Construction of a Proteome Profile and Functional Analysis of the

Proteins Involved in the Initiation of Mouse Spermatogenesis

Xiao-yan Huang, Xue-jiang Guo, Jian Shen, Yu-feng Wang, Lin Chen, Jin Xie, Ning-ling Wang,
Fu-qiang Wang, Chun Zhao, Ran Huo, Min Lin, Xinru Wang, Zuo-min Zhou,* and Jia-hao Sha

Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing, 210029, China

Received March 7, 2008

Spermatogenesis is a complex process of terminal differentiation wherein mature sperm are produced.
In the first wave of mouse spermatogenesis, different spermatogenic cells appear at specific time points,
and their appearance is expected to be accompanied by changes in specific protein expression patterns.
In this study, we used 2D-PAGE and MALDI-TOF/TOF technology to construct a comparative proteome
profile for mouse testis at specific time points (days 0, 7, 14, 21, 28, and 60 postpartum). We identified
362 differential protein spots corresponding to 257 different proteins. Further cluster analysis revealed
6 expression patterns, and bioinformatics analysis revealed that each pattern was related to many
specific cell processes. Among them, 28 novel proteins with unknown functions neither in somatic
cells nor germ cells were identified, 8 of which were found to be uniquely or highly expressed in mouse
testes via comparison with the GNF SymAtlas database. Further, we randomly selected 7 protein spots
and the above 8 novel proteins to verify the expression pattern via Western blotting and RT-PCR, and
6 proteins with little information in testis were further investigated to explore their cellular localization
during spermatogenesis by performing immunohistochemistry for the mouse testis tissue. Taken
together, the above results reveal an important proteome profile that is functional during the first wave
of mouse spermatogenesis, and they provide a strong basis for further research.

Keywords: spermatogenesis • testis development • comparative proteome • bioinformatics analysis

Introduction proteins are the bona fide executors of life-cycle processes.

Spermatogenesis is a biological process that involves suc-
cessive mitotic, meiotic, and postmeiotic phases. During this
complex process, round undifferentiated spermatogonia be-
come elongated, terminally differentiated spermatozoa; this
requires a precise and well-coordinated system that regulates
the constantly changing patterns of gene and protein expres-
sion. It is known that the ultimate molecular regulation in male
germ cells, as in all other cells, primarily occurs at the
transcription level, next at the translation level, and thereafter
at the post-translation level.1 The first of these stages focuses
on gene expression, while the latter 2 are biased toward protein
expression. In the last 20 years, the identification of numerous
genes essential for the development of male germ cells has
crucially improved knowledge on spermatogenesis. Further, a
few laboratories have recently made considerable advances
with regard to genome sequencing and microarray analysis and
have observed the genome-wide expression patterns during
spermatogenesis.2–5
However, a transcriptomic database can only serve as a
starting point for understanding the functioning of a cell or
whole tissue at the molecular level and for establishing that
* To whom correspondence should be addressed. Zuomin Zhou, Labora-
tory of Reproductive Medicine, Department of Histology and Embryology,
Nanjing Medical University, 140 Hanzhong Road, Nanjing, Jiangsu province,
People’s Republic of China. Postal code: 210029. Phone: 86-025-86862908.
Fax: 86-025-86862908. E-mail: zhouzm@njmu.edu.cn.
Moreover, transcriptomics poses certain limitations since a
majority of mRNAs and proteins are not always correlated.6,7
This feature is particularly distinct during spermatogenesis due
to the following points: (1) male germ cell-specific proteins may
be synthesized from specific alternate transcripts; (2) transcrip-
tion is arrested during spermiogenesis, and preexisting mRNAs
are stored for several days; (3) for the completion of spermato-
genesis, appropriate temporal activation of the stored messages
is required, and translational activation must occur indepen-
dent of transcriptional control.1,8,9 Therefore, some researchers
have focused their interest on protein expression, particularly
via proteome analysis, during male germ-cell development.
Recently, proteomes for Drosophila melanogaster sperm,10 rat
spermatogonia,11 different rat spermatogenic cells,12 and hu-
man sperm13 have been reported. In our laboratory, we have
previously established a proteome reference map by using adult
mouse testis and we have performed a proteomic analysis for
a heat-induced spermatogenic disorder in adult male mice.14
Proteomics is developing as a useful tool in male reproduc-
tive biology; however, only a few researchers have used
proteomics to investigate the expression pattern during sper-
matogenesis in whole developing testis, particularly during the
first wave of spermatogenesis, wherein germ cells multiply and
differentiate in a synchronous manner in the testis. Therefore,
the aim of the present study is to establish a proteome profile
during the initiation of mouse spermatogenesis and to identify

10.1021/pr800179h CCC: $40.75  2008 American Chemical Society Journal of Proteome Research 2008, 7, 3435–3446 3435
Published on Web 06/27/2008
research articles
more of the proteins involved in this process. After confirming
specific time points by hematoxylin and eosin (H&E) staining,
we used mouse testes at days 0, 7, 14, 21, 28, and 60 to perform
a comparative proteomic analysis. We identified 362 signifi-
cantly differentiated protein spots and MS/MS validated a
subset of 86 of these. Further cluster analysis revealed 6
expression patterns, and bioinformatics analysis revealed that
each pattern was related to many specific cell processes mostly
in somatic cells and provided important information for further
research during spermatogenesis. In addition, among them, we
identified 28 novel proteins with unknown functions in the
profile and 8 proteins that were uniquely or highly expressed
in the mouse testis via comparison with the GNF SymAtlas
database. Then we randomly selected 7 protein spots and the
above 8 novel proteins to verify the expression patterns via
Western blotting and RT-PCR, and 6 proteins were further
investigated to explore cellular localization by performing
immunohistochemistry (IHC) for the mouse testis tissue. Taken
together, the above results reveal an important proteome
profile that is functional during the first wave of mouse
spermatogenesis and which also provides a resource for future
study of many proteins with unknown function occurring in
mouse spermatogenic cells.
Experimental Methods
Animals. Pregnant ICR mice were obtained from the labora-
tory animal center of Nanjing Medical University (Nanjing,
China) and were maintained in a controlled environment under
a 12/12-h light/dark cycle at 20-22 °C and 50-70% humidity,
with food and water available ad libitum. Following litter
delivery, the testes of the male offspring were collected at
different times postpartum (on days 0, 1, 3, 4, 7, 8, 10, 11, 14,
18, 20, 21, 26, 28, and 60) and were fixed in Bouin’s solution.
The fixed tissues were then paraffin-embedded, sectioned, and
stained with hematoxylin and eosin for histological examination
in order to select specific time points. To facilitate the further
analysis, finally, 6 time points during the first wave of mouse
spermatogenesis (days 0, 7, 14, 21, 28, and 60) were selected
(refer to Results for details).
Protein Extraction. Testes obtained from the mice at the
abovementioned 6 time points (3 independent mouse groups
for each time point) were homogenized in lysis buffer (7 M
urea, 2 M thiourea, 4% [w/v] CHAPS, 2% [w/v] DTT, and 2%
[v/v] IPG buffer [pH 3-10]) in the presence of 1% (v/w)
protease inhibitor cocktail (Pierce Biotechnology, Rockford, IL).
The mixture was placed on a shaker at 4 °C for 1 h, and the
insoluble matter was subsequently removed by centrifugation
at 40 000g and 4 °C for 1 h. The protein concentration in each
sample was determined by the Bradford method, using BSA
as the standard.
Two-Dimensional Electrophoresis. IPG strips (length, 24 cm;
pH, 3-10 NL; Bio-Rad) loaded with 120 µg of proteins extracted
from the mouse testes were rehydrated. Following isoelectric
focusing, the IPG strips were equilibrated, run in an Ettan DALT
twelve electrophoresis system (GE Healthcare, San Francisco,
CA), and visualized by silver staining as described previously.14,15
Statistical Analysis. The stained gels were scanned, and the
ImageMasterTM 2-D Platinum Software (Version 5.0, Amer-
sham Bioscience, Swiss Institute of Bioinformatics, Geneva,
Switzerland) was used for spot detection, quantification, and
comparative analyses, as described previously.14 In this experi-
ment, 24 gels were analyzed in total: 3 containing the inde-
pendent protein groups and 1 containing a mixture of these
3436 Journal of Proteome Research • Vol. 7, No. 8, 2008
Huang et al.
for each of the 6 time points. Thus, proteins from each time
point were repeated four times. The expression level was
determined based on the relative volume of each spot in the
gel and was expressed as a percentage (%volume ) [spot
volume/∑ volumes of all the spots resolved in the gel]). Only
protein groups corresponding to the spots present in all gels
were considered for differential analysis. The values obtained
for 24 independent experiments were pooled for calculating
the means and standard deviation. Protein spots differentially
changed across time were determined if the P-value was less
than 0.05 by statistical analysis (ANOVA). And the P-value
corresponding to each differentiated spot is shown in the
Supplemental Table 1.
Protein Identification by MALDI-TOF/TOF. The differenti-
ated protein spots were excised, dehydrated in acetonitrile
(ACN), and dried at room temperature. The proteins were
reduced using 10 mM DTT/25 mM NH4HCO3 at 56 °C for 1 h
and were subsequently alkylated in situ with 55 mM iodoac-
etamide/25 mM NH4HCO3 in the dark at room temperature
for 45 min. The gel fragments were thoroughly washed with
25 mM NH4HCO3, 50% ACN, and 100% ACN and dried in a
Speed-Vac. These dried gel fragments were reswollen with 2-3
µL of trypsin (Promega, Madison, WI) solution (10 ng/µL in 25
mM NH4HCO3) at 4 °C for 30 min. The excess liquid was
discarded, and the gel plugs were incubated at 37 °C for 12 h.
Trifluoroacetic acid (TFA) at a final concentration of 0.1% was
added to arrest the digestive reaction.
The digests were immediately spotted onto 600-µm Anchor-
Chips (Bruker Daltonics, Bremen, Germany). Spotting was
achieved by pipetting 1 µL of the analyte onto the MALDI target
plate in duplicate and subsequently, 0.05 µL of 2 mg/mL
R-HCCA in 0.1% TFA/33% ACN containing 2 mM (NH4)3PO4
was added. Bruker peptide calibration mixture (Bruker Dal-
tonics, Bremen, Germany) was also spotted for external calibra-
tion. All samples were air-dried at room temperature, and 0.1%
TFA was used for on-target washing. All the samples were then
analyzed on a time-of-flight Ultraflex II mass spectrometer
(Bruker Daltonics, Bremen, Germany) in the positive-ion
reflectron mode.
Each acquired mass spectrum (m/z range, 700-4000; resolu-
tion, 15 000-20 000) was processed using the FlexAnalysis v2.4
and Biotools 3.0 software packages (Bruker Daltonics, Bremen,
Germany) with the following specifications: peak detection
algorithm, Sort Neaten Assign and Place (SNAP); S/N threshold,
3; and quality factor threshold, 50. Tryptic autodigestion ion
picks (842.51, 1045.56, 2211.10, and 2225.12 Da) were used as
internal standards for validating the external calibration pro-
cedure. Matrix and/or autoproteolytic trypsin fragments, or
known contaminants (e.g., keratins), were removed. The masses
of the peptides thus obtained were first searched for in the IPI
mouse database (53 981 sequences) using Mascot (v2.1.03) in
the automated mode with the following search parameters: a
significant protein score at p < 0.05; minimum mass accuracy,
100 ppm; enzyme, trypsin; missed cleavage sites allowed, 1;
cysteine carbamidomethylation; acrylamide-modified cysteine;
methionine oxidation; similarity between pI and relative mo-
lecular mass specified; and a minimum sequence coverage of
15%.
Protein identification was confirmed using the sequence
information obtained by performing MS/MS. Each acquired
MS/MS spectrum was also processed using the FlexAnalysis
v2.4 and Biotools 3.0 software packages (Bruker Daltonics) by
the SNAP method at a signal-to-noise ratio threshold of 3.0.
Proteome Profile in the Initiation of Mouse Spermatogenesis
The MS/MS spectra were searched for in the IPI mouse
database, using Mascot (v2.4) in the automated mode with the
following search parameters: 100 ppm for the precursor ion
and 0.3 Da for the fragment ions. The cleavage specificity and
covalent modifications were considered as described above,
and the score obtained was higher than the minimal significant
(P < 0.05) individual ion score. All significant MS/MS identi-
fications performed using Mascot were manually verified for
spectral quality and for matching the y and b ion series. In the
case of multiple entries corresponding to slightly different
sequences, only the database entry exhibiting the highest
number of matching peptides was included. These identified
proteins are listed in Supplemental Table 1.
Cluster Analysis. Identified proteins were subjected to
clustering analysis. For each identified protein spot, mean
abundance values from the four repeats were calculated and
then normalized. The normalized abundance values were then
loaded into the Cluster 3.0 software,16 and the protein spots
were clustered using k-Means algorithm with similarity metric
of Euclidian distance. Different numbers of clusters were tried
and the one with minimal number of clusters and also giving
sufficient separation of expression patterns across time was
finally chosen. The clustering results were viewed using Tree-
View software.17
Bioinformatics Analysis Using Pathway Studio. To further
explore the significance of proteins in each cluster, the Pathway
Studio (v5.00) software (Ariadne Genomics, Inc., MD), a
specialized graph visualization engine, was used to determine
the relevant molecular functions of proteins exhibiting signifi-
cantly differential expression during mouse testis development.
The gene list was imported into Pathway Studio to identify the
cell processes influenced by these proteins. Each identified
cellular process was confirmed via the Pub Med/Medline
hyperlink embedded in each node.
GNF SymAtlas Database analysis. We compared each
protein profile with those in Pubmed and thus identified several
novel proteins with unknown functions. To predict the roles
of these novel proteins in mouse testis spermatogenesis, we
analyzed their tissue expression patterns via the GNF SymAtlas
database, a database of publishing experimental gene func-
tionalization for gene expression profiles from normal human
and mouse samples across a diverse array of tissues, organs,
and cell lines.19
Western Blot Analysis and Reverse Transcriptional PCR
(RT-PCR). The protein levels of Hspa5, Arhgdia, Cct5, Prdx4,
Sod2, Ddx4, Pdia3, and β-actin in the mouse testis tissue at
the 6 time points (days 0, 7, 14, 21, 28, and 60) were analyzed
by previously described methods.14 Antibodies against Hspa5
(1:100), Arhgdia (1:100), Cct5 (1:100), and Prdx4 (1:50) were
commercially obtained from Santa Cruz Biotechnology. The
other antibodies against Sod2 (1:2000), Ddx4 (1:100), Pdia3 (1:
1000), and β-actin (1:5000) were obtained from Abcam. β-Actin
was used as the positive control.
cDNAs of mouse testis from 6 time points during the first
wave of mouse spermatogenesis (days 0, 7, 14, 21, 28, and 60)
were prepared to perform RT-PCR with the abovementioned
8 novel testis proteins. RNA was extracted with Trizol reagent
(Gibco BRL, GrandIsland, NY) and reverse-transcribed into
cDNA with AMV reverse transcriptase (Promega). The various
cDNAs were PCR-amplified with specific primers (Table 1) in
20 µL of PCR reactions containing 10× PCR buffer (2 µL), 25
mmol/L Mg2+ (1.5 µL), 2 mmol/L dNTPs (1.5 µL), Taq DNA
polymerase (5 U/mL) (0.1 µL), distilled water (10.9 µL), 5 pmol
research articles
Table 1. Specific Primers of the 8 Novel Proteins
product
name sequences length
1700019b03rik F: 5′ TTGACCGGGATTCAATGCCCTCG3′ 232 bp
R: 5′ GCCCTCTTACACATCAAGGCTGG3′
Sept10 F: 5′ GGTCGTCAGTATCCTTGGGGTA 3′ 251 bp
R: 5′ TGACGCTCACCATAGAACTCGTG 3′
1110004e09rik F: 5′ CTGCACCCTAATATGCAAGGGCTG 3′ 281 bp
R: 5′ ATGACCGCACCTCGAAGCTG 3′
1700113h08rik F: 5′ ACTCCAAGGGAGATTCTGGTCCTG 3′ 234 bp
R: 5′ GATGCTTGAGGGTCGTCTCTGG 3′
Prdx6-rs1 F: 5′ GGATGCTAACAGCATGCCTCTGAC 3′ 210 bp
R: 5′ TCGGGAAGGACCATCACGCTC3′
1700037h04rik F: 5′ TGGCAGTGTCAAGTAGGAGCTGC 3′ 241 bp
R: 5′ CTGTGCAGGATCTTCAGGAAGCCA 3′
Acyp1 F: 5′ TCGGATCATCCAAGTGTTTGAGC 3′ 209 bp
R: 5′ CATGAAGCGCACCTTGGAGACG 3′
Irgc1 F: 5′ CCTGCCACCTCTTACTGTTC 3′ 325 bp
R: 5′ATTGATGAGGGAGGACTTGC3′
primer (1 µL), and template cDNA (2 µL). The amplification
conditions consisted of an initial denaturation at 94 °C for 5
min, followed by 30 cycles of 94 °C for 30 s, 52 °C for 30 s and
72 °C for 30 s, with a final extension at 72 °C for 7 min. The
PCR products were analyzed with 1.5% (w/v) agarose electro-
phoresis, and mouse β-actin was amplified as the control.
IHC. Testicular sections fixed in Bouin’s solution and
embedded in paraffin were immunostained as described previ-
ously.18 In brief, the sections were incubated in 2% H2O2 for
quenching the endogenous peroxidase activity and were washed
in phosphate-buffered saline (PBS). They were then blocked
with a blocking serum and incubated overnight at 4 °C with
primary antibodies against Hnrpa2b1 (1:100), Arhgdia (1:50),
Prdx4 (1:50), Pdia3 (1:3000), Hsp27 (1:100), and DDAH (1:10).
After three washings with PBS, the sections were incubated with
HRP-conjugated secondary antibodies. The immunoreactive
sites were visualized as brown staining with diaminobenzidine
and were mounted for performing bright-field microscopy
(Axioskop 2 plus, ZEISS, Germany). The negative controls were
incubated with a solution devoid of any primary antibody.
Results
Identification of specific Time Points during the First
Wave of Mouse Spermatogenesis. Consistent with previous
literature,20 by performing H&E staining, we observed that the
mitotic phase lasts for approximately 11 days, the meiotic phase
for approximately 10 days, and the postmeiotic phase for
approximately 14 days. Therefore, to make the further analysis
economically and effectively, we selected 6 time points, which
evidently represented the specific phase of spermatogenesis,
from the abovementioned 15 time points originally considered.
As shown in Figure 1, the seminiferous epithelium in the testes
of newborn mice contained 2 distinct cell typessgonocytes and
Sertoli cells. By postpartum days 6-7, the germ cells had
adhered to the basement membrane, and mitosis was initiated.
The primary spermatocytes attained an early pachytene stage
by day 14, and the number of round spermatids increased by
day 21; this signified the onset of spermiogenesis. By day 28,
elongating spermatids were observed, and normal asynchro-
nous spermatogenesis was in progress in the testis tissue on
day 60.
Identification of Proteins Related to the First Wave of
Mouse Spermatogenesis. 2-DE of the testis tissue samples was
performed on days 0, 7, 14, 21, 28, and 60 over a pH range of
Journal of Proteome Research • Vol. 7, No. 8, 2008 3437
research articles Huang et al.

Figure 1. H&E staining at 6 time points (days 0, 7, 14, 21, 28, and 60). Each one represented specific phases of mouse spermatogenesis.
The seminiferous epithelium in the testes of newborn mice only contained gonocytes and Sertoli cells. By postpartum days 7, gonocytes
had adhered to the basement membrane, and mitosis began. By day 14, the primary spermatocytes prepared to the first stage of
meiosis. By postpartum day 21, the second stage of meiosis was processing and produced round spermatids. By postpartum day 28,
elongating spermatids were observed and spermiogenesis began. On day 60, normal asynchronous spermatogenesis occurred in the
testis tissue.

3-10 (Figure 2). By examining the 2-DE gels with the Image-
Master 2D Platinum software, we obtained 487 spots that were
significantly (P < 0.05) different. Finally, 362 spots correspond-
ing to 257 proteins were successfully identified via MALDI-TOF/
TOF and 86 spots were further validated via MS/MS (Supple-
mental Table 1). These protein spots were considered highly
related to specific phases in the first wave of mouse spermato-
genesis and further emphasized. Also, the results showed many
proteins in the profile yielded more than 2 spots in the gel.
Cluster Analysis. Cluster analysis was performed to better
characterize the more specific and unique expression patterns
of the 362 protein spots. Finally, 6 numbers of clusters
corresponding to 6 distinct expression patterns with relatively
discrete chronological boundaries emerged with time. These
6 unique patterns included high expression immediately
postpartum (day 0) (Figure 3, C0); upregulation on postpartum
day 7 (Figure 3, C1); dramatic upregulation only on postpartum
day 14, followed by downregulation in adulthood (Figure 3, C2);
high expression mainly on day 21 with sustained expression
until day 28 (Figure 3, C3); induction on day 28 with sustained
elevation until adulthood (Figure 3, C4); and significantly
elevated expression in adulthood (Figure 3, C5).
Bioinformatics Analysis. Supplemental Table 2 shows the
relationship between the important specific cell processes and
the proteins involved in each cluster. List 2-41 showed the
proteins (19/54, 35%) belonging to C0 participate in the 6 cell
processes related to “stem cell properties”, such as embryo-
genesis, embryonic development, anagen and so forth. List
42-119 showed the proteins (22/35, 63%) belonging to C1 were
concerned with the 11 cell processes related to mitosis. List
120-169 showed the proteins (25/75, 33%) belonging to C2
were involved in the 8 cell processes related to meiosis. List
170-207 showed the proteins (23/94, 24%) belonging to C3 and
C4 participate in the 4 cell processes related to spermiogenesis,
also indicated in Figure 4 as an example. List 208-246 displayed
the proteins (23/84, 27%) belonging to C4 and C5 were
concerned with the 6 cell processes related to fertilization.
Tissue Expression of Novel Proteins. On the basis of the
profiles analyzed, 28 novel proteins with unknown functions
neither in somatic cells nor germ cells were identified. GNF
SymAtlas database analysis revealed 3 to be uniquely expressed
and 5 to be highly expressed in mouse testes. Figure 5 shows
the tissue expression profiles of 2 representative proteins that
were uniquely and highly expressed in the testes. And these 8
novel proteins are the perfect candidates for further exploring
their roles during mouse spermatogenesis.
Western Blot Analysis and RT-PCR. To verify the results of
2D-PAGE of the identified proteins, we randomly selected
several known proteins for Western blot. Because in the gel
usually more than 1 spot represents 1 protein, we considered
the results of Western blot should be identical with the protein
spots which had the proper molecular weight in the gel. As
shown in Figure 6A, the results of Western blot and 2D-PAGE
analyses were sufficiently consistent. Such as with the protein
Arhgdia, the Western blot showed it was highly expressed
postpartum and with sustained expression until day 21, then
the expression level was reduced. And also the corresponding
spot in the gel changed the expression level with the similar
tendency, as seen in Cluster 0. The expression patterns of
Hspa5, Cct5 and Sod2 were similar as seen in Cluster 3 and
indicated induced expression on day 14 or 21 and sustained
expression level until day 28. The expression level of Pdia3 was
mostly induced on day 21 and day 28 as in Cluster 4. Ddx4
and Prdx4 were highly expressed on day 60, while Ddx4 was
induced on day 14 and gradually increased, and one isoform

3438 Journal of Proteome Research • Vol. 7, No. 8, 2008

Proteome Profile in the Initiation of Mouse Spermatogenesis
Figure 2. 2-DE gels of mouse testis tissue samples at the 6 time points. Differential expressed proteins were extracted, separated by
2D-PAGE, and visualized by silver staining.
Figure 3. Cluster analysis of 362 differentially expressed protein
spots. Six numbers of clusters corresponding to 6 distinct
expression patterns were identified. Green shows the expression
level repressed and red shows the expression level induced.
of Prdx4 (white arrow) was only highly expressed in adulthood.
Both of them fell into Cluster 5.
As to the novel proteins that have only sequence information
in NCBI, no antibody can be obtained at present, so we used
RT-PCR to verify the expression pattern in the 2D results. Figure
6B showed the results of RT-PCR (left) for the 8 novel proteins
which were uniquely or highly expressed in mouse testes were
similar with the 2D-PAGE results. All were highly expressed in
adult mouse testis.
research articles
Figure 4. Four specific cellular processes (yellow), 23 participating
proteins (red) were identified and were consistent with previous
literatures (the line) in Cluster 3 and 4, related to spermiogenesis.
IHC. To explore the preliminary function of the identified
proteins, we selected several proteins that the literature indi-
cated little information in testis, and performed IHC to define
the cellular localization for mouse testis tissue with the 6 time
points.
1. Hsp27: This protein was highly expressed in the sper-
matogonial cytoplasm in the testes of the newborn mice.
However, later, it was mostly expressed in the cytoplasm of
the primary spermatocytes, while the other spermatogenic cells
exhibited faint immunoreactivity (Figure 7A).
Journal of Proteome Research • Vol. 7, No. 8, 2008 3439
research articles Huang et al.

Figure 5. GNF SymAtlas database analysis shows the tissue distribution of proteins with unknown funcitons. (A) One protein with
unknown function was uniquely expressed in the mouse testis; (B) another protein was highly expressed in the mouse testis.

Figure 6. Western blot validation of known proteins and RT-PCR validation of novel proteins. The expression tendency was almost
identical. (A) The left panel shows the results of Western blot analysis performed with randomly selected 7 protein antibodies using
aliquots of total protein extracts from mouse testis tissue at the 6 time points. The right panel shows the corresponding spots with the
same molecular weight distributed in the 2-DE gels. (B) The left panel shows the results of RT-PCR with 8 novel protein specific primers
using cDNA of mouse testis tissue at the 6 time points. The right panel shows the corresponding spots distributed in the 2-DE gels.

2. Hnrpa2b1: A weak signal was obtained for this protein the appearance of spermatocytes, it was expressed in the
in the spermatogonia of the mouse testes on days 0 and 7. With spermatocyte nucleus during the early stage, while the sper-

3440 Journal of Proteome Research • Vol. 7, No. 8, 2008

Proteome Profile in the Initiation of Mouse Spermatogenesis research articles

Figure 7. Immunolocalization of Hsp27 (A) and Arhgdia (B) in the mouse testis at the 6 time points. (A) Hsp27 was highly expressed
in the spermatogonial cytoplasm (arrows) in the testes of the newborn mice. Later, it was mostly expressed in the cytoplasm of the
primary spermatocytes (arrowheads). (B) Arhgdia was diffusively expressed in the seminiferous tubules of the mouse testes on days
0 and 7. With the appearance of spermatogenic cells of all stages, the signal became stronger, and distinct immunoreactivity was
observed in the Sertoli cells (arrows). Scale bars are all 10 µm.

matogenic cells at later stages almost completely lacked im-
munoreactivity (Supplemental Figure A).
3. Pdia3: This protein was expressed in the spermatogonial
cytoplasm in the testes of the newborn mice; subsequently, an
intermediate signal was distributed in the spermatogenenic
cells at every level, particularly in the round and elongated
spermatids. Leydig cells and Sertoli cells lacked immunoreac-
tivity (Supplemental Figure B).
4. Arhgdia: This protein was diffusively expressed in the
seminiferous tubules of the mouse testes on days 0 and 7. With
the appearance of spermatogenic cells of all stages, the signal
became stronger, and distinct immunoreactivity was observed
in the Sertoli cells (Figure 7B).
5. Prdx4: A weak signal corresponding to this protein
appeared in the spermatogonia of the testis during the first
week and subsequently diffused toward the spermatogenic cells
at other stages. However, strong immunoreactivity was ob-
served in the spermatids and residual bodies in the adult testes.
Simultaneously, during testicular differentiation, Leydig cells
also yielded a similar strong signal (Figure 8A).
6. DDAH: In the mouse testis tissue during the first week,
this protein was expressed in the spermatogonial nucleus, and
an intermediate signal was observed in the interstitial cells.
While the spermatogonia were attached to the basement, the
signal became increasingly weak, and the signal in the Leydig
cells became stronger. In the adult testis, DDAH was highly

Journal of Proteome Research • Vol. 7, No. 8, 2008 3441

research articles Huang et al.

Figure 8. Immunolocalization of Prdx4 (A) and DDAH (B) in the mouse testis at the 6 time points. (A) A weak signal corresponding to
Prdx4 appeared in the spermatogonia of the testis during the first week. However, strong immunoreactivity was observed in the
spermatids and residual bodies in the adult testes (arrowhead). Simultaneously, during testicular differentiation, Leydig cells also
yielded a similar strong signal (arrows). (B) During the first week, DDAH was expressed in the spermatogonial nucleus, and an
intermediate signal was observed in the interstitial cells. While the spermatogonia were attached to the basement, the signal in the
Leydig cells became stronger. In the adult testis, DDAH was highly expressed in the Leydig cells (arrows). Scale bars are all 10 µm.

expressed in the Leydig cells but yielded a weak signal in the
spermatogenic cells (Figure 8B).
Discussion
Spermatogenesis occurs in successive mitotic, meiotic, and
postmeiotic phases; during this complicated process,1 the germ
cells move from the periphery to the lumen of the seminiferous
tubules. It is known that spermatozoa are continuously pro-
duced asynchronously in the postpubertal testes; this makes
it difficult to identify the genes and proteins involved in specific
actions within the testes. However, during the first wave of
spermatogenesis, germ cells multiply and differentiate in a
synchronous manner in the testes.21 Therefore, the major stages
of germ cell development can be independently analyzed to
determine the cellular processes involved in the formation of
spermatozoa.
In the present study, after confirming specific time points
by H&E staining, testes obtained from mice at postpartum
days 0, 7, 14, 21, 28, and 60 were used to perform a
comparative proteome analysis. We consider the above 6
time points to perfectly represent the following major stages
of germ-cell development during the first wave of spermato-

3442 Journal of Proteome Research • Vol. 7, No. 8, 2008

Proteome Profile in the Initiation of Mouse Spermatogenesis
genesis: the appearance of fetal testis exhibiting stem-cell
properties (day 0); spermatogonial mitosis (day 7); initiation
of spermatocyte meiosis (day 14); round-spermatid produc-
tion (day 21); elongated-spermatid formation, also termed
spermiogenesis (day 28); and normal postpubertal spermato-
genesis (day 60). We assumed that many important and
different proteins are expressed during these processes and
that the identification of these differentially expressed
proteins could serve as a useful basis for future studies on
the biological factors influencing testicular development and
spermatogenesis.
In this study, 487 protein spots were observed to exhibit
significantly (P < 0.05) differential expression and these spots
were considered highly related to mouse spermatogenesis;
further, 362 protein spots corresponding to 257 proteins were
successfully identified. Thus, many proteins in the profile
yielded more than 2 spots in the gel. We consider that many
post-translational modification forms of these proteins exist
during mouse testicular development and spermatogenesis.
Further, cluster analysis revealed 6 distinct expression patterns
of the abovementioned proteins. Next, we used the Pathway
Studio (v5.00) software to determine the important cellular
processes that are influenced by these proteins in each cluster;
the results obtained were consistent with the previous litera-
ture. Thus, bioinformatics analysis provided abundant infor-
mation on the functions of the identified proteins in somatic
cells and also indicated their possible roles in mouse
spermatogenesis.
In C0, 54 proteins were highly expressed immediately
postpartum, and 19 of these were previously reported to be
involved in cell processes requiring stem-cell properties, such
as embryogenesis, embryonic development, anagen and so
forth. It is known that the testicular structure is established
during the proliferation and differentiation of migrated pri-
mordial germ cells (PGCs) into gonocytes prepartum and that
these gonocytes then undergo mitotic arrest, which is main-
tained until 3/4 days postpartum.22 After birth (approximately
6 days postpartum), gonocytes reach the basement membrane
of the seminiferous tubules, and those that survive subse-
quently differentiate into spermatogonia. All these germ cells
are termed “gonadal stem cells”.23 Although the proteins
identified in association with stem-cell properties were found
to be related to other stem cells, they can be presumed to play
a potential role in the gonadal stem cells. Here, we select one
protein Hsp27 (also named Hsp25) to explain the above
prediction. Adly et al. demonstrated that the expression of
Hsp27 was prominent in human scalp anagen hair follicles but
was weak in both catagen and telogen hair follicles.24 Gernold
et al. demonstrated that Hsp25 accumulation in mammals is
developmentally regulated during mouse embryogenesis.25
Here, by performing IHC, we observed that Hsp27 was highly
expressed in the cytoplasm of gonacytes during the first week;
however, during the later stages, it was mostly expressed in
the cytoplasm of the primary spermatocytes. Presuming that
Hsp27 is strongly related to the properties of gonadal stem cells,
it would be useful to investigate the functions of all the
abovementioned proteins in these cells.
In C1, 35 highly expressed proteins were identified. On day
7, as the gonacytes approached the basement of the seminif-
erous tubules, they began to produce spermatogonia. This was
followed by spermatogonial proliferation via mitotic division.26
Further, in our study, many proteins were found to participate
in proliferation, mitosis, mitogenesis and so forth. Such as CBX3
research articles
(HP1γ), a component of heterochromatin, Minc et al. demon-
strated that in mammals, HP1R and HP1γ exist in different
phosphorylated forms and become hyperphosphorylated at the
time of mitosis.27 Another protein, Grb2, functions as a link
between tyrosine kinase receptors and Ras signaling. Tari et
al. observed that Grb2 downregulation inhibited the growth of
ErbB2-overexpressing breast cancer cells, indicating its impor-
tance in the proliferation of this type of breast cancer cells.28
Although most of the above results were obtained in studies
on somatic cells, they provide a large amount of useful
information for investigating the functional mechanisms of
these proteins during spermatogonial mitosis.
In C2, the proteins that were highly expressed up to day
14 were considered to be involved in the initiation of
spermatocyte meiosis. It is known that during the meiotic
prophase, homologous chromosomes pair and undergo
recombination, followed by 2 divisions, in the absence of
an intervening S phase.29 In the present study, 13 proteins
were confirmed to be strongly related to the meiosis and
pachytene stages, consistent with the previous literature. It
has been unequivocally established that most of these
proteins, for example, Pgk-1, a key enzyme involved in the
metabolism of glucose or fructose during glycolysis, partici-
pate in spermatocyte meiosis. In mammalian spermatogenic
cells, transcriptional repression of the Pgk-1 gene occurs due
to X-chromosome inactivation during the prophase of meio-
sis I.30 Other proteins such as aldose reductase, serum
albumin, and GNAS are reported to be related to oocyte
meiosis;31–33 however, no information is available regarding
their roles in spermatocyte meiosis. Here, via IHC for mouse
testis tissue, we also explored the preliminary function of
another protein, Hnrpa2b1, selected from this cluster.
Hnrpa2b1 is an important RNA-binding protein. Kamma et
al. reported that it is expressed from the spermatogonium
stage to the spermatocyte stage in rat testis.34 In the present
study, it was weakly expressed in the spermatogonia of the
mouse testis from days 0 to 7. With the appearance of
spermatocytes, it was expressed in the spermatocyte nucleus
during the early stage, while the spermatogenic cells at later
stages almost completely lacked immunoreactivity. There-
fore, we consider that Hnrpa2b1 probably plays an important
role as a chaperone during spermatocyte meiosis. In addi-
tion, several cell processes occurring in somatic cells, such
as chromosomal DNA replication, DNA recombination, DNA
methylation, DNA nucleotide excision repair and so forth,
are also implicated in the process of meiosis;35,36 further
research should be conducted to explore the manner in
which the proteins considered in this study along with those
related to oocyte meiosis function during spermatocyte
meiosis.
Spermiogenesis is the phase of spermatogenesis during
which round spermatids differentiate into elongated sperma-
tozoa, with a unique process involving the formation of
acrosome with a large vesicle structure, condensation of
nucleus, generation of sperm tail and removal of most cyto-
plasm as residual body. During acrosome formation, many
acrosome-specific proteins follow the exocytic pathway and are
packed in proacrosomal granules,37 while microtubules and
cytoskeletal elements are largely involved in the other processes
of spermiogenesis.38,39 In this study, the proteins distributed
in C3 and C4 were highly related to spermiogenesis. On the
basis of information obtained using somatic cells, 23 of these
proteins have been determined to be involved in cell processes
Journal of Proteome Research • Vol. 7, No. 8, 2008 3443
research articles
such as exocytosis, motility, contraction, and relaxation, which
were considered related to spermiogenesis. Therefore, although
we did not find any protein in these 2 clusters reported directly
involved in spermiogenesis, we still suggest that these proteins
may participate in mouse spermiogenesis, and further research
should be conducted in this regard.
Proteins that are highly expressed in adult mouse testes are
suggested to be primarily involved in the future fertilization-
related functions of the sperm, such as capacitation, acrosome
reaction, sperm-egg recognition, binding, and fusion. The
previous literature has identified 5 proteins (Fbp1, Glul, Grp58,
Hspa2 and Sod1) in C4 and C5 as participants in fertilization.
Ergur et al. demonstrated that diminished levels of the chap-
erone Hspa2 can predict IVF failure; therefore, they considered
this protein to be strongly related to fertilization.40 IHC for
mouse testis tissue revealed that another protein, ERp57, also
referred to as Pdia3, was expressed in the spermatogonial
cytoplasm in the testes of newborn mice and that an interme-
diate signal was distributed in spermatogenenic cells at every
stage, particularly in round and elongated spermatids. In fact,
we previously identified this protein as a human sperm
acrosomal protein that plays a critical role in gamete fusion41
(because of some reason, it was not embodied in PathwayStu-
dio software). Thus, we consider that not only Erp57 but also
other proteins that are highly expressed in adult testis may play
important roles in fertilization. Further, proteins involved in
related cell processes such as mating, proteolysis, phagocytosis,
conjugation, and motility are suggested to be strongly related
to sperm function, and these proteins should be further
investigated.
Spermatogenesis is a complex process activated by testoster-
one, which is synthesized by Leydig cells and targets Sertoli
cells.42 Interesting, we also observed that some proteins in our
proteome profile were related to the functions of Sertoli or
Leydig cells. Arhgdia, also known as Rho GDI, is a regulator
that maintains the Rho-family members in a GDP-bound
inactive form in the cytosol.43 In this study, IHC for mouse testis
revealed that the signal was diffused in the newborn and 7-day-
old mice. Subsequently, with the appearance of spermatogenic
cells, the signal became increasingly strong, and distinct
immunoreactivity was observed in the Sertoli cells. In fact,
Togawa et al. observed that in the testis of Rho GDIa-/- mice,
vacuolar degeneration occurred in germ cells at every sper-
matogenic stage, and they predicted that vacuolization may
reflect Sertoli cell dysfunction.44 However, they did not discuss
whether Rho GDIa was localized in Sertoli cells. Thus, to the
best of our knowledge, this is the first report to directly indicate
that mouse Rho GDI is primarily expressed in Sertoli cells; its
precise role should be further investigated.
DDAH is a dimethylarginine dimethylaminohydrolase that
metabolizes the endogenous nitric oxide synthase (NOS)
inhibitors NG-monomethyl-arginine and NG,NG-dimethyl-L-
arginine to citrulline.45 Kostic et al. demonstrated that inhibi-
tion of NOSs, the family of enzymes responsible for NO
generation, prevented a similar inhibition of Leydig cell func-
tion.46 Although no report is available on the relationship
between DDAH and Leydig cells, in our study, we observed
that DDAH was in fact mostly expressed in the Leydig cells.
This result provides a useful insight for further investigation
of the role of DDAH in Leydig cells.
Another protein, Prdx4, is the fourth isoform of peroxire-
doxin. It exists as a 27-kDa secretable form in most tissues,
while the 31-kDa Prdx4, which represents the unprocessed,
3444 Journal of Proteome Research • Vol. 7, No. 8, 2008
Huang et al.
47
membrane-bound form, is only found in testis. In adult rat
testis, the 31-kDa form was observed to be highly expressed in
the elongated spermatids and residual bodies; it was restricted
to the membranes of the acrosome vesicle in the elongated
spermatids and was not detected in spermatozoa, indicating
that this form plays a role in acrosome formation during
vesicular reorganization in spermiogenesis.48 However, to the
best of our knowledge, there has been no report on the role of
the 27-kDa form in the testis. Here, by performing a compara-
tive proteomic analysis of mouse testis, we observed that the
31-kDa form of Prdx4 was in fact only expressed in the adult
testis tissue. Western blotting revealed that its 27-kDa form was
continually expressed in the testes of newborn to adult mice.
Further, IHC for the mouse testis tissue indicated, in the adult
testes, elongated spermatids and residual bodies exhibited
strong immunoreactivity, and we consider that the 31-kDa form
of Pxdx4 is localized here. However, strong signals were also
distributed in the Leydig cells in the testes of newborn to adult
mice; this result is significant, indicating that the 27-kDa form,
which exhibits peroxidase activity, is expressed in the Leydig
cells. A number of studies have suggested that oxidative damage
induced by reactive oxygen species (ROS) can affect critical
events associated with steroidogenesis in Leydig cells; therefore,
these cells exhibit many protective mechanisms against anti-
oxidants, including high antioxidant enzyme activity.49,50 It is
known that peroxiredoxins play a role against oxidative damage;
therefore, we predict that the 27-kDa form of Prdx4 is the
functional antioxidative enzyme localized in Leydig cells during
testicular development in mice.
In addition to the abovementioned proteins with known
functions in somatic cells but unknown functions in germ cells,
we identified 28 novel proteins with unknown functions neither
in somatic cells nor germ cells. To determine whether they are
functional in mouse spermatogenesis, we investigated their
tissue expression in comparison with information from a
known database (GNF SymAtlas). Of these novel proteins, 3
were uniquely expressed and 5 were highly expressed in mouse
testis tissue. Further RT-PCR results showed the mRNA expres-
sion level were similar with the protein level during the first
wave of mouse spermatogenesis. So we consider these 8
proteins may play critical roles in spermatogenesis; it would
be interesting to further conduct functional investigations on
these proteins.
In summary, by performing a comparative proteome analysis
for mouse testis during the first wave of spermatogenesis, we
constructed the protein expression profile involved in this
process. Further, via bioinformatics analysis, we obtained
information on proteins with known functions in somatic cells
and on those with unknown functions; this information could
serve as a basis for further exploration of the functions of these
proteins in mouse spermatogenic cells.
Acknowledgment. The study was supported by grants
from 973 program (2007CB948103), Chinese Natural Science
Funds (30700274, 30425006), Program of Changjiang Scholars
and Innovative Research Team in University (IRT0631) and
Jiangsu Natural Sciences of University (07KJB310070).
Supporting Information Available: Supplemental
Table 1 with full peptide data sets. Supplemental Table 2 with
identified proteins and cell processes in each cluster. Supple-
mental Figure with immunolocalization of Hnrpa2/b1 (A) and
Pdia3 (B) in the mouse testis at the 6 time points. This material
is available free of charge via the Internet at http://pubs.acs.org.
Proteome Profile in the Initiation of Mouse Spermatogenesis
References
(1) Eddy, E. M. Male germ cell gene expression. Recent Prog. Horm.
Res. 2002, 57, 103–128.
(2) Sha, J.; Zhou, Z.; Li, J.; Yin, L.; Yang, H.; Hu, G.; Luo, M.; Chan,
H. C.; Zhou, K. Identification of testis development and spermato-
genesis-related genes in human and mouse testes using cDNA
arrays. Mol. Hum. Reprod. 2002, 8, 511–517.
(3) Schultz, N.; Hamra, F. K.; Garbers, D. L. A multitude of genes
expressed solely in meiotic or postmeiotic spermatogenic cells
offers a myriad of contraceptive targets. Proc. Natl. Acad. Sci. U.S.A.
2003, 100, 12201–12206.
(4) Schlecht, U.; Demougin, P.; Koch, R.; Hermida, L.; Wiederkehr,
C.; Descombes, P.; Pineau, C.; Jegou, B.; Primig, M. Expression
profiling of mammalian male meiosis and gametogenesis identifies
novel candidate genes for roles in the regulation of fertility. Mol.
Biol. Cell 2004, 15, 1031–1043.
(5) Shima, J. E.; McLean, D. J.; McCarrey, J. R.; Griswold, M. D. The
murine testicular transcriptome: characterizing gene expression
in the testis during the progression of spermatogenesis. Biol.
Reprod. 2004, 71, 319–330.
(6) Gygi, S. P.; Rochon, Y.; Franza, B. R.; Aebersold, R. Correlation
between protein and mRNA abundance in yeast. Mol. Cell. Biol.
1999, 19, 1720–1730.
(7) Conrads, K. A.; Yi, M.; Simpson, K. A.; Lucas, D. A.; Camalier, C. E.;
Yu, L. R.; Veenstra, T. D.; Stephens, R. M.; Conrads, T. P.; Beck,
G. R. A combined proteome and microarray investigation of
inorganic phosphate-induced pre-osteoblast cells. Mol. Cell. Pro-
teomics 2005, 4, 1284–1296.
(8) Venables, J. P. Alternative splicing in the testes. Curr. Opin. Genet.
Dev. 2002, 12, 615–619.
(9) DeJong, J. Basic mechanisms for the control of germ cell gene
expression. Gene 2006, 366, 39–50.
(10) Dorus, S.; Busby, S. A.; Gerike, U.; Shabanowitz, J.; Hunt, D. F.;
Karr, T. L. Genomic and functional evolution of the Droso-
phila melanogaster sperm proteome. Nat. Genet. 2006, 38, 1440–
1445.
(11) Com, E.; Evrard, B.; Roepstorff, P.; Aubry, F.; Pineau, C. New
insights into the rat spermatogonial proteome: identification of
156 additional proteins. Mol. Cell. Proteomics 2003, 2, 248–261.
(12) Rolland, A. D.; Evrard, B.; Guitton, N.; Lavigne, R.; Calvel, P.;
Couvet, M.; Jegou, B.; Pineau, C. Two-dimensional fluorescence
difference gel electrophoresis analysis of spermatogenesis in the
rat. J. Proteome Res. 2007, 6, 683–697.
(13) Shetty, J.; Naaby-Hansen, S.; Shibahara, H.; Bronson, R.; Flickinger,
C. J.; Herr, J. C. Human sperm proteome: immunodominant sperm
surface antigens identified with sera from infertile men and
women. Biol. Reprod. 1999, 61, 61–69.
(14) Zhu, Y. F.; Cui, Y. G.; Guo, X. J.; Wang, L.; Bi, Y.; Hu, Y. Q.; Zhao,
X.; Liu, Q.; Huo, R.; Lin, M.; Zhou, Z. M.; Sha, J. H. Proteomic
analysis of effect of hyperthermia on spermatogenesis in adult
male mice. J. Proteome Res. 2006, 5, 2217–2225.
(15) Wang, L.; Zhu, Y. F.; Guo, X. J.; Huo, R.; Ma, X.; Lin, M.; Zhou,
Z. M.; Sha, J. H. A two-dimensional electrophoresis reference map
of human ovary. J. Mol. Med. 2005, 83, 812–821.
(16) De Hoon, M. J. L.; Imoto, S.; Nolan, J.; Miyano, S. Open source
clustering software. Bioinformatics 2004, 20, 1453–1454.
(17) Saldanha, A. J. Java Treeview-extensible visualization of microarray
data. Bioinformatics 2004, 20, 3246–8.
(18) Armstrong, D. J.; Hiscott, P.; Batterbury, M.; Kaye, S. Corneal
stromal cells (keratocytes) express thrombospondins 2 and 3 in
wound repair phenotype. Int. J. Biochem. Cell Biol. 2002, 34, 588–
593.
(19) Su, A. I.; Cooke, M. P.; Ching, K. A.; Hakak, Y.; Walker, J. R.;
Wiltshire, T.; Orth, A. P.; Vega, R. G.; Sapinoso, L. M.; Moqrich, A.;
Patapoutian, A.; Hampton, G. M.; Schultz, P. G.; Hogenesch, J. B.
Large-scale analysis of the human and mouse transcriptomes. Proc.
Natl. Acad. Sci. U.S.A. 2002, 99, 4465–4470.
(20) Clermont, Y.; Trott, M. Duration of the cycle of the seminiferous
epithelium in the mouse and hamster determined by means of
3H-thymidine and radioautography. Fertil. Steril. 1969, 20, 805–
817.
(21) Nebel, B. R.; Amarose, A. P.; Hacket, E. M. Calendar of gametogenic
development in the prepuberal male mouse. Science 1961, 134,
832–833.
(22) Monk, M.; McLaren, A. X-chromosome activity in foetal germ cells
of the mouse. J. Embryol. Exp. Morphol. 1981, 63, 75–84.
(23) de Rooij, D. G.; Grootegoed, J. A. Spermatogonial stem cells. Curr.
Opin. Cell Biol. 1998, 10, 694–701.
research articles
(24) Adly, M. A.; Assaf, H. A.; Hussein, M. R. Expression of the heat
shock protein-27 in the adult human scalp skin and hair follicle:
hair cycle-dependent changes. J. Am. Acad. Dermatol. 2006, 54,
811–817.
(25) Gernold, M.; Knauf, U.; Gaestel, M.; Stahl, J.; Kloetzel, P. M.
Development and tissue-specific distribution of mouse small heat
shock protein hsp25. Dev. Genet. 1993, 14, 103–111.
(26) de Kretser, D. M.; Loveland, K. L.; Meinhardt, A.; Simorangkir, D.;
Wreford, N. Spermatogenesis Hum Reprod. 1998, 13, 1–8.
(27) Minc, E.; Allory, Y.; Worman, H. J.; Courvalin, J. C.; Buendia,
B. Localization and phosphorylation of HP1 proteins during
the cell cycle in mammalian cells. Chromosoma 1999, 108, 220–
234.
(28) Tari, A. M.; Hung, M. C.; Li, K.; Lopez-Berestein, G. Growth
inhibition of breast cancer cells by Grb2 downregulation is
correlated with inactivation of mitogen-activated protein ki-
nase in EGFR, but not in ErbB2, cells. Oncogene 1999, 18, 1325–
1332.
(29) Schlecht, U.; Primig, M. Mining meiosis and gametogenesis with
DNA microarrays. Reproduction 2003, 125, 447–456.
(30) McCarrey, J. R.; Dilworth, D. D.; Sharp, R. M. Semiquantitative
analysis of X-linked gene expression during spermatogenesis in
the mouse: ethidium-bromide staining of RT-PCR products. Genet.
Anal. Tech. Appl. 1992, 9, 117–123.
(31) Colton, S. A.; Downs, S. M. Potential role for the sorbitol pathway
in the meiotic dysfunction exhibited by oocytes from diabetic mice.
J. Exp. Zool., Part A 2004, 301, 439–448.
(32) Faerge, I.; Grondahl, C.; Ottesen, J. L.; Hyttel, P. Autoradiographic
localization of specific binding of meiosis-activating sterol to
cumulus-oocyte complexes from marmoset, cow, and mouse. Biol.
Reprod. 2001, 64, 527–536.
(33) Haas, D.; White, S. N.; Lutz, L. B.; Rasar, M.; Hammes, S. R. The
modulator of nongenomic actions of the estrogen receptor (MNAR)
regulates transcription-independent androgen receptor-mediated
signaling: evidence that MNAR participates in G protein-regulated
meiosis in Xenopus laevis oocytes. Mol. Endocrinol. 2005, 19, 2035–
2046.
(34) Kamma, H.; Horiguchi, H.; Wan, L.; Matsui, M.; Fujiwara, M.;
Fujimoto, M.; Yazawa, T.; Dreyfuss, G. Molecular characterization
of the hnRNP A2/B1 proteins: tissue-specific expression and novel
isoforms. Exp. Cell Res. 1999, 246, 399–411.
(35) Grimes, S. R. Testis-specific transcriptional control. Gene 2004, 343,
11–22.
(36) Rousseaux, S.; Caron, C.; Govin, J.; Lestrat, C.; Faure, A. K.;
Khochbin, S. Establishment of male-specific epigenetic informa-
tion. Gene 2005, 345, 139–153.
(37) Ramalho-Santos, J.; Schatten, G.; Moreno, R. D. Control of
membrane fusion during spermiogenesis and the acrosome reac-
tion. Biol. Reprod. 2002, 67, 1043–1051.
(38) Kierszenbaum, A. L. Sperm axoneme: a tale of tubulin posttrans-
lation diversity. Mol. Reprod. Dev. 2002, 62, 1–3.
(39) Tanaka, H.; Baba, T. Gene expression in spermiogenesis. Cell. Mol.
Life Sci. 2005, 62, 344–354.
(40) Ergur, A. R.; Dokras, A.; Giraldo, J. L.; Habana, A.; Kovanci, E.;
Huszar, G. Sperm maturity and treatment choice of in vitro
fertilization (IVF) or intracytoplasmic sperm injection: diminished
sperm HspA2 chaperone levels predict IVF failure. Fertil. Steril.
2002, 77, 910–918.
(41) Zhang, J.; Wu, J.; Huo, R.; Mao, Y.; Lu, Y.; Guo, X.; Liu, J.; Zhou, Z.;
Huang, X.; Sha, J. ERp57 is a potential biomarker for human
fertilization capability. Mol. Hum. Reprod. 2007, 13, 633–639.
(42) Sharpe, R. M. Testosterone and spermatogenesis. J. Endocrinol.
1987, 113, 1–2.
(43) Sasaki, T.; Takai, Y. The Rho small G protein family-Rho GDI
system as a temporal and spatial determinant for cytoskeletal
control. Biochem. Biophys. Res. Commun. 1998, 245, 641–645.
(44) Togawa, A.; Miyoshi, J.; Ishizaki, H.; Tanaka, M.; Takakura, A.;
Nishioka, H.; Yoshida, H.; Doi, T.; Mizoguchi, A.; Matsuura, N.;
Niho, Y.; Nishimune, Y.; Nishikawa, S.; Takai, Y. Progressive
impairment of kidneys and reproductive organs in mice lacking
Rho GDIalpha. Oncogene 1999, 18, 5373–5380.
(45) MacAllister, R. J.; Parry, H.; Kimoto, M.; Ogawa, T.; Russell, R. J.;
Hodson, H.; Whitley, G. S.; Vallance, P. Regulation of nitric oxide
synthesis by dimethylarginine dimethylaminohydrolase. Br. J.
Pharmacol. 1996, 119, 1533–1540.
(46) Kostic, T. S.; Andric, S. A.; Maric, D.; Stojilkovic, S. S.; Kovacevic,
R. Involvement of inducible nitric oxide synthase in stress-
impaired testicular steroidogenesis. J. Endocrinol. 1999, 163, 409–
416.
(47) Okado-Matsumoto, A.; Matsumoto, A.; Fujii, J.; Taniguchi, N.
Peroxiredoxin IV is a secretable protein with heparin-binding
Journal of Proteome Research • Vol. 7, No. 8, 2008 3445
research articles
properties under reduced conditions. J. Biochem. (Tokyo) 2000,
127, 493–501.
(48) Sasagawa, I.; Matsuki, S.; Suzuki, Y.; Iuchi, Y.; Tohya, K.; Kimura,
M.; Nakada, T.; Fujii, J. Possible involvement of the membrane-
bound form of peroxiredoxin 4 in acrosome formation during
spermiogenesis of rats. Eur. J. Biochem. 2001, 268, 3053–3061.
(49) Diemer, T.; Allen, J. A.; Hales, K. H.; Hales, D. B. Reactive oxygen
disrupts mitochondria in MA-10 tumor Leydig cells and inhibits
3446 Journal of Proteome Research • Vol. 7, No. 8, 2008
Huang et al.
steroidogenic acute regulatory (StAR) protein and steroidogenesis.
Endocrinology 2003, 144, 2882–2891.
(50) Luo, L.; Chen, H.; Trush, M. A.; Show, M. D.; Anway, M. D.; Zirkin,
B. R. Aging and the brown Norway rat leydig cell antioxidant
defense system. J. Androl. 2006, 27, 240–247.
PR800179H