagen zu wollen: Wenn 
du meinen Befehlen nicht Folge leistest, wird dir etwas Grausames zustoßen. 
Du hast den Ring‐Bericht gelesen. Denk daran, du hast keine Chance. Es ist 
zu spät. Als mutiger Mann könntest du natürlich sagen, es ist dir egal, ob 
du stirbst, und versuchen, mich zu vernichten. Deshalb sollst du auch eine 
Belohnung  erhalten,  wenn  du  mir  hilfst.  Ich  lasse  dich  nicht  umsonst  für 
mich arbeiten. Nun, wie sieht es aus? Was könnte ich dir für ein Geschenk 
machen? Es wird etwas sein, das du dir am meistens wünschst. Und das ist 
... 
Miyashita  hörte  auf  zu  lesen.  Mit  erschrockenem  Blick  reichte  er 
Ando  das  Notizbuch.  Offenbar  wollte  er,  dass  Ando  die  folgenden 
Sätze selbst las. 
Ando  glitt  das  Büchlein  aus  der  Hand,  als  er  auf  Sadakos  letzte 
Worte blickte. Fassungslos starrte er vor sich hin. Nie im Leben hätte 
er mit einem solchen ›Vertrag‹ gerechnet. 
Miyashita verstand Andos Gefühle nur zu gut und schwieg. 
Ando  schloss  die  Augen.  Sadako  Yamamura  flüsterte  ihm  mit 
sanften Worten zu, dass er auf ihre Seite überwechseln solle. Sie hatte 
begriffen,  dass  die  neue  Spezies  ohne  Verbündete  auf  der  Seite  der 
Menschen dem Untergang geweiht war. Jun‐ichiro Asakawa, der be‐
absichtigte,  den  Ring‐Bericht  zu  veröffentlichen,  arbeitete  bereits  für 
sie.  Zwar  war  er  sich  dessen  vermutlich  nicht  bewusst,  aber  ohne 
Zweifel wurde er von ihr kontrolliert. 
Ginge  Ando  den  Pakt  mit  dem  Teufel  ein,  würde  ihm  als  Gegen‐
leistung  sein  größter  Wunsch  erfüllt  werden.  Etwas,  um  das  er  Gott 
schon so oft gebeten hatte und das ihm versagt geblieben war. 
Er  öffnete  die  Augen.  In  einem  Briefumschlag,  der  zwischen  den 
Büchern im Regal steckte, befand sich der Schlüssel, der ihm die Tür 
zur  Erfüllung  seines  Wunsches  öffnen  konnte.  Medizinisch  gesehen 
war  es  möglich.  Würde  er  sich  der  besonderen  Fähigkeiten  Sadako 
Yamamuras  bedienen  ...  Ja,  dann  konnte  er  ihn  vielleicht  wirklich 
zurückbekommen. 
Aber ... 
Er  war  im  Begriff,  seine  Seele  an  den  Teufel  zu  verkaufen,  um 
seinen sehnlichsten Wunsch erfüllt zu bekommen. Ein solcher Verrat 
wäre nicht zu entschuldigen, protestierte seine innere Stimme. Sada‐
ko  Yamamura  musste  gestoppt  werden.  Als  Mitglied  der  menschli‐
chen Gesellschaft durfte er nicht zulassen, dass sie eine neue Seuche 
in  die  Welt  setzte,  die  sogar  den  Untergang  des  Homo  sapiens 
bedeuten konnte. Aber wie sollte er sie aufhalten? Es gab vermutlich 
nur einen Weg: Er musste sie umbringen. 
Doch  wenn  Sadako  starb,  blieb  sein  Wunsch  für  immer  unerfüllt. 
Unendliche Verzweiflung stieg in Ando auf. Was sollte er nur tun? 
Schluchzend  ließ  er  sich  auf  das  Bett  fallen  und  umschloss  das 
Kissen. Sein Köper bebte. Vor seinem geistigen Auge tauchte immer 
wieder  dasselbe  Bild  auf.  So  sehr  er  sich  auch  bemühte,  es  zu 
verdrängen,  es  schien  aussichtslos  zu  sein.  »Miyashita,  was  soll  ich 
nur tun?« 
»Das musst du selbst entscheiden«, erwiderte Miyashita ruhig. 
»Ich weiß es nicht. Sag du es mir.« 
»Die  Entscheidung  ist  eigentlich  gar  nicht  so  schwer.  Denk  doch 
mal nach. Egal, was wir tun, wir sind ihr ausgeliefert. Es ist ein Spiel, 
das  wir  nur  verlieren  können.  Wenn  du  dich  Sadako  Yamamura  in 
den Weg stellst, wird sie uns beide töten und sich einen neuen Ver‐
bündeten suchen. So einfach ist das.« 
Miyashita hatte vermutlich Recht. Seine Begegnung mit Sadako war 
sicher kein Zufall gewesen. Sie hatte ihn die ganze Zeit über beobach‐
tet.  Alles  war  geplant  gewesen  ...  Die  Begegnungen  in  Mais  Apart‐
menthaus,  auf  dem  Dach  des  alten  Gebäudes,  an  der  Sangubashi‐
Station ... Irgendwie hatte sie seinen Schwachpunkt herausgefunden. 
Es war unmöglich, sie zu besiegen. Würde er sich ihr entgegenstellen, 
dann würde das in ihm lauernde Virus sofort zu wüten anfangen. 
Für  Miyashita  schien  die  Antwort  auf  der  Hand  zu  liegen.  Ando 
dagegen  hatte  noch  keine  Entscheidung  getroffen.  »Willst  du  damit 
etwa sagen, dass wir unsere Seele dem Teufel verkaufen sollen?« 
»Eine andere Möglichkeit gibt es nicht.« 
»Aber was ist mit der Zukunft der Menschheit? Überleg doch mal! 
Wenn  wir  Sadako  unterstützen,  setzen  wir  eine  Seuche  in  die  Welt, 
die den Untergang der Spezies Mensch bedeuten könnte.« 
»Nun  tu  nicht  so,  als  wärst  du  der  Sprecher  der  Menschheit.  Im 
Grunde deines Herzens hast du dich doch schon entschieden. Schon 
wegen der Belohnung, die auf dich wartet. Du willst doch nicht etwa 
behaupten, das du dir diese Chance durch die Lappen gehen lässt?« 
»Aber es ist ungerecht. Du bekommst nichts.« 
»Sag das nicht. Es ist meine Lebensversicherung.« 
Ando  steckte  in  der  Zwickmühle.  Wie  bin  ich  nur  in  diese  Situation 
geraten? 
Er dachte daran, wie alles begonnen hatte: die Autopsie  von Ryuji 
Takayamas  Leiche,  der  Zahlenkode  auf  der  Zeitungsecke,  der  ent‐
schlüsselt ›Ring‹ bedeutete, schließlich der Asakawa‐Bericht mit dem 
Titel ›Ring‹ ... Er bereute es zutiefst, seine Nase so tief in diese Sache 
hineingesteckt zu haben. Hätte er den Bericht doch nie gelesen! 
Er hielt inne. »Ryuji...«, murmelte er. 
Miyashita  blickte  ihn  stirnrunzelnd  an.  Ohne  darauf  einzugehen, 
spann er seinen Gedanken fort. Ryuji steckte hinter allem, er hatte es 
eingefädelt.  Das,  was  nach  einem  großen  Zufall  aussah,  geschah  in 
Wirklichkeit  nach  einem  teuflischen  Plan.  Die  Nachrichten  ›Ring‹ 
und  ›Mutation‹  hatte  Ryuji  ihm  geschickt,  um  seine  Sinne  zu  schär‐
fen. Jedes Mal, wenn Ando sich etwas von der Lösung zu entfernen 
schien, tauchte plötzlich ein Kode auf, vermutlich, um ihn wieder auf 
den richtigen Weg zu bringen. Aber welche Absicht steckte dahinter? 
Und  da  war  noch  etwas.  Warum  wohl  hatte  Mai  sich  das  Video 
angesehen?  Dazu  kam  ein  zweiter  ›Zufall‹:  Sie  war  in  dieser  Zeit 
fruchtbar  gewesen.  Wäre  sie  das  nicht  gewesen,  dann  wäre  Sadako 
Yamamura nicht wiedergeboren worden. 
Wo ist Mai noch mal auf das Band gestoßen? 
Bei Ryuji. 
Und warum ist sie dort gewesen? 
Weil Ryujis letzter Artikel unvollständig war. Ob die Seiten tatsäch‐
lich fehlten? 
Das weiß nur Ryuji. 
Doch eines war offensichtlich: Alle Fäden liefen bei Ryuji Takayama 
zusammen. 
Mai und Ryuji hatten in einer engen Beziehung zueinander gestan‐
den. Deshalb hatte Ryuji auch gewusst, wann in etwa Mai ihre Men‐
struation  haben  würde.  So  konnte  er  errechnen,  wann  in  etwa  sie 
fruchtbar war. Exakt an diesem Tag rief er sie zu sich. 
Doch was bedeutet das? 
Ando blickte Miyashita an und murmelte: »Es ist Ryuji.« 
Miyashita schien nicht zu verstehen. Schweigend kniff er die Augen 
zusammen. 
»Verstehst du nicht? Es ist Ryuji! Er ist derjenige, der im Verborge‐
nen die Fäden gesponnen hat.« 
Ando  war  mittlerweile  davon  überzeugt,  dass  er  richtig  lag.  Alle 
Personen in diesem mörderischen Spiel wurden von Ryuji wie Mario‐
netten geführt. Er war der Autor des Drehbuchs. 
Draußen  vor  dem  Fenster  erhob  sich  der  abendliche  Stadtlärm  zu 
einem  lauten  Wirbelsturm.  Ando  glaubte,  das  höhnische  Gelächter 
eines  Mannes  zu  hören  —  eine  unheimliche,  gespenstische  Stimme, 
die aus der Ferne an sein Ohr drang. Die Stimme Ryujis. 
Ando starrte zum Himmel. Ob Ryuji wohl da oben ist? 
Natürlich würde er hierauf keine Antwort erhalten. Aber er wurde 
das  Gefühl  nicht  los,  dass  Sadako  und  Ryuji  unter  einer  Decke 
steckten. Sie spielten ›Menschenjagd‹. 
Ando überlegte. Was war wohl Ryujis Wunsch? Ohne seine, Andos, 
Hilfe konnte er ihn sich nicht erfüllen ... 
Auch wenn Ando das Spiel nun verstanden hatte: Er konnte nichts 
dagegen tun. Es war zu spät. Ihm blieb nichts weiter, als sich dem in 
der Finsternis lachenden Ryuji zu unterwerfen. 
 

 
Es  war  ein  ungewöhnlich  sonniger  und  warmer  Tag  inmitten  der 
Regenzeit. Ando war an die Küste gefahren. Dort hatte ihm vor zwei 
Jahren das tobende Meer auf grausame Weise seinen Sohn entrissen. 
Seitdem war er nicht mehr hier gewesen. Heute gab es einen beson‐
deren Grund, weshalb er an diesen Ort des Schreckens zurückkehrte. 
Es  herrschte  eine  ruhige  und  friedliche  Atmosphäre.  Am  weißen 
Sandstrand saßen vereinzelte Fischer. Hier und da machten Familien 
ein Picknick. 
Ando  hatte  die  Ereignisse  von  damals  noch  genau  vor  Augen. 
Obwohl die Wellen sich bei weitem nicht so hoch auftürmten und ein 
neu  erbauter  Damm  den  Strand  verändert  hatte,  kam  ihm  alles  un‐
verändert vor. 
Auf der Mole sitzend, ließ er seine Gedanken schweifen. Seine Au‐
gen ruhten auf einem kleinen Schatten, der fröhlich im feuchten Sand 
spielte,  energisch  Löcher  buddelte  und  Sandburgen  baute.  Dabei 
passte er auf, nicht zu nahe ans Wasser zu kommen. 
Ein  Ruf  lenkte  ihn  ab.  Er  glaubte,  seinen  Namen  gehört  zu  haben. 
Bestimmt  ein  Missverständnis!  Doch  als  er  sich  umdrehte,  sah  er 
einen Mann von kräftiger Statur auf sich zukommen. 
Er trug ein langärmliges, gestreiftes Hemd, das bis oben zugeknöpft 
war.  Sein  Oberkörper  war  muskulös.  Über  das  markante  Gesicht 
liefen  Schweißperlen.  In  einer  Hand  hielt  er  eine  Plastiktüte.  Ando 
kannte den Mann gut. Erst im Oktober letzten Jahres hatte er ihn in 
der Gerichtsmedizin gesehen. 
Der Mann setzte sich neben Ando. 
»Lange nicht gesehen.« 
Ohne  den  Mann  anzusehen,  blickte  Ando  erneut  auf  den  kleinen 
Schatten am Strand. 
»Sich  einfach  so  aus  dem  Staub  zu  machen  ...  das  ist  nicht  gerade 
die feine Art.« Der Mann nahm eine Dose Eistee aus der Tüte. Ohne 
auch  nur  einmal  abzusetzen,  trank  er  sie  leer.  Dann  holte  er  eine 
weitere heraus und hielt sie Ando hin. »Möchtest du was trinken?« 
Schweigend  nahm  Ando  die  Dose.  Wieder  vermied  er  es,  dem 
Mann ins Gesicht zu blicken. »Woher wusstest du, dass ich heute hier 
sein werde?«, fragte er mit ruhiger, gelassener Stimme. 
»Miyashita hat es mir erzählt. Naja, natürlich nicht direkt, ihm hast 
du ja auch nichts erzählt. Aber er sagte mir, dass heute der Todestag 
deines  Sohnes  ist.  Da  musste  ich  nur  eins  und  eins  zusammen‐
zählen.« Der Mann lachte. 
»Gibt  es  einen  bestimmten  Grund  dafür,  dass  du  mich  hier  auf‐
suchst?«, fragte Ando mit düsterer Stimme. 
»He, ich habe ganz schöne Strapazen auf mich genommen, um hier 
zu  sein.  Erst  der  Zug,  dann  der  Bus  ...  Du  könntest  ruhig  etwas 
freundlicher sein.« 
»Da verlangst du zu viel von mir«, entgegnete Ando. 
»Du bist wirklich ein undankbarer Kerl.« 
Ando  spitzte  die  Lippen.  »Undankbar?  Das  musst  gerade  du 
sagen.« 
»Wenigstens bin ich dir dankbar, weil du so gut mitgespielt hast ... 
Das ist der Unterschied zwischen uns.« 
Erneut dachte Ando verbittert daran, dass dieser Mann von Anfang 
an  mit  ihm  gespielt  hatte.  Während  ihrer  Zeit  an  der  Uni  hatte  er 
trotz leichter Anflüge von Neid die Intelligenz und Genialität dieses 
Mannes bewundert. Jeden nur erdenklichen Kode hatte er mit Leich‐
tigkeit entschlüsselt, während die anderen sich daran die Zähne aus‐
bissen. Heute sah Ando ihn in einem anderen Licht. Der Mann hatte 
ihn nur benutzt. Wozu also Lobeshymnen? 
Der Mann, den wir mit eigenen Händen produziert haben ... 
Jetzt wagte Ando doch einen kurzen Blick auf Ryuji Takayama. Was 
ging  wohl  in  diesem  Moment  in  seinem  Kopf  vor?  Ando  erinnerte 
sich  daran,  wie  er  letztes  Jahr  Ryujis  Gehirn  in  seinen  Händen 
gehalten hatte. Mit den Fingern war er über die Oberfläche geglitten, 
doch  er  hatte  die  Denkprozesse  dieses  Mannes  nicht  im  Geringsten 
begriffen. Er hatte keine Ahnung gehabt. Ohne Ryujis Spiel zu durch‐
schauen, hatte er sich wie eine Marionette von ihm führen lassen. Er 
war  gleich  auf  den  Kode  angesprungen  und,  ohne  es  zu  merken,  in 
den  Fall  hineingezogen  worden.  Wäre  ihm  doch  nur  nicht  die 
Autopsie von Ryuji Takayamas Leiche zugefallen! Dann wäre er auch 
nicht zum Komplizen gemacht worden. 
»Na  komm,  du  hast  schließlich  davon  profitiert«,  bemerkte  Ryuji 
schnippisch. 
»Da bin ich mir nicht so sicher.« 
Jetzt  kam  der  kleine  Schatten  auf  ihn  zugerannt.  »Papa,  ich  habe 
Durst.« 
Ando  reichte  seinem  Sohn  Ryujis  Dose.  Gierig  griff  der  Kleine  da‐
nach und trank ein paar Schlucke. Sein heller Kehlkopf reflektierte in 
Andos Augen. Wie kleine Kristalle glitzerten Takanoris Schweißper‐
len am Hals in der Sonne. 
»Na,  Kollege,  möchtest  du  noch  etwas  trinken?«,  fragte  Ryuji  das 
Kind, während er mit einer Hand in seiner Tasche wühlte. 
Das  Wort  ›Kollege‹  gefiel  Ando  überhaupt  nicht.  Andererseits 
waren  beide  aus  der  gleichen  Gebärmutter  gekommen.  Allein  bei 
diesem Gedanken stellten sich ihm alle Haare auf. 
Der Junge schüttelte energisch den Kopf. »Darf ich sie mitnehmen?« 
»Nur zu, kleiner Mann.« 
Freudestrahlend  lief  Takanori  wieder  zum  Strand  hinunter.  Die 
Dose war nun sein neues Spielzeug. 
»Takanori!«, rief Ando laut. 
Abrupt blieb der Junge stehen und drehte sich um. »Ja was ist?« 
»Geh nicht zu dicht ans Wasser, hörst du?« 
Takanori nickte und lief weiter. 
Eigentlich war diese Ermahnung überflüssig. Takanori hielt freiwil‐
lig  Abstand  zum  Meer.  Vielleicht  war  die  Erinnerung  an  den  Mo‐
ment, als er ertrunken war, noch in ihm lebendig. Jedenfalls hatte er 
jetzt eine ausgeprägte Wasserscheu. Ando wusste das, war aber noch 
zu sehr im Albtraum der Vergangenheit gefangen. 
»Ist er nicht ein niedliches Kerlchen?« 
Das  brauchte  Ryuji  nicht  eigens  zu  betonen.  Ja,  Takanori  war  ein 
Schatz.  Um  ihn  zurückzubekommen,  hatte  Ando  seine  Seele  an  den 
Teufel verkauft, die Menschheit verraten. 
Sadako hatte ihm einen Deal vorgeschlagen, und er war darauf ein‐
gegangen:  Als  Gegenleistung  für  seine  Unterstützung  bei  der  Reali‐
sierung ihres teuflischen Plans hatte sie ihm versprochen, seinen vor 
zwei Jahren verstorbenen Sohn zurückzubringen. 
Ando  hatte  ihren  Worten  keinen  Glauben  geschenkt,  als  er  ihren 
Brief  mit  Miyashita  gelesen  hatte.  Doch  seine  Zweifel  hielten  nicht 
lange.  Immerhin  gab  es  einen  lebenden  Beweis:  Sadako  Yamamura. 
Aber noch viel wichtiger war gewesen, dass er das Haarbüschel mit 
der DNA seines Sohnes in dem Briefumschlag zwischen den Büchern 
aufbewahrt hatte. Ohne die Haare wäre das Vorhaben nicht realisier‐
bar  gewesen.  Sie  enthielten  die  genetischen  Informationen  seines 
Sohnes. 
Aus medizinischer Sicht war es nicht schwierig gewesen, Takanori 
zu klonen. Sie hatten nur Sadakos Körper mit seinen besonderen Fä‐
higkeiten  gebraucht.  Alles  andere  war  mit  moderner,  medizinischer 
Technik  möglich  gewesen.  Da  Sadako  Yamamura  weibliche  und 
männliche  Geschlechtsorgane  besaß,  hatten  sie  zunächst  Eizelle  und 
Samenzelle miteinander verschmelzen lassen. Dann war ihrem Orga‐
nismus die befruchtete Eizelle entnommen worden. Mit einem Mani‐
pulator  entnahm  man  nun  aus  den  Zellen  der  Haare  Takanoris  den 
Kern und tauschte ihn gegen den Kern von Sadakos Eizelle aus. Die 
Eizelle,  die  jetzt  die  komplette  Erbinformation  von  Takanori  trug, 
wurde Sadakos Organismus wieder in die Gebärmutter eingesetzt. 
Das  war  eine  sehr  knifflige  Angelegenheit,  aber  wenn  man  sie 
einem  Spezialisten  überließ,  kein  Problem.  Theoretisch  hätte  man 
sogar Dinosaurier wieder auferstehen lassen können, wenn die gene‐
tischen Informationen noch existiert hätten. 
Eine Woche später war Takanoris Klon zur Welt gekommen. 
In  den  nächsten  sieben  Tagen  nach  seiner  Geburt  wuchs  Takanori 
zu dem Jungen heran, der er vor seinem Tod gewesen war. Erstaun‐
licherweise  schien  er  sich  noch  an  alle  Einzelheiten  seines  frühren 
Lebens zu erinnern. Es bestand kein Zweifel daran: Das Kind, das da 
am  Strand  spielte,  war  sein  Sohn.  Von  der  Sprechweise  über 
bestimmte  Verhaltensweisen,  alles  war  gleich  geblieben.  Auch  die 
Erinnerungen  des  Kleinen  an  seine  Eltern  schienen  fest  in  seinem 
Herzen verankert zu sein. Nichts war anders als früher oder irgend‐
wie merkwürdig. 
Nachdem  Sadako  ihm  seinen  Sohn  wiedergegeben  hatte,  äußerte 
sie einen neuen Wunsch — wie er es sich gedacht hatte. Der Handel 
war nicht damit beendet, dass er Sadako nicht in die Quere kam und 
als Belohnung dafür seinen Sohn zurückerhielt. Es musste noch etwas 
folgen. 
Erst war Ando überrascht: Sadako wollte, dass er auf dieselbe Wie‐
se wie Takanori auch Ryuji klonte. Dann ging ihm ein Licht auf. Von 
wegen ›Belohnung‹. Takanori war nur ein Experiment gewesen, mehr 
nicht.  Sadako  Yamamura  hatte  sich  davon  überzeugen  wollen,  dass 
es funktionierte. Von Anfang an hatte sie nur ein Ziel verfolgt: Ryujis 
Wiedergeburt. 
Das  ganze  Spiel  war  von  Ryuji  eingefädelt  worden,  um  sich  den 
Wunsch nach einer Wiedergeburt erfüllen zu können. 
Und er war erfüllt worden. 
Ando  sah  Ryuji  nach  dessen  Wiedergeburt  heute  zum  ersten  Mal. 
Er  hatte  Ryujis  Zellen  den  Kern  entnommen  und  diesen  gegen  den 
Kern  in  Sadakos  befruchteter  Eizelle  ausgetauscht.  Nachdem  er  sich 
Gewissheit verschafft hatte, dass alles gut verlaufen war, hatte er die 
restlichen Arbeiten Miyashita und dessen Kollegen überlassen. Ohne 
jemandem ein Wort zu sagen, war er mit seinem Sohn fortgefahren. 
Aus  Andos  Sicht  war  seine  Aufgabe  erfüllt,  indem  er  Ryujis  DNA 
in  Sadakos  Eizelle  eingeschleust  hatte.  Nach  Ryujis  Wiedergeburt 
brauchte Sadako Ando nicht mehr. 
Doch  wann  hatten  sich  Sadako  Yamamura  und  Ryuji  Takayama 
zusammengetan? Vermutlich hatten sie auf DNA‐Ebene miteinander 
kommuniziert,  ihren  Wert  füreinander  erkannt  und  sich  dann  zu‐
sammengetan, um ihre Interessen durchzusetzen. 
Wie auch immer, Ryuji war Ando gleichgültig. Ihn beschäftigte nur, 
wie er seinen kleinen Sohn großziehen sollte. In den letzten Monaten 
hatten  sich  die  Ereignisse  überschlagen,  alles  war  komplizierter  ge‐
worden. Um Abstand zu gewinnen, hatte er seinen Job als Dozent an 
der Universität vor zwei Monaten an den Nagel gehängt. Ohne lange 
am  selben  Ort  zu  bleiben,  waren  sie  durchs  Land  gezogen.  Ein  Ziel 
hatte Ando nicht vor Augen gehabt. Er wollte nur weit weg von Ryuji 
und Sadako. 
Ryuji kramte in seiner Hosentasche. Eine kleine Ampulle kam zum 
Vorschein. »Hier, für dich.« Ryuji hob die Ampulle hoch. 
»Was ist das?« 
»Vakzin, ein Impfstoff, gewonnen aus dem Ring‐Virus.« 
»Vakzin?«  Vorsichtig  nahm  Ando  die  kleine  Glasampulle.  Inzwi‐
schen hatten er und Miyashita die Ergebnisse ihrer Blutuntersuchun‐
gen  erhalten.  Beide  waren  positiv.  Tatsächlich  waren  sie  durch  die 
Lektüre  des  Ring‐Berichts  zum  Träger  des  Virus  geworden.  Ando 
hatte in ständiger Angst gelebt, weil er nicht wusste, ob und wann es 
seinen Körper attackieren würde. 
»Du  musst  es  dir  nur  spritzen  und  bist  das  Virus  sofort  los.  Dann 
musst du dir keine Sorgen mehr machen.« 
»Bist du extra hierher gekommen, um mir den Impfstoff zu geben?« 
»Na  ja,  ich  dachte,  es  wäre  auch  gut,  mal  wieder  ans  Meer  zu 
fahren«, sagte Ryuji und lachte verlegen. 
Mit einem Schlag fühlte Ando eine Riesenlast von seinen Schultern 
fallen.  Egal,  wohin  er  mit  seinem  Sohn  auch  gezogen  wäre,  er  hätte 
sich nie in Sicherheit gefühlt, weil er das Virus in sich trug. »Sag mir 
eines: Wie geht die Geschichte aus?« Ando ließ die Ampulle in seiner 
Hemdtasche verschwinden. 
»Ich weiß es nicht«, antwortete Ryuji. 
»Du kannst mir nicht erzählen, dass du keine Ahnung hast. Sadako 
Yamamura und du, ihr steckt unter einer Decke. Ist es nicht euer Ziel, 
die biologische Welt neu zu gestalten?« 
»Wie  die  nahe  Zukunft  aussieht,  kann  ich  dir  sagen.  Aber  was 
danach ist, weiß ich selbst nicht.« 
»Das reicht mir schon. Erzähl.« 
»Von  The  Ring  wurden  bereits  über  hundert  Millionen  Exemplare 
verkauft. « 
»Hundert  Millionen!«  Ando  hatte  in  verschiedenen  Zeitungs‐
artikeln  gelesen,  dass  weitere  Auflagen  von  dem  Roman  erschienen 
waren.  Dabei  hatte  er  immer  sofort  an  zwei  Wörter  gedacht:  ›Ver‐
mehrung‹  und  ›Verbreitung‹.  The  Ring  verbreitete  sich  mit  einer 
unvorstellbaren Rasanz — die Zahl der Virusträger hatte bereits über 
hundert Millionen erreicht. 
»Ich  weiß  nicht,  ob  du  schon  davon  gehört  hast,  aber  der  Roman 
wird verfilmt.« 
»Verfilmt? The Ring?« 
»So ist es. Die Hauptrolle — Sadako Yamamura — wurde öffentlich 
ausgeschrieben. Inzwischen ist die Entscheidung gefallen.« 
»Eine öffentliche Ausschreibung«, wiederholte Ando verblüfft. 
Ryuji  lachte  auf.  »Ja  ...  Weißt  du,  wer  die  Rolle  von  Sadako 
Yamamura bekommen hat?« 
Ando  kannte  sich  in  der  Filmwelt  nicht  sonderlich  gut  aus,  und 
Informationen  aus  der  Gerüchteküche  waren  ihm  nicht  zu  Gehör 
gekommen. »Wer?« 
Ryuji krümmte sich vor Lachen. »Mann, du stehst wirklich auf der 
Leitung. Kannst du es dir nicht denken? Es ist eine Frau, die du gut 
kennst.« 
»Etwa Sadako Yamamura?« 
Just in dem Moment, als Ando diesen Namen ausgesprochen hatte, 
wurde ihm die Bedeutung erst richtig bewusst. In der Tat war es Sa‐
dako  Yamamuras  größter  Wunsch  gewesen,  ein  berühmter  Filmstar 
zu  werden.  Deshalb  war  sie  nach  dem  Gymnasium  einer  Theater‐
gruppe  beigetreten.  Insofern  hatte  sie  auch  schon  Erfahrungen  auf 
diesem Gebiet, war kein Laie mehr. Außerdem hatte sie die Jury mit 
Hilfe ihrer besonderen Fähigkeiten sicher leicht beeinflussen können 
... 
Sadako  Yamamura  spielte  sich  also  selbst...  Was  steckte  dahinter? 
Ando begriff rasch. Sie wollte ihre Gedanken in den Film hineinproji‐
zieren. Mit anderen Worten: Sie wollte in die Szene, in der das teufli‐
sche  Video  gezeigt  wurde,  ihre  genetischen  Informationen  hinein‐
packen.  Das  ursprünglich  vernichtete  Video  würde  wieder  zum  Le‐
ben erweckt werden und sich rasch verbreiten. 
Natürlich  war  nicht  vorauszusehen,  ob  der  Kinofilm  ein  Kassen‐
schlager  wurde  oder  nicht;  trotzdem  würde  ihn  sich  eine  genügend 
große  Zahl  von  Menschen  ansehen.  Alle  Frauen,  die  in  diesem 
Moment  gerade  fruchtbar  waren,  würde  das  gleiche  schreckliche 
Schicksal  erwarten  wie  Mai  Takano.  Eine  Woche  später  würden  un‐
endlich viele Sadako Yamamuras geboren und die Körper der Frauen 
›entsorgt‹ werden. 
Bedachte  man  zudem,  dass  der  Film  später  auch  als  Video  oder 
DVD erscheinen oder im Fernsehen ausgestrahlt werden würde, war 
klar,  dass  sich  das  gefährliche  Video  mit  einer  Geschwindigkeit 
verbreiten würde, die durch das Kopieren allein nie denkbar gewesen 
wäre. Außerdem würde es sich großflächig verbreiten, also nicht nur 
auf  wenige  Orte  beschränkt.  Natürlich  konnte  Sadako  Yamamura 
auch selbst Kinder zur  Welt bringen. Sie hatte einen Weg gefunden, 
wie sie sich schnell vermehren und ausbreiten konnte. 
»Eine  Kreuzung  von  Massenmedium  und  Sadako  Yamamura  ...« 
Abrupt hörte Ryuji auf zu lachen und hob den Kopf. 
»Die  Menschen  sind  nicht  so  dumm,  wie  du  vielleicht  annimmst. 
Sie  werden  dahinterkommen,  und  der  Film  wird  sofort  vernichtet 
werden.« 
Aber  das  reichte  nicht.  Alle  Bücher,  Videos,  DVDs  müssten 
eingesammelt und vernichtet werden ... 
»Das  wird  nicht  gelingen.  Über  hundert  Millionen  Menschen  sind 
schon mit dem Virus infiziert und stehen unter unserer Kontrolle. Sie 
werden neue Medien schaffen, wenn der Roman The Ring vernichtet 
werden  würde.  Schließlich  ist  das  Originalvideo  auch  in  ein  Buch 
mutiert.  Musik,  Computerspiele,  PC‐Netzwerke  ...  Das  Ring‐Virus 
kann  sich  überall  einschleichen.  Die  Kreuzung  von  Massenmedium 
und Sadako Yamamura hat zur Folge, dass immer wieder  neue Me‐
dien entstehen und alle fruchtbaren Frauen, die damit in Berührung 
kamen, eine ›Sadako‹ zur Welt bringen.« 
Zutiefst beunruhigt überprüfte Ando, ob sich das Gegenmittel noch 
in seiner Hemdtasche befand. Allerdings war das Vakzin ausschließ‐
lich  ein  Impfstoff  gegen  das  momentane  Ring‐Virus  —  wenn  es 
mutierte, wurde es wirkungslos. 
Das  Problem  war:  In  welches  Medium  mutierte  es  als  Nächstes? 
Ohne  diese  Information  war  es  nicht  möglich,  ein  neues  Antiserum 
zu entwickeln. Die Menschen konnten nur darauf reagieren. Die neue 
Spezies  ›Sadako  Yamamura‹  würde  sich  allmählich  immer  weiter 
ausbreiten,  den  Platz  der  Menschen  einnehmen,  bis  sie  die  Mensch‐
heit vernichtet hatte. 
»Ist dir das denn alles völlig egal? Wie kannst du damit leben?« 
»Du betrachtest die Dinge aus der Perspektive eines Menschen. Für 
mich  stellt  sich  das  etwas  anders  dar.  Wenn  ein  Mensch  stirbt  und 
eine Sadako Yamamura geboren wird, ist das ein Nullsummenspiel.« 
»Tut mir Leid, aber ich kann deine Haltung absolut nicht nachvoll‐
ziehen.« 
Ryuji beugte sich mit schweißüberströmtem Gesicht dicht zu Ando. 
»Ob du es nun verstehst oder nicht, du bist auf unserer Seite.« 
»Aber wozu soll das alles gut sein? Was hat es für einen Sinn?« 
»Man  kann  die  Evolution  steuern.  Das  allein  schon  macht  es 
lohnenswert.« 
»Evolution ... Das ist in deinen Augen Evolution?« 
Die extreme Variabilität von DNA‐Informationen würde sich dann 
nur noch in einer Person, nämlich Sadako Yamamura, konzentrieren 
... Konnte man das wirklich Evolution nennen? 
Hierin  lag  aber  auch  ein  Schwachpunkt.  Dachte  man  zum Beispiel 
an das Wüten der Pest, waren zwar sehr viele Menschenleben zu be‐
klagen gewesen, doch einigen hatte sie nichts anhaben können. Wenn 
die  Welt  ein  einziger  Gletscher  würde,  die  Inuit  könnten  überleben. 
Menschen verfügten über unterschiedliche Widerstandskräfte. 
Doch  wenn  es  keine  Vielfalt  mehr  gab,  bestand  die  Gefahr,  dass 
bereits  eine  kleine  Begebenheit  eine  ganze  Spezies  auf  einen  Schlag 
ausrottete. Sollte Sadako Yamamura zum Beispiel schwache Abwehr‐
kräfte haben, würden alle Sadako Yamamuras dieses Manko aufwei‐
sen. Eine normale Grippe könnte dann verheerende Folgen haben. 
Dies war die einzige Hoffnung, die den Menschen blieb: zu warten, 
bis die Spezies Sadako Yamamura allmählich ausstarb, und unauffäl‐
lig weiterleben. 
»Weißt  du,  warum  Lebewesen  dem  Prozess  der  Evolution  unter‐
worfen sind?«, fragte Ryuji. 
Ando  schüttelte  wortlos  den  Kopf.  Auf  diese  Frage  war  bislang 
noch keine abschließende Antwort gefunden worden. 
»Nehmen  wir  zum  Beispiel  die  Augen  ...  Dir  als  Pathologen 
brauche ich das ja nicht zu erklären, aber die Augen eines Menschen 
funktionieren nach einem sehr komplizierten Mechanismus. Im Lauf 
der  Zeit  veränderte  sich  zufällig  ein  Teil  der  Haut  in  die  Hornhaut, 
die  Nervenenden  der  Pupillen  und  des  Augapfels  wurden  mit  dem 
Gehirn  verbunden,  und  man  konnte  sehen.  Ich  glaube  nicht,  dass 
man  allein  aufgrund  der  Entstehung  des  Mechanismus  Auge  auch 
gleich  automatisch  sehen  konnte.  Dahinter  steckte  vielmehr  der  aus 
dem  Inneren  geborene  Wille,  sehen  zu  wollen.  Lebewesen  im  Meer 
kamen  auf  das  Land,  Reptilien  konnten  fliegen  ...  Das  waren  keine 
Zufälle.  Nur  weil  ein  starker  Wille  existierte,  kam  es  dazu.  Auch 
wenn  viele  Wissenschaftler  über  diese  Theorie  vermutlich  lachen 
werden ... 
Kannst du dir eine Welt voller Lebewesen ohne Augen vorstellen? 
Dem  Regenwurm  unter  der  Erde  offenbart  sich  nur  die  Welt,  die  er 
fühlen kann. Seeanemonen und Seesterne können nur ihre unmittel‐
bare  Umgebung  wahrnehmen  und  fühlen.  Glaubst  du,  dass  sich  bei 
diesen  Lebewesen  der  Wille  zu  sehen  so  einfach  einstellen  könnte? 
Für  diese  lebenden  Organismen  wäre  das  eine  völlig  fremde  Welt. 
Die Lebewesen auf der Erde hingegen können den Prozess der Evolu‐
tion definieren. Schließlich haben sie sogar eine Kultur entwickelt. Ich 
weiß  zwar  nicht,  warum,  aber  aus  irgendeinem  Grund  entsteht  der 
Wille,  etwas  zu  haben,  von  dem  man  nicht  weiß,  dass  es  überhaupt 
existiert.« 
»Sieh  an,  es  gibt  also  auch  Dinge,  auf  die  du  keine  Erklärung  hast 
...«, bemerkte Ando. 
»Ich will damit sagen, dass es letztendlich der Wille des Menschen 
ist, dass die Menschheit untergeht und die neue Spezies ›Yamamura‹ 
entsteht.« 
»Nun  mach  mal  einen  Punkt.  Es  gibt  keine  Spezies,  die  sich  den 
eigenen Untergang wünscht!« 
»Die  Frage  ist,  ob  im  Unterbewusstsein  nicht  doch  ein  bestimmtes 
Verlangen  danach  existiert.  Da  sich  die  Vielfalt  der  DNA  in  Sadako 
Yamamura  konzentrieren  würde,  wären  die  Unterschiede  aufgeho‐
ben:  Alle  Menschen  hätten  das  gleiche  Talent,  denselben  Körper,  es 
gäbe  keine  Differenzierung  in  hübsche  und  hässliche  Menschen, 
keine  Kriege,  auch  keine  Streitigkeiten.  Eine  absolut  friedvolle, 
gleichberechtigte Welt. Der Begriff ›Todesangst‹ würde aus dem Lexi‐
kon gestrichen, denn es wäre eine Welt jenseits von Leben und Tod. 
Ist  es  nicht  das,  was  ihr  euch  im  Grunde  eures  Herzen  wünscht?«, 
flüsterte Ryuji Ando ins Ohr. 
Takanori spielte nach wie vor mit der Dose im Sand. Ando blickte 
Ryuji kurz an. »Ich bin anders.« 
In Andos Augen war sein Sohn ein ganz besonderer Mensch. Nein, 
er ließ sich weiß Gott nicht mit einer anderen Person vergleichen. Das 
konnte er jetzt mit Gewissheit sagen. 
»Wie dem auch sei ...« Ryuji stand auf. 
»Willst du schon los?« 
»Ja, ich muss. Was wirst du jetzt machen?« 
»Ich  werde  mich  auf  eine  kleine,  einsame  Insel  verkriechen,  wo  es 
keine Medien gibt, und meinen Sohn großziehen.« 
»Typisch! Ich werde mir den Untergang der Menschheit anschauen. 
Wer nicht bis zum Schluss dabei ist, kann den Willen, von dem man 
bis  jetzt  noch  nichts  ahnt,  nicht  vom  Himmel  fallen  sehen.  Diesen 
Moment darf ich nicht verpassen.« Ryuji drehte sich um und ging. 
»Lass es dir gut gehen. Grüß Miyashita von mir.« 
Plötzlich  blieb  Ryuji  stehen.  »Noch  etwas.  Warum  haben  die 
Menschen  eine  Kultur  entwickelt?  Die  Antwort  ist  ganz  einfach: 
Menschen können keine Langeweile ertragen — mit anderen Worten: 
um vor der Eintönigkeit zu fliehen. Da gibt es natürlich ein Problem, 
wenn  alles  Leben  nur  noch  aus  einer  DNA  besteht.  Das  dürfte  sehr 
langweilig sein. In Wirklichkeit wäre es aus dieser Perspektive besser, 
Unterschiede  zu  haben.  Aber  da  kann  man  wohl  nichts  machen.  Ihr 
Menschen wünscht es euch nun mal, dass es bald nur noch eine DNA 
gibt. Auf einer Insel wird es sehr langweilig sein.« Ryuji verschwand. 
Eigentlich  hatte  Ando  noch  nicht  entschieden,  wo  er  leben  wollte, 
so  wie  er  überhaupt  keine  Ideen  in  Bezug  auf  seine  Zukunft  hatte. 
Wer  wusste  schon,  wer  Gelegenheit  haben  würde,  sie  zu  verwirk‐
lichen? 
Er  zog  Hose  und  Hemd  aus  und  rannte  zum Strand  hinunter.  Die 
kleine Hand seines Sohnes greifend, sagte er: »Lass uns gehen.« 
Dann  erklärte  er  Takanori  genau,  worauf  es  ankam.  Wie  vor  zwei 
Jahren stürzten sie sich ins Wasser. Damit Takanori nicht untergehen 
konnte, umklammerte Ando seine Hand ganz fest. 
Etwas  Ähnliches  hatte  Sadako  Yamamura  getan,  als  sie  auf  dem 
Dach  im  Entlüftungsschacht  wiedergeboren  worden  war.  Sie  hatte 
das  Gefühl  gehabt,  in  ihrer  neuen  Umwelt  ohnehin  nur  dann  über‐
lebensfähig  zu  sein,  wenn  sie  mit  eigener  Kraft  aus  dem  Schacht 
herausklettern konnte. Ando dachte, dass sein Sohn etwas Ähnliches 
brauchte. 
Takanori  hatte  eine  panische  Angst  vor  dem  Wasser.  Wenn  er  sie 
nicht überwand, würde er im Alltagsleben Schwierigkeiten haben. 
Hand in Hand standen sie bis zu den Knöcheln im Wasser. 
»Du  versprichst  es  mir,  Papa  ...«,  vergewisserte  sich  Takanori  mit 
zitternden Lippen. 
»Du kannst dich auf mich verlassen. Ehrenwort.« 
Wenn Takanori die Angst vor dem Wasser überwand, wartete eine 
kleine Belohnung auf ihn. Er würde seine Mutter wiedersehen. 
»Deine Mama wird große Augen machen.« 
Andos Exfrau wusste nichts von der Wiedergeburt ihres Kindes. Sie 
würden  sich  nach  langer  Zeit  zum  ersten  Mal  wiedersehen.  Ando 
bekam  allein  bei  dem  Gedanken  Herzrasen.  Er  musste  eine  logische 
Erklärung  für  Takanoris  plötzliches  Auftauchen  finden.  Vielleicht 
diese:  Takanori  war  von  einem  Fischer  gefunden  worden  und  hatte 
die  letzten  zwei  Jahre  im  Koma  an  einem  anderen  Ort  verbracht. 
Welches  Lügenmärchen  Ando  seiner  Frau  auch  auftischte  —  wenn 
sie ihr Kind erst einmal berührte, würde sie alles glauben. 
Ob  sie  als  Ehepaar  wieder  zueinander  fanden,  war  eine  andere 
Sache. Ando würde alles dafür geben. Es hing einzig und allein von 
ihr ab. Er schätzte die Chancen dafür auf fünfzig zu fünfzig ein. 
Eine  Welle  türmte  sich  vor  ihnen  auf.  Takanori  entrang  sich  ein 
Schrei. Seinen Sohn fest im Arm haltend, lief Ando ins Meer hinein, 
während er das Pochen des kleinen Herzens auf seiner Haut spürte. 
Wie die Zukunft der Menschheit aussah, wusste er nicht. Nur eines 
war sicher: Sein Sohn lebte.