Sie sind auf Seite 1von 515

Amtliche Methodensammlung Stand: Mai 2013

FLI 1
Amtliche Methodensammlung Stand: Mai 2013

Inhaltsverzeichnis

Einleitung ................................................................................................................................................. 4
Nationale Referenzlaboratorien ............................................................................................................... 5
1. Affenpocken .............................................................................................................................. 17
2. Afrikanische Pferdepest ............................................................................................................ 19
3. Afrikanische Schweinepest (ASP) ............................................................................................ 21
4. Amerikanische Faulbrut ............................................................................................................ 27
5. Ansteckende Blutarmut der Einhufer ........................................................................................ 33
6. Ansteckende Blutarmut der Lachse (ISA) ................................................................................ 40
7. Ansteckende Metritis des Pferdes ............................................................................................ 50
8. Aujeszkysche Krankheit (AK) ................................................................................................... 56
9. Aviäre Influenza ........................................................................................................................ 62
10. Befall mit dem Kleinen Beutenkäfer (Aethina tumida) .............................................................. 70
11. Befall mit der Tropilaelaps-Milbe .............................................................................................. 73
12. Beschälseuche der Pferde........................................................................................................ 77
13. Blauzungenkrankheit ................................................................................................................ 96
14. Bovine Herpesvirus Typ 1-Infektion (alle Formen) ................................................................... 99
15. Bovine Spongiforme Enzephalopathie (BSE) ......................................................................... 113
16. Bovine Virus Diarrhoe (BVD) .................................................................................................. 125
17. Brucellose der Rinder, Schweine, Schafe und Ziegen ........................................................... 141
18. Campylobacteriose (thermophile Campylobacter) ................................................................. 165
19. Chlamydiose ........................................................................................................................... 174
20. Echinokokkose ........................................................................................................................ 194
21. Enzootische Leukose der Rinder ............................................................................................ 200
22. Epizootische Hämatopoetische Nekrose (EHN) ..................................................................... 205
23. Epizootische Hämorrhagie der Hirsche .................................................................................. 217
24. Equine Virus Arteritis .............................................................................................................. 219
25. Infektion mit Bonamia exitiosa ................................................................................................ 230
26. Infektion mit Bonamia ostrea .................................................................................................. 231
27. Infektion mit Marteilia refringens ............................................................................................. 232
28. Infektion mit Microcytos mackini ............................................................................................. 234
29. Infektion mit Perkinsus marinus .............................................................................................. 235
30. Infektiöse Hämatopoetische Nekrose der Salmoniden (IHN), Virale Hämorrhagische
Septikämie der Salmoniden (VHS) ......................................................................................... 236
31. Koi-Herpesvirus-Infektion (KHV-I) .......................................................................................... 250
32. Lumpy-skin-Krankheit (Dermatitis nodularis) .......................................................................... 263
33. Lungenseuche der Rinder ...................................................................................................... 264
34. Maul- und Klauenseuche ........................................................................................................ 287
35. Milzbrand ................................................................................................................................ 296
36. Newcastle-Krankheit (ND) ...................................................................................................... 311
37. Nipah/Hendra Virus Infektion .................................................................................................. 319
38. Paratuberkulose ...................................................................................................................... 320
39. Pest der kleinen Wiederkäuer / Rinderpest ............................................................................ 335
40. Pferdeenzephalomyelitis (alle Formen) .................................................................................. 337
41. Pockenseuche der Schafe und Ziegen ................................................................................... 340
42. Q-Fieber .................................................................................................................................. 344
43. Rauschbrand .......................................................................................................................... 347
44. Rifttal-Fieber (RVF) ................................................................................................................. 355
45. Rotz......................................................................................................................................... 358
46. Säugerpocken (Orthopoxinfektion) ......................................................................................... 367

FLI 2
Amtliche Methodensammlung Stand: Mai 2013

47. Salmonellose der Rinder ........................................................................................................ 371


48. Schweinepest (KSP) ............................................................................................................... 375
49. Stomatitis vesicularis .............................................................................................................. 396
50. Taura-Syndrom ....................................................................................................................... 398
51. Tollwut..................................................................................................................................... 400
52. Toxoplasma gondii .................................................................................................................. 411
53. Transmissible Spongiforme Enzephalopathie (Scrapie) ........................................................ 422
54. Trichomonadenseuche des Rindes ........................................................................................ 435
55. Tuberkulose der Rinder .......................................................................................................... 438
56. Tularämie ................................................................................................................................ 458
57. Verotoxin-produzierende Escherichia coli (VTEC)/
Shiga-Toxin-produzierende Escherichia coli (STEC) ............................................................. 469
58. Vesikuläre Schweinekrankheit (SVD) ..................................................................................... 477
59. Vibrionenseuche der Rinder ................................................................................................... 481
60. Weißpünktchenkrankheit der Krebstiere ................................................................................ 492
61. West-Nil-Virus-Infektion (WNV) .............................................................................................. 493
62. Yellowhead Disease (YHD) .................................................................................................... 496
63. Durch Zecken übertragene Krankheiten – Frühsommer-Meningoenzephalitis ...................... 497
Probenversand – Diagnostische Proben ................................................................................ 501

FLI 3
Amtliche Methodensammlung Stand: Mai 2013

Einleitung
Nach § 4 Absatz 3 Tierseuchengesetz (TierSG) veröffentlicht und aktualisiert das
Friedrich-Loeffler-Institut (FLI) unter Mitwirkung wissenschaftlicher Sachverständiger
die „Amtliche Sammlung von Verfahren zur Probenahme und Untersuchung von
Untersuchungsmaterial tierischen Ursprungs für anzeigepflichtige Tierseuchen“
(Methodensammlung). Diese stellt eine Auflistung der Testprinzipien dar, die in
Deutschland zur Labordiagnose von anzeigepflichtigen Tierseuchen und
(ausgewählten) meldepflichtigen Tierkrankheiten angewendet werden können.

Dabei gilt stets der Grundsatz, dass die nach § 17 c Absatz 1 des TierSG vom FLI
zugelassenen und unter
http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf
abrufbaren Diagnostika anzuwenden sind. Diese Liste wird regelmäßig aktualisiert.

Im Fall, dass für bestimmte Anwendungen keine zugelassenen Diagnostika zur


Verfügung stehen, sind die von den entsprechenden Nationalen
Referenzlaboratorien festgelegten Methoden zu verwenden. Der Einsatz neuer
Methoden und Protokolle ist mit dem zuständigen Nationalen Referenzlabor
abzustimmen.

Die Methodensammlung mit Stand vom 31. Mai 2013 berücksichtigt die Verordnung
über anzeigepflichtige Tierseuchen (TierSeuchAnzV) in der Fassung der
Bekanntmachung vom 19. Juli 2011 (BGBl. I S. 1404) sowie die Verordnung über
meldepflichtige Tierkrankheiten in der Fassung der Bekanntmachung vom 11.
Februar 2011 (BGBl. I S. 252), die durch Artikel 1 der Verordnung vom 30. März
2012 (BGBl. I S. 503) geändert worden ist.

Die Falldefinitionen (Voraussetzungen für die Feststellung eines Falles und dessen
Meldung im Tierseuchennachrichtensystem TSN) können unter
https://tsn.fli.bund.de/Krankheiten/Methoden/Falldefinitionen.pdf abgerufen werden.

Bezüglich des Probenversandes wurde am Ende der Methodensammlung ein


entsprechendes Kapitel angefügt.

FLI 4
Amtliche Methodensammlung Stand: Mai 2013

Nationale Referenzlaboratorien
(Stand: März 2013)

Nationale Referenzlabore für anzeigepflichtige Tierseuchen:

Tierseuche Nationales Referenzlabor


Affenpocken Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Frau Dr. D. Kalthoff
Email: donata.kalthoff@fli.bund.de
Telefon: 03 83 51 - 7 16 27
Telefax. 03 83 51 - 7 12 26
Afrikanische Pferdepest Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Hoffmann
Email: bernd.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 12 01
Telefax: 03 83 51 – 7 12 19
Afrikanische Schweinepest Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Frau Dr. S. Blome
Email: sandra.blome@fli.bund.de
Telefon: 03 83 51 – 7 11 44
Telefax: 03 83 51 – 7 12 19
Amerikanische Faulbrut Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. Marc O. Schäfer
Email: marc.schaefer@fli.bund.de
Telefon: 03 83 51 – 7 12 46
Telefax: 03 83 51 – 7 12 26
Ansteckende Blutarmut der Einhufer Friedrich-Loeffler-Institut
(Infektiöse Anämie der Einhufer) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald -Insel Riems
Leiter: Frau Dr. P. König
Email: patricia.koenig@fli.bund.de
Telefon: 03 83 51 – 7 11 41
Telefax: 03 83 51 - 7 12 19
Ansteckende Blutarmut der Lachse Friedrich-Loeffler-Institut
(Infektiöse Anämie der Lachse) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Frau Dr. H. Schütze
Email: heike.schuetze@fli.bund.de
Telefon: 03 83 51 – 7 12 54
Telefax: 03 83 51 – 7 12 26

FLI 5
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Aujeszkysche Krankheit Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. T. Müller
Email: thomas.mueller@fli.bund.de
Telefon: 03 83 51 – 7 16 59
Telefax: 03 83 51 - 7 11 51
Befall mit Kleinem Beutenkäfer Friedrich-Loeffler-Institut
(Aethina tumida) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. Marc O. Schäfer
Email: marc.schaefer@fli.bund.de
Telefon: 03 83 51 – 7 12 46
Telefax: 03 83 51 – 7 12 26
Befall mit Tropilaelaps-Milbe Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. Marc O. Schäfer
Email: marc.schaefer@fli.bund.de
Telefon: 03 83 51 – 7 12 46
Telefax: 03 83 51 – 7 12 26
Beschälseuche der Pferde Friedrich-Loeffler-Institut,
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Frau Dr. I. Moser
Email: irmgard.moser@fli.bund.de
Telefon: 0 36 41 – 8 04 23 28
Telefax: 0 36 41 – 8 04 22 28
Blauzungenkrankheit Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Hoffmann
Email: bernd.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 12 01
Telefax: 03 83 51 – 7 12 19
Bovine Herpesvirus Typ 1-Infektion Friedrich-Loeffler-Institut
(alle Formen) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: PD Dr. M. Beer
Email: martin.beer@fli.bund.de
Telefon: 03 83 51 – 7 12 23
Telefax: 03 83 51 - 7 12 19
Bovine Virus Diarrhoe Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. H. Schirrmeier
Email: horst.schirrmeier@fli.bund.de
Telefon: 03 83 51 – 7 12 12
Telefax: 03 83 51 – 7 12 19

FLI 6
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Brucellose der Rinder, Schweine, Schafe Friedrich-Loeffler-Institut
und Ziegen Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. F. Melzer
Email: falk.melzer@fli.bund.de
Telefon: 0 36 41 – 8 04 24 66
Telefax: 0 36 41 – 8 04 22 28
Enzootische Leukose der Rinder Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiterin: Frau Dr. R. Hoffmann
Email: rebecca.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 16 45
Telefax: 03 83 51 – 7 12 26
Epizootische Hämatopoetische Nekrose Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Frau Dr. H. Schütze
Email: heike.schuetze@fli.bund.de
Telefon: 03 83 51 – 7 12 54
Telefax: 03 83 51 – 7 11 51
Epizootische Haemorrhagie Friedrich-Loeffler-Institut
der Hirsche Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Hoffmann
Email: bernd.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 12 01
Telefax: 03 83 51 – 7 12 19
Geflügelpest Friedrich-Loeffler-Institut
(aviäre Influenza) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald-Insel Riems
Leiter: PD Dr. T. Harder
Email: timm.harder@fli.bund.de
Telefon: 03 83 51 – 7 11 52
Telefax: 03 83 51 – 7 12 26
Infektiöse Epididymitis Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. F. Melzer.
Email: falk.melzer@fli.bund.de
Telefon: 0 36 41 – 8 04 24 66
Telefax: 0 36 41 – 8 04 22 28
Infektiöse Hämatopoetische Nekrose der Friedrich-Loeffler-Institut
Salmoniden Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Dr. D. Fichtner
Email: dieter.fichtner@fli.bund.de
Telefon: 03 83 51 – 7 11 04
Telefax: 03 83 51 – 7 12 26

FLI 7
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Infektion mit West-Nil-Virus Friedrich-Loeffler-Institut
bei einem Vogel oder Pferd Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Prof. Dr. M. Groschup
Email: martin.groschup@fli.bund.de
Telefon: 03 83 51 – 7 11 63
Telefax. 03 83 51 – 7 12 19
Koi-Herpesvirus-Infektion der Karpfen Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. S. Bergmann
Email: sven.bergmann@fli.bund.de
Telefon: 03 83 51 – 7 11 03
Telefax. 03 83 51 – 7 12 26
Lumpy-skin-Krankheit Friedrich-Loeffler-Institut
(Dermatitis nodularis) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Frau Dr. D. Kalthoff
Email: donata.kalthoff@fli.bund.de
Telefon: 03 83 51 - 7 16 27
Telefax. 03 83 51 - 7 12 26
Lungenseuche der Rinder Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. M. Heller
Email: martin.heller@fli.bund.de
Telefon: 0 36 41 – 8 04 24 25
Telefax. 0 36 41 – 8 04 22 28
Maul- und Klauenseuche Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Haas
Email: bernd.haas@fli.bund.de
Telefon: 03 83 51 – 7 12 11
Telefax. 03 83 51 – 7 12 19
Milzbrand Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Frau Dr. M. Elschner
Email: mandy.elschner@fli.bund.de
Telefon: 0 36 41 – 8 04 24 28
Telefax: 0 36 41 – 8 04 22 28
Muschelkrankheiten Friedrich-Loeffler-Institut
- Infektion mit Bonamia exitosa Bundesforschungsinstitut für Tiergesundheit
- Infektion mit Bonamia ostreae Südufer 10
- Infektion mit Marteilia refringens 17493 Greifswald - Insel Riems
Leiter: Dr. S. Bergmann
- Infektion mit Microcytos mackini
Email: sven.bergmann@fli.bund.de
- Infektion mit Perkinsus marinus Telefon: 03 83 51 – 7 11 03
Telefax: 03 83 51 – 7 12 26

FLI 8
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Newcastle-Krankheit Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: PD Dr. C. Grund
Email: christian.grund@fli.bund.de
Telefon: 03 83 51 – 7 11 52
Telefax. 03 83 51 – 7 12 75
Niedrigpathogene aviäre Influenza bei einem Friedrich-Loeffler-Institut
gehaltenen Vogel Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald-Insel Riems
Leiter: PD Dr. T. Harder
Email: timm.harder@fli.bund.de
Telefon: 03 83 51 – 7 11 52
Telefax. 03 83 51 – 7 12 26
Pest der kleinen Wiederkäuer Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Hoffmann
Email: bernd.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 12 01
Telefax. 03 83 51 – 7 12 19
Pferdeenzephalomyelitis (alle Formen) Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Prof. Dr. M. Groschup
Email: martin.groschup@fli.bund.de
Telefon: 03 83 51 – 7 11 63
Telefax. 03 83 51 – 7 11 93
Pockenseuche der Schafe und Ziegen Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Frau Dr. D. Kalthoff
Email: donata.kalthoff@fli.bund.de
Telefon: 03 83 51 - 7 16 27
Telefax. 03 83 51 - 7 12 26
Rauschbrand Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. C. Seyboldt
Email: christian.seyboldt@fli.bund.de
Telefon: 0 36 41 – 8 04 22 95
Telefax: 0 36 41 – 8 04 22 28
Rifttal-Fieber Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Prof. Dr. M. Groschup
Email: martin.groschup@fli.bund.de
Telefon: 03 83 51 – 7 11 63
Telefax: 03 83 51 – 7 11 93

FLI 9
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Rinderpest Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Hoffmann
Email: bernd.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 12 01
Telefax: 03 83 51 – 7 12 19
Rotz Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Frau Dr. M. Elschner
Email: mandy.elschner@fli.bund.de
Telefon: 0 36 41 – 8 04 24 28
Telefax: 0 36 41 – 8 04 22 28
Salmonellose der Rinder Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. U. Methner
Email: ulrich.methner@fli.bund.de
Telefon: 0 36 41 – 8 04 22 67
Telefax: 0 36 41 – 8 04 22 28
Schweinepest (klassische Schweinepest) Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Frau Dr. S. Blome
Email: sandra.blome@fli.bund.de
Telefon: 03 83 51 – 7 11 44
Telefax: 03 83 51 – 7 12 19
Stomatitis vesicularis Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Haas
Email: bernd.haas@fli.bund.de
Telefon: 03 83 51 – 7 12 11
Telefax: 03 83 51 – 7 12 19
Taura-Syndrom (exotisch) Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. Uwe Fischer
Email: uwe.fischer@fli.bund.de
Telefon: 03 83 51 – 7 11 05
Telefax: 03 83 51 – 7 12 26
Tollwut Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Dr. T. Müller
Email: thomas.mueller@fli.bund.de
Telefon: 03 83 51 – 7 16 59
Telefax: 03 83 51 – 7 11 51

FLI 10
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Transmissible Spongiforme Friedrich-Loeffler-Institut
Enzephalopathien (alle Formen) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Prof. Dr. M. Groschup
Email: martin.groschup@fli.bund.de
Telefon: 03 83 51 – 7 11 63
Telefax: 03 83 51 – 7 12 19
Trichomonadenseuche der Rinder Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Seestraße 55
16868 Wusterhausen
Leiter: Dr. K. Henning
Email: klaus.henning@fli.bund.de
Telefon:: 03 39 79 – 8 01 56
Telefax: 03 39 79 – 8 02 22
Tuberkulose der Rinder Friedrich-Loeffler-Institut
(Mycobacterium bovis und M. caprae) Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Frau Dr. I. Moser
Email: irmgard.moser@fli.bund.de
Telefon: 0 36 41 – 8 04 23 28
Telefax: 0 36 41 – 8 04 22 28
Vesikuläre Schweinekrankheit Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. B. Haas
Email: bernd.haas@fli.bund.de
Telefon: 03 83 51 – 7 12 11
Telefax: 03 83 51 – 7 12 19
Vibrionenseuche der Rinder Friedrich-Loeffler-Institut
(bovine genitale Campylobacteriose) Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. W. Müller
Email: wolfgang.mueller@fli.bund.de
Telefon: 0 36 41 – 8 04 23 56
Telefax: 0 36 41 – 8 04 22 28
Virale Hämorrhagische Septikämie Friedrich-Loeffler-Institut
der Salmoniden Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Dr. D. Fichtner
Email: dieter.fichtner@fli.bund.de
Telefon: 03 83 51 – 7 11 04
Telefax: 03 83 51 – 7 12 26
Weißpünktchenkrankheit der Krebstiere Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. Uwe Fischer
Email: uwe.fischer@fli.bund.de
Telefon: 03 83 51 – 7 11 05
Telefax: 03 83 51 – 7 12 26

FLI 11
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Yellowhead Disease (exotisch) Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. Uwe Fischer
Email: uwe.fischer@fli.bund.de
Telefon: 03 83 51 – 7 11 05
Telefax: 03 83 51 – 7 12 26

FLI 12
Amtliche Methodensammlung Stand: Mai 2013

Nationale Referenzlabore für meldepflichtige Tierkrankheiten:

Tierseuche Nationales Referenzlabor


Ansteckende Metritis des Pferdes Friedrich-Loeffler-Institut
(Contagiöse Equine Metritis - CEM) Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. F. Melzer
Email: falk.melzer@fli.bund.de
Telefon: 0 36 41 – 8 04 24 66
Telefax: 0 36 41 – 8 04 22 28
Campylobacteriose Friedrich-Loeffler-Institut
(thermophile Campylobacter) Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. H. Hotzel
Email: helmut.hotzel@fli.bund.de
Telefon: 0 36 41 – 8 04 22 62
Telefax: 0 36 41 – 8 04 22 28
Chlamydiose Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Dr. K. Sachse
Email: konrad.sachse@fli.bund.de
Telefon: 0 36 41 – 8 04 23 34
Telefax: 0 36 41 - 8 04 22 28
Echinokokkose Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Seestraße 55
16868 Wusterhausen
Leiter: Prof. Dr. F. J. Conraths
Email: franz.conraths@fli.bund.de
Telefon: 03 39 79 – 8 01 76
Telefax: 03 39 79 – 8 02 00
Equine Virus-Arteritis-Infektion Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald -Insel Riems
Leiter: Frau Dr. P. König
Email: patricia.koenig@fli.bund.de
Telefon: 03 83 51 – 7 11 41
Telefax: 03 83 51 – 7 12 19
Infektiöse Laryngotracheitis des Geflügels Friedrich-Loeffler-Institut
(ILT) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald -Insel Riems
Leiter: Dr. W. Fuchs
Email: walter.fuchs@fli.bund.de
Telefon: 03 83 51 – 7 12 58
Telefax: 03 83 51 – 7 12 19

FLI 13
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


Maedi/Visna Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Frau Dr. R. Hoffmann
Email: Rebecca.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 16 45
Telefax: 03 83 51 – 7 12 26
Niedrigpathogene aviäre Influenza der Friedrich-Loeffler-Institut
Wildvögel Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald-Insel Riems
Leiter: PD Dr. T. Harder
Email: timm.harder@fli.bund.de
Telefon: 03 83 51 – 7 11 52
Telefax. 03 83 51 – 7 12 26
Paratuberkulose Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Frau Dr. H. Köhler
Email: heike.koehler@fli.bund.de
Telefon: 0 36 41 – 8 04 22 40
Telefax: 0 36 41 - 8 04 22 28
Q-Fieber Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Seestraße 55
16868 Wusterhausen
Leiter: Dr. K. Henning
Email: klaus.henning@fli.bund.de
Telefon:: 03 39 79 – 8 01 56
Telefax: 03 39 79 – 8 02 22
Toxoplasmose Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Dr. Gereon Schares
Email: gereon.schares@fli.bund.de
Telefon: 03 83 51 – 7 16 58
Telefax: 03 83 51
Tularämie Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: PD Dr. H. Tomaso
Email: herbert.tomaso@fli.bund.de
Telefon: 0 36 41 – 8 04 22 43
Telefax: 0 36 41 – 8 04 22 28
Verotoxin bildende Escherichia coli Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Seestraße 55
16868 Wusterhausen
Leiter: Dr. Lutz Geue
Email: lutz.geue@fli.bund.de
Telefon: 03 39 79 – 8 01 89
Telefax: 03 39 79 – 8 02 00

FLI 14
Amtliche Methodensammlung Stand: Mai 2013

Weitere Nationale Referenzlabore am Friedrich-Loeffler-Institut:

Tierseuche Nationales Referenzlabor


Bunyavirale Erkrankungen Friedrich-Loeffler-Institut
(inklusive Hanta-Virus-Infektion) Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: PD Dr. Rainer Ulrich
Email: rainer.ulrich@fli.bund.de
Telefon: 03 83 51 – 7 11 59
Telefax: 03 83 51 – 7 11 51
Caprine Arthritis und Enzephalitis Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Frau Dr. R. Hoffmann
Email: Rebecca.hoffmann@fli.bund.de
Telefon: 03 83 51 – 7 16 45
Telefax: 03 83 51 – 7 12 26
Japanische Enzephalitis Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Prof. Dr. M. Groschup
Email: martin.groschup@fli.bund.de
Telefon: 03 83 51 – 7 11 63
Telefax: 03 83 51 – 7 12 19
Krebstierkrankheiten (Crustaceen): Friedrich-Loeffler-Institut
Baculovirose, Infektiöse hypodermale und Bundesforschungsinstitut für Tiergesundheit
hämatopoetische Nekrose, Krebspest, Südufer 10
Spawner-isolated mortality virus disease, 17493 Greifswald – Insel Riems
Leiter: Dr. U.. Fischer
Infektion mit Ranavirus
Email: uwe.fischer@fli.bund.de
Telefon: 03 83 51 – 7 11 05
Telefax: 03 83 51 – 7 12 26
Krim-Kongo-Fieber Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald – Insel Riems
Leiter: Prof. Dr. M. Groschup
Email: martin.groschup@fli.bund.de
Telefon: 03 83 51 – 7 11 63
Telefax: 03 83 51 – 7 12 19
Muschelkrankheiten (Bilvalvia): Friedrich-Loeffler-Institut
Perkinsus olseni, Xenohalitiosis Bundesforschungsinstitut für Tiergesundheit
californiensis, Abalone Virussterblichkeit Südufer 10
17493 Greifswald - Insel Riems
Leiter: Dr. S. Bergmann
Email: sven.bergmann@fli.bund.de
Telefon: 03 83 51 – 7 11 03
Telefax: 03 83 51 – 7 12 26
Nipah / Hendra Virus Infektion Friedrich-Loeffler-Institut
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
17493 Greifswald - Insel Riems
Leiter: Frau Dr. A. Balkema-Buschmann
Email: anne.buschmann@fli.bund.de
Telefon: 03 83 51 – 7 11 61
Telefax: 03 83 51 – 7 12 26

FLI 15
Amtliche Methodensammlung Stand: Mai 2013

Tierseuche Nationales Referenzlabor


durch Zecken-übertragene Krankheiten Friedrich-Loeffler-Institut
(ZÜK) Bundesforschungsinstitut für Tiergesundheit
Naumburger Str. 96 a
07743 Jena
Leiter: Frau Dr. C. Klaus
Email: Christine.klaus@fli.bund.de
Telefon: 0 36 41 – 8 04 22 31
Telefax: 0 36 41 – 8 04 22 28

FLI 16
Amtliche Methodensammlung Stand: Mai 2013

1. Affenpocken

1.1. Charakterisierung der Infektion


1.1.1. Erreger
Das Affenpockenvirus (Monkeypox Virus, MPXV) wird in das Genus Orthopoxvirus
klassifiziert Es unterscheidet sich genetisch von den ebenfalls humanpathogenen
Kuhpockenviren (Cowpox Virus, CPXV).

Vorkommen
MPXV kommt endemisch vor in den Regenwaldregionen von West- und Zentral-
Afrika. Die Reservoirspezies des Virus ist unbekannt. Humane Infektionen werden in
der Regel mit dem Verzehr von infizierten Wildtieren (Bushmeat), Kontakt mit
infizierten Tieren, Biss und Kontakt mit tierischem Blut und Sekreten in Verbindung
gebracht.

1.1.2. Klinische Symptomatik


Alt- und Neuweltaffen sind empfänglich für MPXV, daneben wurden Infektionen bei
verschiedenen Nagern, Präriehunden und anderen Kleinsäugern beschrieben.
Bei nicht-menschlichen Primaten treten die Affenpocken normalerweise als
selbstlimitierender Hautausschlag auf. Initial sind die Tiere fiebrig und es bilden sich
Papeln mit einer Größe von 1-4 mm, die sich im weiteren Krankheitsverlauf zu
Pusteln entwickeln und schließlich verkrusten. Eine typische Affenpocken-Läsion
besitzt ein rotes, nekrotisches, eingesunkenes Zentrum und wird von epidermaler
Hyperplasie umgeben. Diese “Pocken” findet man am ganzen Körper, aber
besonders betroffen sind das Gesicht, die Extremitäten, die Hand- und Fußflächen
und der Schwanz. Die Anzahl der Läsionen variiert von wenigen individuellen Pocken
bis zu ausgedehnten, verschmelzenden Läsionsbereichen. Die Krusten der Pusteln
können abfallen und kleine Narben hinterlassen. Bei schweren Verläufen werden
ebenfalls Husten, Nasenausfluss, Dyspnoe, Anorexie, Fazial-Ödem, orale
Ulzerationen oder Lymphadenopathie festgestellt. Die meisten natürlich infizierten
Tiere gesunden wieder, aber letale Verläufe können besonders bei Jungtieren
auftreten. Auch subklinische Erkrankungen sind möglich.
Die klinischen Symptome bei infizierten Präriehunden können Fieber, Depression,
Anorexie, Nasenausfluss, Niesen und/oder Husten, Dyspnoe, ein nodulärer
Hautausschlag und orale Ulzerationen beinhalten. Während eines Ausbruchs bei
Präriehunden in den USA wurde oft eine Konjunktivitis als erstes Symptom
festgestellt. Bei experimentell infizierten Präriehunden traten Hautläsionen ähnlich
wie beim Menschen erst am Kopf und den Extremitäten, gefolgt vom Körperstamm
(zentrifugale Ausbreitung), auf. Die charakteristischen Affenpocken-Läsionen
entwickeln sich von Makeln über Vesikeln hin zu Pusteln, welche schließlich
verkrusten. Bei natürlicherweise infizierten Präriehunden kann eine
Lymphadenopathie auftreten. Einige experimentell infizierte Tiere verstarben nach 1-
2 Wochen ohne Haut- oder Schleimhautläsionen entwickelt zu haben. Natürlich -wie
auch experimentell infizierte Tiere- können wieder gesunden.

FLI 17
Amtliche Methodensammlung Stand: Mai 2013

1.1.3. Differentialdiagnostik
Klinisch lassen sich Läsionen einer Affenpockeninfektion nicht von Kuhpocken-
bedingten Läsionen unterscheiden.

1.1.4. Diagnostische Indikation

1.1.5. Zuständige Untersuchungseinrichtung


• Veterinär- und Lebensmitteluntersuchungsämter der Länder
• Virustypisierung durch das Friedrich-Loeffler-Institut (Nationales Referenzlabor
für Affenpocken), Südufer 10, D-17493 Greifswald-Insel Riems

FLI 18
Amtliche Methodensammlung Stand: Mai 2013

2. Afrikanische Pferdepest

2.1. Charakterisierung der Infektion


2.1.1. Erreger
Der Erreger ist ein dsRNA Orbivirus der Familie Reoviridae. Neun verschiedene Se-
rotypen des Afrikanischen Pferdepest Virus (African Horse Sickness Virus, AHSV)
sind bekannt.

2.1.2. Klinische Symptomatik


Die Afrikanische Pferdepest ist eine meist tödlich verlaufende Erkrankung der
Equiden. Das Virus wird durch Arthropoden der verschiedenen Culicoides-Spezies
übertragen und das Auftreten der Krankheit ist saisonal bedingt. Die klinischen
Erscheinungen sind durch Kreislaufstörungen und respiratorische Symptome
gekennzeichnet. Die Krankheit kommt endemisch in Afrika südlich der Sahara vor,
einzelne Ausbrüche treten auch in Nordafrika, im Mittleren Osten und in Europa
(Spanien u. Portugal) auf.
Es gibt vier klassische klinische Verlaufsformen:
1. die pulmonale Form
2. die Herzform
3. die gemischte Verlaufsform (Herz- und Lungenaffektion)
4. das Pferdepest-Fieber

2.1.3. Differentialdiagnostik
Obwohl die klinischen Zeichen meist charakteristisch sind, ist die Labordiagnose
wegen der leichten Verwechslungsmöglichkeit mit anderen Pferdekrankheiten
essentiell.
Als Virus-Differentialdiagnostik kommen in Frage:
Arthropoden-übertragene Pferdeezephalitiden (VEE, WEE, EEE) sowie Pferde-
Arteriitis.

2.1.4. Diagnostische Indikation


siehe Richtlinie 92/35/EWG

2.1.5. Zuständige Untersuchungseinrichtung


FLI, Institut für Virusdiagnostik, Südufer 10, 17493 Insel Riems

2.1.6. Rechtsgrundlagen
• Richtlinie 92/35/EWG, Richtlinie 90/426/EWG, Entsch. 2002/160/EC
• Amtliche Methodensammlung für anzeigepflichtige Tierseuchen

FLI 19
Amtliche Methodensammlung Stand: Mai 2013

2.2. Untersuchungsmaterial
• Gerinnungsgehemmtes Blut (EDTA-Blut)
• Gewebestücke von Milz, Lunge oder Lymphknoten (post mortem)
• Versand bei +4 °C oder auf Trockeneis, wenn das Material bereits gefroren
gelagert ist

2.3. Untersuchungsgang

Erregernachweis
(NUR DURCH DAS FLI DURCHZUFÜHREN)

Virusisolierung
In BHK- oder Vero-Zellen: cpE zwischen 2. bis 8. Tag p.i.

Polymerase-Kettenreaktion (PCR)
Basierend auf Empfehlungen des spanischen EU-Referenzlabors wurden
verschiedene real-time RT-PCR-Systeme etabliert, die eine schnelle, sensitive und
spezifische Detektion der AHSV-RNA aller 9 Serotypen erlauben (Fernández-Pinero
et al., 2009 und Agüero et al., 2008).
Darüber hinaus stehen konventionelle PCR-Systeme zum Nachweis von AHSV-RNA
und deren Serotypisierung zur Verfügung.

Antikörpernachweis
(NUR DURCH FLI DURCHZUFÜHREN)
Der Antikörpernachweis ist die wichtigste Aufgabe im Rahmen der ständigen Export-/
Import-Kontrollen. Die Antikörper-Untersuchungen werden mittels Kompetitions-
ELISA durchgeführt.
Als weitere ergänzende serologische Untersuchungen sind beschrieben:
Immunoblotting, die KBR und der Virus-NT nach dem OIE Manual of Standards for
Diagnostic Tests and Vaccines.

Literatur
Fernández-Pinero J, Fernández-Pacheco P, Rodríguez B, Sotelo E, Robles A, Arias
M, Sánchez-Vizcaíno JM. (2009): Rapid and sensitive detection of African horse
sickness virus by real-time PCR. Res Vet Sci. 86 (2) 353-8
Agüero M, Gómez-Tejedor C, Angeles Cubillo M, Rubio C, Romero E, Jiménez-
Clavero A. (2008): Real-time fluorogenic reverse transcription polymerase chain
reaction assay for detection of African horse sickness virus. J Vet Diagn Invest. 20(3)
325-8

FLI 20
Amtliche Methodensammlung Stand: Mai 2013

3. Afrikanische Schweinepest (ASP)

3.1. Charakterisierung der Infektion


3.1.1. Erreger
Der Erreger der Afrikanischen Schweinepest (ASP) ist ein großes, komplexes DNA
Virus aus dem Genus Asfivirus der Familie Asfarviridae (ASFAR = African Swine
Fever And Related Viruses). Das ASP-Virus (ASPV) besitzt einen Lederzeckenvektor
(Zecken des Genus Ornithodoros) und ist damit das bisher einzige DNA Virus, das
als Arbovirus (arthropod borne virus) klassifiziert werden kann

3.1.2. Klinische Symptomatik


Die ASP ist eine hochkontagiöse Infektionskrankheit der Haus- und Wildschweine,
die mit einem sehr variablen klinischen Bild einhergehen kann. Abhängig von der
Virulenz des Virus und diversen Wirtsfaktoren, werden perakute bis chronische
Verläufe beobachtet. Klinisch ist die ASP nicht von der Klassischen Schweinepest
(KSP) zu unterscheiden! Aus diesem Grunde ist eine labordiagnostische Abklärung
zwingend erforderlich. Es stehen sowohl direkte Verfahren zum Nachweis des
Erregers als auch indirekte Verfahren zum Antikörpernachweis zu Verfügung.
In den letzten Jahren hat die ASP deutliche Ausbreitungstendenzen in Afrika gezeigt,
und wurde nach Georgien und von dort in weitere transkaukasische Länder und die
russische Föderation eingeschleppt. Die Verfütterung von Speiseabfällen und
unzureichend desinfizierte Schweinetransporter, die aus betroffenen Gebieten
zurückkehren, sind in diesem Zusammenhang besondere Risikofaktoren für die
Einschleppung. Generell sind jedoch auch lebende Schweine (inklusive
Wildschweine), Sperma, tierische Erzeugnisse und Rohstoffe sowie infizierte Zecken
als Einschleppungswege denkbar. Die Übertragung zwischen Hausschweinen kann
durch direkte oder indirekte Kontakte bzw. über kurze Entfernungen auch über
Aerosole erfolgen.
Nach einer Inkubationszeit von 2 bis 7 Tagen (die im EU-Recht angenommene
maximale Inkubationszeit beträgt 45 Tage) entwickeln die betroffenen Tiere hohes
Fieber und schwere, unspezifische Allgemeinsymptome (Futterverweigerung,
Mattigkeit, Bindehautentzündungen, Bewegungsstörungen, Diarrhoe, stark erhöhte
Atemfrequenz). Trächtige Sauen können verferkeln. Bei akuten Verläufen kann es
zur Ausprägung hämorrhagischer Symptome kommen (Petechien in Haut- und
Schleimhaut, Nasenbluten, blutige Diarrhoe). Die aktuell in Russland kursierenden
Viren sind hoch virulent und verursachen ein schweres, nahezu altersunabhängiges,
unspezifisches Krankheitsbild, das nach 7 bis 10 Tagen mit dem Tod des Tieres
endet (Mortalität 100 %).
Die Virusausscheidung beginnt bei den betroffenen Schweinen in der Regel am 2.
bis 4. Tag nach der Infektion und kann bei Tieren, die die Krankheit überleben,
gelegentlich über 12 Monate andauern. Nach ca. 7 bis 10 Tagen sind Antikörper
nachweisbar. Letztere können bei Tieren fehlen, die in diesem Zeitraum versterben.
Gegen die ASP gibt es keinen Impfstoff.

FLI 21
Amtliche Methodensammlung Stand: Mai 2013

3.1.3. Differentialdiagnose
Neben der KSP gehören bakterielle Septikämien, Circovirusinfektionen und die
Aujeszkysche Krankheit zu den vorrangigen Differentialdiagnosen. Aufgrund des
variablen klinischen Bildes kommen jedoch auch viele andere Erkrankungen viraler,
bakterieller und nicht-infektiöser Genese in Frage.

3.1.4. Diagnostische Indikation


Gemäß Schweinepest-Verordnung.

3.1.5. Zuständige Untersuchungseinrichtung


Friedrich-Loeffler-Institut, Südufer 10, 17493 Greifswald-Insel Riems, Tel. 0383517-0

3.1.6. Rechtsgrundlagen
• Verordnung zum Schutz gegen die Schweinepest und die Afrikanische
Schweinepest in der jeweils gültigen Fassung
• Verordnung über anzeigepflichtige Tierseuchen in der jeweils gültigen Fassung
• Richtlinie 2002/60/EG sowie
• Entscheidung 2003/422/EG (Diagnostik-Handbuch)

3.2. Untersuchungsmaterial
Für die Probennahme ist die Entscheidung 2003/422/EG (Diagnostik-Handbuch)
maßgeblich. Die folgenden Ausführungen dienen daher nur der Erläuterung bzw.
Konkretisierung des Vorgehens in Deutschland.
In Deutschland kann ein ASP-Verdacht, außer bei Hinweisen auf Kontakt mit Tieren,
Personen oder Erzeugnissen aus ASP-verseuchten Gebieten (z. B. Russland,
Sardinien, Afrika), dann entstehen, wenn bei klinischen und pathologisch-
anatomischen Hinweisen auf Schweinepest der Verdacht auf die klassische
Schweinepest im Labor nicht bestätigt werden kann. Insofern ist bei Verdacht auf
Schweinepest in bisher nicht betroffenen Regionen auch daran zu denken, dass eine
Untersuchung auf ASP notwendig werden könnte. Es ist daher zu empfehlen,
geeignetes Probenmaterial gekühlt bei +4 °C auch für eine ASP-Untersuchung
zurückzuhalten. Falls ein Bestand mit unklarem Krankheitsbild, bei dem eine
Untersuchung auf ASP in Frage kommen könnte, getötet und unschädlich beseitigt
wird, sollten geeignete Proben gekühlt sichergestellt werden.
Die Probenverpackung muss den ADR-Vorschriften entsprechen, auf jeden Fall aber
flüssigkeitsdicht sein und äußerlich gut desinfiziert werden (z. B. mit 2 % NaOH). Sie
darf außerhalb des zuständigen Labors nicht mehr geöffnet werden. Frische Proben
sind gekühlt, aber nicht gefroren zu versenden (Hinweis: Falls nur gefroren
aufbewahrte Proben zur Verfügung stehen, sind diese im Ausnahmefall
einzusenden, da viele Nachweisverfahren mit gewissen Einschränkungen auch bei
gefrorenen Proben anwendbar wären).
Proben sind nach Möglichkeit per Kurier zum Friedrich-Loeffler-Institut, Südufer 10,
17493 Greifswald - Insel Riems zu schicken. Sie sind in jedem Fall telefonisch
anzukündigen (0383517-0).

FLI 22
Amtliche Methodensammlung Stand: Mai 2013

Bei einem ASP-Verdacht sind einzusenden:


• Serum (möglichst 5 ml je Tier)
• Wo möglich, zusätzlich 10 ml EDTA-Blut.

Hinweis: Empfohlen werden wassergefüllte Kühlakkus, die zu einer Temperatur von


etwas über 0 °C führen; CO 2 -Trockeneis ist nicht zu verwenden.

Aus Untersuchungseinrichtungen oder von Schlachthöfen:


• Serum, 1 - 2 ml
• Lymphknoten, insbesondere der inneren Organe sowie Mandibular- und
Retropharyngeallymphknoten
• Milz, Tonsillen, Lunge, Niere
• zusätzlich möglich: ungeöffnetes Brustbein.

Blutproben sind von einer größeren Zahl von Tieren einzusenden. Das Diagnostik-
Handbuch enthält Festlegungen hierzu und auch zur Untersuchung klinisch
unauffälliger Kontaktbestände.

Organproben sind möglichst von ausgewählten klinisch kranken bzw. pathologisch


auffälligen Tieren einzusenden. Zu den Organproben ist ein Vorbericht über das Tier
(Klinik, Pathologie) zu übermitteln.

Bevorzugte Proben von Schwarzwild:


• Serum
• Milz

Abbildung 1:
Diffuse Blutungen im Mandibularlymphknoten

Abbildung 2:
Petechien in der Niere

FLI 23
Amtliche Methodensammlung Stand: Mai 2013

Abbildung 3:
Splenomegalie

Im Anschreiben ist anzugeben:


• Wer sendet ein? (Veterinäramt, Bearbeiter; inkl. dienstlicher und eventuell privater
Telefon- und Fax-Nummer)
• Was wird eingesandt? (Art des Materials, von welchen Tieren, Anzahl etc.)
• Aus welchem Bestand stammen die Proben?
• Was wurde wann in dem Bestand festgestellt? (anamnestischer Kurzbericht)

Zusätzliche Angaben, soweit möglich:


• Wie groß ist der Bestand? Tierarten?
• Art des Bestandes (Zucht-, Mast-, Händlerbestand etc.)?
• Bestehen Kontakte zu ASP-verseuchten Gebieten?
• Bemerkungen und weitere Hinweise auf eine mögliche Erregereinschleppung.

3.3. Untersuchungsgang
(IM VERDACHTS- UND AUSBRUCHSFALL NUR DURCH FLI DURCHZUFÜHREN)

Für die Untersuchung ist die Entscheidung 2003/422/EG (Diagnostik-Handbuch)


maßgeblich. Die folgenden Ausführungen dienen daher nur der Erläuterung bzw.
Konkretisierung des Vorgehens in Deutschland.
Eine ASPV-Infektion wird am FLI, Insel Riems, diagnostiziert durch den Nachweis
von
• ASPV-Genom in Organen, Blut oder Leukozytenkulturen
• infektiösem ASPV aus Organen oder Blut/Serum
• ggf. ASPV Antigen in Organen, Blut oder Leukozytenkulturen
• ASPV-spezifischen Antikörpern

3.3.1. Nukleinsäurenachweis in der real-time PCR:


Der Nachweis von ASPV-Genom erfolgt primär über das von King et al. (J Virol
Methods. 2003 Jan;107(1):53-61) publizierte, OIE gelistete real-time PCR-Protokoll.
Es dient dem sensitiven Nachweis von ASPV-Genom in Blut-, Serum- und
Organproben sowie Zellkulturüberständen. Es integriert die Amplifizierung eines

FLI 24
Amtliche Methodensammlung Stand: Mai 2013

internen Kontrollsystems (IC2 DNA) im duplex Assay. Kleine Fragmente viraler DNA
werden durch die PCR zu nachweisbaren Mengen amplifiziert und über eine
fluoreszenzmarkierte TaqMan-Sonde nachgewiesen. Die PCR eignet sich auch für
Materialien, die für die Virusisolierung bzw. den Antigennachweis nicht mehr
geeignet sind.
Zeitaufwand für die initiale Testung: ca. 1 Tag; positive Ergebnisse sind in einer
zweiten, unabhängigen PCR zu überprüfen bzw. durch Sequenzierung des PCR-
Produktes abzusichern.
Für die Bestätigung werden am FLI die Protokolle nach Tignon et al. (J Virol
Methods. 2011 Dec; 178(1-2):161-70) und Zsak et al. (J Clin Microbiol. 2005 Jan;
43(1):112-9) verwendet.
Das Protokoll nach King wurde zur Ausschlussdiagnostik an die
Untersuchungseinrichtungen der Länder abgegeben.

3.3.2. Virusisolierung in Makrophagen-/Leukozytenkulturen


Die Anzucht von ASPV erfolgt primär als Hämadsorptionstest. Er dient dem
Nachweis von vermehrungsfähigem ASPV aus Blut-, Gewebe- und Tupferproben in
primären Blutmonozyten (PBMCs) bzw. daraus generierten Makrophagenkulturen.
Es handelt sich um einen Bestätigungstest, der insbesondere im Ausbruchsfall zum
Einsatz kommt, und im OIE Manual beschrieben ist. Der Test ist bei entsprechender
Erfahrung hoch sensitiv, ist jedoch nicht für alle ASPV Isolate aussagekräftig, kann
durch bestehende Antikörperreaktionen behindert werden und muss daher von
anderen Testsystemen begleitet werden.
Der Test macht sich den Umstand zunutze, dass es in ASPV-infizierten
Leukozytenkulturen zu einer Hämadorptionsreaktion kommt, d.h. Erythrozyten lagern
sich rosettenartig um infizierte Leukozyten („Himbeeren“). Circa 48 Stunden nach
dem Auftreten der Hämadsorption kommt es zur Lyse der infizierten Zellen. Da kein
anderes für Schweine relevantes Virus dieses Phänomen auszulösen vermag, ist der
Test als spezifisch für ASPV anzusehen.
Blut-, Gewebe- oder Tupferproben von Schweine werden nach entsprechender
Aufbereitung auf primäre Blutleukozytenkulturen verimpft. Die infizierten Kulturen
sind über einen Zeitraum von mindestens sieben Tagen täglich abzulesen. Im
positiven Falle kommt es zu der spezifischen Rosettenbildung (siehe Abbildung 4).
Im Regelfall werden mindestens zwei Passagen angesetzt.
Zeitaufwand: 1. Passage 7 Tage (im klar positiven Falle ca. 2 Tage), 2. Passage ca.
7 weitere Tage

3.3.3. Nachweis von ASPV-Antigen


Für den Nachweis von ASPV-Antigen steht ein kommerzieller ELISA zur Verfügung,
der jedoch nur in Ausnahmefällen zum Einsatz kommt.
In Kryoschnitten bzw. Milzabklatschpräparaten kann virales Antigen mittels
Immunfluoreszenz- oder Immunperoxidasefärbung nachgewiesen werden.
Zeitaufwand: ca. 1 Tag

3.3.4. Nachweis ASPV-spezifischer Antikörper


Für die serologische Diagnostik der ASP stehen derzeit drei kommerzielle ELISA-
Systeme zur Verfügung, die jedoch in Deutschland (noch) nicht zugelassen sind. Die

FLI 25
Amtliche Methodensammlung Stand: Mai 2013

Testsysteme bedienen sich verschiedener Antigene und werden daher parallel


eingesetzt. Neben einem Blocking ELISA auf der Basis des p72 (INGEZIM PPA
COMPAC, Ingenasa), sind zwei indirekte Testsysteme verfügbar, die sich des p30
Antigens (SVANOVIR ASFV-Ab, Boehringer Ingelheim Svanova) bzw. einer
Antigenmischung aus p72, p62 und p32 (ID Screen® African Swine Fever Indirect
ELISA, IDvet) bedienen.

Zeitaufwand: ca. 1 Tag

Zur Bestätigung stehen Immunoblot bzw. indirekte Immunperoxidase-Tests zur


Verfügung.

Zusätzlicher Zeitaufwand: 1-2 Tage.

Abbildung 4:
Positiver Hämadsorptionstest 48 h nach
Inokulation eines positiven Serums

FLI 26
Amtliche Methodensammlung Stand: Mai 2013

4. Amerikanische Faulbrut

4.1. Charakterisierung der Infektion


4.1.1. Erreger
Das Bakterium Paenibacillus larvae kann immer in an Amerikanischer Faulbrut
erkrankter Brut gefunden werden. Aufgrund von DNA-Analysen konnten
verschiedene Genotypen nachgewiesen werden. Als Wirt ist ausschließlich die
Honigbiene bekannt. Die Sporen sind sehr widerstandsfähig und bleiben über
Jahrzehnte infektiös.

4.1.2. Klinische Symptomatik


Je nach Genotyp tötet der Erreger die Brut vor oder nach der Verdecklung ab. Die
Zelldeckel sind eingesunken und oft löchrig. Die Brut hat sich zu einer breiigen,
kaffeebraunen Masse zersetzt, die in der Regel deutlich Fäden zieht. Nach etwa
einem Monat trocknet die tote Brut ein und bildet in der unteren Zellrinne
schwarzbraune Schorfe, die sich nur schwer entfernen lassen.
Die Inkubationszeit kann je nach Infektionsdosis und Genotyp wenige Wochen bis
einige Monate betragen. Weiterhin spielt der Zustand des Bienenvolks eine
wesentliche Rolle. Bei geschwächten Tieren bricht die Erkrankung in der Regel
schneller aus.

4.1.3. Differentialdiagnostik
Das klinische Bild der Amerikanischen Faulbrut ist dem der Europäischen
(Gutartigen) Faulbrut sehr ähnlich. An Amerikanischer Faulbrut eingegangene Brut
bildet aber in der Regel einen schleimigen Faden und fest mit dem Zellboden
verbundenen Schorf (siehe Abbildungen 1 und 2). Nur in der vegetativen Phase in
junger Brut treten keine deutlichen Symptome auf. Bei Mischinfektionen mit
Melissococcus plutonius, dem Erreger der Europäischen Faulbrut, oder Viren (ABPV
und SBV) ist eine Differentialdiagnose anzuraten.

Abbildung 1: Abbildung 2:
Hinweis auf eine Infektion mit Von Amerikanischer Faulbrut
Amerikanischer Faulbrut: Der befallene Brutwabe mit verfärbten,
Wabeninhalt bleibt fadenartig löchrigen Zelldeckeln. Die in der
am Streichholz kleben Brutzelle verbleibende Masse ist
(= fadenziehende Masse) schon zu Schorfen eingetrocknet.

FLI 27
Amtliche Methodensammlung Stand: Mai 2013

FLI 28
Amtliche Methodensammlung Stand: Mai 2013

4.1.4. Diagnostische Indikation


• Tierverkehr
• Klinischer oder epidemiologischer Verdacht
• Untersuchung im Rahmen des Nachweises der Seuchenfreiheit
(Gesundheitszeugnisse für das Verbringen der Bienenvölker an einen anderen
Standort)
• Verdacht aufgrund des hohen Sporenanteils im Futter

4.1.5. Zuständige Untersuchungseinrichtungen


• Veterinäruntersuchungsämter, Tiergesundheitsämter bzw. Staatliche
Lebensmittel- und Veterinäruntersuchungsämter der Bundesländer oder die
von den Ländern beauftragten staatlichen Einrichtungen
• Chemisches und Veterinäruntersuchungsamt Freiburg, Tierhygiene, Am
Moosweiher 2, 79108 Freiburg (Referenzlabor für Bienenkrankheiten des
OIE), Tel.: 0761/1502175
• Friedrich-Loeffler-Institut, Bundesforschungsinstitut für Tiergesundheit,
Südufer 10, 17493 Greifswald – Insel Riems (NRL für Bienenkrankheiten),
Tel.: 038351/71246

4.1.6. Rechtsgrundlagen
Bienenseuchenverordnung vom 24.11.95 (BGBl. I S. 1552) in der jeweils geltenden
Fassung

4.2. Untersuchungsmaterial
4.2.1. Untersuchungsmaterial Brut
Verdächtige Brutwaben werden möglichst vollständig im Rahmen eingesandt und
untersucht. Nur so ist eine Untersuchung auf klinische Symptome möglich. Um die
veränderten Brutzellen identifizieren zu können und eine Kontamination durch
auslaufendes Futter zu verhindern, sollten die Waben zunächst in Papier und
anschließend in Plastikfolie eingepackt und in einem stabilen Karton versandt
werden. Die Waben sollten möglichst frisch entnommen sein und eventuell kühl
gelagert werden. Einfrieren verändert die Symptome ohne jedoch den
Erregernachweis zu beeinflussen.

4.2.2. Untersuchungsmaterial Futter


Futterproben werden aus dem Bereich des Futterkranzes aus Brutwaben
entnommen. Die Brut sollte ebenso wie das Futter gedeckelt sein, d. h. älter bzw.
länger gelagert sein. Werden Proben in anderen Bereichen des Bienenstockes
entnommen oder während Nektar bzw. Honigtau oder Futter eingetragen wird, so hat
ein negativer Befund keine Aussagekraft.

FLI 29
Amtliche Methodensammlung Stand: Mai 2013

4.3. Untersuchungsgang
4.3.1. Mikroskopischer Erregernachweis
Paenibacillus larvae ist ein grampositives, peritrich begeißeltes Stäbchen von sehr
variabler Größe (zwischen 0,5 und 0,8 μm Breite bzw. 2,5 und 5 μm Länge). Die
ovalen Sporen sind doppelt so lang wie breit (0,6 bis 0,7 bzw. 1,1 bis 1,9 μm). Zur
mikroskopischen Untersuchung wird die verdächtige Brut oder fadenziehende Masse
mit einer Pinzette oder Impföse entnommen. Schorfe sollten mit einer sterilen
0,9 %igen NaCl-Lösung suspendiert werden. Es wird entweder ein natives oder
gefärbtes Präparat hergestellt. Hierzu wird das Untersuchungsmaterial direkt auf dem
Objektträger ausgestrichen, luftgetrocknet und die vegetativen Formen nach Gram
oder Giemsa und die Sporen nach Rakette gefärbt. Bei 1000-facher Vergrößerung
(Ölimmersion) können die vegetativen Formen und die Sporen leicht erkannt werden.
Die Geißeln werden erst nach ihrer Ablösung und Zusammenlagerung zu
Geißelzöpfen sichtbar. Ihr Nachweis gelingt im direkten Präparat nur selten, nach
vorheriger Anzucht in Columbia-Blut-Schrägagar nach Plagemann (siehe dort) aber
immer.

4.3.2. Kulturmethoden
Ein sicheres Erkennen und weitere biochemische Tests sind nur nach vorheriger
Anzucht des Paenibacillus larvae mit speziellen Kulturmethoden möglich.
Paenibacillus larvae wächst sowohl in Nährbouillon mit Pepton und Dextrose als
auch in Serumbouillon mit Dextrose. Diese können auch zur Anreicherung des
Bakteriums verwendet werden. Als Nährböden haben sich Columbia-Blut-Agar (CSA)
und MYPGP-Agar am besten bewährt. Ein Zusatz von Nalidixinsäure (3 mg auf
1 Liter Agar) verhindert das Wachstum von vielen Keimen.
Der Nachweis der Geißelzöpfe erfolgt auf Columbia-Blut-Schrägagar nach
Plagemann (1985). Der beimpfte Schrägagar wird 3 bis 4 Tage bei 37 bis 38 °C im
Brutschrank belassen. Danach wird etwas Flüssigkeit vom Boden des
Reagenzglases auf einen Objektträger gegeben und nach dem Trocknen hitzefixiert.
Die Geißelzöpfe können am besten im Phasenkontrast oder mit Nigrosin sichtbar
gemacht werden.

Identifizierung der Kolonien


Die Kolonien des Paenibacillus larvae auf MYPGP-Agar sind weiß und können leicht
anhand ihrer konkaven Form und rauen Oberfläche erkannt werden. Zusätzlich kann
man einen biochemischen Test, insbesondere den Katalase-Test durchführen. Auf
Columbia-Blutagar sind die Kolonien je nach Typ grau-weißlich bis orange
pigmentiert.

Die Untersuchung von Futter- oder Honigproben auf Sporen des Paenibacillus larvae
gehört zu den Standardmethoden im Routinelabor, da sie bei der staatlichen
Seuchenbekämpfung anstelle einer zweiten klinischen Untersuchung gezielt
eingesetzt wird. Als Nährböden eignen sich MYPGD-Agar und Columbia-Schafsblut-
Agar.

• Neben den gezogenen Proben werden pro Untersuchungsreihe jeweils eine


negative und positive Probe mitgeführt
• Die Proben werden zur leichteren Verarbeitung auf 34 °C erwärmt

FLI 30
Amtliche Methodensammlung Stand: Mai 2013

• Jeweils 5 g der bei Bedarf grob gefilterten Futter- bzw. Honigprobe und 5 ml
steriles entmineralisiertes Wasser werden im Reagenzglas mit Hilfe eines
Schüttlers bzw. Rührers homogenisiert
• Alle Proben werden im auf 90 °C ± 1 °C vorgeheizten Wasserbad 6 Minuten
lang erhitzt, um die Sporen anderer Bakterien und Pilze weitgehend abzutöten
• Aus jedem Reagenzglas werden mindestens 100 μl der Suspension auf jeweils
mindestens drei Platten pipettiert und mit einem Drigalski-Spatel ausgespatelt
• Die Kulturen werden 6 Tage aerob im Brutschrank bei 37 °C bebrütet. Im
Begasungsbrutschrank mit 5 % Kohlendioxid reichen 4 Tage aus
• Die gewachsenen Kolonien werden zunächst anhand ihrer äußeren
Charakteristika differenziert. Zur weiteren Bestimmung kann ein Katalase-Test
durchgeführt werden (siehe dort)
• Die Zahl der Kolonieformen mit negativem Katalase-Test kann man mit einem
Kulturzählgerät bestimmen
• Können die Kolonien nicht mehr gezählt werden, legt man entweder einen
Verdünnungsausstrich an oder verdünnt die Ausgangsprobe entsprechend
• Zur zusätzlichen Absicherung kann eine Kolonie auf Columbia-Blut-
Schrägagar überimpft (Plagemann, 1985), und 3 bis 4 Tage lang bei 37 °C
bebrütet werden. In der Flüssigkeit am Boden des Reagenzglases können z.B.
mit Hilfe eines Nigrosin-Präparates oder im Phasenkontrast leicht Geißelzöpfe
nachgewiesen werden, die auf Paenibacillus larvae hinweisen
• Da auch andere Bakterien Geißelzöpfe bilden können, wird zum sicheren
Nachweis eine molekularbiologische Methode (PCR) empfohlen (siehe dort)

Unter Anwendung dieser Methode gewachsene Paenibacillus larvae Kolonien geben


einen Hinweis auf einen möglichen Ausbruch der Amerikanischen Faulbrut. Ein
Ausbruch der Seuche ist unwahrscheinlich, wenn keine Kolonien wachsen. Bei
positivem Befund (hierzu reicht bereits der Nachweis einzelner Kolonien) müssen die
Bienenvölker auf klinische Symptome untersucht werden. Erst wenn diese
nachgewiesen werden, gilt die Seuche als ausgebrochen.

4.3.3. Biochemischer Erregernachweis


Biochemische Tests sind nicht eindeutig und sollten nur zur zusätzlichen
Absicherung verwendet werden.

Katalase-Test
Der Katalase-Test mit 3 %igem Wasserstoffperoxyd eignet sich besonders zur
zusätzlichen Identifizierung von auf Nährböden gewachsenen Kolonien des
Paenibacillus larvae. Die meisten aerobischen Bakterien reduzieren mit ihrer
Katalase das Wasserstoffperoxid unter Sauerstoffabspaltung zu Wasser. Bei
Paenibacillus larvae kommt es zu keiner Gasbildung, die an der schäumenden
Flüssigkeit sichtbar würde. Bei Kolonien auf Columbia-Blut-Agar bringt der Test ein
falsches Ergebnis. Die Kolonie muss daher auf einen sauberen Objektträger
übertragen werden.

4.3.4. Molekularbiologische Methoden: PCR


Für die schnelle Untersuchung von Brut mit klinischen Symptomen der AFB wird der
Inhalt von zwei Brutzellen in 1 ml sterilen Wasser suspendiert und gründlich
geschüttelt. 100 μl der Suspension werden mit 900 μl destillierten Wassers verdünnt.

FLI 31
Amtliche Methodensammlung Stand: Mai 2013

Von der im Vortex-Schüttler bearbeiteten Suspension werden 100 μl für die DNA
Extraktion verwendet. Wenn Bakterienkolonien von Nährböden identifiziert werden
sollen, wird eine Kolonie in 50 μl destillierten Wassers suspendiert und für 15
Minuten auf 95 °C erhitzt. Nach der anschließenden Zentrifugation bei 5000 × g für 5
Minuten werden 1 bis 5 μl des Überstandes als Template-DNA in einer 50 μl PCR
Mixtur verwendet.
Für die PCR Reaktion verläuft in einer Mixtur aus 5 μl Template-DNA, 50 pmol
„Forward“ Primer (AFB-F) und „Reverse“ Primer (AFB-R), 10 nmol von
Desoxynukleosid-Triphosphat und 1-2,5 U von Taq-Polymerase in geeignetem PCR
Puffer (wird zusammen mit Taq-Polymerase angeboten) mit 2 mM MgCl 2 . Die
Amplifikation eines spezifischen DNA Fragments erfolgt im Thermocycler unter den
folgenden Bedingungen: ein 95 °C (15 Minuten) Schritt, 30 Zyklen bei 94 °C (30
Sekunden), 56 °C (30 Sekunden) und 72 °C (1 Minute) und ein letzter Zyklus bei
72 °C (10 Minuten).

Die Molekulargewichte der PCR-Produkte werden mit Hilfe der Elektrophorese in


0,8 % Agarose-Gel bestimmt und mit Ethidiumbromid gefärbt.

Primer:
AFB-F 5`-CTTGTGTTTCTTTCGGGAGACGCCA-3´
AFB-R 5`-TCTTAGAGTGCCCACCTCTGCG-3´

Die Länge des Amplikons aus diesen Primern beträgt 1106 bp

4.3.5. Serologische Tests


Geprüfte Antiseren sind zurzeit nicht käuflich zu erwerben.

FLI 32
Amtliche Methodensammlung Stand: Mai 2013

5. Ansteckende Blutarmut der Einhufer

5.1. Charakterisierung der Infektion


5.1.1. Erreger
Die Infektiöse Anämie der Einhufer, auch bezeichnet als Equine infektiöse Anämie
(EIA) oder Ansteckende Blutarmut der Einhufer (ABE), ist eine systemische
Viruserkrankung der Pferde, Ponys, Esel, Maultiere und Zebras. EIAV, ein Lentivirus
aus der Familie der Retroviren, verursacht eine persistierende Infektion und vermehrt
sich in Monozyten und Makrophagen. Der Erreger besitzt ein einzelsträngiges RNA-
Genom positiver Polarität. Die Glykoproteine der Virushüllmembran zeigen eine
kontinuierliche, langsame Veränderung der immunitätsinduzierenden Strukturen
(Antigendrift). Das Hauptstrukturprotein p26 des Virusinnenkörpers ist hingegen
konserviert und wird daher für die serologische Diagnose der EIA-Infektion
herangezogen.
Die Krankheit ist in Deutschland anzeigepflichtig und wird durch die „Verordnung zum
Schutz gegen die ansteckende Blutarmut der Einhufer“ (4. Oktober 2010 (BGBl. I S.
1326)) reglementiert, die eine Tötung positiver Tiere sowie Sperrung und
Untersuchung der betroffenen Bestände und der Kontaktbetriebe vorschreibt.
Immunprophylaxe oder Therapie sind nicht verfügbar. Eine Gefährdung des
Menschen durch EIA liegt nicht vor.

Vorkommen
EIA ist weltweit verbreitet und tritt regional gehäuft in Nord- und Südamerika, Afrika,
Asien, Australien sowie Süd- und Osteuropa auf. Sie kommt in nord- und
mitteleuropäischen Länder nur sporadisch vor. Das Virus ist in Deutschland nicht
heimisch, jedoch kommt es immer wieder zu vereinzelten EIA-Ausbrüchen.

Epidemiologie
Die Übertragung erfolgt in erster Linie mechanisch durch große blutsaugende
Insekten wie Pferdebremsen und Wadenstecher (Tabanus, Stomoxys). Diese können
bei einer Unterbrechung der Blutmahlzeit infektiöses Blut an ihren Mundwerkzeugen
auf ein benachbartes Tier übertragen. Das EIA-Virus bleibt nur für kurze Zeit infektiös
(ca. 30 Minuten), daher kommt eine Übertragung durch Insektenvektoren über
größere räumliche Distanzen hinweg nicht vor. EIA-Infektionen treten saisonal
gehäuft in den vektorreichen Jahreszeiten (Sommer und Herbst) auf. Infizierte Tiere
scheiden Virus mit Körpersekreten wie Speichel, Milch und Sperma aus. Eine
Virusübertragung durch Exkrete erfordert einen sehr engen Kontakt der Tiere.
Intrauterine Infektionen sind ebenfalls beschrieben. EIAV kann darüber hinaus durch
infizierte biologische Produkte wie Blut oder Blutzubereitungen übertragen werden.
Eine etwaige Verschleppung durch Injektionskanülen, tierärztliche Instrumente oder
Pflegezubehör ist durch Verwendung von Einwegmaterial bzw. durch geeignete
Desinfektions- und Hygienemaßnahmen auszuschließen.

5.1.2. Klinische Symptomatik


Infektionen mit Lentiviren, zu denen das EIAV gehört, sind dadurch charakterisiert,
dass sie zu persistierenden Infektionen führen. Spezifische Antikörper sind zwei bis

FLI 33
Amtliche Methodensammlung Stand: Mai 2013

drei Wochen (in Ausnahmefällen bis zu 90 Tage) nach der Infektion nachweisbar.
Aufgrund der stetigen Veränderung der Antigeneigenschaften des Virus führt die
induzierte Immunantwort nicht zur Eliminierung des Erregers. Infizierte Tiere bleiben
lebenslang Virusträger und stellen potentielle Infektionsquellen dar.
Die Erkrankung zeigt sich in akuter oder chronischer Form mit jeweils vereinzelt
tödlichem Verlauf. Die akute Verlaufsform äußert sich in Fieber, Apathie,
Schwäche, Ataxie, Ikterus, Tachykardie, Arrhythmie sowie petechialen Blutungen auf
Schleim-häuten und Lidbindehäuten sowie insbesondere auf der Zungenunterseite.
Die chronische Verlaufsform ist hingegen durch Krankheitsschübe mit
rekurrierenden Fieberanfällen, Konditionsverlust, Anämie sowie Ödembildung an
Unterbauch und Extremitäten gekennzeichnet. Eine Anämie (Blutarmut) entsteht
nach Infektion mit EIAV vorrangig durch immunpathologische Auflösung der roten
Blutkörperchen, aber auch durch eine Störung ihrer Neubildung. Pathologische
Veränderungen haben im akuten Stadium eher degenerativen (Lebernekrosen,
fokale Blutungen) und im chronischen Stadium eher lymphoproliferativen Charakter
(Hepatosplenomegalie, Hämosiderose, Lymphadenopathie).
In 30 bis 90 % der Fälle treten keine Krankheitssymptome auf, die Tiere bleiben
gesund erscheinende Virusträger, sogenannte asymptomatische Carrier.

5.1.3. Differentialdiagnostik
Fieber, geringgradiger Ikterus und Nachhandschwäche werden auch bei Babesiose,
Ehrlichiose und Leptospirose beobachtet. Ödembildung kann auch im Rahmen von
Nephrosen, Nephritiden, Herz-, Kreislaufinsuffizienz und starkem Wurmbefall
auftreten. Die immunvermittelte hämolytische Anämie (IMHA) kommt bei Pferden
zwar selten vor, ist in Deutschland aber die häufigste Ursache einer hämolytischen
Anämie. Akute Infektionsverläufe können dem klinischen Bild der Equinen Viralen
Arteritis (EVA) ähneln. Eitrige Herdinfektionen können zu ähnlichen klinischen
Befunden führen, wie sie bei dem chronischen Verlauf der EIAV-Infektion zu
beobachten sind.

5.1.4. Diagnostische Indikation


Gemäß „Verordnung zum Schutz gegen die ansteckende Blutarmut der Einhufer“

5.1.5. Zuständige Untersuchungseinrichtungen


• Veterinäruntersuchungseinrichtungen der Länder
• Friedrich-Loeffler-Institut, Bundesforschungsinstitut für Tiergesundheit, Insel
Riems: Nationales Referenzlabor für EIA am Institut für Virusdiagnostik

5.1.6. Rechtsgrundlagen
„Verordnung zum Schutz gegen die ansteckende Blutarmut der Einhufer“ (Einhufer-
Blutarmut-Verordnung) in der letzten Fassung vom 4. Oktober 2010 (BGBl. I S. 1326)

FLI 34
Amtliche Methodensammlung Stand: Mai 2013

5.2. Untersuchungsmaterial

Für die hämatologische Untersuchung


• gerinnungsgehemmte Blutprobe (EDTA, Heparin, Citrat)

Für die serologische Untersuchung:


• Nativblutprobe, Serum; Plasma ist nicht für alle serologischen Tests geeignet

Für die virologische Untersuchung:


• gerinnungsgehemmte Blutprobe (EDTA [Anzucht!], Heparin, Citrat)
• Organmaterial (Leber, Milz, Niere)

5.3. Untersuchung
Der Agargel-Immunodiffusionstest (AGID, Coggins-Test) ist der Test der Wahl für die
Diagnosestellung. Der EIAV-Antikörper-ELISA (Enzyme Linked Immunosorbent Assay)
beruht auf einem enzymatischen Nachweis der Antikörper und muss bei einer positiven
Reaktion durch den AGID bestätigt werden. Der direkte Nachweis des Virus ist
üblicherweise nicht notwendig, da ein serologisch positives Tier das Virus lebenslang
beherbergt und es potentiell weiterverbreiten kann. Der Nachweis von viralem
Erbmaterial aus Blut und Organmaterial ist mittels Polymerase-Kettenreaktion (PCR)
möglich.
Die Untersuchungen erfolgen nach dem „O.I.E. Manual of Diagnostic Tests and
Vaccines for Terrestrial Animals“ (2012, Part 2, Section 2.5, Chapter 2.5.4; Stand 2008).
Weiterführende Ergänzungen können der AVID-Methodensammlung entnommen
werden (www.dvg.net).

5.3.1. Antikörpernachweis
Von Pferden, die sich möglicherweise in einer frühen Infektionsphase befinden, sollte
nach 1 bis 2 Wochen erneut eine Blutprobe untersucht werden. Um für Fohlen eine
Aussage treffen zu können, muss der Antikörperstatus der Mutterstute bekannt sein.
Falls im Blut der Stute Antikörper gegen EIAV nachgewiesen werden, kann der
serologische Befund des Fohlens erst nach dem sechsten Lebensmonat beurteilt
werden, da erst nach dieser Periode passiv übertragene maternale Antikörper
abgebaut sind.

5.3.1.1. Agargel-Immunodiffusionstest (AGID, Coggins-Test) – offizieller


Test, vorgeschrieben für internationalen Handel, Einfuhr
In den ersten zwei bis drei Wochen nach der Infektion fällt der Test üblicherweise
negativ aus. In Ausnahmefällen können bis zum Auftreten nachweisbarer Antikörper
bis zu 90 Tage vergehen. Präzipitierende Antikörper aus dem Testserum diffundieren
in einem Agargel gegen ein ebenfalls diffundierendes Antigen (Kapsid/Core p26).
Eine entstehende Präzipitationslinie ist dann als positiver Befund zu bewerten, wenn
diese Bande mit der Präzipitationsbande des positiven Kontrollserums kommuniziert.
Kommerzielle Testkits beinhalten rekombinantes EIAV-Antigen und positives
Kontrollserum.

FLI 35
Amtliche Methodensammlung Stand: Mai 2013

Vorbereitung der AGID-Platten


2 g NaOH
9 g H 3 BO 3
1 l destilliertes Wasser zugeben
pH auf 8,6±0,1 einstellen

Im Puffer eine 1%-Lösung von Noble-Agar herstellen: Agarlösung in Intervallen von


30 sec für insgesamt 3 min oder solange, bis der Agar gelöst ist, im Mikrowellenherd
behandeln. Der erhitzte und vollständig gelöste Agar wird in einer Schichtdicke von
etwa 3 mm (z.B. 5 ml Agar pro 3,5 cm-Petrischale bzw. 15 ml in eine Petrischale (∅
100mm)) ausgegossen.

• Platten 1 h bis 12 h bei Raumtemperatur abkühlen, maximal 3 Wochen bei 2 bis


8°C lagern

• rosettenartig 6 periphere und 1 zentrale Vertiefung unmittelbar vor Gebrauch aus


dem 2 bis 8°C kalten Agarplatten ausstanzen (siehe Gebrauchsinformation).
Agarpfropfen und Flüssigkeit entfernen.

Achtung: Ablösen des verbliebenen Agars von der Unterfläche vermeiden!

o Folgende Stanze hat sich besonders bewährt:


Durchmesser der Stanzlöcher 5 mm
Abstand der einzelnen Löcher voneinander 3 mm.

Durchführung des AGID


• In das zentrale Loch wird das EIAV-Testantigen und in die peripheren Löcher
werden alternierend ca. 50 μl Referenzserum (Positivkontrollen) und Feldseren
einfüllen.
Löcher randvoll plan befüllen.

• Die beschickte AGID-Platte wird danach ca. 15 Minuten nicht bewegt und
anschließend über Nacht bei Raumtemperatur in einer feuchten Kammer
bebrütet.

• Ablesung gegen dunklen Hintergrund am 1. und 2. Tag nach Testansatz;


Abschließende Beurteilung von negativen Proben frühestens nach 48 Stunden.

5.3.1.2. EIAV-Antikörper-ELISA (Enzyme Linked Immunosorbent Assay)


Kommerzielle double sandwich sowie blocking ELISA-Tests sind zum Nachweis von
Antikörpern gegen p26 (Kapsid) verfügbar. Aufgrund ihrer höheren Sensitivität und
der schnellen Durchführung stellen sie eine sinnvolle Ergänzung zum
Agargelimmunodiffusionstest dar, insbesondere bei der Routineuntersuchung
größerer Probenzahlen. Ein positives ELISA-Testergebnis muss im AGID verifiziert
werden, da in den ELISA-Tests vereinzelt falsch positive Reaktionen auftreten
können.

FLI 36
Amtliche Methodensammlung Stand: Mai 2013

Aktuell sind sowohl AGID-Testsysteme als auch ELISA-Tests jeweils zweier


unterschiedlicher Hersteller in Deutschland zugelassen. Zu abklärenden
Untersuchungen bei unklaren, schwachen oder unspezifischen Reaktionen können
Proben jederzeit dem NRL übermittelt werden.

5.3.2. Virusnachweis
Da das Virus im infizierten Tier persistiert, ist ein positiver serologischer Befund
ausreichend für die Diagnosestellung der EIAV-Infektion.

5.3.2.1. Virusisolierung
Die Virusisolierung ist zeitaufwändig, und die Durchführung ist nicht routinemäßig
erfolgreich. EIAV kann in primären Makrophagen- und Leukozytenkulturen
angezüchtet werden, in Pferdehaut- und Nierenzelllinien vermehrt sich das Virus
deutlich schlechter und die Anzucht misslingt häufig.

Eine nested Polymerase-Kettenreaktion (n-PCR) kann zum Genomnachweis


eingesetzt werden (Nagarajan et al. 2001, J. Virol. Methods, 94, 97-109). Der
Nachweis viraler RNA erfolgt aus zellfreiem Material (Plasma, Serum), der Nachweis
von integrierter proviraler DNA aus Blutzellen oder Organmaterial. Da die Viruslast
sehr niedrig sein kann und die Sequenzen der zirkulierenden EIAV-Stämme auch im
gag-Bereich (p26) variieren können, ist lediglich ein positiver PCR-Befund als
aussagekräftig zu bewerten.
Es werden mit Hilfe des TRIZOL-Reagents (Invitrogen) oder eines Säulchen-RNA-
Isolierungs-Kits (QIAamp viral RNA (zellfreie Proben), RNeasy Mini Qiagen
(zellhaltige Proben)) aufgereinigte RNA Proben eingesetzt.

Für die DNA-Extraktion hat sich besonders das High Pure PCR Template Kit von
Roche bewährt (Gewebe 1:10 in Lysispuffer verdünnen, homogenisieren z. B. Tissue
Lyser, Qiagen). Die genauen Aufreinigungsprotokolle für die unterschiedlichen
Materialien finden sich in den entsprechenden Herstelleranweisungen. Es sind 1 bis
5 µl nach der Aufreinigung gewonnene DNA- oder RNA-Suspension in der EIAV-
PCR einzusetzen. Wird keine Carrier-RNA eingesetzt, kann eine genaue Messung
mittels Photometrie erfolgen (100 bis 500 ng Gesamt-DNA / 500 bis 2000 ng
Gesamt-RNA).

Zur Überprüfung der erfolgreichen Nukleinsäure-Extraktion und Amplifikation wurde


der Assay mit einem internen Kontrollsystem, basierend auf dem beta-Aktin-Gen,
gekoppelt. Die Ergebnisse der spezifischen (RT-)PCR gelten nur als valide, wenn die
Amplifikationsreaktion in der beta-Aktin-PCR erfolgreich ist.

Um einen Hinweis auf vorkommende Kreuzkontaminationen während der


Nukleinsäure-Isolierung zu erhalten, wird bei jeder Extraktion mindestens eine
Isolierungskontrolle mitgeführt. Hierbei wird negatives Probenmaterial (z.B. Serum
oder Organe) zusammen mit den Feldproben aufgearbeitet. Die Extraktionskontrolle
dient somit auch als positive Kontrolle für das beta-Aktin-Detektionssystem. Werden
parallel mehr als 7 Feldproben aufgearbeitet sollte mehr als eine Extraktionskontrolle
mitgeführt werden

FLI 37
Amtliche Methodensammlung Stand: Mai 2013

5.3.2.2. RT-PCR zum Nachweis von gag (p26) spezifischen Genomab-


schnitten von EIAV
(RT-PCR-Protokoll nach Nagarajan et al./ OIE-Referenztest)

Detektion viraler RNA aus Viruspartikeln in zellfreien Matrices wie Serum,


Plasma.
Extraktion mit dem QIAamp viral RNA kit (Qiagen) mit Carrier-RNA

Reaktionsansatz z.B.: SuperScript III One Step RT-PCR Kit

2x Puffer 12,5 µl (enthält 12,5 mM MgCl 2 )


kein weiterer Zusatz von Magnesium
Primer EIAf 1,0 µl (100 pmol/µl Stammlösung)
Primer EIAr 1,0 µl (100 pmol/µl Stammlösung) Endkonzentration je 0,5-1,0µM

Enzym 0,5 µl
Template 3,0 µl
H2O ad 25 µl

PCR-Zyklus
55°C 30 min (RT-Reaktion)
94°C 15 min
40x:
94°C 30 sec
55°C 30 sec
72°C 30 sec
72°C 7 min
12°C halten

äußere Primer EIAV gag (p26)


P1_f 613: GTA ATT GGG CGC TAA GTC TAG
P2_r 1222: CCT CTA ATA AAT CTT GCT GTC Produktgröße: 610 bp
2 µl in den Reaktionsansatz für die innere PCR überführen (siehe Abschnitt PCR)

innere Primer EIAV gag (p26)


P3_f 914: GGC TGG AAA CAG AAA CTT TA
P5_r 1173: CCA GTG GAG CAT TCG GTA A Produktgröße: 260 bp

PCR-Zyklus
95°C 15 min
40x:
94°C 30 sec
55°C 30 sec
72°C 30 sec
72°C 7 min
12°C halten

FLI 38
Amtliche Methodensammlung Stand: Mai 2013

5.3.2.3. PCR zum Nachweis von integrierten proviralen gag (p26)


spezifischen Genomabschnitten von EIAV
(PCR-Protokoll nach Nagarajan et al./ OIE-Referenztest)
Gesamt-DNA, welche in das zelluläre Genom integrierte provirale DNA enthalten
kann, wird mit Hilfe des Puregene-Kits (Fa. Biozym), DNA Mini Kits (Qiagen) oder
des High Pure PCR Template Kits (Roche) isoliert und aufgereinigt. Qualität und
Quantität der DNA können im Agarosegel abgeschätzt bzw. im Photometer überprüft
werden. Anderenfalls können 1 bis 5 µl (3µl) direkt nach der Aufreinigung
gewonnene DNA-Suspension in die EIAV-PCR eingesetzt werden.

z. B. Quantitect Multiplex No Rox


2x Reaktionspuffer 12,5 µl
Primer f 1,0 µl (100 pmol/µl Stammlösung)
Primer rev 1,0 µl (100 pmol/µl Stammlösung
A.dest. 7,5 µl
Template 3 µl [2 µl bei innerer EIAV gag-PCR und innerer nested
RT-PCR]
H2O ad 25 µl

Auswertung
Die Auswertung erfolgt i.d.R. mit Hilfe der Agarosegel-Elektrophorese mit
Ethidiumbromid-Färbung. Eine Auswertung erfolgt dann durch den Vergleich der
Größe etwaiger Amplifikate mit Positiv-Kontrollen und einem mitgeführten
Molekulargewichtsmarker.

5.3.2.4. Extraktions- und Inhibitorkontrolle auf endogenes Pferde-β-Aktin-


Gen
hAktin_f 1572: ATG TGC AAG GCC GGC TTC G
hAktin_r 1769: TTG TTG TGC TGA CTC TTC TGT TGT ATC GGG
Produktgröße: 580 bp
PCR-Kits und -Bedingungen wie bei äußerer EIAV (RT-) PCR.
• Nagarajan MM, Simard C. Detection of horses infected naturally with equine
infectious anemia virus by nested polymerase chain reaction. J Virol Methods.
2001; 94(1-2):97-109.

5.3.2.5. Tierversuch
Virus-Übertragungsversuche mit dem Blut verdächtiger Pferde können in
Ausnahmefällen durchgeführt werden. 1 bis 25 ml Vollblut eines infizierten Tieres, in
Einzelfällen bis zu 250 ml, werden benötigt, um nach intravenöser Inokulation eine
Infektion in einem Empfängertier zu etablieren (Beobachtungszeitraum ≥45 Tage).

FLI 39
Amtliche Methodensammlung Stand: Mai 2013

6. Ansteckende Blutarmut der Lachse (ISA)


(Stand: April 2012)

6.1. Charakterisierung der Infektion


Die Infektiöse Anämie (Infectious Salmon Anemia, ISA) ist eine Infektionskrankheit
der Atlantischen Lachse (Salmo salar) und wird durch ein Orthomyxovirus, dem ISA-
Virus (ISAV), verursacht. Infizierte Lachsbestände sind in Kanada, Norwegen, den
USA, den Färöer- und den Shetland-Inseln sowie in Schottland sowie in Irland bei
Regenbogenforellen (Oncorhynchus mykiss) im Salzwasser nachgewiesen worden.
2001 wurde in Chile ein ISA-Ausbruch beim pazifischen Silberlachs (O. kisutch)
bestätigt. Dies ist somit die zweite Spezies, die für die ISAV empfänglich ist. Neben
den beiden Lachsarten konnte ISAV aus der Meerforelle (Salmo trutta trutta), der
Regenbogenforelle (O. mykiss) und dem Atlantischen Hering (Clupea harengus)
isoliert werden. Diese Fischarten erkranken nicht, können aber offensichtlich als
Überträger des Virus fungieren. Nach der Aquakultur-Richtlinie 2006/88/EG (1)
gelten Regenbogenforelle (Oncorhynchus mykiss), Atlantischer Lachs (Salmo salar)
und Forelle (Salmo trutta) als empfängliche Arten.
Deutschland wurde bezüglich ISA 2009 von der EU-Kommission als seuchenfrei
erklärt.

6.1.1. Erreger und seine Einordnung


Die ISA wird durch ein behülltes Virus hervorgerufen, welches morphologische,
biochemische und genomische Eigenschaften der Orthomyxoviren besitzt. Es ist
nach seinem Gefährdungspotential für Fische derzeit noch nicht in eine Risikogruppe
eingeordnet. Die Krankheit ist aber als nicht exotische Krankheit im Anhang IV der
Aquakultur-Richtlinie 2006/88/EG (1) aufgeführt. Laborarbeiten mit ISAV sollten unter
L2-Bedingngungen nur mit zusätzlichen Auflagen (eingeschränkter Personenverkehr,
2 Tage kein Kontakt zu Nutzfischen) gestattet werden. Für Tierversuche müssen L3-
Bedingungen gefordert werden.

6.1.2. Klinische und pathologisch-anatomische Symptomatik


Klinisch ist die systemische und letal verlaufende Viruserkrankung durch Anämie,
Ascites, geschwollene und vergrößerte Leber (sehr dunkel) und Milz, aber auch
durch petechiale Blutungen im Peritoneum gekennzeichnet. Blutungen wurden
ebenfalls im Auge beobachtet. Typische histopathologische Befunde sind
degenerative und nekrotische Veränderungen in den Leberzellen sowie tubuläre
Nekrosen und Blutungen in der Niere. Die Erkrankung tritt meist bei Fischen auf, die
im Salzwasser gehalten wurden bzw. Salzwasser ausgesetzt waren. Es häufen sich
aber die Berichte über das Auftreten der ISA bei Süßwasser-Lachsen. In der Regel
verbreitet sich das Virus dort langsam und besitzt nur eine geringe Virulenz, wobei
Ausbrüche im Salzwasser durch eine hohe Mortalität gekennzeichnet sind. Zur
weiteren pheno- und genotypischen Charakterisierung werden das Virus und seine
RNA gegenwärtig bearbeitet.

FLI 40
Amtliche Methodensammlung Stand: Mai 2013

6.1.3. Vorkommen
Das ISAV wurde in Kanada, Norwegen, Chile, den USA, den Färöer- und den
Shetland-Inseln sowie in Schottland und Irland nachgewiesen. In Kanada wurde ISA
ursprünglich als „Hämorrhagisches Nieren Syndrom (HKS)“ beschrieben. Bisher
konnte das ISAV aus Lachsen, aus Meer- und Regenbogenforellen sowie aus dem
Atlantischen Hering nach natürlicher oder experimenteller Infektion isoliert werden.
Nach künstlicher Infektion des Steinbutt (Psetta maxima), der Wrasse (Labrus
bergylta), der Seebrasse (Dicentrachus labrax) oder des Kabeljau (Gadus morhua)
war eine Reisolierung des ISAV nicht möglich. Ein natürliches Reservoir des ISAV ist
bisher nicht bekannt. Eine Ausbreitung des Virus als eine Folge von subklinischen
Infektionen der „Smolt“-Lachse erfolgte nachweisbar von Farm zu Farm durch
Wellboats bzw. von Schlachthäusern oder der Fischindustrie dann, wenn Fische
transportiert oder Organmaterial ISA-infizierter Tiere und unbehandeltes Abwasser
direkt ins Meer eingeleitet wurden.
Zu den Umweltfaktoren, die die Infektion beeinflussen, zählen in latent infizierten
Populationen verschiedene Stressfaktoren, wie z. B. Behandlungen gegen
Forellenläuse oder Cestoden, aber auch gegen andere Infektionskrankheiten. Diese
Belastungen können 2 bis 3 Wochen später zu einem ISA-Ausbruch führen.

6.1.4. Diagnostik der ISA


Die ISA-Diagnostik basiert gegenwärtig auf der ISA-typischen Klinik, der
pathologischen Anatomie, der Histopathologie und den hämatologischen
Veränderungen sowie der Kultivierung des ISAV in SHK-1-Zellen und/oder dem
Nachweis der Viren mittels Immunfluoreszenz in charakteristischen zellulären
Veränderungen der Organe als Ergänzung bei einem untypischen
Krankheitsgeschehen. Zur Bestätigung von positiven Befunden als auch zur
primären Diagnostik wurde eine RT-PCR entwickelt. Die Methoden sind in der
Entscheidung der Kommission 2001/183/EG zur Festlegung der Probennahmepläne
und Diagnoseverfahren zur Erkennung und zum Nachweis bestimmter Fischseuchen
(2) vorgegeben.

6.1.5. Bekämpfung
Die Inzidenz der ISA kann erfolgreich durch die Einführung von allgemeinen
Maßnahmen, wie der Reglementierung des Fischtransports, einer obligatorischen
Kontrolle der Bestände und der Schlachthäuser, reduziert werden. Gleichzeitig
müssen spezifische Maßnahmen festgelegt werden, die infizierte,
infektionsverdächtige und deren Nachbarfarmen betreffen. Die Schlachthaushygiene,
das Rein-Raus-Prinzip in produzierenden Farmen sowie die Desinfektion von
Abwässern aus Farmen, Schlachthäusern und der fischverarbeitenden Industrie
müssen ebenfalls in die Bekämpfung einbezogen werden.

6.1.6. Zuständige Untersuchungseinrichtungen


Die virologischen Untersuchungen zum Nachweis der Freiheit der Fischbestände
vom ISAV für die Anerkennung seuchenfreier Gebiete bzw. Fischfarmen und die
Überwachung der Seuchenfreiheit werden in den zugelassenen, regionalen
Untersuchungsämtern der Bundesländer durchgeführt. Die Bestätigung eines

FLI 41
Amtliche Methodensammlung Stand: Mai 2013

Ausbruches bzw. Verdachts erfolgt am NRL für ISA (NRL-ISA). Das NRL-ISA
koordiniert die Diagnose auf Grundlage der EU- und nationalen Gesetzgebung.

6.1.7. Rechtsgrundlagen
ISA ist eine anzeigepflichtige Tierseuche. Die Diagnose und Bekämpfung der ISA ist
in Deutschland durch die "Fischseuchenverordnung und Verordnung zur Änderung
der Verordnung über anzeigepflichtige Tierseuchen vom 24. November 2008
(Fischseuchenverordnung)" geregelt. Diese Verordnungen dienen zur Umsetzung der
Aquakultur-Richtlinie 2006/88/EG, die zur Harmonisierung der Diagnose und
Bekämpfung von Fischseuchen innerhalb der Europäischen Union erlassen wurde.
In Entscheidung 2001/183/EWG der Kommission werden die Probennahmepläne
und Diagnoseverfahren zum Nachweis der ISA festgelegt. Diese Entscheidung ist für
die Diagnose der ISA in der BRD verbindlich und dient daher der Erstellung der
folgenden methodischen Hinweise. Eine Anleitung zur Diagnose der ISA und
weiterer, gegebenenfalls differentialdiagnostisch abzugrenzender Fischkrankheiten
findet man auch im "Diagnostic Manual for Aquatic Animal Diseases" des OIE von
2000 bzw. in der regelmäßig überarbeiteten Ausgabe.

6.2. Untersuchungsmaterial
für die ISA-Überwachung

6.2.1. Zeitplan
Der Betreiber eines Fischhaltungsbetriebes hat seinen Fischbestand regelmäßig
durch die zuständige Behörde und durch die „mit der Gesundheit von Wassertieren
befassten qualifizierten Dienste“ (in Deutschland sind das i. d. R. die
Fischgesundheitsdienste) klinisch und ggf. auch virologisch untersuchen zu lassen.
Die Kontrollhäufigkeit ist abhängig von der Einordnung des Aquakulturbetriebes in
die Kategorien und der damit festgelegten Art der Überwachung laut EU-Richtlinie
2006/88/EG und ist im Anhang III, Teil B dieser Richtlinie festgelegt.

6.2.2. Probennahme
6.2.2.1. Histologische Proben
Proben für histologische Untersuchungen werden von frisch getöteten Fischen, die
deutliche klinische Zeichen der ISA zeigen, gewonnen. Fische mit vorhandenen
äußeren und inneren pathologisch-anatomischen Organveränderungen sollten
ebenfalls einzeln beprobt werden. In jedem Fall werden Proben von Leber,
Mittelniere, Herz und Milz eines Fisches mit einem Skalpell herausgeschnitten und in 8-
bis 10 %igem neutralen Formalin fixiert. Das Verhältnis von Probe zu Fixativ sollte
1:20 betragen.

6.2.2.2. Proben für virologische Untersuchungen


Material für die virologischen Untersuchungen wird von allen beprobten Fischen
gewonnen. Teile von Leber, Kopfniere, Herz und Milz werden mit einem sterilen
Skalpell herausgeschnitten und in ein Plastikgefäß mit 9 ml Transportmedium, z. B.
Zellkulturmedium mit Antibiotikum, gegeben. Eine Kombination aus 12,5 μg
Fungizone, 200 IU Polymyxine B und 200 μg Kanamycin pro ml Medium hat sich
bewährt. Es können aber auch andere geprüfte Mischungen verwendet werden.

FLI 42
Amtliche Methodensammlung Stand: Mai 2013

Organteile von bis zu fünf Fischen können als Poolprobe in einem Plastikgefäß
gesammelt werden. Das Gesamtgewicht der Poolprobe sollte etwa 1,0 +/- 0,5 g pro
Gefäß nicht überschreiten.

6.2.2.3. Immunfluoreszenz vom Abklatschpräparat der Niere


Ein Abklatsch der Niere darf nur vom frisch getöteten Fisch erfolgen. Dazu wird ein
Teil der Mittelniere mit einem sterilen Skalpell und einer Pinzette herausgeschnitten.
Das austretende Blut wird auf einer aufsaugenden Unterlage entfernt. Danach wird
das Organstück wiederholt auf einen Poly-L-Lysin-beschichteten Objektträger
gepresst, um eine Folge von Tupfpräparaten zu garantieren, die sich nicht
überlappen sollten. Da Blut und Gewebsflüssigkeit den Test durch Koagulation
stören können, wird das Präparat anschließend kurz auf eine aufsaugende Unterlage
gedrückt. Das Abklatschpräparat soll lufttrocknen und anschließend bis zur Fixation,
z. B. mit Aceton-Methanol Ratio 80:20, innerhalb von 72 h (nicht länger) kühl und
trocken gelagert werden.

6.2.2.4. Proben für die Blutuntersuchung


Von Fischen mit klinischen Zeichen einer Anämie wird nach Betäubung Heparinblut
zur sofortigen Untersuchung von Parametern, wie z. B. die Bestimmung des
Hämatokritwertes, gewonnen.

6.2.2.5. Proben für die RT-PCR


Gewebe für die RT-PCR ist von allen untersuchten Fischen zu entnehmen. Dazu
wird ein kleiner Teil der Kopfniere mit einem sterilen Skalpell entnommen und in ein
Mikroröhrchen, welches 1 ml RNA-Stabilisierungslösung enthält, gegeben. Als Mittel
der Wahl wird RNA-later (Ambion Inc., USA) empfohlen. Es können auch andere
geprüfte RNA-Stabilisatoren mit gleicher Schutzwirkung verwendet werden.
Gewebeteile von bis zu fünf Fischen können als eine Poolprobe in einem
Mikroröhrchen gesammelt werden. Das Gesamtgewicht einer Poolprobe sollte 0,5 g
nicht überschreiten. Im Fall der Beprobung von kleinen Fischen wird das empfohlene
Gewicht von 0,5 g dadurch erreicht, indem zusätzlich Teile von Niere, Herz, Milz,
Leber oder der Pylorusschläuche entnommen werden.

6.2.3. Versand von Probenmaterial


Heparinisiertes Blut und Mikroröhrchen für virologische Untersuchung sowie für RT-
PCR müssen in einem gekühlten Container (vorzugsweise eine dickwandige
Polystyrol-Box mit Kühlaggregaten) versandt werden. Dabei ist zu sichern, dass die
Kühlkapazität der Aggregate für die Transportzeit ausreichend ist und das Material
gekühlt im Labor eintrifft. Ein Einfrieren des Materials ist unbedingt zu vermeiden.
Ausnahmen können nur bei dem Material gemacht werden, welches für die RT-PCR
verwendet wird. Durch das RNA-Schutzmedium kann die Probe bei -20 °C oder
darunter transportiert werden. Ein Auftauen ist dann zu vermeiden.

Objektträger mit Abklatschpräparaten sollen im Objektträgerhalter oder -ständer mit


ausreichendem Abstand zwischen den Objektträgern trocken und gekühlt versandt
werden.

FLI 43
Amtliche Methodensammlung Stand: Mai 2013

Formalin-fixiertes Material für histologische Untersuchungen soll in auslaufsicheren


Gefäßen in einem formalinresistenten Container (vorzugsweise eine dickwandige
Polystyrol-Box) transportiert werden.
Die virologischen Untersuchungen müssen schnellstmöglich begonnen werden,
jedoch nicht später als 72 h nach der Probennahme.

Ganze tote Fische sollten in einem aufsaugenden Papier eingeschlagen in einer


Plastiktüte je nach Außentemperatur im Kühlcontainer oder ohne diesen versandt
werden. Lebende Fische sollten entsprechend der Vorgaben der verantwortlichen
Veterinärbehörde verschickt werden.

Die RNA-stabilisierten Proben für die RT-PCR müssen entsprechend ihrer Lagerung
bearbeitet werden. Für die RNA-Extraktion gelten folgende Grundregeln:

Lagerung bei (°C): 37 25 4 -20


Bearbeitung nach: 1 Tag 1 Woche 1 Monat länger als 1 Monat

Alle Verpackungen sowie deren Beschriftung müssen den nationalen und


internationalen Vorschriften entsprechen.

6.2.4. Gewinnung von zusätzlichem diagnostischem Material


In Abstimmung mit dem diagnostischen Labor können auch andere Organe in
unterschiedlicher Präparation gesammelt werden.

6.3. Untersuchungsgang
6.3.1. Aufarbeitung der Proben für virologische Untersuchungen
Wenn die gesammelten und gekühlten Proben nicht innerhalb von 72 h aufgearbeitet
werden können, besteht die Möglichkeit, sie für 28 d bei -80 °C einzufrieren. Das
Probenmaterial darf vor der Untersuchung aber nur einem Gefrier-Tau-Zyklus
unterzogen werden.
Jede Poolprobe ist komplett mit entsprechenden Gerätschaften zu homogenisieren.
Danach wird das Material zwischen 2000 bis 4000 g für 15 Min. bei 0 bis 6 °C
zentrifugiert, der Überstand filtriert (0,45 μm) und mit gleicher Menge eines
Antiserums oder eines Pools von Seren gegen einheimische IPNV-Stämme
(vorzugsweise Serotypen Ab und Sp) in geeigneter Verdünnung für 1 h bei 15 °C
inkubiert. Das Serum oder der Serum-Pool sollten einen Mindesttiter von 1:2000 im
50 % Plaque-Neutralisationstest gegen die IPNV aufweisen.
Diese Suspension ist das Inokulum für die Zellkultur.

6.3.2. Animpfen der Zellkultur


SHK-1-Zellen (weniger als 80 Passagen) oder ASK-Zellen sollen in L-15 Medium mit
5 % FKS, 2 % 200 mM L-Glutamin und 0,08 % 50 mM 2-Mercaptoethanol in 12-well
Zellkultur-Platten wachsen. Es können auch andere Zelllinien von gleicher geprüfter
Effektivität und Empfänglichkeit für die Isolierung des ISAV verwendet werden. Das
zu prüfende Material soll in eine aktiv wachsende Zellkultur inokuliert werden, wobei

FLI 44
Amtliche Methodensammlung Stand: Mai 2013

eine Endverdünnung des Gewebematerials zum Zellkulturmedium von 1:1000


erreicht werden sollte. Dazu sollte von jeder filtrierten Organanreibung 40 μl zu 2 ml
Medium in eine Kavität der 12-well-Platte gegeben werden. Für jede
Probennahmestelle auch innerhalb einer Farm ist eine separate 12-well-Platte zu
beimpfen.
Als negative Kontrolle dient eine nicht beimpfte 12-well-Platte.
Eine weitere separate 12-well-Platte wird mit einem Referenzstamm des ISAV
beimpft (positive Kontrolle). Hier ist folgendermaßen vorzugehen: 100 μl ISAV mit
einem Mindesttiter von 107 KID50/ml wird in der ersten Kavität in der oberen Reihe
der Platte mit den 2 ml Medium gut gemischt.
Die Platten sind bei 14 +/- 2 °C bis zu 15 Tage zu inkubieren.

6.3.3. Mikroskopie
Die Zellen sollen mindestens zweimal zwischen dem 5. bis 7. und dem 12. Bis 14.
Tag nach der Inokulation mikroskopisch untersucht werden. Bei auftretenden CPE
muss eine Virusidentifizierung mittels RT-PCR oder IFT erfolgen. Tritt innerhalb von
14 Tagen kein CPE auf, sollte ein Hämadsorptionstest durchgeführt werden.

6.3.4. Hämadsorption
Die Zellkulturüberstände (ZKÜ) aller zu testender Kavitäten, positive und negative
Kontrollen eingeschlossen, werden in sterilen Röhrchen abgefüllt. 500 μl einer
0,2%igen Lösung gewaschener Kaninchenerythrozyten oder einer 0,5%igen
Suspension von gewaschenen
Regenbogenforellen oder Lachserythrozyten werden in jede Kavität gegeben und für
45 Min. bei Raumtemperatur inkubiert. Danach wird die Erythrozyten-Lösung
abgenommen und die Kavitäten zweimal mit L-15-Medium gewaschen. Jede Kavität
wird im Mikroskop betrachtet.
Das Vorkommen von Erythrozyten-Ballungen an der Oberfläche der SHK-1-Zellen
zeigt eine wahrscheinliche Infektion mit Orthomyxoviren an. Im positiven Fall ist eine
Virusidentifizierung mittels RT-PCR oder IFT anzuschließen.

6.3.5. Subkultivierung oder Blindpassage


Die Weiterpassage soll zwischen dem 13. bis 15. Tag post inoculationem (p.inoc.)
erfolgen. Hierzu werden 225 μl des ZKÜ in eine frische SHK-1- oder ASK-Zelle auf
einer 12-well-Platte überimpft. Diese wird dann bei 14 +/- 2 °C für 14 bis 18 Tage
bebrütet. Unter dem Mikroskop wird die Zelle am 5. bis 7. sowie am 14. bis 18. Tag
auf CPE kontrolliert. Im positiven Fall ist eine Virusidentifizierung anzuschließen.
Falls kein CPE zu beobachten ist, sollte ein Hämadsorptionstest durchgeführt
werden.
Falls das Inokulum zytotoxische Reaktionen in der Zelle vor dem 7. Tag p.inoc.
induziert, ist eine sofortige zweimalige Subkultivierung für 14 bis 18 Tage
anzuschließen. Tritt die Zytotoxizität nach dem 7. Tag p.inoc. auf, dann ist nur einmal
zu subkultivieren. Die Dauer für beide Passagen sollte 28 bis 36 Tage seit der
primären Inokulation nicht überschreiten.
Sind bakterielle Kontaminationen in der primären Kultur zu erkennen, muss die Probe
erneut aus dem bei -80 °C eingefrorenem Material angezüchtet werden. Vor der
Inokulation in die Zellkultur ist das Homogenisat zu zentrifugieren (4000 g, 30 Min., 0

FLI 45
Amtliche Methodensammlung Stand: Mai 2013

bis 6 °C) und der Überstand zu filtrieren (0,22 μm Filter). Ist eine der
Subkultivierungen bakteriell kontaminiert, dann ist der ZKÜ ebenfalls zu filtrieren
(0,22 μm) und das Filtrat in eine frische Zellkultur zu inokulieren. Diese Passage wird
für weitere 14 bis 18 Tage bei 14 +/- 2 °C inkubiert.

6.3.6. Methoden der Virusidentifizierung


Wenn ein CPE in der Zellkultur aufgetreten bzw. der Hämadsorptionstest positiv
ausgefallen ist, muss eine Virusidentifizierung folgen. Als Methoden der Wahl zur
Identifizierung des ISAV stehen dabei der Immunfluoreszenztest (IFT) und die RT-
PCR zur Verfügung. Falls andere Viren (z. B. VHSV, IHNV, IPNV) vermutet werden,
sind diese durch geeignete diagnostische Methoden zu identifizieren. Werden die
Viren innerhalb einer Woche nicht eindeutig identifiziert, ist ZKÜ der betreffenden
Kulturen an das NRL-FK Insel Riems bzw. an das EU-Referenzlabor für
Fischkrankheiten (Aarhus, Dänemark) zu übersenden.

6.3.7. Immunfluoreszenztest
Die Zellen werden mit dem beschriebenen Medium in 24-well-Platten angezüchtet,
infiziert und mikroskopisch beobachtet, bis ein konfluenter CPE von 50 % auftritt.
Dazu werden 225 μl des fraglich virushaltigen ZKÜ‟s in zwei Kavitäten gegeben und
gemischt. Aus dieser Suspension werden wiederum 225 μl in zwei weitere Kavitäten
überpipettiert (Verdünnung 1:5). Zwei unbeimpfte Kavitäten dienen als negative
Kontrolle. Pools von Entnahmestellen einer Fischfarm bzw. Pools von
unterschiedlichen Fischfarmen sollen auf separaten Platten angezüchtet werden.
Eine weiter separat zu behandelnde Platte dient nach Animpfung mit einem ISAV-
Referenzstamm (z. B. Stamm Glesvaer, Norwegen) als positive Kontrolle.
Die bei 14 +/- 2 °C inkubierten Platten werden ab dem 7. Tag p.inoc. täglich
mikroskopisch untersucht. Wird ein CPE beobachtet bzw. ist bis zum 7. Tag kein
CPE vorhanden, ist die Platte zu fixieren. Der ZKÜ wird abgenommen und die Platte
ist mit PBS zu waschen. Da-nach werden die Zellen mit einem Azeton-Methanol-
Gemisch (Ratio 80:20) für 20 Min. bei Raumtemperatur fixiert. Die anschließend
luftgetrockneten Platten werden sofort weiter verarbeitet. Sie können auch nach einer
Lagerung von 24 h bei 0 bis 6 °C für den IFT genutzt werden.
Der Doppelansatz der Kavitäten mit beiden ISAV-Verdünnungen werden mit in
Deutschland zugelassenen monoklonalen Antikörpern (mAk) oder mit anderen
empfohlenen (z. B. in EU-Entscheidung 2001/183/EG oder im OIE Manual) mAk der
gleichen geprüften Effektivität und Empfindlichkeit (siehe Bezugsquellen für
diagnostische Reagenzien und Zellkulturen) in der angegebenen Verdünnung (PBS)
überschichtet und für 30 Min. bei 37 °C inkubiert. Der ungebundene mAk wird durch
Waschen entfernt. Anschließend wird ein in PBS verdünntes anti-Maus-FITC-
Konjugat zu den Kavitäten gegeben und für 30 Min. bei 37 +/- 4 °C inkubiert. Die
Verdünnung für den mAk und das Konjugat sollte in jedem Labor ausgetestet
werden. Alle Waschungen werden mit einer PBS-Tween-20-Lösung (0,05 % Tween
20, PBS-T) durchgeführt.
Die Reaktion ist im geeigneten Fluoreszenzmikroskop mit den passenden Filtern für
FITC zu beurteilen.
Die Reaktion ist positiv, wenn fluoreszierende Zellen (Zellverband oder Einzelzellen)
beobachtet werden. Der Test wird als gültig angesehen, wenn die positiven und
negativen Kontrollen die erwarteten Reaktionen zeigen.

FLI 46
Amtliche Methodensammlung Stand: Mai 2013

6.3.8. Untersuchung von Abklatschpräparaten der Niere mit der IFT


Das folgende Protokoll wurde zur Untersuchung von Abklatschpräparaten der Niere
in der IFT ausgearbeitet.

6.3.8.1. Präparation und Färbung der Abklatschpräparate


Die Objektträger sollen mit Methanol/Azeton (1:1) für 3 Min. fixiert und anschließend
luftgetrocknet werden. Vor der Färbung muss jeder Objektträger untersucht werden
und die Nierenabklatsche sollen mit einem Stift (z. B. Pap Pen oder ImmEdgeTM)
eingerahmt werden. Nach der Trocknung werden die Objektträger mit einer
Blockierungslösung (6 % Trockenmagermilchpulver in PBS-T) überschichtet und
unter leichtem Schütteln für 30 Min. bei Raumtemperatur inkubiert. Die Objektträger
sollen sich in einer feuchten Kammer befinden und immer feucht gehalten werden.
Nach dem Absaugen der Blockierungslösung wird jeder Objektträger mit dem anti-
ISAV-mAk 3H6F8 (oder einem anderen geprüften mAk) in einer Verdünnung von
1:10 und 1:100 mit 1 % Trockenmagermilchpulver im Verdünnungspuffer
überschichtet (für jede Charge ist die optimale Verdünnung der mAk in jedem Labor
zu ermitteln). Diese werden für 1 h bei Raumtemperatur inkubiert. Anschließend sind
die Objektträger 3 x für 2 Min. mit PBS-T (0,1 % Tween 20) zu waschen. Die
Objektträger sind nun mit einem FITC-Konjugat (z. B. Ziege-anti-Maus-Ig-FITC) in
der ermittelten Verdünnung (z. B. 1:1000) im Verdünnungspuffer mit 1 %
Trockenmagermilchpulver zu überschichten und für 1 h in einer feuchten Kammer zu
inkubieren. Danach werden die Objektträger wieder 3 x gewaschen wie bereits
angegeben. Jeder Objektträger wird nun mit einer Mischung von CITIFLOURTM-
Lösung (500 μl CITIFLOURTM) und 1,5 ml PBS-T (0,1 % Tween 20) für 10 Min.
überschichtet und wiederum 3 x für 2 Min. gewaschen. Jetzt werden die Objektträger
mit einer Propidiumjodid-Lösung (0,01 mg/ml) in PBS-T (0,1 % Tween 20)
beschichtet und für 3 Min. bei Raumtemperatur inkubiert. Anschließend erfolgt eine
weitere Waschung 3 x für 2 Min. Am Ende wird die Flüssigkeit um die
Abklatschpräparate mit einem saugfähigen Material entfernt und der Objektträger mit
CITIFLOURTM überschichtet. Die Objektträger sind bis zur Untersuchung bei 4 °C in
Dunkelheit zu lagern.

6.3.8.2. Beurteilung der Reaktion im Fluoreszenzmikroskop


Jeder Objektträger wird in einem geeigneten Fluoreszenzmikroskop mit einem
geeigneten Filter, der FITC anregt, beurteilt. Alle eingerahmten Gebiete auf dem
Objektträger werden mit einer 10-fachen und 20-fachen Vergrößerung untersucht.
Die verdächtig erscheinenden Abklatschpräparate werden mit einer 40-fachen
Vergrößerung erneut beurteilt, um die Zellverbundenheit der Fluoreszenz besser zu
bestätigen. Mindestens eine weitere Person sollte im positiven Fall das gefundene
Ergebnis bestätigen. Dies gilt auch für positive Fluoreszenz auf weiteren
Objektträgern.

6.3.8.3. Kontrollen für den IFT


Wenigstens 3 Kontrollen sollten ständig mitgeführt werden:
1. negative Kontrolle: Nierenabklatsch von einem gesunden Fisch (Lachs)

FLI 47
Amtliche Methodensammlung Stand: Mai 2013

2. negative Kontrolle: eine nicht infizierte Zellkultur (oder eine andere für ISAV
empfängliche Zelle)
3. positive Kontrolle: ISAV-inf. Zellkultur

Falls möglich, sollte ein Abklatschpräparat von einem mit ISAV infizierten Lachs als
weitere positive Kontrolle mitgeführt werden.
Wenn eine der negativen Kontrollen positiv bzw. die positive Kontrolle nicht reagiert,
ist die gesamte Untersuchungsreihe zu verwerfen und der Test ist erneut mit den
Duplikaten der Abklatschpräparate durchzuführen.

6.3.8.4. Untersuchung anderer Gewebe in der IFT


Die gleiche Methode kann auch bei anderen Geweben wie Leber, Milz, Herz und,
wenn in ausreichendem Maße vorhanden, auch mit Endothelzellen oder Leukozyten
durchgeführt werden. Die Markierung der mAk mit dem FITC-Konjugat erfolgt nach
den gleichen Prinzipien wie vorher beschrieben, wobei bei einigen Geweben die
Propidiumjodid-Färbung weggelassen werden sollte.

6.3.8.5. Histologie
Paraffinschnitte sollten ca. 5 μm dick sein und dann HE-gefärbt werden. Die
Charakteristik der Veränderungen im histologischen Schnitt wurde bereits
beschrieben

Bezugsquellen für diagnostische Reagenzien und Zellkulturen


Kommerziell erhältliche Diagnostika:
Bio-X Diagnostics, Belgien:
Bio-X Anti-ISAV Monoklonaler Antikörper (BIO 337); mAk 18B11-M. Dauber
(in Deutschland zur Diagnose der ISA zugelassen, Zulassungsnummer: FLI-B 422)

Referenzviren, im Handel nicht erhältliche Diagnostika und Zelllinien:


Friedrich-Loeffler-Institut,
Bundesforschungsinstitut für Tiergesundheit
Südufer 10
D-17493 Greifswald – Insel Riems

Zentralabteilung Zellbank:
Zelllinie SHK-1 (salmon head kidney); Katalog-Nr.: CCLV RIE 489,
Zelllinie ASK (atlantic salmon kidney), Katalog-Nr.: CCLV RIE 926,
Institut für Infektionsmedizin, NRL für ISA
ISAV-Referenzstamm 390/98, Scotland
ISAV-Referenzstamm Glesvaer 2/90, Norway
Anti-ISAV mAk 18B11, M. Dauber (Insel Riems)
Anti-ISAV mAk 3H6F8, K. Falk (Oslo)

Literatur
1. Verordnung über anzeigepflichtige Tierseuchen in der jeweils gültigen Fassung
2. Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über
anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

FLI 48
Amtliche Methodensammlung Stand: Mai 2013

3. Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und zur
Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU Nr.
L328 S. 14)
4. Entscheidung der Kommission 2001/183/EG vom 22.Februar 2001 zur
Festlegung der Probennahmepläne und Diagnoseverfahren zur Erkennung und
zum Nachweis bestimmter Fischseuchen und zur Aufhebung der Entscheidung
92/532/EWG. (ABl. EU Nr. L 56 S. 65)
5. OIE manual of diagnostic tests for aquatic animals. Sixth Edition 2009, World
Organisation for Animal Health, Paris

FLI 49
Amtliche Methodensammlung Stand: Mai 2013

7. Ansteckende Metritis des Pferdes

7.1. Charakterisierung der Infektion


7.1.1. Erreger
Der Erreger der Kontagiösen Equinen Metritis (Contagious Equine Metritis - CEM)
Taylorella (T.) equigenitalis, ist ein kleines gramnegatives kokkoides
Stäbchenbakterium.

7.1.2. Klinische Symptomatik


Bei der CEM handelt es sich um eine Erkrankung des Geschlechtsapparates bei
Equiden. Die Infektion wird durch Taylorella equigenitalis verursacht und kann eine
temporäre Infertilität verursachen. Falls klinische Veränderungen auftreten, sind das
Endometriums-, Zervix- und Vaginalentzündungen gekennzeichnet durch einen
mukopurulenten Vaginalausfluss. Der Erreger persistiert v.a. im Klitorissinus, in der
Fossa und im Uterus. Aborte sind äußerst selten. Auch wenn keine klinischen
Zeichen auftreten können die Stuten den Erreger ausscheiden und beim Deckakt auf
den Hengst übertragen, der seinerseits symptomlos bleibt und den Erreger weiter
übertragen kann. Der Erreger besiedelt beim Hengst die Schleimhaut der äußeren
Genitalien, wobei die bevorzugten Kolonisationsorte die primäre und die sekundären
Eichelgruben sind.

7.1.3. Differentialdiagnostik
Als Differentialdiagnose kommen andere mit Endometritiden einhergehende
Infektionskrankheiten, verursacht durch v.a. Pseudomonas aeruginosa,
Streptococcus zooepidemicus, Klebsiella pneumoniae, in Betracht.

Taylorella equigenitalis ist von Taylorella asinigenitalis zu differenzieren.

7.1.4. Diagnostische Indikation


• Klinisch oder epidemiologisch begründeter Verdacht
• Ungeklärte Fruchtbarkeitsstörungen (Aborte)
• Exportuntersuchungen, Monitoring von Zuchtpferden

7.1.5. Zuständige Untersuchungseinrichtung


• private und staatliche Laboratorien
• Referenzlabor für Kontagiöse Equine Metritis: Friedrich- Loeffler- Institut,
Naumburger- Str. 96a, 07743 Jena

FLI 50
Amtliche Methodensammlung Stand: Mai 2013

7.1.6. Rechtsgrundlagen
• Bekanntmachung vom 22. Dezember 2005: Nationale Referenzlaboratorien
für anzeigepflichtige Tierseuchen und meldepflichtige Tierkrankheiten
• Entscheidung 93/197/EWG der Kommission vom 05.02.1993 Verordnung über
die meldepflichtigen Tierseuchen in der jeweils gültigen Fassung
• Richtlinie 92/65/EWG in der jeweils gültigen Fassung
• Verordnung über die Gewinnung, Abgabe und Verwendung von Samen,
Eizellen und Embryonen von Zuchttieren (Samenverordnung - SamEnV) vom
14.10.2008 in der jeweils gültigen Fassung

7.2. Untersuchungsmaterial
Vorgeschriebene Untersuchungen an Hengsten, die zur Gewinnung von Samen für
die künstliche Besamung vorgesehen sind:

1. nach Samenverordnung:
eine Samen- oder Vorsekret und Harnröhrenprobe und eine Eichelgrubentupferprobe
(kultureller Erregernachweis oder PCR)

2. Die in der Richtlinie 92/65/EWG in der aktuellen Fassung:


aus dem Vorsekret oder einer Samenprobe und aus Genitalabstrichen isoliert wird,
die zumindest an Penisschaft, Harnröhre und Fossa glandis (kulturellen
Erregernachweis).

Vorgeschriebene Untersuchungen für Spenderstuten (Richtlinie 92/65/EWG):


Proben, die von den Schleimhäuten der Fossa clitoridis und des Sinus clitoridis in
zwei aufeinanderfolgenden Östrusperioden entnommen werden, sowie eine
zusätzliche Kulturprobe, die an der Zervikalschleimhaut während einer Östrusperiode
entnommen wird

Allgemeine Untersuchungen von Urogenitaltupferproben von Stuten und Hengsten:


Hengst: Vorsekret oder Samenprobe, sowie Genitalabstriche (Tupfer) mindestens
von Penisschaft (Penis sollte vollständig ausgeschachtet sein), Harnröhre und Fossa
glandis
Stuten: Genitalabstriche (Tupfer) mindestens von Fossa clitoridis und Sinus clitoridis
(spezielle Klitoristupfer verwenden), Endometriumstupfer (während Östrus)
Für Vollblutpferde siehe „Codes of Practice 2013“
Die einzelnen Tupfer werden in Amies-Transportmedium mit Aktivkohlezusatz
verbracht und gekühlt versandt.
Der Ausstrich bzw. die Untersuchung im Labor hat spätestens 48 Stunden nach der
Probennahme zu erfolgen, deshalb kein Probenversand übers Wochenende.

Zur Bestandskontrolle auf das Vorkommen einer CEM- Infektion kann neben
dem kulturellen Erregernachweis auch der indirekte Erregernachweis des
Probenmaterials (Genitaltupfer) mittels PCR- Analyse erfolgen.

FLI 51
Amtliche Methodensammlung Stand: Mai 2013

7.3. Untersuchungsgang
7.3.1. Kultureller Erregernachweis
Chemikalien und Nährmedien (z.B.)
1. modifizierte EUGON Schokoladenagar (MECA) (Grundsubstanz: Tryptikase-
Soja-Agar, z.B. BD, Heidelberg)
• mit Amphotericin B (MECA+A)
• mit Amphotericin B und Streptomycin (MECA+AS)
• mit Glindamycin, Trimethoprim und Amphotericin B (MECA+CTA)
oder C.E.M.O.- Agar (MAST Diagnostica, Reinfeld)
• mit MAST C.E.M.O. Selectab (MS 31) streptomycinhaltig
• mit MAST C.E.M.O. Selectab (MS 32) streptomycinfrei
2. Nähragar mit 7,5% Kälberblut
3. Hirn- Herz- Aufguss- Bouillon (MAST Diagnostica, Deutschland)
4. Oxidase-Reagenz (1%Tetramethyl-p-Phenylendiamindihydrochloride)
5. Katalase-Reagenz (3% Wasserstoffperoxid)
6. Phosphatase-Reagenz
7. MONO-TAYL Agglutination Kit zur Identifizierung von T. equigenitalis (Bionor,
Norwegen) (http://www.bionor.com/monotayl.pdf)
8. Vergleichsstämme:
• T. equigenitalis (Streptomycin resistenter Biotyp) ATCC 35865 DSM 10668
• (T. equigenitalis (Streptomycin sensitiver Biotyp) NCTC 11225)
• Escherichia (E.) coli ATCC 25922 (Oxidase-negativ, beweglich) DSM 1103
• Streptococcus (Str.) agalactiae ATCC 13813 (Katalase-negativ) DSM 2134
• Oligella (O.) urethralis ATCC 17960 (Phosphatase-negativ) DSM 7531
• (T. asinigenitalis DNA für PCR über NRL CEM)

7.3.2. Herstellung der MECA-Platten


• die auf dem Packungsetikett angegebene Menge Agar in dem
entsprechenden Volumen destilliertem Wasser suspendieren (1l)
• bis zum vollständigen Lösen erhitzen und gut mischen
• pH: 7,1 +/- 0,2 überprüfen und ggf. einstellen
• → Zugabe von Na 2 SO 3 (Natriumsulfit), FW 126,0 0,2 g
und L-Cystine (C 6 H 12 N 2 O 4 S 2 ), FW 240,3 0,3 g
• 15 min bei 121 °C autoklavieren
• im Wasserbad auf 80°C abkühlen lassen
• Medium mit 5% (50ml) sterilem defibriniertem Pferdeblut versetzen und gut
mischen
• auf ca. 50 °C abkühlen lassen

FLI 52
Amtliche Methodensammlung Stand: Mai 2013

MECA + A
→ Zugabe von Amphotericin B (C 47 H 73 NO 20 ), FW 960,1 5,0 mg
• gut mischen und in sterile Petrischalen gießen
(25 ml Medium pro 100 x 15 mm Platte)
• Platten in waagerechter Position erstarren lassen
Die Platten sind schokoladenbraun.

MECA+ AS
→ Herstellung wie MECA + A,
• jedoch zusätzlich Streptomycinsulfat (Menge: 0,2 g/l)
unter sterilen Bedingungen zugeben
(25 ml Medium pro 100 x 15 mm Platte)

MECA + CTA
→ Herstellung wie MECA + A,
• jedoch zusätzlich Trimethoprim (Menge: 1mg/l) und Clindamycin
(Menge: 5mg) sowie 50 ml lysiertes Pferdeblut
unter sterilen Bedingungen zugeben
(25 ml Medium pro 100 x 15 mm Platte)

7.3.3. Durchführung des Tests

Achtung: Alle Arbeiten mit Proben und Kulturen in einem Sicherheitslabor der
Klasse 2 ausführen!

Die Agarplatten nach folgender Methode beimpfen.


• Tupfer auf jeder der 3 o.g. MECA- Platten so ausstreichen, dass gut isolierte
Kulturen entstehen können

Alle inokulierten Medien (MECA- Platten) bei 35- 37°C, hoher Luftfeuchte und 5-10%
CO 2 inkubieren

Kolonien von T. equigenitalis erscheinen auf MECA+A und MECA+AS meist nach 48
h Inkubationszeit als sehr kleine stecknadelkopfgroße Kolonien, weiß, etwas grau
oder beige gefärbt. Die Größe kann von stecknadelkopfgroß bis 2 mm variieren.
Nach 72 h werden die Kolonien größer und klar und nach weiterer Inkubation werden
sie gelblich braun und wachsartig und können über die Agaroberfläche erhaben sein.
Kolonien auf MECA+CTA wachsen langsamer und sind etwas kleiner ansonsten
aber gleich den Kolonien auf den anderen Isolierungsmedien.
Eine längere Inkubationszeit kann bei Erstisolierung des Organismus notwendig sein.
Einige Isolate benötigten bis zu 13 Tage bevor ein Wachstum festgestellt werden
kann. Ein negatives Ergebnis sollte erst nach mindestens 7 Tagen (bis zu 14 Tagen)
Inkubationszeit festgestellt werden.

Verdächtige Kolonien von Platte entnehmen und Identifizierungstest durchführen wie


im weiteren beschrieben (siehe Flussdiagramm).
Wenn ein gemischtes Wachstum oder nur ganz geringes Wachstum der
verdächtigen Kolonie zu verzeichnen ist, dann erfolgt eine Subkultur auf einer

FLI 53
Amtliche Methodensammlung Stand: Mai 2013

modifizierten EUGON Schokoladenagarplatte (MECA+A), die für 48 bis 72 h inkubiert


wird, um ein ausreichendes Wachstum einer Reinkultur für die notwendigen weiteren
Tests zu ermöglichen.
Die verdächtigen Kolonien z. B. auf die Oxidase-, und Katalase- und Phosphatase-
reaktion sowie auf Beweglichkeit prüfen oder/und in der PCR untersuchen.

Tabelle: Zusammenfassung der wichtigsten kulturellen und biochemischen


Eigenschaften von T. equigenitalis T. asinigenitalis und Oligella urethralis

T. equigenitalis T. asinigenitalis Oligella urethralis


Wachstumsbedingungen 37°C, 5% CO 2 37°C, 5% CO 2 aerob, 37°C
aerobes Wachstum negativ negativ positiv
Gramverhalten gramnegativ gramnegativ gramnegativ
Oxidase positiv positiv positiv
Katalase positiv positiv positiv
Phosphatase positiv positiv negativ
Beweglichkeit unbeweglich unbeweglich unbeweglich
Mono-Tayl Agglutination positiv schwach positiv negativ
z.B. Wakeley-PCR HEX- kein CT- Wert f.HEX CT-HEX positiv kein CT- Wert
S
z.B. Wakeley- PCR FAM - CT- FAM positiv kein CT- Wert f. FAM kein CT- Wert
S

7.3.4. Interpretation der Ergebnisse


T. equigenitalis ist ein kleiner Gram-negativer kokkoider Bakterienorganismus. Das
Bakterium wächst nicht aerob auf Blutagar, ist unbeweglich und reagiert positiv im
Oxidase-, Phosphatase- und Katalasetest sowie im Monotayl Agglutination Test.
Zur Bestätigung von T.- equigenitalis verdächtigen Kolonien sollte generell ein für T.-
equigenitalis spezifischer PCR- Nachweis erfolgen, z.B. mittels realtime-PCR (z.B.
Wakeley et al., 2006).
Wenn ein Isolat die obengenannten Kriterien erfüllt (mind. PCR), wird eine positive
Diagnose für CEM gestellt.
Ein vom FLI zugelassener PCR-Kit (FLI-B 470) „cador T. equigenitalis PCR Kit“
(QIAGEN, Hilden) wurde vom Hersteller auch für die Verwendung, von aus
Tupferprobenmaterial isolierter DNA, validiert. Eine Freigabe einer aktuellen Charge
existiert allerdings gegenwärtig nicht.

Literatur
• OIE: Manuel of Standards for Diagnostics Tests and Vaccines
(http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.05.02_CEM.pdf)
• Richtlinie 92/65/EWG in der jeweils gültigen Fassung
• Verordnung über die Gewinnung, Abgabe und Verwendung von Samen, Eizellen
und Embryonen von Zuchttieren (Samenverordnung - SamEnV) vom 14.10.2008
in der jeweils gültigen Fassung
• Wakeley, P.R. et al (2006): Development of real time PCR for the detection of
Taylorella equigenitalis directly from genital swabs and discrimination from
Taylorella asinigenitalis, Veterinary Microbiology 118, 247- 254

FLI 54
Amtliche Methodensammlung Stand: Mai 2013

FLI 55
Amtliche Methodensammlung Stand: Mai 2013

8. Aujeszkysche Krankheit (AK)

8.1. Charakterisierung der Infektion


8.1.1. Erreger
Das Virus der Aujeszkyschen Krankheit (Synonym Pseudorabiesvirus, PrV) gehört
zur Familie der Herpesviridae, Subfamilie Alphaherpesvirinae, Genus Varicellovirus
und wird laut derzeit gültiger Taxonomie als Suid Herpesvirus 1 (SHV1) bezeichnet.
Das Wirtsspektrum umfasst nahezu alle Säugetierarten; wobei die Infektion in den
meisten Fällen tödlich verläuft; lediglich die Primaten und Einhufer weisen hohe
natürliche Resistenzen auf. Als Hauptreservoir ist das Hausschwein (aber auch
Schwarzwild) anzusehen, bei dem der Infektionsverlauf stark vom Lebensalter und
von der Virulenz des Erregers abhängt.

8.1.2. Klinische Symptomatik


Die Inkubationszeit liegt in der Regel zwischen 1 bis 8 Tagen, in Abhängigkeit von
der Infektionsdosis auch bis zu 3 Wochen. Die Pathogenität bzw. Virulenz des
Erregers und die unterschiedlichen pathogenetischen Eigenheiten bestimmen die
Krankheitserscheinungen bei den einzelnen Tierarten. Die klinischen Symptome
beim Schwein variieren in Abhängigkeit des Lebensalters, der Virulenz des Ak-Virus,
des Infektionsweges und -dosis. Bei juvenilen Tieren überwiegen durch
Meningoencephalitis und Virämie bestimmte Symptome Neugeborene Ferkel sterben
innerhalb kürzester Zeit oft ohne klinische Symptome. Saugferkel (2-3 Wochen)
zeigen schwere ZNS-Störungen in Form von Inkoordination, Zucken, Tremor,
Ruderbewegungen, Ataxie, Krämpfen und Paralysen mit einer fast 100% Mortalität.
Drei bis sechs Wochen alte Ferkel können zwar weiterhin neurologische Symptome
aufweisen, aber die Mortalität ist gewöhnlich reduziert.
Bei adulten Schweinen sind die klinischen Erscheinungen meist mild; innerhalb
weniger Tage tritt Rekonvaleszenz ein (stumme Durchseuchung). Das klinische Bild
wird vornehmlich durch respiratorische Symptome wie Husten, Schnauben, Dyspnoe
und Aspirationspneumonie geprägt. In Mastbetrieben kommt es infolge der
Sekundärinfektionen zu schweren katarrhalischen oder kruppösen Pneumonien.
Bei den übrigen Tierarten stehen ausschließlich durch den starken Neurotropismus
verursachte Symptome im Vordergrund (Reizungs-, Lähmungs-, vegetative
Schockform), die innerhalb weniger Stunden bis Tage zum Tod führen. Das
charakteristischste Symptom ist der akute Juckreiz (fehlt beim Schwein!), der zu
schweren Automutilationen führen kann. Oft zeigen sich auch perakute Verläufe
ohne jegliche Symptomatik

8.1.3. Differentialdiagnostik
Als Differentialdiagnose sind beim Schwein hauptsächlich Coli-Enterotoxikose,
Kochsalzvergiftung, ESP, ASP, Teschener Krankheit, sonstige
Meningoencephalitiden, Schweineinfluenza und Pasteurellose in Betracht zu ziehen.
Bei allen anderen Tierarten spielen die Tollwut und Vergiftungen die größte Rolle
(Mettenleiter et al. 2012. Herpesviruses (Aujeszky’s disease virus, porcine
cytomegalovirus, porcine lymphotropic herpesviruses, malignant catarrhal fever

FLI 56
Amtliche Methodensammlung Stand: Mai 2013

virus). In: Zimmerman J, Karriker L, Ramirez A, Schwartz K, Stevenson G (eds),


Diseases of Swine, 10th edition, 2012, John Wiley & Sons, 412-444).

8.1.4. Diagnostische Indikation


• Tierverkehr (Tierhandel, Ausstellungen)
• klinischer oder epidemiologisch begründeter Verdacht
• Untersuchungen im Zuge von Anerkennungsverfahren und zum Nachweis der
Seuchenfreiheit
• Quarantäne

8.1.5. Zuständige Untersuchungseinrichtungen


• Veterinäruntersuchungs-, Tiergesundheitsämter bzw. Staatliche Lebensmittel-
und Veterinäruntersuchungsämter der Bundesländer
• Friedrich-Loeffler-Institut, Bundesforschungsinstitut für Tiergesundheit, Institut
für Molekularbiologie, Südufer 10, 17493 Greifswald - Insel Riems (NRL für
Aujeszkysche Krankheit), Tel. 038351 1659.

8.1.6. Rechtsgrundlagen
• Verordnung zum Schutz gegen die Aujeszkysche Krankheit in der Fassung der
Bekanntmachung vom 20. Dezember 2005 (BGBl. I S. 3609), die durch Artikel
12 der Verordnung vom 13. Dezember 2011 (BGBl. I S. 2720) geändert worden
ist
• Richtlinie 64/432/EWG des Rates vom 26. Juni 1964 zur Regelung
viehseuchenrechtlicher Fragen beim innergemeinschaftlichen Handelsverkehr
mit Rindern und Schweinen/* KODIFIZIERTE FASSUNG CF 375Y0820(01) */
• ENTSCHEIDUNG DER KOMMISSION vom 23. Juli 2001 zur Festlegung
zusätzlicher Garantien für den innergemeinschaftlichen Handel mit Schweinen
hinsichtlich der Aujeszky-Krankheit und der Kriterien für die
Informationsübermittlung sowie zur Aufhebung der Entscheidungen 93/24/EWG
und 93/244/EWG

8.2. Untersuchungsmaterial

Untersuchungsmaterial Erregernachweis
Nasen-, Rachen- und Genitaltupfer; Organmaterial wie Gehirn, Lunge, Tonsille
(Menge: ca. 1 cm3) bei verendeten bzw. geschlachteten Tieren, bei Saugferkeln evtl.
auch Milz. Lagerung bei -20 °C, optimal bei -80 °C. Mehrfaches Einfrieren und
Auftauen führt zur drastischen Senkung des Virustiters und damit zu einer
Verminderung der Nachweisbarkeit in der Zellkultur.

Untersuchungsmaterial Antikörpernachweis
Nativblutproben, Seren; Menge: mindestens 500 µl

FLI 57
Amtliche Methodensammlung Stand: Mai 2013

8.3. Untersuchungsgang
8.3.1. Erregernachweis

Antigennachweis mittels direkter Immunfluoreszenz (IFT)


• Herstellung von Kryostatschnitten auf fettfreien Objektträgern,
• Fixierung der Kryostatschnitte in Azeton für 10 bis 15 min bei ca. -20 °C,
• Spülen in isotonischem Phosphatpuffer (IP) oder PBS, pH 7,2, für 5 min,
• Inkubation mit einem FITC-markiertem Anti-PrV Konjugat in
Arbeitsverdünnung bei 37 °C (Dauer nach Produktinformation des Herstellers
– derzeit kein FITC-markiertes Konjugat zugelassen, Ausnahmegenehmigung
möglich),
• dreimal Spülen in IP für insgesamt 10 min, kurzes Spülen in Aqua dest,
lufttrocknen,
• Eindecken der Präparate in IP-Glycerol (9/1)
• IF-Mikroskopie bei 200-facher Vergrößerung unter Mitführung von Positiv- und
Negativkontrollen

Virusisolierung in der Zellkultur


Das PrV vermehrt sich in Zellkulturen verschiedenster Herkunft mit
charakteristischem cythopathogenem Effekt (CPE); am geeignetsten sind African
Green Monkey (Vero)-Zellen.

Folgende Methode hat sich bewährt:

Virusisolierung
• Homogenisieren des Organmaterials, Herstellen einer Organsuspension (1:5
bis 1:10) unter Verwendung antibiotika- bzw. antimykotikahaltigen Mediums
(Anlage), Lagerung für 1 bis 2 h bei 4 °C im Kühlschrank, anschließende
Zentrifugation.
• Inokulation des Überstandes auf die entsprechende Zellkultur (z. B. Vero, ML
[mink lung]); zur Virusisolierung können 24-Lochplatten, Zellkulturröhrchen
oder Zellkulturflaschen verwendet werden, das Zellkulturmedium sollte zur
Verhinderung bakterieller Kontaminationen Antibiotika und Antimykotika in
gebräuchlichen Konzentrationen enthalten (Anlage), anschließende Bebrütung
bei 37 °C für mindestens 7 Tage.
• tägliche Kontrolle des Auftretens eines CPE (bei hohem Virusgehalt diffus
verteilte Zellabkugelungen nach ca. 1 bis 2 d, bei niedrigem Virusgehalt
Entstehung von Synzytien oder einzelnen Plaques)
• bei latenten Infektionen kann unter Umständen eine bis zu vierfache
Passagierung notwendig sein.

Identifizierung des Virus durch Immunfluoreszenz an Deckglaskulturen


• Abtrypsinieren der CPE-Zellkultur, mischen mit einer Negativpopulation (1:2),
• vorsichtiges Abspülen der Objektträger in isotonischem Phosphatpuffer (IP),
pH 7,2 (oder PBS),
• Auftragen der Zellen auf fett- und fluoreszenzfreie Objektträger, lufttrocknen,
• Fixierung in Azeton für 10 min bei Raumtemperatur (RT),

FLI 58
Amtliche Methodensammlung Stand: Mai 2013

• 5 min IP, RT,


• nach kurzem Lufttrocknen Einlegen der Deckgläser in eine feuchte Kammer,
• Beschicken mit FITC-markiertem Konjugat (direkter IFT) bzw. monoklonalem
Antikörper (indirekter IFT) (10 µl/Objektträger je nach Gebrauchsverdünnung)
die weitere Bearbeitung erfolgt unterschiedlich.

Direkter IFT
Inkubation mit FITC-markiertem Anti-PrV Konjugat in Gebrauchsverdünnung für 1 h
bei 37 °C (Gebrauchsverdünnung lt. Angaben des Herstellers)

Indirekter IFT
• Inkubation mit monoklonalem anti-PrV-Antikörper oder PrV-HIS vom Schwein
je nach Gebrauchsverdünnung für 1 h bei RT in feuchter Kammer
• zweimaliges kurzes Abspülen in IP und Einlegen in frischen Spülpuffer (IP) für
mindestens 5 min
• Inkubation mit FITC-markiertem anti-Maus IgG (Gebrauchsverdünnung lt.
Hersteller) für 1 h bei RT,
• zweimaliges kurzes Abspülen in IP und Einlegen in frischen Spülpuffer für
mindestens 10 min, kurzes Abspülen in Aqua dest., lufttrocknen,
• Präparate in noch leicht feuchtem Zustand auf fluoreszenzfreie Objektträger in
IP-Glycerol (9/1) eindecken.

Identifizierung durch Virusneutralisationstest (siehe NT)


• Inkubation des vermeintlichen PrV-Isolates in log 10-Verdünnungen mit einem
PrV-positiven and PrV-negativen Referenzserum vom Schwein für 2 h bei
37 °C,
• Inokulation des Virus-Serumgemisches auf 96-well Mikrotiterplatte
(Vierfachansatz) und anschließende Bebrütung für 2 bis 3 Tage bei 37 °C,
• Kontrolle der virusneutralisierenden Aktivität

Nachweis von PrV-DNA mittels Polymerasekettenrektion (PCR)


Die PCR kann zum Nachweis von PrV-DNA in Organproben sowie in Tupferproben
genutzt werden und kann vor allem beim Nachweis latenter AK-Infektionen von
Vorteil sein. Je nach Fragestellung sind in der Literatur verschiedene PCRs
(konventionelle und Realtime PCRs) für die Aujeszkysche Krankheit beschrieben.
Primer und die Amplifikationsparameter müssen entsprechend der Zielstellung
ausgewählt werden. Die PCR muss für die jeweiligen spezifischen Bedingungen
optimiert werden, um unter Routinebedingungen erfolgreich zu funktionieren. Der
hohe GC-Gehalt des PrV kann zu Schwierigkeiten führen. Grundregeln der
molekularen Diagnostik zur Vermeidung von Kreuzkontminationen sind zu beachten.
Die Verwendung von artifiziellen Positivkontrollen wird empfohlen.

Generelle Arbeitsschritte sind:


• Homogenisierung des zu untersuchenden Probenmaterials,
• Proteinase K-Verdau & anschließende DNA-Extraktion (Phenol-Chloroform-
Extraktion oder konventionelle DNA-Extraktionskits)
• Amplifikation
• Agarosegel-Elektrophorese (konventionelle PCRs) oder Analyse der ct-Werte
(Realtime PCRs)

FLI 59
Amtliche Methodensammlung Stand: Mai 2013

Am NRL für AK am FLI sind hochsensitive UL19-, gB- sowie gE-spezifische in-house
Realtime PCRs zum Nachweis viraler DNA etabliert, die sowohl als simplex oder
auch multiplex Realtime PCRs genutzt werden können. Die entsprechenden
Protokolle können über das NRL abgefragt.

8.3.2. Indirekter Erregernachweis

Enzyme Linked Immunosorbent Assay (ELISA)


Für die serologische Untersuchung zur Aufrechterhaltung des AK-freien Status sowie
im Verdachtsfall dürfen nur zugelassene ELISA-Tests verwendet werden [siehe Liste
der zugelassenen Mittel bzw. der freigegeben Chargen
(http://www.fli.bund.de/de/startseite/service/zulassungsstelle-des-fli.html)
Bezüglich der Durchführung der einzelnen ELISA-Tests wird auf die
Produktinformationen der Hersteller verwiesen

Serumneutralisationstest zur Antikörperbestimmung (SNT)


Mit dem SNT wird die spezifische und unspezifische virusneutralisierende Aktivität
eines Testserums gemessen.

Ausführung:
• Virusvermehrung aus Masterstockvirus (z. B. Laborstamm AK-64 oder Kaplan)
auf Vero-Zellen in Zellkulturflaschen (Dichte 100.000 Zellen/ml), Virusernte
nach ca. 24 bis 48 h (CPE sollte ca. 80 bis 90 % des Zellrasens erfasst haben)
• Titration des Arbeitsvirus auf Mikrotiterplatten (Vierfachansatz), Bestimmung
des Virustiters nach Kärber (nach 48 h), Arbeitsvirus aliquotieren in 1 ml
Portionen, Lagerung bei -80 °C
• Einstellen der Virussuspension auf 200 KID 50 /0,1ml
• Serum von Nativblutproben (keine EDTA-Plasmaproben); Inaktivierung in
Mediumverdünnung (1:2) für 30 Minuten bei 56 °C
• Serumverdünnung der Test- und Referenzseren (Positiv- Negativserum) in
lg2-Schritten in Mikrotiterplatte oder Röhrchen (100 µl)
• Zugabe eines äquivalenten Volumens (100 µl) der Virussuspension (200
KID 50 /0,1ml), Inkubation für 2 h bei 37 °C (Inkubation für 24 h erhöht die
Sensitivität des Tests)
• Inokulation eines 1 d alten Monolayers (Vero-Zellen, Dichte ca. 105 Zellen/ml),
bei dieser Zellkonzentration soll sich nach einem Tag ein fast konfluenter
Monolayer ausgebildet haben)
• Virusrücktitrierung in lg2 Stufen (Vierfachansatz) auf einer Testplatte
• Platten für 3 Tage bei 37 °C inkubieren
• mikroskopische Ablesung des Tests, Bestimmung des Ak-Titers nach Kärber
(Grenzwert = 1:4).

Literatur
OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2012, Chapter
2.1.2, Aujeszk’s disease
(http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.01.02_AUJESZKYS
_DIS.pdf)

FLI 60
Amtliche Methodensammlung Stand: Mai 2013

Anhang

Zelllinien
Virusisolierung: Vero 76:
VNT
Katalognummer: 228
Bezugsquelle: Zellbank für Zelllinien in der Veterinärmedizin am FLI, Institut
für Infektionsmedizin, Insel Riems, Dr. Riebe

Medien
Medien für Zelllinie Vero 76:
Anzuchtmedium:
• 89 % Eagle MEM Dulbecco w/L-Glut
• 10 % Fetales Kälberserum (FKS)
• 1 % Antibiotika

Antibiotika:
• Amphotericin B (250 µg/ml)
• Penicillin (100.000 IE/l), Streptomycin (100 mg/l) oder Gentamycin
(50mg/ml)

Erhaltungsmedium:
• 96 % Eagle MEM Dulbecco w/L-Glut
• 3 % FKS
• 1 % Antibiotika

Puffer, Lösungen, Reagenzien

PBS: 8,00g NaCl + 0,2g KH 2 PO 4 + 2,9g Na 2 HPO 4 x 12 H 2 0 + 0,2g KCl ad


1.000 ml Aqua bidest, pH 7,2
Isotonischer 8,28g NaCl + 3,30g Na 2 HPO 4 x 12 H 2 0 ad 1.000 ml Aqua bidest
Phosphatpuffer:
(IP) pH 7,8
IP-Glycerol: IP - Glycerol = 9 : 1
Anti-PrV-Konjugat: FITC-markiertes Anti-PrV-Konjugat

FLI 61
Amtliche Methodensammlung Stand: Mai 2013

9. Aviäre Influenza

9.1. Charakterisierung der Infektion


`Geflügelpest' ist ein historischer Krankheitsbegriff, der im englischen Sprachraum in
den letzten Jahren generell durch ‚avian influenza' (aviäre Influenza) ersetzt wurde.
Infektionen mit aviären Influenzaviren variieren, abhängig vom viralen Sub- bzw.
Pathotyp sowie wirtsspezifischen Faktoren, stark in der Schwere der Erkrankung.
Neben inapparenten Formen sind perakute Verlaufsformen mit bis zu 100 %
Mortalität möglich. Ausschlaggebend dafür ist vor allem die Virulenz des
Erregerstammes. Der Begriff `Geflügelpest' beinhaltet nur die schweren,
anzeigepflichtigen Verlaufsformen der aviären Influenza, hervorgerufen durch
hochpathogene Virusstämme, die sich bislang ausschließlich aus den Subtypen H5
und H7 rekrutiert haben. Alle Infektionen des Hausgeflügels mit aviären
Influenzaviren der Subtypen H5 und H7, also auch solche mit Stämmen niedriger
Pathogenität, sind gemäß geltendem EU-Recht bekämpfungspflichtig.

9.1.1. Erreger
Influenzaviren gehören zur Familie Orthomyxoviridae. Es sind umhüllte RNA-Viren,
die aufgrund der Antigenität ihrer Nukleo- und Matrixproteine in die Typen A, B und C
und, im Falle des Typs A, nach den Hüllantigenen Hämagglutinin (H) und
Neuraminidase (N) in Subtypen unterteilt werden. Sie zeigen eine große antigene
Vielgestaltigkeit und Wandlungsfähigkeit und ein breites Virulenzspektrum. Die von
Vögeln isolierten Influenzaviren gehören ausnahmslos zum Typ A und umfassen
derzeit mindestens 16 H- und 9 N-Subtypen in (theoretisch) 144 Kombinationen.
Reservoir aller dieser Subtypen sind aquatisch lebende Wildvögel. Ein 17. HA Subtyp
wurde bislang nur bei Fledermäusen in Mittelamerika detektiert.

Alle bisher isolierten hochpathogenen aviären Influenzaviren (HPAIV) - Erreger der


Geflügelpest - gehörten zum Subtyp H5 oder H7. Es gibt jedoch auch H5- und H7-
Virusisolate von niedriger Pathogenität (engl. `low pathogenic avian influenza
viruses', LPAIV). Letztere haben die Potenz zu einer sprunghaften
Pathogenitätssteigerung und sind als potentielle Erreger der Geflügelpest
anzusehen. Entscheidend für ihre Einstufung gemäß Tierseuchenrecht ist hierbei
einerseits das Verhalten im Versuchshuhn (Bestimmung des intravenösen
Pathogenitätsindex, IVPI) sowie – gleichrangig - andererseits die
Aminosäuresequenz im Bereich der endoproteolytischen Schnittstelle des
Hämagglutinins (monobasisch versus polybasisch). Isolate mit einem IVPI > 1.2
werden als hochpathogen bewertet, solche mit Indices < 1.2 sind niedrig-pathogen.
Alternativ hierzu werden Isolate mit monobasischer Schnittstelle definitionsgemäß als
niedrig-pathogen bewertet; solche mit polybasischer Schnittstelle sind als
hochpathogen einzustufen. Alle H5- und H7-Viren werden aufgrund ihrer Bedeutung
in der OIE-Klassifizierung als „notifiable avian influenza = NAI“ bezeichnet.

FLI 62
Amtliche Methodensammlung Stand: Mai 2013

9.1.2. Klinische Symptomatik


Vermutlich sind alle Vogelspezies empfänglich für eine Influenzavirusinfektion; bei
Wildvögeln treten jedoch nur selten Erkrankungen auf. Auch die Hausgeflügelarten
erkranken nicht einheitlich. Hochempfänglich sind Hühnervögel, vor allem Puten und
Hühner; bei ihnen kann die Mortalität nach Infektionen mit HPAIV bis 100 %
betragen. Puten zeigen nicht selten auch bei Infektionen mit LPAIV klinische
Symptome.

Abbildung 1: Pekingente mit


zentralnervösen Störungen
(Inkoordination, Lähmungen) nach
Infektion mit HPAIV H5N1 (Dr. Werner,
FLI)

Die Hauptsymptome der durch HPAIV ausgelösten Geflügelpest sind Rückgang des
Futterverbrauchs, Apathie, Atemnot, Ödeme der Kopfregion, Zyanose und Ödeme
der Kopfanhänge, Durchfall, hohe Mortalität, bei Legetieren Einbruch der
Eiproduktion. Oft sterben die Tiere auch ohne vorherige klinische Symptome. Bei der
Sektion können gelegentlich Hämorrhagien auf den Serosen (Abb. 2), im
Drüsenmagen u. a. Organen, Pankreasveränderungen (Abb. 3) sowie bei Legetieren
hämorrhagische Eierstockentzündung und Dotterperitonitis beobachtet werden.
Weder klinisches Bild noch Sektionsbefund sind pathognomonisch.

Abbildung 2: Subepikardiale petechiale


Blutungen (Prof. Dr. Teifke, Institut für
Infektionsmedizin, FLI)

FLI 63
Amtliche Methodensammlung Stand: Mai 2013

Abbildung 3: Umschriebene
Pankreasnekrosen (Prof. Dr. Teifke,
Institut für Infektionsmedizin, FLI)

9.1.3. Differentialdiagnostik
Bei plötzlichem Auftreten einer schweren Allgemeinerkrankung des Geflügels mit
hoher Morbidität und Mortalität ist immer auch an Geflügelpest zu denken.
Differentialdiagnostisch sind u. a. Newcastle Krankheit (engl. `Newcastle Disease',
ND), Geflügelcholera und akute Vergiftungen abzuklären. Im Verdachtsfall (Meldung
beim zuständigen Veterinäramt) sind Proben nach Maßgaben des EU-Handbuchs
zur Diagnostik der aviären Influenza (Entscheidung 2006/437/EU) zu entnehmen,
wobei frisch verendete oder moribunde Tiere sowie Tupfer- und Blutproben im
zuständigen Staatlichen Veterinäruntersuchungsamt zu untersuchen sind. Hierzu
wird empfohlen von 40 Tieren sogenannte „kombinierte“ Tupfer zu entnehmen:
Zunächst wird dem zu beprobenden lebenden Tier ein oropharyngealer (bei
verendeten Tieren ein trachealer) Tupfer entnommen; mit demselben Tupfer wird
dann die Kloake des gleichen Tieres beprobt. Weiterhin sind nicht-
gerinnungsgehemmte Blutproben zur Serumgewinnung von weiteren 20 Tieren zu
entnehmen.

Kriterien, die den Verdachtsfall rechtfertigen, schildert u. a. §4 der bundesdeutschen


Geflügelpestverordnung.

Für die Diagnose sind die Virusisolierung oder der molekular-diagnostische


Genomnachweis und die Bestimmung der Pathogenität des Erregers mittels
Tierversuch oder molekular-diagnostischer Verfahren erforderlich.

In der Richtlinie 2005/94/EG vom 20. Dezember 2005, auf die sich die
bundesdeutsche Geflügelpest-Verordnung vom 18.10.2007 bezieht, ist für die
diagnostischen Verfahren zur Bestätigung und Differentialdiagnose der Geflügelpest
sinngemäß folgende Definition gegeben:

„Die Geflügelpest ist eine Infektionskrankheit, die von einem Influenza-A-Virus mit
einem intravenösen Pathogenitätsindex (IVPI) in sechs Wochen alten Hühnern von
1,2 oder mehr verursacht wird bzw. eine Influenza-A-Infektion der Virussubtypen H5
und H7, bei der im Rahmen einer Nukleotid-Sequenzanalyse das Vorhandensein
multipler basischer Aminosäuren im Spaltbereich des Hämagglutinins nachgewiesen
wurde.“

FLI 64
Amtliche Methodensammlung Stand: Mai 2013

Die oben genannten Rechtssetzungen legen in Übereinstimmung mit den


Regelungen des OIE darüber hinaus fest, dass Infektionen des Hausgeflügels mit
allen Viren vom Subtyp H5 und H7 (NAI), unabhängig vom jeweiligen Pathotyp, zu
maßregeln sind. Weiterhin führen Nachweise des HPAIV H5N1 asiatischer Herkunft
bei Wildvögeln ebenfalls zu weitreichenden Bekämpfungsmaßnahmen.

9.1.4. Diagnostische Indikation


An Geflügelpest muss generell bei schwerer Allgemeinerkrankung mit hoher
Morbidität und Mortalität insbesondere in gegen ND geimpften Geflügelbeständen
gedacht werden.
Die Geflügelpest-VO legt fest, ab welchen Verlustraten und bei welchen
Veränderungen eine Untersuchung auf Geflügelpest (Ausschlussdiagnostik)
unverzichtbar ist.

9.1.5. Zuständige Untersuchungseinrichtungen


• Staatlich autorisierte Veterinäruntersuchungsämter bzw. Staatliche
Lebensmittel- und Veterinäruntersuchungsämter der Bundesländer
• FLI, Institut für Virusdiagnostik, 17493 Greifswald-Insel Riems (O.I.E. und
Nationales Referenzlabor für aviäre Influenza), Tel. 038351/70.

9.1.6. Rechtsgrundlagen
• Richtlinie 2005/94/EG vom 20. Dezember 2005
• Diagnostikhandbuch der EU für Aviäre Influenza gem. Entscheidung
2006/437/EG vom 4. August 2006
• Verordnung zum Schutz gegen die Geflügelpest (Geflügelpest-VO) in der jeweils
gültigen Fassung
• Verordnung über anzeigepflichtige Tierseuchen in der jeweils gültigen Fassung

9.2. Untersuchungsmaterial
9.2.1. Erregernachweis
Kloakenabstriche oder Fäzes und Abstriche aus dem Oropharynx von lebenden
Vögeln. Fäzes oder Darminhalt, Hirngewebe, Luftröhre, Lunge, Niere, Milz, Leber
sowie andere Organe kürzlich verendeter oder getöteter Tiere.
Fäkalmaterial ist von anderen Proben getrennt zu halten.
Alle Probenmaterialien sollten während des Transportes gekühlt werden. Abstriche
sollten ganz in ein Stabilisierungsmedium (antibiotisch, proteinhaltig) eingetaucht
werden.

9.2.2. Antikörpernachweis
Blutproben, von denen Heparin-Plasma oder nach Gerinnung das Serum für die
Untersuchung gewonnen wird.
Anstelle von Serum kann auch Eidotter aufbereitet und untersucht werden.

FLI 65
Amtliche Methodensammlung Stand: Mai 2013

Die jeweils zu entnehmenden Stichprobengrößen regelt das Diagnostikhandbuch der


EU im Detail.

9.3. Untersuchungsgang

Siehe Abbildung 4

Abbildung 4: Untersuchungsgang zum direkten Erregernachweis bei Geflügelpest gem. EU-


Diagnostikhandbuch, modifiziert durch NRL

FLI 66
Amtliche Methodensammlung Stand: Mai 2013

9.3.1. Direkter Erregernachweis

Probenaufbereitung
Organe und Gewebe können gepoolt werden, nur Fäkalmaterial ist gesondert zu
behandeln. Abstriche sollten ganz in antibiotisches Medium getaucht werden. Fäzes
und Organe sind in antibiotischem Medium im geschlossenen Homogenisator zu
zerkleinern (Sicherheitsvorkehrungen zur Vermeidung von Aerosolen sind zu
beachten), um eine 10- bis 20%ige Suspension herzustellen.
Zur Entfaltung der antibiotischen Wirkung sind die Suspensionen für mindestens 30
Minuten bei Umgebungstemperatur (bei 4 °C entsprechend länger) stehen zu lassen
und danach durch Zentrifugieren zu klären (z. B. 800 bis 1000 g für 10 Minuten).

Virusisolierung in embryonierten Hühnereiern


Pro Probe sind mindestens 4 embryonierte, 8 bis 10 Tage vorbebrütete Hühnereier
mit je 0,1 bis 0,2 ml des geklärten Überstandes in die Allantoishöhle zu beimpfen. Die
Eier sollten aus einer spezifiziert pathogenfreien (SPF) Herde stammen; im Notfall
können auch Eier aus einem Bestand verwendet werden, der nachweislich frei von
Influenza-Antikörpern ist.
Die beimpften Eier werden bei 37,0 °C bis 37,8 °C weiterbebrütet und täglich
durchleuchtet. Eier mit toten oder absterbenden Embryonen sind auf 4 °C
abzukühlen, ebenso alle verbliebenen Eier 5 Tage nach der Beimpfung. Die
Allantois- und Amnionflüssigkeiten (AAF) sind auf Hämagglutination zu untersuchen.
Lässt sich keine Hämagglutination feststellen, wird die unverdünnte AAF erneut auf
Eier verimpft (2. Eipassage).
Wird Hämagglutination festgestellt, so muss eine bakterielle Kontamination
ausgeschlossen werden. Sind Bakterien vorhanden, so können die AAF durch 450
nm-Membranfilter gegeben werden und nach Zugabe weiterer Antibiotika erneut auf
embryonierte Eier verimpft werden.
Zellkulturen sind wegen ihrer geringeren Sensitivität für die Isolierung von
Influenzavirus derzeit ungeeignet.

Antigen-Schnelltest
Für den Nachweis von Influenzavirusantigen binnen 20 bis 40 Minuten wird eine
Reihe von konfektionierten Testbestecken kommerziell angeboten.
Diese Tests zeichnen sich durch eine sehr einfache Handhabung aus und wären
daher auch durch Laien und direkt im Stallbereich anwendbar.

Derzeit liegen jedoch nur begrenzte Erfahrungen im Umgang mit diesen Tests im
Felde vor. Aus experimentellen Untersuchungen, u. a. im NRL, wurde jedoch eine
gegenüber der Virusisolierung und den PCR-Nachweisverfahren deutlich verminderte
Sensitivität dieser Tests erkennbar. Somit sind diese Tests nicht für eine
Ausschlussdiagnostik am Einzeltier einsetzbar, da ein negatives Ergebnis das
Vorhandensein anzeigepflichtiger Influenzaviren des Typs A nicht sicher ausschließt.
Diese Tests (auch wenn eine Zulassung des FLI vorliegt) können also derzeit
bestenfalls für eine (nicht-amtliche!) grob orientierende Voruntersuchung eingesetzt
werden und ersetzen niemals Untersuchungen mittels Virusisolierung oder RT-PCR.

FLI 67
Amtliche Methodensammlung Stand: Mai 2013

Nachweis viraler RNA mittels RT-PCR


Aus Kloaken- und Rachentupferproben und aus Organ- und Fäzesmaterial kann
virale RNA mittels RT-PCR oder real-time RT-PCR (RT-qPCR) nachgewiesen
werden. Der RT-qPCR ist aufgrund ihrer höheren Sensitivität und des geringeren
Kontaminationsrisikos der Vorzug zu geben. Die PCR kann vor der Virusisolierung,
parallel dazu oder als Bestätigungstest (z. B. virushaltige AAF) eingesetzt werden.
Für den Ja-/Nein-Nachweis von Influenza A-Virus-RNA wird eine RT-qPCR
durchgeführt, die ein Fragment des Matrixprotein-Gens amplifiziert. Darüber hinaus
werden RT-qPCR-Teste zum subtypspezifischen Nachweis von H5-, H7- und N1-AIV
eingesetzt. Die durch das Referenzlabor der EU derzeit validierten Methoden sind
dem Diagnostikhandbuch der EU zu entnehmen oder können im Nationalen
Referenzlabor (NRL) abgefragt werden. Gegenüber den Angaben des
Diagnostikhandbuchs werden im NRL erweiterte RT-qPCR-Methoden eingesetzt
(Abb. 1), die auch den Einsatz einer internen Kontrolle zum Ausschluss falsch-
negativer Befunde durch PCR-Inhibitionen beinhalten. Methodik und
Referenzmaterial können im NRL abgefordert werden.

Kommerziell erhältliche Diagnostika:


FLI-zugelassene PCR-Kits zum Nachweis von RNA aviärer Influenzaviren

VIROTYPE Influenza A Labor Diagnostik FLI-B 538


Real-time RT-PCR Testkit zum Nachweis des Leipzig
Influenza A-Virus
Kurzform: VIROTYPE Influenza A

ACHTUNG!
Wurde ein Influenzavirus der Subtypen H5 oder H7 bei Hausgeflügel nachgewiesen,
ist die Probe zusammen mit einem Aliquot der extrahierten RNA bzw. das Isolat
sofort zur weiteren Charakterisierung an das Nationale Referenzlabor für aviäre
Influenza im FLI, Insel Riems weiterzuleiten.

Tabelle 1: Zu kalkulierende Dauer der diagnostischen Methoden zum Nachweis


und zur Charakterisierung aviärer Influenzaviren

Methodik Dauer
PCR mit Ergebnis Influenza Ja/Nein 1 Tag
PCR mit Ergebnis AIV H5 oder H7 sowie rRT- Pathotypisierung 1-3 Tage
(H5);
Pathotypisierung mittels Nukleotidsequenzierung 2-4 Tage
Virusanzucht und H-Subtypisierung (Verdacht HPAIV) 3-6 Tage

Aussagen zur Pathogenität mittels Tierversuch (Bestätigung 14 Tage


HPAIV)
Ausschluss Geflügelpest mittels klassischer Methodik 21 Tage
(Nachweis von Influenzavirus mit IVPI < 1.2) bzw. Ausschluss AIV
(fortgesetzte Passagierung mit negativem Ergebnis)

FLI 68
Amtliche Methodensammlung Stand: Mai 2013

9.3.2. Indirekter Erregernachweis


Zur allgemeinen Voruntersuchung auf Antikörper gegen eine Influenza-A-
Virusinfektion sind vor allem ELISA Tests geeignet, bei denen Antikörper
nachgewiesen werden, die gegen die gruppenspezifischen Antigene gerichtet sind.
Die Anwendung kommerzieller ELISA-Kits erfolgt nach den Empfehlungen des
Herstellers. Hierbei ist auf das Vorliegen einer Zulassung für amtliche
Untersuchungen der einzusetzenden Tests durch das FLI zu achten.
Im Falle positiver Reaktionen müssen die Antikörper mittels HAHT subtypisiert
werden; hierbei sind zumindest Antikörper gegen die Subtypen H5 und H7
auszuschließen. Gezielte Untersuchungen auf Antikörper gegen Influenzavirus vom
Subtyp H5 oder H7 oder einen anderen H-Subtyp können mit dem HAHT unter
Einsatz des H-Subtyp-spezifischen Antigens erfolgen. HAHT-Untersuchungen des
EU-kofinanzierten Hausgeflügelmonitorings sind mit den durch das Referenzlabor
der EU vorgeschriebenen Antigenen durchzuführen. Aliquots dieser Antigene können
gebührenfrei beim NRL-AI des FLI abgerufen werden. HAHT Untersuchungen im
Rahmen anderer Programme, insbesondere gebührenpflichtige Untersuchungen,
führen die Untersuchungseinrichtungen mit kommerziell bezogenen oder selbst
hergestellten Antigenen ihrer Wahl durch.

Kommerziell erhältliche Diagnostika:


FLI-zugelassene ELISA-Kits zum Nachweis von Antikörpern gegen aviäre
Influenzaviren

Avian Influenza Virus Antibody Test Kit BioChek BFAV-B 361


Kurzform: AI ELISA
Avian Influenza Virus Multispezies Antikörper BioChek FLI-B 472
Testkit
Kurzform: AI MSp ELISA
Testkit zum Nachweis von Antikörpern gegen das IDEXX BGVV-B 219
Virus der Aviären Influenza
Kurzform: FlockChek AI
Testkit zum Nachweis von Antikörpern gegen das IDEXX FLI-B 444
Virus der Aviären Influenza, ELISA (MultiS-Screen)
Kurzform: FlockChek AI MultiS-Screen
ID Screen Influenza A Antibody Competition ID Vet FLI-B 438
Kurzform: FLUAcA
FluDETECT BE Synbiotics FLI-B 488
Kurzform: ASFLU1
FLOCKTYPE recAIV Screening, ELISA-Testkit zum Labor Diagnostik FLI-B 435
Nachweis von Antikörpern gegen das Virus der Leipzig
Aviären Influenza in Huhn und Pute
Kurzform: FLOCKTYPE recAIV Screening
IDScreen Influenza H5 antibody Competition. ID Vet FLI-B 506
Kurzform: FLUACH5

FLI 69
Amtliche Methodensammlung Stand: Mai 2013

10. Befall mit dem Kleinen Beutenkäfer


(Aethina tumida)

10.1. Charakterisierung des Befalls


10.1.1. Erreger
Der Kleine Beutenkäfer, Aethina tumida Murray, Coleoptera: Nitidulidae (Murray
1867), kommt natürlich in Afrika südlich der Sahara vor. Der Käfer hat sich
inzwischen durch Importe von Bienen auf andere Kontinente ausgebreitet. Der Käfer
sucht seine Wirte, die Bienenvölker, zur Vermehrung auf. Nach der Verpaarung im
Bienenvolk werden die Eier in unregelmäßigen Gelegen bevorzugt in Spalten der
Beuten oder in Waben, die Pollen und Brut enthalten, abgelegt. Nach zwei bis sechs
Tagen schlüpfen die Larven und beginnen zu fressen. Nach zehn bis 29 Tagen
haben die Larven ihr Wachstum abgeschlossen und sind ca. zehn bis zwölf
Zentimeter lang. Die Larven wandern nun durch den Stockeingang und bohren sich
meist in unmittelbarer Nähe des befallenen Volkes in den Boden. Sie können aber
auch größere Entfernungen zurücklegen. Im Boden bauen sie glattwandige
Erdzellen, in denen sie sich verpuppen. Die Verpuppung dauert je nach Temperatur
und Feuchtigkeit drei bis vier Wochen. Danach schlüpfen die ausgewachsenen Käfer
und suchen neue Beuten mit Bienenvölkern auf. Damit ist der Lebenszyklus des
Kleinen Beutenkäfers abgeschlossen.

Abbildung 1

Abbildung 2 Abbildung 3

Abbildungen 1 bis 3: Entwicklung des Kleinen Beutenkäfers: Larve (Wanderlarve), Puppe und Adultus

FLI 70
Amtliche Methodensammlung Stand: Mai 2013

10.1.2. Klinische Symptomatik


Der Käfer lebt und vermehrt sich hauptsächlich in Bienenvölkern und gelagerten
Bienenprodukten, z. B. Waben, kann sich jedoch auch auf Obst fortpflanzen. Die
Larven fressen Honig, Pollen und Brut und zerstören dabei nicht nur die Waben,
sondern verderben auch den Honig. Leicht befallene Waben zeigen Fressgänge der
Larven, sowie Verschleimung des Honigs. Stark befallene Waben zerfallen. Am
Beutenboden verbleibt bei starkem Befall häufig nur ein schwärzlich trockenes Mehl
(Fraßmehl) aus dem Kot der Larven und zerstörtem Wachs. Sind Honigwaben
befallen, so läuft der vergorene, schleimige Honig aus den Waben auf den
Beutenboden und aus dem Flugloch. Es entsteht fauliger Geruch.

10.1.3. Differentialdiagnostik
Der Kleine Beutenkäfer kann z. B. mit dem nahe verwandten Glanzkäfer, Cychramus
luteus, der ebenfalls in Bienenvölkern vorkommenden kann, leicht verwechselt
werden. Die Eier des Kleinen Beutenkäfers sind mit im Mittel 1,4 × 0,26 mm etwa um
ein Drittel kleiner als Eier der Honigbiene. Käferlarven können von
Wachsmottenlarven anhand ihrer morphologischen Merkmale leicht unterschieden
werden: Wachsmottenlarven haben Bauchfüße am 3. und 6. Hinterleibssegment,
Käferlarven besitzen sechs voll ausgebildete Beine in unmittelbarer Nähe des Kopfes
und dorsale Stachelreihen (Abbildung 1).

10.1.4. Diagnostische Indikation


• Tierverkehr
• klinischer oder epidemiologischer Verdacht
• Untersuchungen im Rahmen des Nachweises der Seuchenfreiheit
(Gesundheitszeugnisse für das Verbringen der Bienenvölker an einen anderen
Standort)

10.1.5. Zuständige Untersuchungseinrichtungen


• Veterinäruntersuchungsämter, Tiergesundheitsämter bzw. Staatliche
Lebensmittel- und Veterinäruntersuchungsämter der Bundesländer
• Chemisches und Veterinäruntersuchungsamt Freiburg, Tierhygiene, Am
Moosweiher 2, 79108 Freiburg (Referenzlabor für Bienenkrankheiten des
OIE), Tel.: 0761/1502175
• Friedrich-Loeffler-Institut, Bundesforschungsinstitut für Tiergesundheit,
Südufer 10, 17493 Greifswald – Insel Riems (NRL für Bienenkrankheiten),
Tel.: 038351/71246

10.1.6. Rechtsgrundlagen
Bienenseuchenverordnung vom 24.11.95 (BGBl. I S. 1552), in der jeweils geltenden
Fassung.

FLI 71
Amtliche Methodensammlung Stand: Mai 2013

10.2. Untersuchungsmaterial

Zur Untersuchung bieten sich der adulte Käfer, die Larven, der Beutenboden
(Bodeneinlagen), und die Waben bzw. Honigwaben an.

1. Untersuchungsmaterial Gemülle
Eine einfache Methode zur Diagnose des Kleinen Beutenkäfers besteht in der
Untersuchung des Beutenbodens. Bei starkem Befall trockener Waben (Pollen
und/oder Brut) verbleibt häufig nur noch ein schwärzliches trockenes Pulver
(Fraßmehl) aus dem Kot der Larven und zerstörtem Wachs, das sich auf dem Boden
der Beute anhäuft. In diesem Pulver können sich die Larven oder Käfer verstecken.
So kann der Beuteboden direkt makroskopisch auf vorhandene Käfer oder Larven
untersucht werden.

2. Untersuchungsmaterial Waben
Durch das Fressen und Kotabsetzen der Larven des kleinen Beutenkäfers werden
die Honigwaben stark beschädigt und bekommen ein „schleimiges“ Aussehen. Der
Honig ist verdorben und unbrauchbar. Leere Waben und Brutwaben weisen
Fraßgänge der Larven auf.

3. Untersuchungsmaterial aus Käferfallen


Die Käfer verstecken sich vor Licht oder den attackierenden Bienen meist in Spalten
und Ritzen, bevorzugt in der Nähe des Bodenbretts. Man kann daher am
Beutenboden Käferfallen auslegen. Diese können im einfachsten Fall aus einem
Stück Wellpappe bestehen, unter dem sich die Käfer sammeln. Effektiver kann man
die Käfer in einem am Beutenboden ausgelegten Diagnose-Streifen fangen
(Kunststoff-Doppelstegplatte: 0,4 × 7,5 × 50 cm).

10.3. Untersuchungsgang

1. Identifizierung der adulten Käfer und Larven


Die Bestimmung des Käfers und Larven erfolgt aufgrund ihres Aussehens und der
morphologischen Besonderheiten. Weiteres hierzu siehe in der Broschüre des
Bundesministeriums für Verbraucherschutz, Ernährung und Landwirtschaft „Der
kleine Beutenkäfer“ Erkennen und Bekämpfen. Als Vergleichsmaterial dienen
abgestorbene Käfer bzw. Larven.

2. Molekularbiologische Methoden: PCR


Molekulargenetische Methoden werden in Kürze angeboten.

3. Serologische Tests
Antiseren sind zurzeit nicht käuflich zu erwerben.

FLI 72
Amtliche Methodensammlung Stand: Mai 2013

11. Befall mit der Tropilaelaps-Milbe

11.1. Charakterisierung der Infektion


11.1.1. Erreger
Tropilaelaps-Milben sind braun-rot gefärbte, längliche Parasiten mit einer Größe von
0,7 bis 1 mm (Abbildung 1). Sie können sich sehr schnell auf den Waben der
Honigbienen fortbewegen. Bis zu zwei Tagen halten sie sich auf erwachsenen
Bienen auf (phoretische Phase). Dort parasitieren sie nicht, da sie im Gegensatz zu
Varroa-Milben den Chitinpanzer der Bienen nicht durchstechen können. Die
Milbenweibchen (bis zu einem Dutzend pro Zelle) legen kurz vor der Deckelung 1 bis
4 Eier in die Brutzellen der Bienen. Die Milbenentwicklung dauert ca. eine Woche,
danach verlassen die ausgewachsenen Milben einschließlich des Gründerweibchens
mit der schlüpfenden Biene die Zelle.

Abbildung 1:
Von Tropilaelaps-Milben befallene
Bienenbrut (Puppe)

11.1.2. Klinische Symptomatik


Bienen mit verkürztem Abdomen und missgebildeten Flügeln, sowie missgebildeten
oder fehlenden Gliedmaßen können ein Anzeichen für den Befall mit Tropilaelaps-
Milben sein. Brutwaben weisen ähnlich wie bei einem Befall mit Varroa-Milben tote
Brut mit eingesunkenem oder teilweise entferntem Zelldeckel auf.

11.1.3. Differentialdiagnostik
Die Differentialdiagnose mit Varroamilben (Varroa destructor) oder Bienenläusen
(Braula coccea) ist leicht visuell oder makroskopisch mit einer schwachen Lupe
(vierfache Vergrößerung) möglich. Eine genauere Abgrenzung hinsichtlich der
morphologischen Merkmale ist bei Pollenmilben und anderen auf den Waben
laufenden Milben notwendig.

FLI 73
Amtliche Methodensammlung Stand: Mai 2013

11.1.4. Diagnostische Indikation


• Tierverkehr
• klinischer oder epidemiologischer Verdacht
• Untersuchungen im Rahmen des Nachweises der Seuchenfreiheit
(Gesundheitszeugnisse für das Verbringen der Bienenvölker an einen anderen
Standort)

11.1.5. Zuständige Untersuchungseinrichtungen


• Veterinäruntersuchungsämter, Tiergesundheitsämter bzw. Staatliche
Lebensmittel- und Veterinäruntersuchungsämter der Bundesländer oder die
von den Ländern beauftragten staatlichen Einrichtungen
• Chemisches und Veterinäruntersuchungsamt Freiburg, Tierhygiene, Am
Moosweiher 2, 79108 Freiburg (Referenzlabor für Bienenkrankheiten des
OIE), Tel.: 0761/1502175
• Friedrich-Loeffler-Institut, Bundesforschungsinstitut für Tiergesundheit,
Südufer 10, 17493 Greifswald – Insel Riems (NRL für Bienenkrankheiten),
Tel.: 038351/71246

11.1.6. Rechtsgrundlagen
Bienenseuchenverordnung vom 24.11.95 (BGBl. I S. 1552) in der jeweils geltenden
Fassung.

11.2. Untersuchungsmaterial
Um einen Befall in einem Volk zu erkennen, müssen die Proben gezielt gesammelt
und entnommen werden.

1. Untersuchungsmaterial Gemülle
Eine einfache Methode zur Diagnose des Befalls mit Tropilaelaps-Milben besteht in
der Untersuchung von dem im Bienenvolk gewonnenen Gemülle, das auf einer am
Boden der Beute eingelegten Einlage gesammelt wird. Die Bodeneinlagen sollten
nicht länger als zwei Tage im Volk liegen, da die Milben sonst von Ameisen entfernt
werden könnten. Es kann von Vorteil sein, die Bodeneinlagen mit Vaseline oder
Melkfett zu bestreichen, damit die Milben darin haften.

2. Untersuchungsmaterial Bienenbrut
Für die Diagnose des Befalls der Brut mit Tropilaelaps-Milben kann nur gedeckelte
Brut verwendet werden. Drohnenbrut eignet sich besser als Arbeiterbrut.

3. Untersuchungsmaterial adulte Bienen


Bienenproben eigen sich nur bedingt zur Untersuchung auf den Befall mit
Tropilaelaps-Milben. Die Milbe sitzt sehr locker auf den Bienen und verlässt tote
Bienen sofort. Am besten füllt man lebende Bienen direkt in ein Gefäß und tötet sie
darin durch Einfrieren ab.

FLI 74
Amtliche Methodensammlung Stand: Mai 2013

11.3. Untersuchungsgang

1. Untersuchung von Wabenoberflächen


Für ein Screening des Befalls mit Tropilaelaps-Milben eignet sich die Untersuchung
der Oberfläche von Brutwaben einzelner Bienenvölker. Dazu werden die Bienen von
der Wabe in das Bienenvolk abgefegt und anschließend die Wabe über einem
offenen mit Wasser oder Alkohol gefüllten Behälter abgeklopft. Die Flüssigkeit wird
anschließend durch ein Sieb (Maschenweite 2 bis 3 mm) gegossen und dieses auf
Milben untersucht.

2. Untersuchung von Gemülle


Ist nur wenig Gemülle vorhanden, kann die Bodeneinlage direkt makroskopisch auf
vorhandene adulte Milben untersucht werden. Bei sehr großen Gemüllemengen ist
es vorteilhaft, eine Untersuchung mit Hilfe des Flotationsverfahrens durchzuführen.
Das Gemülle sollte vor der weiteren Verarbeitung für die Dauer von 24 Stunden
getrocknet werden. Anschließend wird es mit der doppelten Menge vergälltem
Alkohol aufschwemmt und für eine Minuten gerührt. Nur wenn das Gemülle
Propolispartikel enthält, muss es 10 bis 20 Minuten gerührt werden. Die an der
Oberfläche schwimmenden Milben können nun identifiziert und gezählt werden.

3. Untersuchung von Bienenbrut


Welche der folgenden Methoden verwendet wird, hängt von dem Umfang der Probe
und von der notwendigen Genauigkeit der Untersuchung ab. Soll ein Überblick über
einen Befall gegeben werden, so kann die Brutfläche insgesamt untersucht werden.

Untersuchung von Brutflächen


Mit einem Messer werden die Zelldeckel der Brutfläche entfernt und die Brut direkt
mit warmem Wasser aus der Handbrause in ein doppeltes Siebsystem gewaschen.
Die Brut und andere Teile aus dem oberen groben Sieb (Maschenweite 2 bis 3 mm)
kann man verwerfen. Die Milben können im unteren feinen Sieb (Maschenweite
< 1 mm) gesammelt werden. Zur leichteren Identifizierung der Milben schlägt man
den Inhalt des Siebes auf eine helle Unterlage.

Untersuchung von einzelnen Brutzellen


Zur Untersuchung von einzelnen Brutzellen werden die Zelldeckel mit einer Pinzette
oder Skalpell entfernt, die Brut der Honigbienen aus der Zelle entfernt und dann die
Brut sowie das Innere der Zelle unter Zuhilfenahme einer Kaltlichtlampe auf
vorhandene Milben bzw. andere Anzeichen eines Milbenbefalls untersucht.

4. Untersuchung von adulten Bienen


Bei einer kleinen Probe (< 50 Bienen) reicht es aus, die Bienen makroskopisch zu
untersuchen. Bei großen Bienenmengen kann ein Auswaschungsverfahren
verwendet werden.

FLI 75
Amtliche Methodensammlung Stand: Mai 2013

Auswaschungsverfahren
Noch lebende Bienen mit Äther abtöten oder alternativ für die Dauer von mindestens
zwei Stunden tiefkühlen. Die toten Bienen in einen Glaskolben mit der doppelten
Menge an vergälltem Alkohol füllen und 10 Minuten lang schütteln. Anschließend die
Bienen von den Tropilaelaps-Milben mit einem Sieb (Maschenweite 2 bis 3 mm)
trennen und auszählen.

Auswertung
Tropilaelaps-Milben können mit bloßem Auge erkannt werden. Die Bestimmung der
Milben und deren Nachkommen erfolgt aufgrund ihres Aussehens und ihrer
morphologischen Besonderheiten. Nähere Angaben im „Manual Standards for
Diagnostic and Vaccines“ der OIE (2008).

5. Molekularbiologische Methoden: PCR


Molekulargenetische Methoden stehen in Kürze zur Verfügung.

6. Serologische Tests
Antiseren sind zurzeit nicht käuflich zu erwerben.

FLI 76
Amtliche Methodensammlung Stand: Mai 2013

12. Beschälseuche der Pferde


(Stand: April 2012)

12.1. Charakterisierung der Infektion


12.1.1. Erreger
Beschälseuche (Dourine) ist eine Deckseuche der Einhufer, die klassischerweise
durch die Infektion mit Trypanosoma (T.) equiperdum (Doflein, 1901) verursacht wird.
Im Gegensatz zu allen übrigen Trypanosomen wird der Erreger nicht durch Insekten
sondern ausschließlich beim Deckakt übertragen. Neuere molekulare
Untersuchungen zeigen, dass T. equiperdum sehr nahe mit T. evansi verwandt ist
und mit heutigen diagnostischen Mitteln nicht sicher unterschieden werden kann.
Andererseits kann auch T. evansi beim Pferd eine ähnliche Symptomatik auslösen
wie T. equiperdum.

12.1.2. Klinische Symptomatik


Da die Beschälseuche in Westeuropa nicht mehr vorkommt, werden kaum Pferde mit
charakteristischen Symptomen angetroffen. In Ländern mit endemischem
Vorkommen nimmt die Krankheit oft einen chronischen Verlauf, der sich über Jahre
erstrecken kann. Gelegentlich werden aber auch akute Fälle beobachtet, die
innerhalb von wenigen Wochen zum Tode führen. Typische klinische Erscheinungen
im Frühstadium sind ödematöse Schwellungen im Bereich der Genitalien,
kreisförmige Ödeme am Unterbauch und im Bereich der Rippen ("Talerflecken").
Später treten nervöse Symptome auf wie unkoordinierte Bewegungen der
Hinterextremitäten, Lähmung des Nervus facialis u. a. Bei Importpferden aus
Risikogebieten (z. B. Mongolei, Afrika) werden bei auch bei ansonsten fehlender
Symptomatik hin und wieder Serumantikörper nachgewiesen, die den Verdacht auf
eine Infektion nahe legen.

12.1.3. Differentialdiagnostik
Einzelne ähnliche Krankheitserscheinungen treten auch bei der Deckdruse (Erreger:
Streptococcus equi) und beim Bläschenausschlag (Koitales Exanthem, Erreger:
Equines Herpes-Virus Typ III) oder auf Grund orthopädischer Ursachen auf.

12.1.4. Diagnostische Indikation


Handelsbestimmungen, klinisch, epidemiologisch oder anamnestisch begründeter
Verdacht.

12.1.5. Zuständige Untersuchungseinrichtungen


• Staatliche Veterinäruntersuchungsämter
• NRL für Beschälseuche am FLI, Naumburger Str. 96a, 07743 Jena

FLI 77
Amtliche Methodensammlung Stand: Mai 2013

12.1.6. Rechtsgrundlagen
• Tierseuchengesetz § 79 Abs. 4
• OIE Manual of Standards for Diagnostic Tests and Vaccines in der jeweils
aktuellen Fassung.
• Entscheidung der Kommission vom 5. Februar 1993 (93/197/EWG) über
tierseuchenrechtliche Bedingungen und die Beurkundung für die Einfuhr von
registrierten Equiden sowie Zucht- und Nutzequiden

12.2. Untersuchungsmaterial

Der Nachweis des Erregers ist ausgesprochen schwierig und gelingt nur sehr selten
in Vaginal- oder Präputialspülproben, noch seltener im Blut. Somit zielen die
diagnostischen Verfahren nicht auf den Erregernachweis sondern auf den Nachweis
von spezifischen Antikörpern im Blutserum ab. Nach der Klassifizierung
serologischer Verfahren durch die O.I.E. gilt hier die Komplementbindungsreaktion
(KBR) nach wie vor als Methode der Wahl. Auch der "enzyme-linked immunosorbent
assay" (ELISA) sowie der indirekte Fluoreszenz - Antikörpertest (IFAT) sind im
"Manual of Standards for Diagnostic Tests and Vaccines" der OIE als alternative
Verfahren aufgeführt. Ein Erregernachweis mittels PCR ist nur in bestimmten frühen
Krankheitsstadien möglich.

12.3. Untersuchung

Da die Beschälseuche in Deutschland und den meisten Ländern der nördlichen


Hemisphäre getilgt ist, beschränkt sich die Diagnostik hier auf den Nachweis von
spezifischen Antikörpern mittels Komplement-Bindungsreaktion (OIE). Als
Zusatzmethode kann auch ein ELISA oder ein Fluoreszenzantikörper-Test
durchgeführt werden.

12.3.1. Komplementbindungsreaktion (KBR)

1. Anwendungszweck
Qualitativer und quantitativer Nachweis von komplementbindenden Antikörpern
gegen T. equiperdum im Blutserum von Pferd, Esel und deren Kreuzungsprodukten.

Allgemeine Vorbemerkung
Die KBR kann bei 37 °C (Wärmebindung) oder bei 4 °C (Kältebindung) durchgeführt
werden. Die OIE empfiehlt die Wärmebindung, das Referenzlabor empfiehlt
ebenfalls, den Test bei 37 °C durchzuführen.
Als Verdünnungspuffer ist bei allen Teilschritten und Reagenzien HEPES-
Puffer zu verwenden, da Veronalpuffer (Barbiturat) nicht mehr verwendet
werden darf.
Es sollten möglichst viele Reagenzien käuflich erworben werden, um ein
größtmögliches Maß an Standardisierbarkeit zu erzielen (z. B. Virion/Serion,
Würzburg).

FLI 78
Amtliche Methodensammlung Stand: Mai 2013

Zu untersuchende Serumproben, Verdünnungspuffer und Antigen sind vor Beginn


der Untersuchung auf Raumtemperatur (Wasserbad) zu erwärmen.
Bei Inkubation in einer feuchten Kammer sollten die Zeiten gegenüber den Zeiten bei
Inkubation im Wasserbad eher etwas verlängert werden, da der Temperaturausgleich
über Luft langsamer geht als über Wasser.

2. Grundlagen
• OIE: Manual of Standards for Diagnostic Tests and Vaccines (Paris, in der
jeweils aktuellen Fassung (Fassung 2008, Chapter 2.5.2., S. 668-674)
• BMELF (1998): Arbeitsanleitungen zur Labordiagnostik von anzeigepflichtigen
Tierseuchen, S. 58-65
• Amtsblatt der Europäischen Gemeinschaften, Entscheidung der Kommission
vom 5. Februar 1993, Einfuhr von Equiden - 93/197/EWG - idF vom 26.02.96

3. Materialien/Geräte
3.1. Geräte
• Zentrifuge mit Mikrotiterplattenrotor (optional)
• Brutschrank/Brutraum (37 ± 1 °C) mit Sandbad, Haus 01, Raum 210
• 2 Wasserbäder, variable Temperatureinstellung (37 °C, 55 - 65 °C)
• Kühlschrank (5 ± 3 °C)
• Gefrierschrank (-21 ± 3 °C)
• Waage (zum Austarieren der Mikrotiterplatten)
• Kolbenhubpipetten (10 - 100 µl, 100 - 1000 µl, 5ml)
• Mehrkanalkolbenhubpipette, 20-100 µl
• Dispenser (10 µl - 5 ml)
• Ablesespiegel für Mikrotiterplatten

3.2. Gebrauchsmaterialien
• Reagenz-/Zentrifugenröhrchen (Einweg, 10 ml, 50 ml)
• Erlenmeyerkolben (100 ml)
• Mikrotiterplatten (U-Form, 8 x 12 wells) mit Deckel
• Pipettenspitzen (10 - 100 µl, 100 - 1000 µl, 5ml)
• Reagenzglasständer
• Schwimmständer
• feuchte Kammer
• -Reagenzgefäße (Plastik; 1,5 o. 2,0 ml)
• Präzisionsdispensertips (PD) für 2,5 ml und 1,25 ml

3.3. Chemikalien, Reagenzien und Lösungen


• Aqua bidest (steril)
• Beschälseuche-Antigen, zugel. nach § 17c TierSG; Lagerung bei 4 °C
• Beschälseuche-Kontrollserum, positiv, zugel. nach § 17c
TierSG ; mit definiertem Titer (siehe Etikett); Lagerung bei 4 °C
• Beschälseuche-Kontrollserum, negativ, zugel.
nach § 17c TierSG; Lagerung bei 4°C
• Ambozeptor (Hämolysin); z. B. Virion/Serion Lagerung bei 4°C

FLI 79
Amtliche Methodensammlung Stand: Mai 2013

• Hammel-Erythrozyten; z. B. Virion/Serion Lagerung bei 4°C


(1%ige Suspension, die alle 4 Wochen neu geliefert wird)
• HEPES-Puffer (seit 2009); z. B. Virion/Serion Lagerung bei 4°C
• Komplement; z. B. Virion/Serion Lagerung bei 4°C
oder rekonstituiert und portioniert bei -20 °C

• HEPES-Puffer (CFTB = complement fixation test buffer; Virion /Serion)

Löst Veronal-Puffer ab (2009); Barbituratpuffer darf nicht mehr hergestellt


werden.
Die Pufferlösung ist entsprechend der Herstellerangabe zu lösen oder selbst
herzustellen.

3.4. Antigen (siehe Anhang)

Bezugsquelle Antigen
Das in Deutschland zugelassene Antigen wird durch das Referenzlabor für
Beschälseuche (FLI, Standort Jena) hergestellt und als Lyophilisat an die
Untersuchungsämter abgegeben.

Lagerung
Die Lagerung des Antigens erfolgt im lyophilisierten Zustand bei 4 °C.
Bereits gelöstes Antigen (Stammlösung) wird portioniert (100 µl) bei -20 °C bis zur
Verwendung gelagert. Aufgetaute Reste von bereits gefroren gelagertem Antigen
sind zu verwerfen.

Herstellung der Stammlösung


Lyophilisiertes Antigen wird mit sterilem Aqua dest. zu dem auf dem Etikett
angegebenen Volumen gelöst (Stammlösung). Es ist am gleichen Tag zu verwenden
bzw. wie oben beschrieben portioniert zu lagern. Gelöstes Antigen wird mit Puffer zur
Gebrauchsverdünnung (siehe Etikett der Ampulle) verdünnt.

Für die Antigentitration (siehe dort) sind pro Serum 50 µl Antigen-Stammlösung zu


berechnen
Beispiel: für 2 Kontrollseren + 1 Feldserum >>> 150 µl Antigen-Stammlösung
Für die Serumtitration (siehe dort) sind pro Serum ca. 300 µl
Antigengebrauchsverdünnung zu berechnen.
Beispiel: 2 Kontrollseren + 1 Feldserum >>> 900 µl Antigengebrauchsverdünnung
Für die Komplementkontrolle sind (bei Antigengebrauchsverdünnung von 1:16) 300
µl Antigengebrauchslösung zu berechnen.

4. Durchführung
4.1. Vorbehandlung der Proben- und Kontrollseren
Vor der Untersuchung sind alle zu untersuchenden Serumproben einschließlich
Kontrollseren im Wasserbad zu inaktivieren. Verunreinigte und hämolytische Seren
sind zur Untersuchung nicht geeignet. Lyophilisierte Reagenzien sind mit Wasser zu
rekonstituieren.

FLI 80
Amtliche Methodensammlung Stand: Mai 2013

4.2. Inaktivierung der Seren


Vor der Untersuchung sind alle Serumproben einschließlich der Kontrollseren im
Wasserbad in entsprechender Verdünnung mit Puffer wie folgt zu inaktivieren.
500 µl 1:5 verdünntes Serum (100 µl Serum + 400 µl Puffer) in 1,5-2ml
Reagenzgefäße pipettiert. Bereits zu einem früheren Zeitpunkt inaktivierte und bei -
20 °C gelagerte Serumproben werden nochmals für 10 min bei der entsprechenden
Temperatur inaktiviert.

Serumverdünnung Temperatur
(in CFTB) Tierart (°C) Zeit (min)
1:5 Pferd 58 30
1:5 Maultier, Maulesel, Esel 62 30

4.3. Hämolytisches System

4.3.1. Herstellung der Erythrozyten-Suspension


Das Hämolytische System, auch Indikatorsystem genannt, macht die Aktivität des
Komplements in Anwesenheit eines Antigen-Antikörper-Komplexes sichtbar. Es
muss für jeden Test frisch angesetzt werden.

OIE 2008: 3%ige Erythrozytensuspension


USDA: 2%ige Erythrozytensuspension
Andere, inkl. Referenzlabor in Jena: 1%ige Erythrozytensuspension

Schaferythrozyten-Suspensionen können käuflich erworben werden.

Erythrozyten-Suspension und Ambozeptor können in auf einander


abgestimmter Form käuflich erworben werden. Damit wird die eigene
Ermittlung der einzusetzenden Ambozeptorkonzentration überflüssig (3.5.5.).
Sie wird dann vom Hersteller vorgegeben (z. B. Virion/Serion, Würzburg).

Wird das das Hammelblut für die Erythrozytensuspension selbst gewonnen, so ist
darauf zu achten, dass keine Gerinnung eintritt. Das mit Alsever’s Lösung
(Gerinnungshemmung) versetzte Hammelblut (Anhang 2 u. 3) 3- bis 5-mal in Puffer
(Anhang 1) wird gewaschen (Zentrifugation bei 1000g, 10 min, 10 °C) bis die
überstehende Flüssigkeit wasserklar ist. Der Überstand wird jeweils verworfen.
Das gewaschene Erythrozytensediment wird vorsichtig aufgeschüttelt (kein Vortex),
so dass eine dichte Suspension entsteht, die pipettierbar ist. Mit Puffer wird eine
1%ige Suspension hergestellt. Diese sollte jedes Mal photometrisch kontrolliert
werden (540 nm).

4.3.2. Ermittlung der benötigten Ambozeptor-(Hämolysin)-Konzentration


(1x pro Charge durchführen)
• Durchführung in der Mikrotiterplatte
• Doppelbestimmung
• Erste Verdünnungsstufe (Vol. 500 µl) in separatem Reaktionsgefäß ansetzen

FLI 81
Amtliche Methodensammlung Stand: Mai 2013

4.3.2.1. Ansatz geometrischer Verdünnungsreihen des Ambozeptors

well 1 2 3 4 5 6 7

Reihe A) 1:500 1 000 2 000 4 000 8 000 16 000 32 000

Reihe B) 1:750 1 500 3 000 6 000 12 000 24 000 48 000

• Ausgangsverdünnung 1:100 (z. B. 20 µl Ambozeptor + 1 980 µl Puffer) = 2 ml


I) 100 µl der Ausgangsverdünnung entnehmen und eine 1:5 Verdünnung
(Puffer) herstellen = 100 µl + 400 µl Puffer = 500 µl Verdünnung 1:500
II) 100 µl der Ausgangsverdünnung entnehmen und eine 1:7,5
Verdünnung (Puffer) herstellen = 100 µl + 650 µl Puffer = 750 µl
Verdünnung 1:750
• Reihe A und B: Vorlage von 25 µl Puffer ab well 2
• Reihe A: zu well 1 und 2 jeweils 25 µl Ambozeptorverdünnung 1:500 (I)
zufügen und ab well 2 durch fortlaufendes Über-Pipettieren von jeweils 25 µl
die weiteren Verdünnungen anlegen, letzte 25 µl verwerfen
• Reihe B: zu well 1 und 2 jeweils 25 µl Ambozeptorverdünnung 1:750 (II)
zufügen und ab well 2 durch fortlaufendes Über-Pipettieren von jeweils 25 µl
die weiteren Verdünnungen anlegen, letzte 25 µl verwerfen

4.3.2.2. Durchführung der Ambozeptorauswertung

Tabelle 1: Ansatzschema der Ambozeptorauswertung


Gesamtvolumen: 100 µl pro well (Doppelbestimmung)

well Puffer Ambozeptor Ambozeptor Erythroz.- Komplement


(I) (II) Susp. 1:20
(µl) (25 µl) (25 µl) (µl) (µl)
1 25 1:500 1:750 25 25
2 25 1:1 000 1:1 500 25 25
3 25 1:2 000 1:3 000 25 25
4 25 1:4 000 1:6 000 25 25
5 25 1:8 000 1:12 000 25 25
6 25 1:16 000 1:24 000 25 25
7 25 1:32 000 1:48 000 25 25

4.3.3. Kontrollen
a) Erythrozytenkontrolle: 25 µl Erythrozytensuspension (1 %)
75 µl Puffer
b) Komplementkontrolle: 25 µl Erythrozytensuspension (1 %)
25 mlKomplement 1:20
50 ml Puffer
c) Ambozeptorkontrolle: 25 µl Erythrozytensuspension (1 %)
25 ml Ambozeptor 1:500
50 ml Puffer

Mikrotiterplatte vorsichtig schütteln, Inkubation 30 min bei +37 °C ± 1 °C in einer


feuchten Kammer.

FLI 82
Amtliche Methodensammlung Stand: Mai 2013

4.3.4. Auswertung
Die höchste Ambozeptorverdünnung, die noch eine vollständige Hämolyse bewirkt,
wird als 1 Ambozeptoreinheit (AE) definiert.
Deutsche Vorschrift (Godglück, 1952): Die Gebrauchskonzentration beträgt 4 AE,
also die vierfache Konzentration.
OIE 2008: Gebrauchskonzentration beträgt 2 AE

Dieser Methodische Unterschied sollte keine Bedeutung haben. Die Verwendung von
4 AE erhöht die Sicherheit, dass keine falsch positiven Ergebnisse auftreten. Diese
Gefahr wird jedoch auch durch den Komplementvorversuch, der bei jeder KBR mit
angesetzt wird, ausgeschlossen.

Die Kontrollen dürfen keine Hämolyse aufweisen.

4.3.5. Herstellung des Hämolytischen Systems für die KBR

• Erythrozytensuspension (z. B. 1%ig; Virion/Serion) vorsichtig aufschütteln


• Ambozeptor-Gebrauchsverdünnung (je nach Herstellerangabe, oder nach
eigenen Vorversuchen, z. B. 1:2500 = 25 ml VP + 10 µl Ambozeptor; siehe
3.5.2.2.) und Erythrozyten-Suspension (siehe 3.5.1.) zu gleichen Teilen
mischen
• 30 min bei 37 °C im Wasserbad inkubieren , damit sich der Erythrozyten-
Antikörper-Komplex bilden kann

4.4. Komplement

Allgemeines
Komplement kann mit anderen Reagenzien für die KBR in aufeinander
abgestimmter Form käuflich erworben werden (z. B. Virion / Serion).
Vorversuche zur Ermittlung der Gebrauchskonzentration können dann
wesentlich reduziert werden, da vom Hersteller Empfehlungen für die
Gebrauchskonzentration gegeben werden.

Komplement ist bei jeder KBR frisch anzusetzen.


Da Komplement mit der Zeit an Aktivität verliert, ist bei jeder KBR ein
Komplementvorversuch mitzuführen.

Komplement kann auch aus Meerschweinchen-Blut selbst gewonnen werden (z. B.


Herzpunktion, Citrat-Blut, Plasma-Herstellung). Es sollte dann portioniert und bei -
80 °C gelagert werden.

FLI 83
Amtliche Methodensammlung Stand: Mai 2013

4.4.1. Ermittlung der Komplementgebrauchsverdünnung für die Durchführung der


KBR (Komplementvorversuch) mit selbst gewonnenem Komplement oder
käuflich erworbenem Komplement ohne Herstellerangabe zur
Gebrauchskonzentration

Dieser Teilversuch dient der Feststellung der Komplementgebrauchsverdünnung, die


zu einer vollständigen Hämolyse des verwendeten Hämolytischen Systems (siehe
4.3.) führt. Dies ist notwendig, wenn nicht alle KBR-Reagenzien als aufeinander
abgestimmtes Gesamtpaket käuflich erworben werden.

Ein Ansatz enthält:


1) Puffer
2) Antigen (da das Antigen die Hämolyse beeinflussen kann)
3) Komplement
4) Hämolytisches System

Das Serum fehlt in diesem Ansatz und wird durch Puffer ersetzt.
Die Komplementaktivität muss bei jedem Versuch neu ermittelt werden. Auch bei
Versuchen im Abstand von 24 Stunden sollte nicht der Wert vom Vortag
übernommen werden.
Es werden 8 Komplementverdünnungen geprüft (Herstellung siehe Tabelle 2a).
Alle Komplementverdünnungen werden in einem Komplementvorversuch ohne
Serum eingesetzt (Tab. 2b)
Werden alle Reagenzien aufeinander abgestimmt käuflich erworben, so kann auf die
Komplementauswertung am Untersuchungstag im Umfang reduziert werden (z. B. 4
Verdünnungsstufen, siehe Tab. 2a).

Tabelle 2a: Herstellung der Komplementverdünnungen

Komplementverdünnungen
Endkonzentration 0,5 1,0 1,5 2,0 2,5 3,0 3,5 4,0
(%)
Kompl. 1:10 (µl) 5 10 15 20 25 30 35 40
Puffer (µl) 100 100 100 100 100 100 100 100

Tabelle 2b: Komplementvorversuch

Komplement je Verd.-Stufe (µl) 25


Antigengebrauchsverdünnung (µl) 25
Puffer (µl) 25
Hämolytisches System (1.5.) (µl) 50

4.4.2. Auswertung
Es wird die geringste Komplementkonzentration bestimmt, die eine vollständige
Hämolyse bewirkt. Diese Komplementkonzentration wird als 1 Komplement-Einheit
definiert. Nach Empfehlung der OIE ist die KBR mit 2 Komplement-Einheiten, also
der doppelten Konzentration durchzuführen.

Beispiel: Vollständige Hämolyse 2,0 %


Gebrauchskonzentration 4,0 %

FLI 84
Amtliche Methodensammlung Stand: Mai 2013

4.4.3. Ermittlung der Komplement-Gebrauchskonzentration mit käuflich erworbenem


Komplement (Komplementvorversuch) mit entsprechender Herstellerangabe

Bei jeder KBR ist ein Komplementvorversuch zur Ermittlung der aktuellen
Komplementaktivität durchzuführen.
Das lyophilisierte Komplement wird mit sterilem Aqua dest. nach Herstellervorschrift
gelöst. Bei 2 – 8 °C ist das Komplement je nach Herstellerangaben eine gewisse Zeit
haltbar. Das gelöste Komplement kann auch portioniert (100 µl) und bei -20 °C oder
-80 °C eingefroren werden.
Die Komplement-Gebrauchslösung wird durch Verdünnung von gelöstem
Komplement mit Puffer vor Gebrauch frisch hergestellt.
Da die Komplementaktivität im Laufe der Zeit abnimmt, die
Erythrozytenkonzentration von Charge zu Charge geringe Unterschiede aufweisen
kann und das Antigen die Komplementaktivität beeinflussen kann, sind bei jeder KBR
zusätzlich zur Komplement-Gebrauchsverdünnung, die vom Hersteller empfohlen
wird, zwei weitere Verdünnungen jeweils im Abstand von einer halben Zehnerpotenz
unterhalb der vom Hersteller empfohlenen Verdünnung herzustellen.

Beispiel:
vom Hersteller empfohlene Verdünnung: 1: 55 (A)
zwei weitere Verdünnungen: 1: 50 (B)
1: 45 (C)

Für die Antigentitration sind je ca. 200 µl Komplementverdünnung zu berechnen.


Für die Serumtitration sind pro Serum ca. 300 µl Komplementgebrauchsverdünnung
zu berechnen.
Beispiel:
2 Kontrollseren + 1 Feldserum >>> 900 µl Komplementgebrauchsverdünnung

Für den Komplementvorversuch sind 3 x 50 µl Komplementverdünnung zu berechnen.

4.4.4. Komplementvorversuch

Der Komplement-Vorversuch wird mit drei Komplement-Gebrauchsverdünnungen


durchgeführt (Pkt. 3.6.3.). Das Antigen wird in der auf dem Etikett der Ampulle
vermerkten Gebrauchsverdünnung (in Puffer; siehe Pkt. 3.4.) verwendet.

Die höchste Verdünnungsstufe der Komplement-Gebrauchslösung, die noch eine


vollständige Hämolyse bewirkt, wird als 1 Komplement-Einheit bezeichnet.
Für den Komplement-Hauptversuch wird derjenige Ansatz (Pkt. 4.4.3. A, B, C)
verwendet, bei dem die Komplement-Gebrauchslösung sowohl unverdünnt als auch
1:2 verdünnt eine vollständige Hämolyse herbeiführt.
In diesem Fall enthält die Gebrauchslösung also 2 Komplement-Einheiten.
Nach Empfehlung der OIE soll die KBR mit 2 Komplement-Einheiten durchgeführt
werden.

Die aktuelle Komplementaktivität sollte vor jeder KBR neu überprüft werden.
Dafür gibt es folgende Gründe:
- Das Antigen kann die Komplementaktivität beeinflussen.
- Die Komplementaktivität kann abnehmen, insbesondere nach Lagerung bei -20 °C

FLI 85
Amtliche Methodensammlung Stand: Mai 2013

Ein Komplementansatz besteht aus


• Antigen
• Puffer (anstelle von Serum)
• Hämolytisches System
• Komplement

4.4.4.1. Durchführung des Komplementvorversuches


• Feuchte Kammer offen in den Brutschrank stellen (Temperaturausgleich)
• 10 ml Puffer im Wasserbad auf 37°C temperieren (mind. 10 min)
• Herstellung der Antigenverdünnung (siehe Etikett) in Puffer; 300 µl, warm
stellen (37 °C)
• Herstellung der drei Komplementgebrauchslösungen in Puffer (siehe 4.4.3. A,
B, C)
• Komplementverdünnungsreihen in Zweierschritten mit
Komplementgebrauchslösung (siehe Pkt. 3.4.3. A, B, C): „unverdünnt“ bis
„1:16“
- Reihen B – E; jeweils wells 2 + 3, 5 + 6, 8 + 9: 25 µl Puffer
- Reihen A und B wells 2 + 3, 5 + 6, 8 + 9:
jeweils 25 µl Komplementverdünnung (Doppelbestimmung),
A bzw. B bzw. C (siehe Pkt. 4.4.3.)
- Überpipettieren von 25 µl von Reihe B in Reihe C, von C in D und von
D in E; 25 µl aus der Reihe E verwerfen
• Reihe A - E, beschickte wells: Antigenzugabe, Verdünnung siehe Etikett der
Antigenampulle, 25 µl
• Reihe A – E, beschickte wells: Zugabe von Puffer, 25 µl
• Inkubation bei 37 °C, 1h:05 min, in feuchter Kammer
• Herstellung des Hämolytischen Systems 25 min nach Beginn der Inkubation
der Platte
• Inkubation des Hämolytischen Systems bei 37 °C im Wasserbad.
• Reihe A – E, beschickte wells: Zugabe von Hämolytischem System, 50 µl
• Inkubation bei 37 °C (feuchte Kammer) für 35 min.
• Platten kurz zentrifugieren (5 min/ca. 700 x g, 2000 upm); danach sofort ablesen

Bewertung: Die niedrigste Komplementkonzentration (höchste Verdünnung: Pkt.


4.4.3. A, B, C), bei der die Erythrozyten in den beschickten wells der Reihen A
und B vollständig lysiert sind, wird im Hauptversuch verwendet.
Wenn zwei oder drei Ansätze diese Forderung erfüllen, wird der Ansatz mit der
höchsten Komplementverdünnung gewählt.

4.5. Kontrollsysteme

• Kontrollseren werden als Lyophilisate vom Referenzlabor für Beschälseuche


an die Untersuchungsämter abgegeben. Die Lyophilisate sind mit Aqua dest.
zu rekonstituieren.
• In jedem Ansatz wird ein spezifisch positives (mit definiertem Titer; siehe Anhang)
sowie ein antikörperfreies, d. h. negatives Kontrollserum (siehe. Anhang)
mitgeführt.

FLI 86
Amtliche Methodensammlung Stand: Mai 2013

• Resuspendierte Seren und Antigen können portioniert bei -21 °C ± 3 °C


gelagert werden. Sie sind danach ein Jahr (Antigen) und länger (Antikörper)
verwendbar.

Je Platte sind folgende Kontrollen mitzuführen:


• Beschälseuche-Kontrollserum, positiv; alle Reaktionspartner
• Beschälseuche-Kontrollserum, negativ; alle Reaktionspartner
• Die Kontrollseren sind in den gleichen Verdünnungen mitzuführen, in welchen
die Probenseren ausgetestet werden.
• Serumkontrolle (SK) für jedes mitgeführte Serum (1:5 verdünnt); alle
Reaktionspartner außer dem Antigen (1 well)
• Antigenkontrolle (AK; Gebrauchsverdünnung); alle Reaktionspartner außer
dem Serum (1 well)
• Komplementkontrolle (KK); alle Reaktionspartner außer dem Antiserum (siehe
Komplementvorversuch, Doppelbestimmung)
• Hämolytisches System-Kontrolle (HS-K); nur Hämolytisches System und Puffer
(1 well)

Das Volumen der fehlenden Reaktionspartner ist jeweils durch Puffer zu ersetzen.

4.6. Durchführung der KBR-Wärmebindung (Hauptversuch)

Anmerkungen:
Der Puffer und die benötigte Menge an Erythrozytensuspension sind vor Verwendung
auf 37 °C zu erwärmen. Das Komplement ist auf Raumtemperatur zu erwärmen.
Die KBR wird in einer 96-well-Platte durchgeführt.
Im ersten Schritt wird mit einer konstanten Serumkonzentration von 1:5 die aktuelle
Antigenaktivität ausgetestet. Dieser Schritt wird von der OIE als Screening Test
vorgeschrieben.
Ergibt ein Serum bei einer Antigen-Konzentration von 2 Antigeneinheiten eine
positive Reaktion, so wird dieses Serum mit einer konstanten Antigenkonzentration
von 2 Antigen-Einheiten mittels einer Serumverdünnungsreihe austitriert, um den
Serumtiter zu bestimmen.
Da diese Untersuchungen im Referenzlabor regelmäßig durchgeführt werden,
besteht für die Nutzer des vom Referenzlabor erworbenen Antigens keine
Notwendigkeit, die Antigen-Titration selbst durchzuführen. Es genügt eine
Serumtitration. Gebrauchsverdünnung des Antigens siehe Etikett der
Antigenampulle.

4.6.1. Antigentitration (Durchführung)

Die Antigenkonzentration, bei der das Vorhandensein von Antikörpern in einem 1:5
verdünnten Serum beurteilt wird, wird bei jeder KBR neu austitriert.
Probeseren und Kontrollseren werden in einer konstanten Verdünnung von 1:5 in
Puffer verwendet (keine Serumtitration).
Das Antigen wird mit der auf dem Etikett angegebenen Menge an Aqua dest. (0,5 ml)
rekonstitutiert. Es muss völlig gelöst sein.
Das Antigen wird in Zweierschritten in Puffer verdünnt (1:4 bis 1:128).

FLI 87
Amtliche Methodensammlung Stand: Mai 2013

Die höchste Verdünnungsstufe (geringste Konzentration) der Antigenlösung, bei der


es zu einer vollständigen Sedimentation der Erythrozyten (++++) kommt, wird als
1 Antigen-Einheit bezeichnet.
Nach Empfehlung des OIE wird das KBR-Ergebnis bei 2 Antigeneinheiten beurteilt,
d. h. man geht einen Verdünnungsschritt zurück.

Beispiel:
Antigen-Verdünnung 1:64 = 1 Antigen-Einheit
Antigen-Verdünnung 1:32 = 2 Antigen-Einheiten

Anmerkungen: Die KBR wird in drei 96-well-Platten durchgeführt, je Komplement-


Gebrauchsverdünnung (A, B, C; siehe 3.6.3.) eine Platte.

Antigentitration
1. Puffervorlage Je 25 µl Puffer in wells 1, 3, 5 + 6 der Reihen A - H
1: für positives Kontrollserum, 1:5 verdünnt
3: für negatives Kontrollserum, 1:5 verdünnt
5 + 6: für Probeserum, 1:5 verdünnt (Doppelbestimmung)
2. Antigenzugabe Je 25 µl Antigen-Stammlösung, 1:2 verdünnt in Puffer, jeweils in Reihe A,
wells 1, 3, 5, 6 pipettieren
Verdünnung in Zweierschritten von Reihe A nach Reihe H
3. Serumzugabe Je 25 µl 1:5 verdünntes (Puffer) und inaktiviertes positives oder negatives
Kontroll- bzw. Patientenserum in die Kavitäten 1, 3, 5, 6 der Reihen A – H
pipettieren.
4. Komplementzugabe Je 25 µl Komplementgebrauchsverdünnung (siehe Pkt. 3.4.3.) in wells 1, 3,
5, 6 der Reihen A – H pipettieren.

Komplementkontrolle (Reihen 9 + 10; Doppelbestimmung)


1.a Puffervorlage Je 25 µl Puffer in Reihe B - H, wells 9 + 10
2.a. Komplementzugabe Je 25 µl Komplementgebrauchsverdünnung (A, B, C; Pkt. 3.4.3.) in wells 9 +
10 der Reihen A und B
Verdünnung in Zweierschritten von Reihe B nach Reihe H
3a. Pufferzugabe Je 25 µl Puffer in wells 9 + 10 der Reihen A – H (Serum-Ersatz)
4a. Antigenzugabe zu Für die Komplementkontrolle wird die auf dem Etikett der Antigenampulle
Reihen 9 + 10 angegebene Gebrauchsverdünnung verwendet.
Je 25 µl Antigen in die Kavitäten A – H der Reihen 9 + 10

5. weitere Kontrollen In wells 12 der Reihen A – H:


- Antigen-Kontrolle (Verd.-Reihe; Serum durch HP ersetzen)
In wells 11 der Reihen A – H
- Serumkontrollen (positiv, negativ, Probe; Antigen durch HP ersetzen)
und Kontrolle Hämolytisches Systems
6. Inkubation Inkubation bei 37 °C in feuchter Kammer 1:05 min
Herstellen des Hämolyt. Systems etwa 25 min nach Beginn der
Inkubation
7. Hämolytisches Je 50 µl Hämolytisches System in wells 1, 3, 5, 6, 9, 10 der Reihen A - H
System

FLI 88
Amtliche Methodensammlung Stand: Mai 2013

8. Inkubation Ansatz bei 37 °C in feuchter Kammer 35 min inkubieren


9. Zentrifugation: 5 min bei 2000 Upm (670g) zentrifugieren
Sofern keine Zentrifuge verfügbar ist, können die Platten bei
Raumtemperatur für ca. 2 h inkubiert werden. In dieser Zeit sedimentieren
die nicht lysierten Erythrozyten spontan. Eine weitere Inkubation bei 4 °C
über Nacht kann bei unklarer Endpunktbestimmung zu besser ablesbaren
Ergebnissen führen.

4.6.2. Serumtitration (Durchführung)

1. Puffervorlage Je 25 µl Puffer in Kavitäten 3 - 12 der Reihen A, B für Kontrollseren


und C – F, je nach der Anzahl der Probeseren, die zu testen sind
A: Positives Kontrollserum
B: Negatives Kontrollserum
C – F: Probeseren
Die Reihen G und H bleiben frei für Kontrollen

2. Serumzugabe: Je 25 µl Serum (1:5 verdünnt) in wells 1 und 2


Verdünnung der Seren in jeder Reihe in Zweierschritten ausgehend von
Kavität 2 bis well 11
Letzte 25 µl aus well 11 verwerfen
Kavität 1: Serumkontrolle
Kavität 12: Antigenkontrolle (kein Reagenz zugeben)

3. Antigenzugabe Je 25ml Antigengebrauchsverdünnung (siehe Etikett der Antigen-Ampulle


oder eigener Vorversuch) in wells 2 – 11 der Reihen A, B und C-F, je nach
Anzahl der Probeseren, die zu testen sind
Kavität 1: je 25 Puffer

4. Komplementzugabe Je 25 µl Komplementgebrauchsverdünnung (siehe Komplement-


Vorversuch) in wells 1 – 12 der Reihen A, B und C-F, je nach Anzahl der
Probeseren, die zu testen sind

5. Komplementkontrolle Sollte aktuell durchgeführt werden, wenn der Komplement-Vorversuch nicht


am gleichen Tag gemacht wurde wie der Hauptversuch
Reihen G und H, wells 2 – 5:
Puffervorlage je 25 µl in wells 3 – 5
Komplement-Gebrauchsverdünnung je 25 µl in Kavitäten 2 und 3
Herstellung einer Verdünnungsreihe (drei Schritte) in Zweierschritten
ausgehend von well 3
Antigenzugabe je 25 µl in wells 2 - 5

6. Inkubation Inkubation bei 37 °C in feuchter Kammer 1: 05 min

Herstellen des Hämolyt. Systems etwa 25 min nach Beginn der


Inkubation
7. Hämolytisches Je 50 µl Hämolytisches System in alle beschickten wells der Reihen A – H,
System ein zusätzliche Kavität in Reihe H für die Kontrolle des Hämolytischen
Systems (+ 75 µl Puffer

8. Inkubation Ansatz bei 37 °C in feuchter Kammer 35 min inkubieren

9. Zentrifugation: 5 min bei 2000 Upm (670g) zentrifugieren


Sofern keine Zentrifuge verfügbar ist, können die Platten bei
Raumtemperatur für ca. 2 h inkubiert werden. In dieser Zeit sedimentieren
die nicht lysierten Erythrozyten spontan. Eine weitere Inkubation bei 4 °C
über Nacht kann bei unklarer Endpunktbestimmung zu besser ablesbaren
Ergebnissen führen.

FLI 89
Amtliche Methodensammlung Stand: Mai 2013

4.6.3. Kontrollsysteme und Interpretation der Ergebnisse

Das Ablesen der Reaktion je Verdünnungsstufe erfolgt nach dem Grad der Hämolyse
und der Größe des Erythrozytensedimentes (Knopfbildung)

100 % Hämolyse = 0 % Erythrozytensediment = negativ


• winziges, schwach rötliches Erythrozytensediment ist ebenfalls negativ zu
bewerten
Gründe: z. B. Ungenauigkeit beim Pipettieren, ungenauer Komplementvorversuch

75 % Hämolyse = 25 % Erythrozytensediment = fraglich (+ positiv)


= Erythrozytensediment klein, aber noch deutlich mit rötlichem Puffer

50 % Hämolyse = 50 % Erythrozytensediment = positiv (nach OIE; ++)


= Erythrozytensediment etwa halbe Größe mit rötlichem Puffer

25 % Hämolyse = 75 % Erythrozytensediment = positiv (+++)


= großes Erythrozytensediment mit leicht rötlichem Puffer

0 % Hämolyse = 100 % Erythrozytensediment = positiv (++++)


= großes Erythrozytensediment mit wasserklarem Puffer

Bei der Durchführung des Versuches sind jeweils folgende Kontrollansätze mitzuführen:

• Kontrolle der antikomplementären Wirkung jedes Serums (Serumkontrolle- SK)


- Serumverdünnung (1:5): 25 µl
- Puffer: 25 µl
- Komplement: 25 µl
- Hämolyt. System: 50 µl
Bewertung: 100 % Hämolyse, es darf kein Erythrozytensediment entstehen.
Entsteht ein Erythrozyten-Sediment, so ist das Serum zu titrieren. Wenn die
Differenz zwischen dem Titer der positiven SK und dem Titer des
Hauptversuches drei Verdünnungsstufen oder mehr beträgt, so ist das Serum
als positiv zu bewerten. Andernfalls ist der Test nicht auswertbar.

• Kontrolle des Antigens (AK)


- Puffer: 25 µl
- Antigen: 25 µl
- Komplement: 25 µl
- Hämolyt. System: 50 µl

Bewertung: 100 % Hämolyse, es darf kein Erythrozytensediment entstehen

FLI 90
Amtliche Methodensammlung Stand: Mai 2013

• Kontrolle des Komplements (KK)


angesetzt in den Reihen G und H
- Puffer: 25 µl
- Antigen 25 µl
- Komplement: 25 µl
- Hämolyt. System: 50 µl

Bewertung: 100 % Hämolyse in den ersten 2 wells der Komplement-


Verdünnungsreihe = 2 Komplement-Einheiten

• Kontrolle des Hämolytischen Systems (HS)


angesetzt in den Reihen G und H
- Puffer: 75 µl
- Hämolyt. System: 50 µl

Bewertung: keine Hämolyse

• Positives Kontrollserum
- Serumverdünnung (1:5): 25 µl
- Antigen: 25 µl
- Komplement: 25 µl
- Hämolyt. System: 50 µl

Bewertung: in Abhängigkeit vom Antikörpergehalt kommt es zur


Sedimentbildung mit und ohne/ mit partieller Hämolyse. Der Titer
der Positivkontrolle sollte höchstens eine Titerstufe vom
erwarteten Wert (siehe Etikett) abweichen

• Negatives Kontrollserum
- Serumverdünnung (1:5): 25 µl
- Antigen: 25 µl
- Komplement: 25 µl
- Hämolyt. System: 50 µl

Bewertung: 100 % Hämolyse, es darf kein Erythrozytensediment entstehen

Alle Kontrollen müssen das erwartete Resultat zeigen, andernfalls ist der Test
nicht auswertbar!
Wird bei einer Serumprobe (1:5) ein positives KBR-Ergebnis erzielt, so wird die
Probe erneut untersucht, indem bei konstanter Antigenverdünnung eine
Serumtitration durchgeführt wird, um den Grenztiter zu bestimmen. Dabei müssen
dann erneut die notwenigen Kontrollen durchgeführt werden.

4.7. Untersuchungsbericht
Der Untersuchungsbericht dokumentiert mit eindeutigen Angaben über die getestete
Serumprobe sowie die angewandte Untersuchungsmethode das Ergebnis.

FLI 91
Amtliche Methodensammlung Stand: Mai 2013

4.8. Referenz für die Auswertung


Gemäß OIE Manual 2000 gelten Titer ab 1 : 5 ++ (Wärmebindung) als positiv. Nach
der Entscheidung der EU-Kommission – 93/197/EWG – i.d.F. vom 26.02.1996 sind
Titer ab 1 : 10 als Beschälseuche-positiv einzustufen.

ELISA

1. Durchführung
• Das Antigen (FLI, Gebrauchsverdünnung nach Angabe des Herstellers) wird
in 5 ml Karbonatpuffer rekonstituiert und dreimal 10 Sekunden bei maximal
zulässiger Amplitudeneinstellung ultrabeschallt (z. B. Sonoplus-Ultraschall
Homogenisator HD 200 der Firma Bandelin (Berlin) und der Sonotrode MS 73
(60 %)). Während der Beschallung wird das Antigen in Eiswasser gekühlt.
Nach 5 Minuten Zentrifugation bei 10000 x g wird der Überstand in der
angegebenen Gebrauchsverdünnung mit Karbonatpuffer (siehe Anhang)
verdünnt. Alternativ (besser) sollte eine Proteinbestimmung vorgenommen
und das Antigen in einer Konzentration von 10 µl/ml Coating-Puffer eingesetzt
werden. Die Kolumnen 1, 3, 5, 7, 9 und 11 werden mit 50 µl Karbonatpuffer
beschickt, die Kolumnen 2, 4, 6, 8, 10 und 12 mit 50 µl Antigen. Die Platten
werden in einer feuchten Inkubationskammer 40 Minuten im Brutschrank bei
+37 °C± 1 °C inkubiert.

• Die Platten werden dekantiert und mit Aqua bidest. dreimal gewaschen.
Anschließend Dekantieren der Platten.

• Zugabe von 200 µl Blocking - Puffer (siehe Anhang) pro well. Inkubation 30
Minuten bei +37 °C± 1 °C in feuchter Inkubationskammer.
• Die Platten werden dekantiert und dreimal mit PBS - Tween (siehe Anhang)
gewaschen. Anschließend Dekantieren der Platten.

• Trocknen der Platten bei +37 °C± 1 °C im Brutraum für 120 Minuten.
Anschließend werden die Platten unter Vakuum in Vaku-Beuteln
eingeschweißt. Bei einer Lagerungstemperatur von +7 °C ± 3 °C
(Kühlschrank) beträgt die Haltbarkeit ½ Jahr.

• Vor Beginn des ELISA die benötigte Anzahl an Testplatten auf


Raumtemperatur erwärmen. Verdünnung der Probandenseren und
Kontrollseren 1 : 100 in PBS - Tween / FKS. Die Kolumnen 1 - 10 sind für den
Doppelansatz der Probandenseren vorgesehen, die Kolumnen 11 und 12 für
den Doppelansatz der Kontrollseren (Positives und negatives Kontrollserum,
FLI Jena).

• Pro well werden 50 µl eingefüllt. Inkubation 30 Minuten bei +37 °C ± 1 °C in


feuchter Inkubationskammer.

• Die Platten werden entleert und dreimal mit PBS - Tween gewaschen.
Anschließend Dekantieren der Platten.

FLI 92
Amtliche Methodensammlung Stand: Mai 2013

• Zugabe von 50 µl Konjugat in Gebrauchsverdünnung pro well. Inkubation 30


Minuten bei +37 °C ± 1 °C in feuchter Inkubationskammer.
• Die Platten werden dekantiert und dreimal mit PBS - Tween gewaschen.
Anschließend Dekantieren der Platten.

• Zugabe von 100 µl Chromogen-Substrat-Lösung pro well.

• Messung der Platte im Plattenphotometer bei 405 nm. Mindest-O.D.-Wert der


positiven Kontrolle 0.400. Je nach aktuellen Testbedingungen sollte dieser
Wert nach 15-30 Minuten Chromogen-Substrat-Inkubation bei
Raumtemperatur (+22 °C ± 3 °C)erreicht werden.

2. Bewertung
Bestimmt wird die Netto-Extinktion, d. h. der Wert, der sich aus der Subtraktion der
Extinktion des Ansatzes mit Antigen minus der Extinktion des Ansatzes ohne Antigen
ergibt. Die Netto-Extinktion des schwach positiven Serums wird als 100 %
angesehen. Zu diesen 100 % werden die Ergebnisse der Feldseren in Beziehung
gesetzt, ebenfalls ausgedrückt in %. Ein Überschreiten der 100 % als ein positives
Ergebnis.

FLI 93
Amtliche Methodensammlung Stand: Mai 2013

Anhang

1. Diagnostika

Beschälseuche Antigen à 0.5 ml, lyophilisiert


Beschälseuche-Kontrollserum positiv v. Pferd à 1,0 ml, lyophilisiert
Beschälseuche-Kontrollserum negativ v. Pferd à 0,5 ml, lyophilisiert

2. Puffer, biologische und chemische Reagenzien

2.1. Verdünnungslösung für KBR


Die Verdünnungsflüssigkeit für alle Reagenzien ist HEPES-Puffer-Lösung. Zur
besseren Haltbarkeit wird ein HEPES-Konzentrat im Verhältnis 5:1 hergestellt und
portioniert bei +5 °C ± 3 °C gelagert. Vor Gebrauch ist es 1:5 mit Aqua bidest. zu
verdünnen.
Veronalpuffer und alle anderen Reagenzien für die KBR (Erythrozyten-Suspension,
Komplement, Ambozeptor) sind käuflich zu erwerben (z. B. Firma Virion/Serion in
Erlangen).

2.2. Alsever’s Lösung zur Konservierung von Hammelbluterythrozyten


- Dextrose (Glucose) 18,66 g
- Natriumchlorid 4,18 g
- Natriumcitrat 8,00 g
- Aqua bidest. ad 1000,00 ml
- Lösen im Dampftopf für 20 min

2.3. Hammelblut ("sheep red blood cells", SRBC)


Das Blut wird vom Schaf unter sterilen Bedingungen durch Punktion der Vena
jugularis entnommen und unter leichtem Schütteln zu gleichen Teilen mit Alsever´s
Lösung in einem sterilen Gefäß (im geschlossenen System) aufgefangen. Ein Zusatz
von Penicillin (200.000IE/l) kann die Haltbarkeit erhöhen. Das konservierte
Hammelblut ist bei +5 °C ± 3 °C ca. drei Wochen haltbar.

2.4. Ambozeptor (Hämolysin)


Der Ambozeptor wird käuflich erworben und seine Aktivität vor erstmaligem
Gebrauch jeder Charge bestimmt.

2.5. Komplement
Das Komplement ist ein Misch-Plasma (also aus Citrat-Blut) von gesunden
Meerschweinchen, die vor dem Bluten 24 Stunden nicht gefüttert werden. Das Blut
kann durch Kardialpunktion gewonnen werden. Es kann portioniert bei -80 °C ±3 °C
aufbewahrt werden. Vor jeder KBR wird eine Komplement-Auswertung
vorgenommen.
Besser ist es, das Komplement käuflich zu erwerben.

FLI 94
Amtliche Methodensammlung Stand: Mai 2013

2.6.Witte-Lösung (Kalium-Borlösung) zur Konservierung von


Meerschweinchenkomplement
Kaliumsulfat 10,0 g
Borsäure 4,0 g
Aqua bidest. ad 100,0 ml
1h bei 100 °C im Dampftopf lösen,

Komplement und Konservierungslösung werden zu gleichen Teilen gemischt. Der


Verdünnungsfaktor des Komplements muss beim Ansatz (Komplementauswertung
und Hauptversuch) berücksichtigt werden. Haltbarkeit bei geringem Titerabfall ca.
acht Wochen.

2.7. Karbonatpuffer: (0,05 M, pH 9,6)


Na 2 CO 3 1,59 g
NaHCO 3 2,93 g
Aqua dest. ad 1000 ml

2.8. Blocking-Puffer:
Karbonatpuffer 0,05 M, pH 9,6 + 3 % fötales Kälberserum (FKS)
Das Kälberserum kann portioniert bei -20 °C eingefroren werden.

2.9. Phosphatpuffer mit Tween 20 ( PBS-Tween 0,05 % ), pH 7,4


NaCl 8,0 g
Na 2 HPO 4 x 2H 2 O 2,9 g
KH 2 PO 4 0,2 g
KCl 0,2 g
Aqua dest. ad 1000 ml
Tween 20 0,5 ml

2.10. Puffer für Proben, Kontrollen und Konjugat:


PBS - Tween, pH 7,4 + 6 % FCS

2.11. Konjugat
Kaninchen anti-Pferd IgG (H+L)/Meerrettich-Peroxidase konjugiert (Nordic
Immunology, Tilburg, Holland, zu beziehen über TEBU, Frankfurt a. M.),
Arbeitsverdünnung nach Herstellerempfehlung.

2.12. Chromogen-Substrat-Lösung (ABTS, Serva oder Sigma)


Citrat-Puffer, pH 6
C6H8O7 x H2O 4,20 g  200 ml Aqua bidest.
Na 2 HPO 4 x 12 H 2 O 7,16 g  200 ml Aqua bidest.

ABTS 160 mg  400 ml Citratpuffer

Haltbarkeit der Chromogen-Substrat-Lösung: sollte immer frisch angesetzt werden


Unmittelbar vor Gebrauch wird der Substratlösung 1 % (w/v) H 2 O 2 (Perhydrol)
zugegeben.

Cave: H 2 O 2 -Konz. in Perhydrol (30 %) berücksichtigen!

FLI 95
Amtliche Methodensammlung Stand: Mai 2013

13. Blauzungenkrankheit

13.1. Charakterisierung der Infektion


13.1.1. Erreger
Das Bluetongue-Virus (BTV) ist ein dsRNA Orbivirus aus der Familie Reoviridae. Es
gibt mittlerweise 26 Serotypen von BTV.
Das komplette BTV-Partikel enthält ein Core mit Doppelkapsid, wobei die äußere
Schale zwei Proteine (VP2 und VP5) enthält, von denen VP2 die Hauptdeterminante
für den Serotyp ist. Das innere, ikosaedrische Core enthält zwei Haupt- und drei
untergeordnete Proteine und 10 dsRNA Segmente.

13.1.2. Klinische Symptomatik


Bluetongue ist eine infektiöse, nicht-kontagiöse und von Insekten übertragene
Krankheit der Schafe sowie anderer domestizierter und wild lebender Wiederkäuer.
In vielen Gebieten der Welt hat die Krankheit wegen der insektengebundenen
Übertragung ein saisonales Auftreten. Die typischen klinischen Symptome sind nur
beim Schaf anzutreffen, wogegen andere befallene Wiederkäuer meist
asymptomatisch infiziert sind. Klinische Symptome sind massive Ödeme und
Hämorrhagien mit Fieber und Entzündungen bis hin zu Ulzera der Schleimhäute.
Häufig kommt es zu Trächtigkeitsstörungen mit Aborten und Fetopathien, auch durch
schwach virulente Serotypen und attenuierte Viren (Impfstoffe). Typisch und
namengebend für die Krankheit ist die intensive Hyperämie und Schwellung der
Zunge (Bluetongue), die aber nicht regelmäßig festgestellt werden können.

13.1.3. Differentialdiagnostik
Grundsätzlich gilt, dass auch bei „typischer“ Symptomatik die Diagnose BT anhand
des klinischen Bildes lediglich mit einer Sensitivität von 76 % und einer Spezifität von
72 % gestellt werden kann (Elbers et al., 2008). Als Differentialdiagnosen kommen in
erster Linie alle Zustände, die zu Fruchtbarkeitsstörungen und Aborten führen, in
Frage. Als virale Infektionserreger sind hier zu nennen: MKSV, Rinderpest Virus,
Akabane Virus, Border Disease Virus, ORF-Virus, EHDV, Bösartiges Katarrhalfieber
Virus, BVD/MD und BHV1. Zudem sind auch Photosensibilität, Besnoitiose und
Mykotoxikose als Differentialdiagnosen zu berücksichtigen.

13.1.4. Diagnostische Indikation


siehe VO zum Schutz gegen die Blauzungenkrankheit

13.1.5. Zuständige Untersuchungseinrichtungen


Friedrich-Loeffler-Institut, Institut für Virusdiagnostik, Südufer 10, 17493 Greifswald -
Insel Riems

FLI 96
Amtliche Methodensammlung Stand: Mai 2013

13.1.6. Rechtsgrundlagen
• Richtlinie 92/119/EWG
• Richtlinie 2000/75/EG
• Verordnung (EG) Nr. 1266/2007
• Verordnung zum Schutz gegen die Blauzungenkrankheit vom 22. März 2002
in der jeweils geltenden Fassung

13.2. Untersuchungsmaterial
Gerinnungsgehemmtes Blut. Hier eignet sich am besten EDTA-Blut, da mit diesem
Untersuchungsmaterial sowohl der AK-Nachweis mittels ELISA als auch die real-time
RT-PCR durchgeführt werden kann. Das EDTA-Blut sollte im gekühlten (+4 °C)
Zustand versendet werden. Lagerung über längere Zeit sollte bei -70 °C erfolgen,
weil BTV bei -20 °C nicht lange stabil bleibt.

Post mortem sind Milz und Lymphknoten die Organe der Wahl zur Virusisolierung,
schnellstmöglicher Versand erfolgt bei +4 °C.

Für den Antikörpernachweis können EDTA-Blut oder mindestens 500 μl Serum/


Plasma eingesendet werden.

13.3. Untersuchungsgang
Für den BTV-Genom-Nachweis und den Nachweis von BTV-Antikörpern stehen
zugelassene Diagnostika zur Verfügung, die angewendet werden sollten. Darüber
hinaus kann auf nachfolgende BTV-Nachweisverfahren hingewiesen werden.
Aktuelle Methoden zur Viruscharakterisierung sollten im NRL-BT nachgefragt
werden.

13.1.1. Erregernachweis

Virusisolierung
Die Virusisolierung in embryonierten Hühnereiern ist sehr schwierig in der
Durchführung (intravasale Inokulation von 10 bis 12 Tage alten Eiern). Routinemäßig
erfolgt die Anzucht von BT-Viren aus gerinnungsgehemmten Blut auf Aorten-
Endothelzellen, Verozellen, Insektenzellen bzw. auf BHK21-Zellen. Generell ist die
Effizienz der Zellkulturanzucht geringer als die der Virusisolierung in embryonierten
Eiern.

Antigennachweis
Ein indirekter Sandwich-ELISA zum BTV-Antigennachweis wurde am Institute for
Animal Health in Pirbright, U.K. entwickelt. Aufgrund der höheren Sensitivität und
Spezifität der RT-PCR hat der AG-ELISA im Routinelabor keine Bedeutung mehr.

Polymerase Kettenreaktion (PCR)

FLI 97
Amtliche Methodensammlung Stand: Mai 2013

Für den Nachweis aller Serotypen werden Pan-BTV-real-time RT-PCR eingesetzt.


Hier gibt es verschiedene vom FLI zugelassene real-time RT-PCR Kits, die
angewendet werden sollten. Des Weiteren werden spezifische real-time RT-PCR
Systeme zum Nachweis der BTV-Serotypen angewendet. Zusätzlich stehen
klassische RT-PCR-Systeme zur Verfügung, die eine spezifische Amplifikation der
verschiedenen Serotypen erlauben.

13.3.1. Antikörpernachweis
In Deutschland sind kommerzielle cELISA für den BTV-AK-Nachweis aus Serum und
Plasma zugelassen (z. B. VMRD, IDvet, Pourquier-IDEXX). Diese Tests werden
aufgrund ihrer einfachen Anwendung, verbunden mit einer hohen Spezifität und
Sensitivität, routinemäßig am FLI eingesetzt und sind die erste Wahl für die
Untersuchung auf BTV-Antikörper. Für den sehr frühen Nachweis von BTV-Ak nach
Infektion und für den sensitiven Nachweis von Impfantikörpern wurde Doppel-Antigen
(Sandwich)-ELISA durch das FLI zugelassen (ID Screen Bluetongue Early Detection,
ID-VET; PrioCHECK BTV DR, Prionics Deutschland). Weiterhin ist es möglich,
mittels kommerziellen Milch-ELISA BTV-AK auch in der Milch von Rind und Schaf zu
detektieren. Auch hierzu steht ein zugelassener ELISA zur Verfügung (ID Screen
Blue Tongue Milk Indirect, ID-VET).

Literatur
Elbers A.R.W., Backx A., Ekker H.M., van der Spek A.N., van Rijn P.A. (2008):
Performance of clinical signs to detect bluetongue virus serotype 8 outbreaks in cattle
and sheep during the 2006-epidemic in The Netherlands. Veterinary Microbiology
129; 156-162.

FLI 98
Amtliche Methodensammlung Stand: Mai 2013

14. Bovine Herpesvirus Typ 1-Infektion (alle Formen)


14.1. Charakterisierung der Infektion
14.1.1. Erreger
Das Bovine Herpesvirus Typ 1 (BHV-1) gehört zur Familie der Herpesviridae,
Subfamilie Alphaherpesvirinae, Gattung Varicellovirus. Es verursacht verschiedene
Krankheitsbilder, verhält sich aber immunologisch einheitlich. Nur über Analysen des
Genoms ist in vielen Fällen eine Differenzierung zwischen „IBR-Stämmen" und
„IPV/IBP-Stämmen" möglich. Die Infektion ist weltweit verbreitet und erreicht in vielen
Ländern hohe Prävalenzen. Dänemark, Österreich, Bozen, Schweden, Finnland, die
Schweiz und Bayern sind anerkannt BHV-1-frei. Deutschland (außer Bayern) besitzt
neben der Tschechischen Republik und der italienischen Autonomen Region Friaul-
Julisch-Venetien und der Autonomen Provinz Trient die EU-Anerkennung für sein
BHV-1-Bekämpfungsprogramm (2004/215/EG und 2004/558/EG) und damit den so
genannten „Artikel 9-Status“ gemäß der Richtlinie 64/432/EWG. Mehr als 94% aller
Milchviehbetriebe in Deutschland sind BHV-1 Feldvirus-frei.

14.1.2. Klinische Symptomatik


Die BHV-1-Infektion ist eine überwiegend akut verlaufende, hochkontagiöse
virusbedingte Allgemeinerkrankung des Rindes und anderer Boviden. Die
Inkubationszeit liegt bei allen Verlaufsformen etwa zwischen 2 und 6 Tagen.
Die vorwiegend respiratorische Manifestationsform wird als Infektiöse Bovine
Rhinotracheitis (IBR) bezeichnet. Sie geht in ihrer akuten Form mit Fieber bis zu 42
°C, serösem Nasenausfluss, einer Hyperämie der Schleimhäute von Flotzmaul und
Nase sowie Speicheln einher. Bereits zu Beginn der Erkrankung sinkt die
Milchleistung laktierender Tiere. Später treten Husten und Augenausfluss auf.
Teilweise sind auf der Nasenschleimhaut stecknadelkopfgroße, pustelartige
Erhebungen zu beobachten. Die Krankheitsdauer beträgt 10 bis 14 Tage. Bei
Kälbern fällt die IBR in der Regel als fieberhafte Allgemeinerkrankung mit vorwiegend
respiratorischen Symptomen auf. Bakteriell bedingte Pneumonien treten als schwere
Sekundärinfektionen auf. Sehr selten werden innerhalb weniger Tage letal
verlaufende Meningoenzephalitiden bei Kälbern im Alter von 4 bis 6 Monaten
beobachtet. Trächtige Kühe können vor allem im 5. bis 8. Trächtigkeitsmonat nach
einer Inkubationszeit von 3 bis 6 Wochen abortieren. Nicht selten verläuft die
Infektion jedoch bei einzelnen Tieren oder in ganzen Herden klinisch inapparent.
Die genitale Form der Infektion tritt als Infektiöse Pustuläre Vulvovaginitis (IPV) beim
weiblichen Rind und als Infektiöse Balanoposthitis (IBP) beim Bullen auf. Sie geht oft
mit leichtem Fieber, Rötung und Schwellung der Schleimhaut der äußeren
Genitalien, Unruhe und schmerzhaftem Harndrang einher. Auf der
Genitalschleimhaut bilden sich stecknadelkopf- bis kirschkerngroße, bläschenartige,
grau-weiße Erhebungen mit gerötetem Hof, die sich zu Pusteln, kruppösen
Veränderungen und ulzerativen Erosionen weiterentwickeln können.
Einmal infizierte Tiere bleiben wie generell bei Herpesvirusinfektionen lebenslang
latent infiziert. Nach Reaktivierungen der Infektion, die meist klinisch inapparent
bleibt, kommt es zur Virusausscheidung und zur Übertragung auf andere Tiere. Auch
geimpfte Tiere können Wildtypvirus aufnehmen und ohne Erkrankung zu Virusträgern
werden. Die Virusausscheidung erfolgt hauptsächlich mit den Sekreten der

FLI 99
Amtliche Methodensammlung Stand: Mai 2013

Schleimhäute des Genitaltraktes (IPV/IBP), des Respirationstraktes und dem


Konjunktivalsekret (IBR), aber auch mit dem Kot und mit dem Sperma. Die
Virusausscheidung dauert selten länger als 14 Tage über den Respirationstrakt,
vaginal bis zu 14 Tagen und beim Bullen bis zu 4 Wochen. In der
Rekonvaleszenzphase befindliche Tiere können das Virus diskontinuierlich
ausscheiden. Die Reaktivierung latenter Infektionen kann durch Immunsuppression
(z. B. durch Behandlung mit Glukokortikoiden oder besondere Belastungen wie
Geburts- oder Transportstress) provoziert werden.

14.1.3. Differentialdiagnostik
Differentialdiagnostisch kommen bei der IBR andere viral oder bakteriell bedingte
Respirationserkrankungen sowie Infektionen mit Lungenwürmern in Betracht. Die IPV
muss gegen bakteriell und parasitär (Tritrichomonas fetus) bedingte Deckinfektionen
abgegrenzt werden. Bei der differentialdiagnostischen Abklärung infektiöser
Abortursachen sind unter anderem die BVD/MD-Infektion, bakterielle Erkrankungen
(z. B. Leptospirose, Chlamydiose, Coxiellose) und parasitäre Infektionen (z. B.
Neosporose) in Erwägung zu ziehen.

14.1.4. Diagnostische Indikation


Diagnostische Indikationen sind beim Auftreten klinischer Erkrankungen und Aborten,
bei der Bestandssanierung, beim Verbringen von Rindern in Bestände mit BHV-1-
freien Tieren sowie beispielsweise bei An- und Verkaufsuntersuchungen gegeben
(siehe auch 15.1.6).

14.1.5. Zuständige Untersuchungseinrichtungen


• Staatliche Lebensmittel- und Veterinäruntersuchungsämter der Bundesländer
• NRL und OIE Referenzlabor für BHV1 am Institut für Virusdiagnostik des FLI,
Insel Riems – Abklärungsuntersuchungen.

14.1.6. Rechtsgrundlagen
• Verordnung zum Schutz der Rinder vor einer Infektion mit dem Bovinen
Herpesvirus Typ 1 (BHV-1-VO) in der Neufassung vom 20. Dezember 2005
(Bundesgesetzblatt I S. 3520)

FLI 100
Amtliche Methodensammlung Stand: Mai 2013

14.2. Untersuchungsmaterial
14.2.1. Untersuchungsmaterial für den Erregernachweis
Nasen- und Genitaltupfer; Abortmaterial, Organmaterial wie Lunge, Gehirn, Ganglien,
Tonsille (Menge: ca. 0,5 bis 1 cm3) bei verendeten bzw. geschlachteten Tieren sowie
Spermaproben (Frischsperma oder abgefüllte Proben in Verdünnerlösung/
Paillettensperma). Lagerung bei -20 °C, optimal bei -70 °C.
Mehrfaches Einfrieren und Auftauen führt zur drastischen Senkung des Virustiters
und damit der Nachweisbarkeit in der Zellkultur.

14.2.2. Untersuchungsmaterial für den Antikörpernachweis


Plasma, Serum: mindestens 500 μl
Milchproben: Einzel- oder Sammelmilch; für Nativmilchverfahren mind. 500 μl,
für Konzentrierungsverfahren mind. 50 ml

14.3. Untersuchungsgang
• O.I.E. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (2012,
Part 2, Section 2.4, Chapter 2.4.13; Stand 2010).

14.3.1. Erregernachweis
14.3.1.1. Virusisolierung in der Zellkultur
BHV-1 vermehrt sich in bovinen Zellkulturen und -linien (z. B. MDBK, KOP), teilweise
auch in Zellen anderer Herkunft. Die Infektion verläuft zytopathisch und führt im
Monolayer zur Plaque-Bildung. Bei den meisten Zelllinien runden sich die Zellen
innerhalb der Plaques ab oder bilden seltener kleine Synzytien.

Ausführung:
• Homogenisieren des Organmaterials, Herstellen einer Organsuspension (10-
20%) unter Verwendung antibiotika- bzw. antimykotikahaltigen Mediums
(Anlage), Inkubation für 1 bis 2 h bei 4 °C im Kühlschrank, anschließende
Klär-Zentrifugation. Tupferproben werden in Virusanzuchtmedium für etwa 15s
stark geschüttelt (Vortex). Die Probenflüssigkeit kann dann direkt auf die
Zellkultur aufgebracht werden. Nicht angeimpfte Proben können bei –70 °C
gelagert werden. Die Proben sollten weder gefriergetaut noch mit Ultraschall
behandelt werden.
Spermaproben in Verdünnerlösung (in der Regel gebrauchsfertig in Pailletten
verpackt) werden unverdünnt und in einer 1:10 Verdünnung
(Virusanzuchtmedium) angeimpft. Die Proben sollten tiefgefroren geliefert und
sofort nach dem Auftauen bearbeitet werden. Native Spermaproben werden
vor der Animpfung 1:10 und 1:100 in Virusanzuchtmedium verdünnt.
Nicht angeimpfte Proben können bei –70 °C gelagert werden.

• Inokulation der bearbeiteten Probe auf die entsprechende Zellkultur (z. B.


MDBK, FBTr oder KOP) sollte im Doppelansatz erfolgen. Zur Vermeidung von
toxischen Effekten (z. B. bei Spermaproben) kann die Probe nach 1-4 h

FLI 101
Amtliche Methodensammlung Stand: Mai 2013

Adsorption bei 37 °C wieder entfernt und vollständig durch


Virusanzuchtmedium ersetzt werden (lichtmikroskopische Kontrolle!). Zur
Virusisolierung können 24-Lochplatten, Zellkulturröhrchen oder
Zellkulturflaschen verwendet werden. Das Medium sollte zur Verhinderung
bakterieller Kontaminationen Antibiotika und eventuell Antimykotika in
gebräuchlichen Konzentrationen enthalten (Anlage). Die Bebrütung sollte bei
37 °C für mindestens 7 Tage erfolgen. Nach 7 Tagen werden 1000 μl
Zellkulturüberstand aus den beimpften Zellkulturen jeweils auf frisch angelegte
Kulturen verbracht (1. Passage) und für weitere 5 bis 7 Tage bei 37 °C
inkubiert. Die Überstände können bei Bedarf (z. B. Rücklage für weitere
Abklärung) bei -70 °C gelagert werden. In der Regel werden bis zu 2
Blindpassagen durchgeführt. Eventuell sind weitere Passagen notwendig.

• tägliche Kontrolle des Auftretens eines CPE (bei hohem Virusgehalt diffus
verteilte Zellabkugelungen nach ca. 1 bis 2 Tagen, bei niedrigem Virusgehalt
einzelne Plaques mit Abrundung der Zellen oder Ausbildung kleiner
Synzytien). Zur Sicherung der Diagnose kann der Zellrasen nach Fixierung mit
Hilfe von BHV-1-spezifischen Antikörpern (polyklonales Antiserum oder
monoklonale Antikörper) angefärbt werden (Immunfluoreszenz- oder
Immunperoxidase-färbung).

Identifizierung durch Virusneutralisation


Das vermeintliche BHV-1-Isolat sowie ein BHV-1 Referenzvirus in log10-Schritten mit
einem BHV-1-positiven monospezifischen Referenzserum und einem BHV-1-
negativen Referenzserum vom Rind (kann vom NRL für BHV-1 angefordert werden)
verdünnen und für 24 h bei 37 °C inkubieren, anschließend:
• Inokulation des Virus-Serumgemisches auf eine 96-well Mikrotiterplatte
(Vierfachansatz) und anschließende Bebrütung für 4 Tage bei 37 °C,
• Kontrolle der virusneutralisierenden Aktivität.
• Differenz von mindestens 1 log10 ist hinweisend für BHV-1

14.3.1.2. Nachweis von BHV1-DNA mittels Polymerasekettenreaktion (PCR)


Die PCR kann zum Nachweis von BHV-1-DNA in Organproben, in Tupferproben und
in Blutproben während der Virämiephase genutzt werden. Die PCR eignet sich ferner
für den BHV-1-Nachweis in Spermaproben.
Der Nachweis latenter Infektionen mittels PCR (z. B. Nachweis in Organproben) ist
schwierig und für die allgemeine Diagnostik nicht geeignet. Je nach Fragestellung
sind in der Literatur verschiedene PCR-Techniken für die BHV-1-Infektion
beschrieben. Primer und die Amplifikationsparameter müssen entsprechend der
Zielstellung ausgewählt werden. Die PCR muss für die jeweiligen spezifischen
Bedingungen optimiert werden, um unter Routinebedingungen erfolgreich zu
funktionieren.

Generelle Arbeitsschritte sind:


• Homogenisierung des zu untersuchenden Probenmaterials
• DNA-Extraktion (z. B. Phenol-Chloroform-Extraktion nach Proteinase K-
Verdau oder Verwendung kommerzieller Systeme wie z. B. Roche High pure
PCR Template Preparation Kit oder QIAamp DNA Kit)

FLI 102
Amtliche Methodensammlung Stand: Mai 2013

15.3.1.2.1. Konventionelle Polymerasekettenrektion (PCR)


• Amplifikation in der PCR, in Ausnahmefällen nested-PCR
• Agarosegel-Elektrophorese
• für die Differenzierung von BHV-1-Markerimpfvirus und Wildtypvirus können
beispielsweise gE- und gB-spezifische Primer eingesetzt werden.

Nähere Angaben zur Anwendbarkeit der PCR im Rahmen der BHV-1-Diagnostik sind
beim NRL für BHV-1 zu erhalten. Angaben zu Primern, Reagenzien und Zykluszeiten
finden sich im Anhang.

15.3.1.2.2. Nachweis von BHV-1-DNA mittels real-time Polymerasekettenrektion


(qBHV-1 PCR)
Diverse real-time PCR-Protokolle zum Nachweis von BHV-1 sind mittlerweile
publiziert. Der BHV-1-Nachweis ohne anschließende Produktanalyse steht in Bezug
auf Sensitivität nicht hinter den konventionellen nested PCR-Methoden zurück.
Generell birgt für den BHV-1-Nachweis die PCR gegenüber der Virusanzucht keinen
wirklichen Sensitivitätsvorsprung, ist andererseits jedoch automatisierbar und
wesentlich schneller durchzuführen.

qBHV-1 Triplex-PCR nach Wernike et al.


Das BHV-1-gD/gE real-time PCR-System ermöglicht den sensitiven und spezifischen
Nachweis von Genomen des Bovinen Herpesvirus Typ 1verbunden mit der schnellen
und direkten Differenzierung von Wildtyp-Viren und gE-deletierten Impfviren. Der
Assay besteht aus einem Texas Red-markierten Nachweissystem für das
Glykoprotein D-Gen (gD) und einem FAM-markierten Nachweissystem für das
Glykoprotein E-Gen (gE). Somit ermöglicht dieser Multiplex-Assay eine
Unterscheidung von gE-deletierten Impfviren von Feldviren.

Zur Überprüfung der erfolgreichen DNA-Extraktion und Amplifikation wurde der BHV-
1- Assay mit einem internen Kontrollsystem, basierend auf dem beta-Aktin-Gen,
gekoppelt. Hierbei werden die Sonde und der reverse Primer des beta-Aktin-Assay
(nach Toussiant et al., 2007) mit einem neuen Forward-Primer kombiniert. Dieser
neue Forward-Primer ist nicht mehr nur mRNA-spezifisch, sondern amplifiziert auch
sehr erfolgreich die genomische beta-Aktin-DNA aller bisher getesteten Vertebraten.

Um einen Hinweis auf vorkommende Kreuzkontaminationen während der DNA-


Isolierung zu erhalten, wird bei jeder Extraktion mindestens eine DNA-
Isolierungskontrolle (DIC) mitgeführt. Hierbei wird negatives Probenmaterial (z.B.
Serum oder negative Nasentupferproben) zusammen mit den Feldproben
aufgearbeitet. Die DIC dient somit auch als positive Kontrolle für das IC-
Detektionssystem. Werden parallel mehr als 7 Feldproben aufgearbeitet sollte mehr
als eine DIC mitgeführt werden.

Allgemeines:
a) Die Amplifizierung erfolgt auf Basis des QuantiTect Multiplex PCR NoROX
Kit (#204741, #204743, #204745; Qiagen) in 25µl Gesamtvolumen.

FLI 103
Amtliche Methodensammlung Stand: Mai 2013

b) Als Kontrollen werden neben der/den DNA-Isolierungskontrolle/n (DIC) eine


„No Template“ Kontrolle (NTC) und mindestens eine positive Kontrolle (PC)
mitgeführt.
Auswertung der generierten Fluoreszenzdaten:
HEX-Kanal:
a) Für alle Gewebeproben und die entsprechende Extraktionskontrolle sollte
die Beta-Aktin-IC mit einem vergleichbaren Quantification Cycle (Cq)
nachweisbar sein. Sind die Cq-Werte für die genannten Proben vorhanden,
ist von einer erfolgreichen DNA-Isolierung und PCR auszugehen. Ist kein
Cq-Wert für die IC feststellbar und gleichzeitig auch keine BHV-1-spezifische
Amplifizierung aufgetreten, ist die real-time PCR nicht auswertbar und somit
ist die DNA-Isolierung und/oder die PCR zu wiederholen.
b) Für die NTC und die PC (in Abhängigkeit von der Art der Kontrolle) sollte
kein Cq-HEX-Wert feststellbar sein

Texas Red-Kanal und FAM-Kanal:


a) Für die PC sollte jeweils ein Cq-Wert von ca. 33 eingestellt werden.
Mit der PC wird die Funktion des BHV-1-gD-und gE-Detektionssystems
sichergestellt. Ist für die PC kein Cq-Wert feststellbar, ist die PCR mit neuen
Primer-Sonden-Mixen und/oder einer neuen PC zu wiederholen.
b) Für die DIC und die NTC sollte kein Cq -Wert feststellbar sein.
c) Wenn alle eingesetzten Kontrollen in richtiger Weise reagieren, ist eine
Auswertung der zu untersuchenden Proben möglich.

Eine BHV-1-Verdachtsprobe wird dann als positiv in der PCR gewertet, wenn
ein Cq-Texas Red-Wert für die entsprechende Probe festgestellt wird und/oder
ein signifikanter Anstieg der Texas Red-Fluoreszenz über das Basislevel
festzustellen ist.
Bei einem gD-Texas Red- und gE3-FAM-Nachweis ist in der untersuchten
Probe BHV-1-Feldvirusgenom nachgewiesen.
Kann nur gD-Texas Red detektiert werden, ist von einem gE-deletierten
Impfvirusgenom auszugehen.
Ein signifikantes positives gE3-FAM-Signal bei gleichzeitigem Vorliegen eines
negativen gD-Texas Red-Ergebnis kann durch nah verwandte, nicht-BHV-1-
Herpesviren, begründet sein. Hier empfiehlt sich, zur weiteren Abklärung das
NRL-BHV-1 zu kontaktieren.

Hinweis:
• Positive PCR-Ergebnisse sollten möglichst durch die Virusisolierung und
nachfolgende serologische Untersuchungen verifiziert werden.

14.3.2. Indirekter Erregernachweis


14.3.2.1. Enzyme Linked Immunosorbent Assay (ELISA)
Mehrere kommerziell erhältliche und in Deutschland zugelassene ELISA-Systeme
existieren, mit denen Antikörper gegen das gesamte Virus (indirekter „Vollvirus“
ELISA) oder gegen einzelne Glykoproteine (gB- bzw. gE-blocking ELISA)
nachgewiesen werden können. ELISA-Systeme zum Nachweis von Antikörpern
gegen das Glykoprotein E dienen als spezifisches Diagnostikum zur Unterscheidung

FLI 104
Amtliche Methodensammlung Stand: Mai 2013

von uninfizierten Rindern und Tieren, die mit gE-Markerimpfstoff immunisiert wurden,
von solchen, die mit Wildtyp-BHV-1 in Kontakt waren (Marker- oder DIVA-Prinzip).
Bezüglich der Durchführung der einzelnen ELISAs wird auf die Produktinformationen
der Hersteller verwiesen.
BHV-1-Referenzseren für die ELISA Diagnostik können vom NRL für BHV-1
angefordert werden.
Die höchste Sensitivität besitzen die gB-blocking-ELISAs sowie moderne indirekte
ELISA-Systeme (> 98 %). In der Regel ist die Sensitivität dieser Systeme deutlich
höher als die des Neutralisationstests. Geringere Sensitivitäten werden hingegen mit
den gE-blocking-ELISAs erreicht. Dies ist insbesondere bei Einzeltieruntersuchungen
problematisch. Im Gegensatz hierzu ist die „Herdensensitivität“ der gE-blocking-
ELISAs als hoch zu bewerten.
Für Milchproben eignen sich ausschließlich die zugelassenen indirekten ELISA-
Systeme, die speziell auf die Untersuchung von Einzel- oder Tankmilchproben
ausgerichtet sind. Moderne indirekte ELISAs erlauben die sensitive und spezifische
Untersuchung von Nativmilchpools von bis zu 50 Tieren. Diese Testsysteme sind in
der Lage, ein schwach positives Tier in einer Poolprobe zu erkennen. Ein
zuverlässiger Markertest für Milchproben existiert dagegen bisher nicht. Die
zugelassenen gE-blocking-ELISAs reagieren mit Sammelmilchproben erst dann
sicher positiv, wenn mehr als 10 % der Herde BHV-1-gE-Antikörper-positive
Reagenten sind.
Derzeit werden vom NRL für BHV-1 alle gE-blocking-ELISA, indirekte Milch- und
Serum-ELISA-Testchargen einer Prüfung unterzogen. Andere BHV-1-Antikörper-
ELISAs werden nach einer Freistellung von der Chargenprüfung stichprobenartig
untersucht.

14.3.2.2. Neutralisationstest zum Nachweis von BHV1-Antikörpern (NT)


Der Neutralisationstest basiert auf dem Nachweis der neutralisierenden Aktivität von
Rinderseren gegen das BHV-1. Durch logarithmische Verdünnung der Seren wird der
neutralisierende Antikörpertiter im Vergleich zu mindestens einem schwach positiven
und einem negativen Standardserum bestimmt. Die Titer werden nach der Tabelle
von Kärber als neutralisierende Dosis 50 % oder 100 % (ND50 oder ND100)
berechnet. Eine Rücktitration des Testvirus stellt die Verwendung einer korrekten
Virusmenge für die Neutralisierung sicher. Aufgrund ihrer Sensitivität und der
Eignung für Massenuntersuchungen haben ELISA-Testsysteme den NT für
allgemeine diagnostische Zwecke weitestgehend abgelöst. Er sollte jedoch zur
Abklärung unplausibler Reaktionen und zur Untersuchung von rinderartigen Spezies
(Bovinae), die nicht zu den Rindern gehören, als Referenzmethode zur Verfügung
stehen.
In jedem Fall ist eine Serum-Virus-Inkubation von mindestens 12 besser 24 Stunden
einzuhalten, da die Sensitivität damit im Vergleich zu einer 1- bis 2-stündigen Serum-
Virus-Inkubation signifikant ansteigt.

Ausführung:
Herstellen und Titrieren von BHV-1-Testvirus
• MDBK-Zellen niedriger Passage 1:6 in 175 cm² Kulturflaschen teilen.
Nachdem sich ein nahezu konfluenter Zellrasen gebildet hat (nach ca. 24h)
Erhaltungsmedium zugeben und mit etwa 0,1 infektiösen Einheiten BHV-1 (z.
B. Stamm Schönböken) pro Zelle beimpfen (etwa 100 μl einer BHV-1-haltigen
Virussuspension mit einem Titer von 107 KID50/ml je 175 cm² Kulturflasche).

FLI 105
Amtliche Methodensammlung Stand: Mai 2013

Nach 24-36 h, wenn erste Zeichen eines zytopathischen Effektes sichtbar


werden, Überstand von den Kulturflaschen steril entnehmen, bei 2500 x g für
3 min zentrifugieren und in 1 ml-Portionen abfüllen. Die Lagerung erfolgt sofort
bei mindestens -70 °C. Diese Viruspassage wird im Folgenden als Testvirus
(TV) bezeichnet.
• Zwei Röhrchen mit eingefrorenem Testvirus schonend auftauen, in log10-
Schritten von 10-1 bis 10-8 in Anzuchtmedium verdünnen und jeweils 100 μl
der verdünnten Virussuspension im Achtfachansatz auf 96-Loch-
Mikrotiterplatten pipettieren und für 24 h bei 37 °C und 5 % CO2 inkubieren.
MDBK-Zellen auf eine 75 cm² Kulturflasche 1:6 teilen und für 24 h inkubieren.
Nach 24 h Zellen mittels Trypsinlösung ablösen, zählen und auf 300 000
Zellen/ml mit Anzuchtmedium verdünnen. Je 100 μl Zellsuspension auf die
vorinkubierten Mikrotiterplatten geben.
• Nach 4 Tagen zytopathischen Effekt beurteilen (tägliche protokollierte
Kontrolle!). Berechnung des BHV-1-Titers erfolgt nach der Tabelle von Kärber
als kulturinfektiöse Dosis 50 % (KID50). Aus beiden Ansätzen wird das
geometrische Mittel der erhaltenen 24-h-Titer berechnet (Summe der
Exponenten geteilt durch Anzahl der Exponenten: z. B. 107,3 KID50/ml und
107,7 KID50/ml = 10((7,3+7,7)/2) = 107,5 KID50/ml).

Vorbereiten der Seren


• Serum von Nativblutproben wird für 30 Minuten bei 56 °C im Wasserbad
inaktiviert.

Testdurchführung
• Verdünnung der Test- und Referenzseren (Positiv-, Negativserum) in log2-
Schritten in der Mikrotiterplatte: 50 μl Mediumvorlage in alle Vertiefungen
außer in Reihe A (unverdünnter Ansatz) pipettieren, 100 μl Serumvorlage in
Reihe A zugegeben und jeweils 50 μl in nächste Reihe überführen, achtmal
pro Verdünnungsschritt mischen, in der letzten Reihe 50 μl verwerfen („log2-
Verdünnungsreihe“). Je Serum sollte mindestens ein Dreifachansatz
untersucht werden.
• Testvirus durch Verdünnung in Anzuchtmedium auf 102 KID50/50 μl (= 103,3
KID50/ml) einstellen. Hierfür sollte pro Verdünnungsschritt nicht weniger als
0,5 ml Virussuspension und keine Einzelverdünnung größer als 1:10
verwendet werden (z. B. Ausgangstiter des Testvirus = 107,3 KID50/ml,
benötigte Virussuspensionsmenge = 50 ml. Daraus folgt ein
Verdünnungsfaktor von 107,3 – 103,3 = 104 = 10000; Verdünnungsreihe: 0,5 ml
Virussuspension + 4,5 ml Medium → 0,5 ml VS1 + 4,5 ml M → 0,5 ml VS2 +
4,5 ml M → 5 ml VS3 + 45 ml M).
• Zugabe von 50 μl des verdünnten Testvirus (eingestellt auf 100 KID50/50 μl)
zu den Serumverdünnungen, Platte kurz schütteln und für 24 h bei 37 °C und
5 % CO2 inkubieren.
• Virusrücktitration in log10-Stufen: 0,5 ml der verwendeten Virusverdünnung
werden hierzu 10-1 bis 10-4 verdünnt und 50 μl der Virusverdünnung und der
jeweiligen Rücktitrationsverdünnungen im Achtfachansatz pipettiert. Die Platte
wird anschließend ebenfalls für 24 h bei 37 °C und 5 % CO2 inkubiert.
• Für alle Seren sollte eine Serumkontrolle (unverdünnt) im Doppelansatz
mitgeführt werden (Toxizitätskontrolle).

FLI 106
Amtliche Methodensammlung Stand: Mai 2013

• Nach 24 h werden 100 μl MDBK-Zellsuspension in Anzuchtmedium (ca.


30 000 Zellen/100 μl) zu allen Vertiefungen gegeben.
• Platten für 4 Tage bei 37 °C und 5 % CO2 inkubieren.

Ablesen und Auswerten des NT


• Alle Vertiefungen werden täglich mikroskopisch kontrolliert und die Ergebnisse
protokolliert. Die endgültige Bestimmung des nAk-Titers (z. B. ND100) erfolgt
am Tag 4. Bereits ein Virusplaque macht die entsprechende Vertiefung positiv.
• Der NT ist valide, wenn die Rücktitration einen Titer von 102+-/-0,5 ergibt, das
positive Kontrollserum nicht mehr als eine log2-Stufe vom Erwartungswert
abweicht und keine Virusneutralisation in den Vertiefungen des negativen
Kontrollserums nachweisbar ist.
• Die Serumkontrolle darf keine oder nur geringgradige Zeichen toxischer
Veränderungen aufweisen
• Berechnung des Neutralisationstiters (ND 100 ): (-log2) = a/b + c
a = Anzahl der Vertiefungen ohne Virusvermehrung
b = Anzahl der Vertiefungen pro Verdünnungsstufe
c = -log2 einer evtl. Vorverdünnung des Testserums (z. B. -log2 für 1:64 = 6)

BHV-1-positive und negative Referenzseren sowie Referenzmilchen zur Validierung


der BHV-1-Serologie sowie charakterisierte BHV-1-Virusstämme können vom NRL
für BHV-1 angefordert werden. Für den NT existiert ein spezielles „NT-Panel“ von 10
Seren mit unterschiedlichen BHV-1-Antikörper-Titern.

Referenzmaterial
Für die BHV-1-Serologie kann beim NRL für BHV-1 ein Panel an validierten
Referenz-seren und -milchen angefordert werden. Die deutschen Standardsera
orientieren sich dabei an den EU-Standards EU1 (positiv), EU2 (schwach positiv) und
EU3 (negativ). Die Seren sind als R1 (positiv), R2 (schwach positiv), R3 (sehr
schwach positiv) sowie R31 (negativ) und R32 (negativ) bezeichnet. Diese
Standardseren sollen jeweils als Basis für die Entwicklung laboreigener, angepasster
Standardproben dienen.
Zudem kann vom NRL für BHV-1 auf Anfrage ein „großes BHV-1-Referenzpanel“ mit
etwa 20 Seren sowie eine „NT-Panel“ mit etwa 10 Seren zu Validierungszwecken
angefordert werden.

FLI 107
Amtliche Methodensammlung Stand: Mai 2013

Anhang I: Reagenzien

Zelllinien
Virusisolierung und NT: MDBK oder FBTr (Fötale Bovine Trachea) oder KOP
(Kälberösophagus-Zellen)

Bezugsquelle: Zellbank für Zelllinien in der Veterinärmedizin, Friedrich-


Loeffler-Institut (FLI) Insel Riems (Leiter: Dr. M. Lenk).

Virusstämme
BHV-1-Virusstämme (z. B. Stamm Schönböken) können von der Virusbank des FLI
Insel Riems angefordert werden (Leiter: Dr. S. Reiche).

Medien
Anzuchtmedium:
• Eagle MEM Dulbecco w/L-Glutamin
• 10 % Fetales Kälberserum (FKS)
• Antibiotika

Antibiotika:
• Amphotericin B (250 μg/ml) 1:100
• Penicillin (100.000 IE/l), Streptomycin (100 mg/l) 1:100 oder Gentamycin (10
mg/ml) 1:1000

Erhaltungsmedium und Virusanzuchtmedium:


• Eagle MEM Dulbecco w/L-Glut. mit 2% FCS
• 2 % FKS
• Antibiotika

Puffer, Lösungen, Reagenzien


PBS:
8,00g NaCl + 0,2g KH 2 PO4 + 2,9g Na 2 HPO4 x 12 H 2 0 + 0,2g KCl
ad 1.000 ml Aqua bidest, pH 7,2

Isotonischer Phosphatpuffer:
8,28g NaCl + 3,30g Na 2 HPO4 x 12 H 2 0 ad 1.000 ml Aqua bidest
(IP) pH 7,8

IP-Glycerol:
IP - Glycerol = 9 : 1

Trypsinlösung:
Saline-Versen-Trypsinlösung zum Ablösen von Zellen

Lysispuffer:
8,29g NH 4 Cl + 1,0 g KHCO 3 , 1mM EDTA ad 1000 ml Aqua bidest,
pH 7,4

FLI 108
Amtliche Methodensammlung Stand: Mai 2013

Anhang II: PCR-Protokolle

Einleitung
In der hier vorliegenden Labormethodenanweisung werden spezielle PCR-Protokolle
zum Nachweis von Genomen des BHV-1 aufgeführt (gE- und gB-spezifische
Sequenzabschnitte).

Material und Geräte


Geräte:
Thermo Zykler / Real-time Zykler
Polymerase PFX Platinum (Gibco-BRL Life Technologies PCRx Enhancer © System)
dNTP Mix
Primer (gE und gB)
Quantitect Multiplex PCR No Rox Kit (Qiagen)
Primer-Sonden-Mix (β-Aktin, gD, gE)
mol.biol H2O.
ca. 1 - 10 μl aufgereinigte DNA-Suspension (enthält etwa 1 bis 50 μg DNA)

Durchführung
Die Durchführung teilt sich in Probenaufbereitung, eigentliche Polymerase-
Kettenreaktion und den Nachweis spezifischer Amplifikate.

Probenvorbereitung
Es werden mit Hilfe von Nukleinsäure-Isolierungs-Kits aufgereinigte DNAs eingesetzt
(Aufreinigung nach Beschreibung des Herstellers). Qualität und Quantität der DNA
können im Agarosegel abgeschätzt werden.
Es sind 1 bis 5 μl direkt nach der Aufreinigung gewonnene DNA-Suspension in der
BHV-1-PCR einzusetzen. Im Einzelfall kann von der Menge abgewichen werden
bzw. eine genaue Messung mittels Photometrie erfolgen.

Konventionelle BHV-1-PCR zum Nachweis von gE- und gB-spezifischen


Genomabschnitten

a) BHV-1-gE-PCR:
• Mastermix
PFX Platinum (Invitrogen)

10X Puffer 5 μl
MgSO4 2 μl (50 mM stock solution)
10x Enhancer 5 μl
dNTP Mix 4 μl (2,5 mM stock solution)
Primer Mix 2 μl (10 pmol/μl stock solution entspricht ca. 50 ng/μl)
Template 2-5 μl (10 bis 500 ng)
Taq Polymerase 2,5 U (PFX Platinum Taq Polymerase
H2O ad 50 μl

FLI 109
Amtliche Methodensammlung Stand: Mai 2013

• Primer
gE_1: GCTTCGGTCGACACGGTCTT
gE_2: GGTACGTCTCCAAGCTGCCC
Produktgröße: etwa 265 bp

• PCR-Zyklus
96°C 5 min
10x:
65°C 90 sec
72°C 100 sec
96°C 80 sec
15x:
54°C 90 sec
72°C 100 sec
96°C 80 sec
10x:
60°C 90 sec
72°C 100 sec
96°C 80 sec
72°C 10 min
12°C hold

b) BHV-1-gB-PCR

• Mastermix
PFX Platinum (Invitrogen)

10x Puffer 5 μl
MgSO4 1,5 μl (50 mM stock solution)
10x Enhancer 5 μl
dNTP Mix 4 μl (2,5 mM stock solution)
Primer Mix 2 μl (10 pmol/μl stock solution entspricht ca. 50 ng/μl)
Template 2-5 μl (10 bis 500 ng)
Taq Polymerase 2,5 U (PFX Platinum Taq Polymerase)
H 2 O ad 50 μl

• Primer
gB1: TACGACTCGTTCGCGCTCTC
gB2: GGTACGTCTCCAAGCTGCCC
Produktgröße: etwa 478 bp

• PCR-Zyklus
SIEHE gE

c) Kontrollen:
Es sind stets Positiv- und Negativkontrollen mitzuführen und auch
Extraktionskontrollen (Inhibitorenkontrollen) sind einzusetzen. Der Einsatz der
Kontrollen ist für jede Proben mit dem Laborleiter oder seinem Stellvertreter
abzustimmen.

FLI 110
Amtliche Methodensammlung Stand: Mai 2013

d) Auswertung:
Die Auswertung erfolgt mit Hilfe der Agarosegel-Elektrophorese mit Ethidiumbromid-
Färbung aufgrund der Größe im Vergleich zu den Positiv-Kontrollen und einem
mitgeführten Molekulargewichtsmarker.
Die Untersuchungen sind nur valide, wenn die bei den einzelnen PCR-Methoden
vorgeschriebenen Negativ- und Positiv-Kontrollen korrekt detektiert werden.

Referenzen
Fuchs et al. J. Clin. Microbiol. 37, 2498-2507, 1999

2. BHV-1 triplex real-time PCR:

Allgemeines:
a) Die Amplifizierung erfolgt auf Basis des QuantiTect Multiplex PCR NoROX Kit
(#204741, #204743, #204745; Qiagen) in 25 µl Gesamtvolumen.
b) Als Kontrollen werden neben der/den DNA-Isolierungskontrolle/n (DIC) eine
„No Template“ Kontrolle (NTC) und mindestens eine positive Kontrolle
mitgeführt.
c) Nach Herstellung des Mastermix werden je 20 µl im PCR-Reaktionsgefäß
vorgelegt und dann 5 µl Template zugefügt.

Herstellung des Mastermix:


a) Die Menge des herzustellenden Mastermixes richtet sich nach der Anzahl der
extrahierten Proben plus Kontrollansätze (PC; NTC) und eine entsprechende
Reserve.
b) Nachdem der Mastermix durch auf und nieder Pipettieren gut gemischt wurde,
erfolgt die Verteilung von 20 µl in die Reaktionsgefäße.
c) Nach Zugabe der Template-DNA und Verschluss der Reaktionsgefäße erfolgt
ein kurzes Abzentrifugieren der PCR-Ansätze.

Pipettier- Mastermix-Komponenten Volumen


folge
1. DNase freies Wasser 1,5 µl
2. 2x QuantiTect Multiplex PCR NoROX Master Mix 12,5 µl
3. Primer-Sonden-Mix 1: 2,0 µl
Beta-Actin-DNA-Mix 2-HEX
4. Primer-Sonden-Mix 2: 2,0 µl
BHV-gD-Texas Red-Mix
5. Primer-Sonden-Mix 3: 2,0 µl
BHV-gE3-FAM-Mix
Total Volumen Mastermix 20 µl
Total Volumen Reaktionsansatz 25 l

FLI 111
Amtliche Methodensammlung Stand: Mai 2013

Cycler-Programm:
Denaturierung/Aktivierung Taq 95°C 15 min
Denaturierung 95°C 60 sec
Annealing 58°C 30 sec 42 Zyklen
Elongation 72°C 30 sec
Die Aufnahme der Fluoreszenzdaten erfolgt im HEX-, Texas Red-, und FAM- Kanal.
Das Sammeln der Fluoreszenzdaten erfolgt in der Annealingphase

Primer- und Sondensequenzen:

• BHV-1-gD-TEX-Mix:
20 µl BHV1-gD5595-F (100pmol/µl)
5`-CCG CCG TAT TTT GAG GAG TCG-3´
20 µl BHV1-gD5704-R (100pmol/µl)
5`-TCG GTC TCC CCT TCR TCC TC-3´
2,5 µl BHV1-gD-TEX (100pmol/µl)
5`-TexasRed-TAC GAG CCG CCG CCT GCC GC-BHQ2-3´
157,5 µl 0,1x TE (pH=8,0)
200 µl

• BHV-1-gE3-FAM-Mix-1:
20 µl BHV1-gE3-883F (100pmol/µl)
5`- CAA TAA CAG CGT AGA CCT GGT C -3´
20 µl BHV1-gE3-989R (100pmol/µl)
5`- GCT GTA GTC CCA AGC TTC CAC -3´
3,75 µl BHV1-gE3-FAM (100pmol/µl)
5`-FAM- TGC GGC CTC CGG GCT TTA CGT CT –BHQ1-3´
156,25 µl 0,1x TE (pH=8,0)
200 µl

• beta-Actin-DNA-Mix2-HEX:
(Basierend auf einer Publikation von Toussiant et al. 2007, modifiziert)

5 µl ACT2-1030-F (100pmol/µl)
5`- AGC GCA AGT ACT CCG TGT G -3´
5 µl ACT-1135-R (100pmol/µl)
5`- CGG ACT CAT CGT ACT CCT GCT T -3´
2,5 µl ACT-1081-HEX (100pmol/µl)
5`- HEX- TCG CTG TCC ACC TTC CAG CAG ATG T -BHQ1-3´
187,5 µl 0,1x TE (pH=8,0)
200 µl

Referenzen:
Development and validation of a triplex real-time PCR assay for the rapid detection
and differentiation of wild-type and glycoprotein E-deleted vaccine strains of Bovine
herpesvirus type 1.; Wernike K, Hoffmann B, Kalthoff D, König P, Beer M.; J Virol
Methods. 2011, 174(1-2):77-84.

FLI 112
Amtliche Methodensammlung Stand: Mai 2013

15. Bovine Spongiforme Enzephalopathie (BSE)

15.1. Charakterisierung der Infektion


15.1.1. Erreger
Die Bovine Spongiforme Enzephalopathie (BSE) ist eine infektiöse
neurodegenerative Erkrankung des Rindes, die erstmalig 1985 in Großbritannien
nachgewiesen wurde. Ätiologisch wird sie der Gruppe der TSE/Prionenerkrankungen
zugeordnet, die durch Ablagerungen des pathologischen Prion-Proteins im Zentralen
Nervensystem erkrankter Tiere gekennzeichnet ist. Als wichtigster Übertragungsweg
wird die Verfütterung von infektiösem Tiermehl angesehen. Bisher wurden
europaweit mehr als 185 000 BSE-Fälle diagnostiziert, davon mehr als 99 % im
Vereinigten Königreich.

15.1.2. Klinische Symptomatik


Das klinische Bild der BSE ist sehr vielfältig und in Tabelle 1 dargestellt. Erkrankte
Tiere zeigen ein ungewöhnliches Verhalten und verändertes Temperament und
können unter Nervosität, Tremor, Hyperästhesie und Juckreiz, Bewegungsstörungen
bis zum finalen Festliegen, Gewichts- und Konditionsverlust sowie Milchrückgang
leiden. Häufig wird ein Treten der Tiere in die Einstreu oder nach Personen
beobachtet. Fieber tritt in der Regel nicht auf. Die Krankheit verläuft protrahiert (3
Wochen bis 6 Monate Krankheitsdauer).

Infolge der langen Inkubationszeit sind nur erwachsene Tiere klinisch betroffen. Das
Alter erkrankter Tiere mit nachgewiesener BSE lag zwischen 22 Monaten und 15
Jahren, wobei 4 Jahre alte Tiere am häufigsten erkrankt waren. Der Ausbruch der
Erkrankung ist unabhängig von Trächtigkeit, Laktationsperiode oder Jahreszeit,
obwohl im Vereinigten Königreich mehr Fälle während der Kalbezeit gemeldet
wurden.

Die BSE-Erkrankung bei Rindern entwickelt sich anfangs schleichend und unauffällig
und kann bei oberflächlicher Betrachtung übersehen werden. Deshalb kann schon
die kleinste Veränderung ein Hinweis auf eine sich entwickelnde BSE sein. Selbst im
fortgeschrittenen Erkrankungsstadium sind oft nur einzelne Veränderungen und nur
äußerst selten alle Symptome gleichzeitig bemerkbar.

FLI 113
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 1: Überblick über die wichtigsten klinischen Anzeichen von BSE

Rückgang der Milchleistung bei erhaltener Fresslust


Allgemeines Langsame Abmagerung bei erhaltener Fresslust
Festliegen nach dem Abkalben
Zunehmende Ängstlichkeit und Nervosität z. B. Zögern vor kleinsten
Hindernissen (z. B. am Boden liegende Stange) oder vor dem
Überschreiten des Kotgrabens, Angst vor Durchgängen
Aggressivität (Ausschlagen gegen Menschen und Tiere, Schlagen
Störung des
beim Melken)
Verhaltens
Erhöhte Aufmerksamkeit und Schreckhaftigkeit
Absondern von der Herde
Häufiges Belecken der Nase
Zähneknirschen
Zusammenzucken infolge geringster Umwelteinflüsse (Lärm,
Bewegung von Personen oder Tieren, Türen schlagen oder
Störungen in Herunterfallen von Gegenständen)
der Zusammenzucken beim plötzlichem Einschalten von Licht in einem
Empfindlichkei dunklen Raum
t Überreaktion bei Berührung im Kopf- und Halsbereich
Zittern oder Muskelzuckungen an Lippen, Flotzmaul, Ohren, Hals,
Vorderkörper, Flanken oder am ganzen Körper
Steifer Gang, Traber- und Hahnentrittartige Bewegungen
Störung in der
Einknicken mit den Hinterbeinen
Bewegung
Schwankender Gang

15.1.3. Differentialdiagnosen
Wichtige Differentialdiagnosen bei Rindern sind:

• Stoffwechselstörungen:
- Hypomagnesiämie, nervöse Form der Ketose, Kupfermangel,
cerebrocorticale Nekrose (CCN)
• virale und bakterielle Infektionen des zentralen Nervensystems:
- Listeriose, Tollwut, Aujeszkysche Krankheit
• Aggressionen psychogener Ursache

15.1.4. BSE-Überwachung
In der EU wird gemäß Verordnung EU 999/2001 ein BSE-Überwachungsprogramm
mittels BSE-Schnelltestverfahren durchgeführt. Zur Untersuchung dürfen dabei nur
solche Tests verwendet werden, die für die Untersuchung dieser Spezies zugelassen
sind (http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf).

Die Bestätigung eines reaktiven Testergebnisses hat in allen Fällen am NRL für BSE
und Scrapie am FLI auf der Insel Riems zu erfolgen, alles verfügbare Material muss
daher umgehend an das FLI weitergeleitet werden. Die Untersuchungsstelle hat das
BMELV und das NRL am FLI bundeseinheitlich nach einem vorgegebenen
Meldesystem (siehe Untersuchungsmaterial) über das Ergebnis der jeweiligen
Untersuchungen zu informieren.

FLI 114
Amtliche Methodensammlung Stand: Mai 2013

Im Falle des klinischen Verdachtes einer TSE kann dieser nach den derzeitigen
Vorgaben (Verordnung (EG) Nr. 103/2009) des OIE nicht durch ein negatives
Schnelltest-Ergebnis ausgeräumt werden. Die Abklärung eines solchen
Verdachtsfalles muss am NRL durchgeführt werden. Um bei einem klinisch
erkrankten Tier eine umfangreiche Asservation von Proben (siehe
Untersuchungsmaterial) sicherzustellen, sollte das FLI in solchen Fällen frühzeitig
benachrichtigt werden. Neben einer Verbringung des Tieres an das FLI ist auch eine
Sektion vor Ort mit Unterstützung eines Mitarbeiters des FLI möglich.

Abschließende Falldefinition für BSE


Ein BSE-Verdacht wird auf Grund klinischer Symptomatik oder eines reaktiven
Ergebnisses in einem der national und von der EU zugelassenen BSE-Schnelltests
geäußert. Die Meldung eines BSE-Verdachts aufgrund eines reaktiven BSE-
Schnelltest-Ergebnisses in TSN sollte keinesfalls erfolgen.

Ein BSE-Fall ist nach Erhalt eines den Verdacht bestätigenden Befundes aus dem
NRL für BSE/Scrapie am FLI festzustellen und in TSN einzustellen.

15.1.5. Zuständige Untersuchungseinrichtungen


• Staatliche Untersuchungsstellen:
BSE-Untersuchungen bei Schlachttieren, not- und krankgeschlachteten
Tieren, tot aufgefundenen Tieren sowie bei klinischen Verdachtsfällen
• privat geführte Untersuchungslabors
ausschließlich BSE-Untersuchungen bei Schlachttieren

Bestätigungsuntersuchungen müssen durch das nationale Referenzlabor am


FLI durchgeführt werden. Dies gilt für alle bei Tieren auftretenden TSE-
Erkrankungen (z. B. auch CWD, FSE). Im NRL werden die in den geltenden
Bestimmungen festgelegten Untersuchungsverfahren angewandt.

15.1.6. Rechtsgrundlagen
EU: Anhang X der VO (EG) 999/2001 und alle Änderungen

National: BSE-Maßnahmenkatalog
BSE-Untersuchungsverordnung

Internationales Tierseuchenamt (OIE Manual of Diagnostic Tests and Vaccines for


Terrestrial Animals 2008).

FLI 115
Amtliche Methodensammlung Stand: Mai 2013

15.2. Untersuchungsmaterial
15.2.1. Probennahme
Probennahme und Beprobung erfolgen entsprechend Anhang X, Kapitel C der VO
(EG) 999/2001 sowie nach den Vorgaben des Internationalen Tierseuchenamtes OIE
Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2004).

15.2.1.1. Entnahme des Hirnstammes


Der Gehirnstamm ist durch Amtstierärzte, amtliche Tierärzte und Fleischkontrolleure
oder durch eingewiesene Probenehmer unter direkter Aufsicht des amtlichen
Tierarztes zu entnehmen.
Die Proben sollten so frisch wie möglich sein und unverzüglich nach dem Tod des
Tieres entnommen werden um die fortschreitende Autolyse des Gewebes zu
verhindern.

Zur Entnahme des Hirnstammes sind folgende Methoden bekannt:

a) mit dem Entnahmelöffel (scharfer Löffel)


Diese Methode ist eine geeignete Technik zur Entnahme von Hirnproben. Die
Entnahme hat mit einem Entnahmelöffel durch das Foramen magnum zu erfolgen.

b) mit Wasserdruck
Bei dieser Methode wird das Hirngewebe mit Wasser, das mit einem geeigneten
Gerät durch den Schusskanal zugeführt wird, durch das Foramen magnum
herausgedrückt. Bei Anwendung dieser Entnahmetechnik kann es jedoch zu einer
Verteilung von mit Risikomaterial kontaminiertem Tropfwasser kommen.
Die Entnahmetechnik mit Wasserdruck ist geeignet, wenn
• durch eine Gummimanschette vorn am Gerät das Zurückspritzen von Wasser
verhindert und
• der Wasserdruck am Gerät geregelt wird und
• die Probeentnahme in einem Kopfkabinett erfolgt.

Der Gehirnstamm ist unversehrt in das mit der Untersuchung befasste Labor zu
senden. Dort werden die für den jeweils verwendeten Test notwendigen Proben
genommen und der Probenrest bis zum Abschluss der Untersuchung bei +4 °C
gelagert.

15.2.1.2. Probennahme im Rahmen der Schnelltestuntersuchungen


Unabhängig von ihrem Zustand ist im Rahmen der aktiven Überwachung prinzipiell
jede Probe mittels Schnelltest zu untersuchen.
Soweit es der Gewebezustand zulässt, ist dabei das Material aus der Obex-Region
des Hirnstammes (Abb. 1 und 2) zu entnehmen. Dies erhöht die Wahrscheinlichkeit
auch frühe, präklinische Stadien nachweisen zu können. Andere Hirnregionen
und/oder das Rückenmark dürfen im Rahmen der Schnelltestuntersuchungen unter
keinen Umständen verwendet werden.

FLI 116
Amtliche Methodensammlung Stand: Mai 2013

Ist die Obex-Region wegen fortgeschrittener Autolyse und Fäulnis des Gewebes
nicht mehr auffindbar, muss in jedem Fall eine möglichst repräsentative Probe des
Hirnstammes entnommen werden. In solchen Fällen ist ein positives Ergebnis gültig.
Ein negatives Ergebnis hingegen kann nur unter Vorbehalt verwendet werden.

Vorgehensweise:
Es sollte eine würfelförmige Gewebeprobe unilateral, unter Schonung der
Gegenseite (Abb. 2), vorzugsweise mittels eines Skalpells entnommen werden;
alternativ kann die Probe auch mittels spezieller Entnahmetechniken
(Entnahmespritze o.ä.) gewonnen werden; näheres hierzu regeln die jeweils amtlich
zugelassenen Gebrauchsanweisungen der TSE-Schnelltests.

Abbildung 1: Medianschnitt durch das Gehirn (nach Budras und Wünsche)

FLI 117
Amtliche Methodensammlung Stand: Mai 2013

Entnahmestelle für Histopathologie/Immun-


Obex; Lokalisation für Histologie (Formalinprobe des Stammhirns)
Schnelltestung

Medulla Reste des


oblongata Kleinhirns Mittelhirn

Abbildung 2: Stammhirn von dorsal nach Abtragung des Kleinhirns.

15.2.1.3. Probennahme nach einem reaktiven Schnelltestergebnis (BSE-


Verdacht)
Reaktive BSE-Schnelltest-Ergebnisse führen zur weitergehenden Abklärung durch
das nationale Referenzzentrum am INNT des FLI, Insel Riems. Einzelheiten des
Versands der Proben siehe Kap. 3.
Einsendungen an das NRL müssen telefonisch vorangemeldet werden. Zur
Ankündigung der Einsendung ist zudem das FAX-Formular gemäß Anhang zu
verwenden. Zur Untersuchung sind alle Vorergebnisse (Filme, ELISA-Werte der
Probe - einschließlich des jeweiligen Cut-offs), alle zur Verfügung stehenden Proben
sowie die Reste der ersten Homogenate einzusenden.
Weiterhin sollte eine vollständige, transversale Scheibe (ca. 5mm) aus der Region
direkt kranial des Obex entnommen werden (Abb. 2). Diese dient der späteren
histopathologischen sowie immunhistologischen Untersuchung.
Um einerseits die Diagnostik beeinträchtigende morphologische Verluste zu
vermeiden und andererseits eine schnellstmögliche diagnostische Untersuchung zu
gewährleisten sollte diese Probe unabhängig vom Autolysegrad bereits im
Schnelltestlabor in neutral gepuffertes Formalin (4 %) fixiert werden. Ein Einfrieren
des für die histomorphologische Untersuchung gedachten Gewebes sollte unbedingt
vermieden werden.

15.2.1.3.1. Zusätzliche Probennahme nach einem reaktiven Schnelltestergebnis


Bei Feststellung eines reaktiven BSE-Schnelltest-Ergebnisses müssen im
Schlachthof alle noch verfügbaren Proben vom zugehörigen Tier unter amtlicher
Verwahrung verbleiben. Die Aufbewahrung dieser Proben sollte getrennt von
anderen Materialien und Schlachtprodukten vorerst bei +4 oC erfolgen und die
Proben sollten, sofern die Laboruntersuchung länger als 36 Stunden dauert, bei

FLI 118
Amtliche Methodensammlung Stand: Mai 2013

Minus 20 oC tiefgefroren werden. Bei Aufhebung des Verdachts erlischt die amtliche
Verwahrung.
Im Falle der Bestätigung des BSE-Verdachts könnten daher, sofern diese Möglichkeit
besteht, zusätzliche Proben für die nationale BSE-Probenbank genommen werden.
Sollte der Kopf des Tieres bis zum Abschluss der Untersuchungen noch
identifizierbar sein, kann dieser an das FLI eingesandt werden. Besteht diese
Möglichkeit nicht, sollten vor dessen Entsorgung nachfolgend ausgeführte Proben
entnommen werden. Ein Teil dieser Proben sollte separat bei –20 °C tiefgefroren, ein
Teil sollte nach Rücksprache mit Mitarbeitern des FLI in neutral gepuffertes 4%iges
Formalin eingelegt werden.
BSE-positiv getestetes Schlachttier bzw. ein gefallenes (TKBA-)Tier:
• das gesamte Gehirn (soweit noch verfügbar evtl. auch autolytisches Gewebe)
• Ohrmarke mit anhängender Gewebeprobe
• je10 g Skelettmuskulatur von M. longissimus dorsi, M. semitendinosus, M.
biceps brachii)

Tiere mit reaktiven Ergebnis eines BSE-Schnelltestes aus der Kohorte eines
nachgewiesenen BSE-Falles
• Hirnstamm (verbliebenes Material nach Schnelltest; entnommen mit der Löffel-
Methode)
• 10 ml Serum
• Ohrmarke mit anhängender Gewebeprobe

15.2.1.4. Probennahme bei einem klinischen Verdacht auf BSE


Im Falle des klinischen Verdachtes einer TSE kann dieser nach den derzeitigen
Vorgaben des OIE nicht durch ein negatives Schnelltest-Ergebnis ausgeräumt
werden.
Sollte eine Überweisung des Tieres an das FLI bzw. eine Sektion vor Ort mit
Beteiligung eines Mitarbeiters des FLI nicht möglich sein, sollte das Tier mit einer
Barbiturat-Überdosis getötet werden. Nach Eintritt des Todes sollten, sofern die
Gegebenheiten dies zulassen, die nachfolgend (Tab. 1) aufgeführten Proben
entnommen werden. Sollte dies nicht möglich sein, kann auch der vollständige Kopf
an das FLI eingesandt werden.
Im Anschluss daran kann ein Schnelltest durchgeführt werden, wobei jedoch auch
bei einem negativen Ergebnis alle vorhandenen ZNS-Proben an das FLI
weitergeleitet werden müssen. Dies bezieht explizit auch das bereits zur
Schnelltestung hergestellte Homogenat und ggfs. auch Gewebeblöcke und -schnitte
für die Histologie mit ein. Die Proben sollten separat gekennzeichnet und verpackt
werden.

FLI 119
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 1: zu asservierendes Probenmaterial klinischen Verdacht auf BSE

Gewebe +4 °C -20 °C Formalin (4 %)


Nach der Sedation
100 ml Vollblut,
400 ml EDTA-
zentrifugieren und
Blut Vollblut (Isolierung --
Überstand (Serum)
der Leukozyten)
einfrieren
Milch -- 100 ml --
Nach der Tötung
Gehirn (paramedian
zerteilt, ca. 1 cm neben -- kleinere Hälfte größere Hälfte
der Medianen)
Rückenmark nach Möglichkeit:
Scheiben (5-10mm)
-- vollständig aus dem Hals, Brust-,
Lenden- und
Sakralmark
Auge -- vollständig vollständig
Tonsille -- Hälfte max. 2 x 2 x 2 cm
Darm je 10 cm mit
(Ileum, Jejunum) anhängenden
-- max. 2 x 2 x 2 cm
lymphatischen
Gewebe
Milz -- ca. 50 g max. 2 x 2 x 2 cm
Skelettmuskulatur
- M. longissimus dorsi,
-- je 10 g max. 2 x 2 x 2 cm
- M semitendinosus,
- M. biceps brachii
Zerebrospinalflüssigkeit nach Zentrifugation
-- --
(ohne Blutaspiration) Überstand einfrieren
erreichbare Nerven
des peripheren
-- Hälfte des Materials Hälfte des Materials
Nervensystems
(z. B. N. ischiadicus)

15.2.2. Arbeitsschutzmaßnahmen

15.2.2.1. Arbeitsschutzmaßnahmen bei der Probenentnahme bei


Schlachttieren
Die Entnahme von Probenmaterial bei klinisch unverdächtigen Schlachttieren kann
im Rahmen der Schlachtung unter Einsatz von persönlicher Schutzausrüstung, wie
flüssigkeitsdichte und feuchtigkeitsabweisende Handschuhe und Gesichtsschutz
(Spritzschutz: Visier oder alternativ Schutzbrille sowie Mund- und Nasenschutz)
erfolgen.
Alle Instrumente, die für die Entnahme der Hirnstammproben bestimmt sind, dürfen
ausschließlich zu diesem Zweck verwendet werden. Dieses Besteck ist nach jeder
einzelnen Probeentnahme mechanisch (durch Abspülen oder Abwischen) zu reinigen
und nach Abschluss der Arbeiten durch mindestens einstündiges Einlegen in 1 N
NaOH oder Natriumhypochloritlösung mit mindestens 2 % freiem Chlor2 zu
dekontaminieren. Auf das Tragen von Augenschutz bei Tätigkeiten mit diesen

FLI 120
Amtliche Methodensammlung Stand: Mai 2013

Lösungen wird hingewiesen. Ein Abflammen des Besteckes reicht nicht aus und hat
zu unterbleiben.

15.2.2.2. Arbeitsschutzmaßnahmen bei der Probenentnahme bei TKBA-Tieren


und von klinischen BSE-Verdachtstieren
Die Probenentnahme kann in den zur Sektion bzw. zur Zerlegung solcher Tiere zur
Verfügung stehenden Räumen an der TBA, im Untersuchungsamt oder am
Schlachthof durchgeführt werden.
Bei der Probenentnahme sind folgende Sicherheitsmaßnahmen einzuhalten:

a) Es ist persönliche Schutzausrüstung bestehend aus


• Geeigneter Schutzkleidung (langer geschlossener Kittel, Gummischürze),
• Flüssigkeitsdichten und feuchtigkeitsabweisenden Schutzhandschuhen
und
• Gesichtsschutz (Visier oder alternativ Schutzbrille und Mund- und
Nasenschutz)
zur Verfügung zu stellen.

b) Die Schutzkleidung ist nur für diese Arbeiten zu verwenden. Die


Schutzausrüstung ist bei positivem Befund einer chemischen (NaOH oder
Natriumhypochloritlösung nach Nr. 3.3.1) oder thermischen (ABAS-Beschluss
603) Behandlung zur Inaktivierung der TSE-Erreger zu unterziehen.

c) Bei der Entnahme der Proben müssen die Instrumente nach jeder einzelnen
Probe einem Dekontaminationsschritt mit NaOH oder
Natriumhypochloritlösung nach ABAS 603 unterzogen werden.

d) Nach der Probennahme bzw. Sektion sind die Räume (Oberflächen, Boden)
und Gegenstände mit NaOH oder Natriumhypochloritlösung nach ABAS 603
zu dekontaminieren. Die Einwirkzeit soll mindestens 60 Minuten betragen,
bevor mit Wasser nachgespült wird (Wasserstrahl, kein Hochdruck).

e) Das Aufsägen der Schädel ist auf ein Mindestmaß zu beschränken. Sollte es
im Einzelfall dennoch notwendig sein, müssen Maßnahmen zum Schutz vor
Spritzern getroffen werden, wie z. B. das Tragen eines Gesichtsschutzes.

f) Flüssige Abfälle sind so weit wie möglich zu vermeiden. Ansonsten sind sie
einer chemischen oder thermischen (ABAS-Beschluss 603) Behandlung zu
unterziehen.

15.2.3. Beförderung von Probenmaterial (Inland)


Für die gefahrgutrechtliche Klassifizierung von Probenmaterial ist prinzipiell der
Absender verantwortlich. Es werden drei Kategorien von TSE-Proben unterschieden:

15.2.3.1. Routineproben zur BSE-Schnelltestung (sog. A-Proben)


Für Spezifisches Risikomaterial den sog. SRM-Proben aus dem Gehirn von
routinemäßig geschlachteten oder verendeten Rindern ohne gezielten TSE Verdacht
wird -wie auch für das übrige Risikomaterial- ein Transport nach Maßgabe der

FLI 121
Amtliche Methodensammlung Stand: Mai 2013

„Guidelines for the Safe Transport of Infectious Substances ans Diagnostics


Specimen“ der WHO für den „Local Surface Transport“ zwischen Entnahmeinstitution
und Untersuchungslabor empfohlen. Sie sind nicht als ansteckungsgefährliche Stoffe
der Klasse 6.2 nach der ADR zu klassifizieren und unterliegen daher nicht den
Anforderungen des Gefahrgutrechts für den Transport. Der Transport solcher Proben
kann mit Kurier-Fahrzeugen der Überwachungs- bzw. Untersuchungsämter oder der
Schlachtbetriebe nach Maßgabe der probenentnehmenden Veterinärbehörden oder
anderen amtlich beauftragten Institutionen erfolgen. Hierbei sollten die Proben in
verschließbaren Plaste-Röhrchen in Reagenzglasgestellen und diese in
verschließbaren, beschrifteten Plaste-Boxen transportiert werden, die in den
Transportfahrzeugen stoßfest zu sichern sind.

15.2.3.2. TSE-Verdachtsproben (sog. B-Proben)


Gehirnproben, die im BSE-Schnelltest kein eindeutig negatives Ergebnis (= reaktives
Ergebnis) ergeben haben, sowie Gehirnproben mutmaßlich an TSE klinisch-
erkrankter Wiederkäuer gelten als TSE-Verdachtsproben. Solche Proben gelten
ebenfalls nicht als Gefahrgut und werden ab dem 01.01.2005 nach der
anzuwendenden neuen ADR 2005 als ansteckungsgefährliche Stoffe der
Gefahrenklasse 6.2 in die Kategorie B, „UN 3373 Diagnostische Proben“
eingeordnet. Dieses Transportgut unterliegt in der Gefahrgut-VO jedoch keinen
weiteren Reglementierungen.
Es können unter Einhaltung der Verpackungsvorschrift P 650 wesentliche
Erleichterungen beim Transport über öffentliche Straßen in Anspruch genommen
werden, d. h. eine ordentliche Verpackung und Beschriftung mit den entsprechenden
UN-Zetteln genügt, es sind keine Gefahrgutpapiere notwendig. (bestätigt in einer
Stellungnahme des Robert-Koch-Institutes als Sicherheitsbehörde des Gefahrgut-
Verkehrs-Beirates vom 20.10.2004).

Auszüge aus der Verpackungsvorschrift P 650 :


• Die Proben müssen in Verpackungen von guter Qualität verpackt werden, die
stark genug sind, um den normalerweise während der Beförderung
einschließlich Umladen zwischen Fahrzeugen und/oder Warenlagern sowie
Entnehmen von einer Palette oder aus einer Umverpackung zur weiteren
manuellen oder mechanischen Behandlung auftretende Stöße und
Belastungen standzuhalten. Die Verpackungen müssen so gebaut und
verschlossen werden, dass ein Austreten des Inhalts aus der versandfertigen
Verpackung, was unter den normalen Bedingungen des Transports, durch
Erschütterungen oder durch Temperatur-, Feuchtigkeits- oder
Druckänderungen verursacht werden kann, verhindert wird.
• Die Gefäße als erste Verpackungen müssen in die zweite Verpackung so
eingesetzt werden, dass sie unter den normalen Beförderungsbedingungen
nicht zerbrechen oder durchstoßen werden können und dass ihr Inhalt nicht in
die zweite Verpackung austreten kann. Zweite Verpackungen müssen durch
geeignete Polstermittel in Außenverpackungen gesichert werden. Die
Schutzeigenschaften der Polstermittel oder der Außenverpackungen dürfen
durch austretenden Inhalt nicht wesentlich beeinträchtigt werden.
• Die Verpackung muss aus 3 Bestandteilen bestehen; Primärgefäß,
Sekundärgefäß und Außenverpackung.
• Die ersten Gefäße müssen wasserdicht sein.

FLI 122
Amtliche Methodensammlung Stand: Mai 2013

• Jedes Versandstück muss klar und deutlich mit der Aufschrift UN 3373
„Diagnostische Proben“ gekennzeichnet sein.
• Wenn mehrere zerbrechliche Gefäße in eine einzelne zweite Verpackung
eingesetzt werden, müssen sie entweder einzeln eingewickelt oder so
voneinander getrennt werden, dass eine gegenseitige Berührung verhindert
wird.
• Eine Zertifizierung der Verpackung ist nicht erforderlich.

15.2.3.3. Definierte TSE-Proben (positives TSE-Material)


Definiert TSE-haltige SRM-Proben (z. B. bestätigte BSE-Gehirnproben zur
Durchführung von Ringversuchen, Versand positiver Kontrollproben, durch das FLI-
bestätigte BSE-Verdachtsproben etc.) sind ansteckungsgefährliche Stoffe der
Gefahrenklasse 6.2 und fallen ebenfalls seit dem 01.01.2005 in die Kategorie B der
ADR 2005 und werden unter UN 3373 „Diagnostische Proben“ klassifiziert. Denn
unter Berücksichtigung von den in den letzten Jahren bekannt gewordenen
wissenschaftlichen Erkenntnissen zu Infektionswegen und –risiken, insbesondere
einer BSE-Übertragung auf den Menschen, besteht beim Transport der TSE-Proben
nach der Verpackungsvorschrift P 650 keine Exposition für Mensch oder Tier, um bei
Austritt aus der Schutzverpackung eine lebensbedrohliche oder tödliche Krankheit zu
verursachen. Gleichzeitig ist in der Liste der ansteckungsgefährlichen Stoffe unter
Kategorie A kein TSE-Material aufgeführt.
Diese Klassifizierung wurde ebenfalls in einer Stellungnahme des Robert-Koch-
Institutes als Sicherheitsbehörde des Gefahrgut-Verkehrs-Beirates vom 20.01.2005
bestätigt.

15.3. Untersuchungsgang

Zur Bestätigung von BSE-Fällen können ausschließlich die vom Internationalen


Tierseuchenamt anerkannten Verfahren herangezogen werden

• Histopathologie
• Immunhistochemie
• SAF-Immunoblot
• ggf. der Nachweis der Infektiosität im Tierversuch

Bestätigungsuntersuchungen müssen durch das nationale Referenzlabor am FLI


durchgeführt werden.

FLI 123
Amtliche Methodensammlung Stand: Mai 2013

Anmeldung einer BSE-/Scrapie-Verdachtsprobe zur Untersuchung an das FLI


Insel Riems

Bitte zunächst telefonische Anmeldung unter der Nummer: 038351/7-1161 (ggfs.


Pforte 038351/7-0 (rund um die Uhr besetzt). Anschließend per FAX an 038351/7-
1192

Einsendung der Probe an (bitte für jede Einzeltierprobe separates Anmeldeformular)

Nationales Referenzlabor für BSE/Scrapie


Institut für neue und neuartige Tierseuchenerreger
am FLI Insel Riems
Südufer 10
17493 Greifswald - Insel Riems

Anschrift des Einsenders: Ansprechpartner


Name:
Tel.:
FAX:

Vorbericht zur Probe


Ohrmarkennr. ____________________ Geburtsdatum ______________________
Rind Schaf Ziege sonst. ___________
Schlachthof TBA Klin. Verdacht Kohorte __________

Ergebnisse der Voruntersuchung (Initial/Wdh.)

TeSeE Werte: _______________ Cut-off: ________________


Prionics LIA Werte: _______________ Cut-off: ________________
Enfer Werte: _______________ Cut-off: ________________
_________________ Werte: _______________ Cut-off: ________________
Prionics WB ____________________

Formalinfixierte Obexprobe anbei ja nein

Versand der Probe am ____________ um ________Uhr


Fahrer TNT sonst. ____________
voraussichtliche Ankunft am ____________ um ________Uhr

Wir bitten um Übersendung des vollständigen Vorberichts (Vorergebnisse wie Elisa-


Werte, Röntgenfilm etc.; Herkunftsnachweis des Tieres incl. Ohrmarkennr. etc.). In
Formalin eingelegte Proben bitte getrennt versenden und dieses Paket mit dem
Hinweis „bei Raumtemperatur lagern“ versehen, falls die Sendung am Wochenende
oder nach 14.30 Uhr am FLI eintrifft. Das andere Paket mit der gekühlten Probe bitte
mit dem Hinweis „gekühlt lagern“ kennzeichnen.

Wichtiger Hinweis: aus Gründen des Arbeitsablaufes können am selben Arbeitstag nur
Proben bearbeitet werden, die vor 8 Uhr am FLI eingetroffen sind! Bei späterer Ankunft
kann die Untersuchung der Proben erst am folgenden Tag beginnen!

FLI 124
Amtliche Methodensammlung Stand: Mai 2013

16. Bovine Virus Diarrhoe (BVD)

16.1. Charakterisierung der Infektion


16.1.1. Erreger
Der Erreger bildet gemeinsam mit dem Virus der Klassischen Schweinepest, und
dem Border Disease Virus das Genus Pestivirus in der Familie der Flaviviridae.
Atypische Pestiviren („Giraffe“, „Pronghorn“, „HoBi“, „Bungowannah“) sind
beschrieben, für die aktuelle BVD-Epidemiologie aber von marginaler Bedeutung Es
werden zwei Genotypen des BVDV als selbständige Spezies unterschieden, bei
denen jeweils zytopathogene (cp) und nicht-zythopathogene (ncp) Biotypen
vorkommen. Subtypisierungen auf genomischer Ebene sind möglich. Es handelt sich
um ein 40 - 60 nm großes, behülltes Virus, das Genom besteht aus einer
einsträngigen RNA positiver Polarität von einer Länge von ca. 12 kB.

16.1.2. Klinische Symptomatik


Akute Infektionen verlaufen i.d.R. symptomlos, vor allem bei Kälbern können
Fieber, Inappetenz, seröser Nasenausfluss, milde Atemwegserkrankung oder
Durchfall auftreten, bei Kühen kann es zum Rückgang der Milchleistung kommen.
Eine Immunsuppression begünstigt andere Infektionen. Darüber hinaus kann BVDV,
insbesondere vom Genotyp 2 verlustreiche Erkrankungen unter dem Bild eines
hämorrhagischen Syndroms mit schwerer pulmonaler Symptomatik, blutiger Diarrhoe
und Erosionen im Verdauungstrakt verursachen.

Eine Infektion trächtiger Tiere resultiert in Abhängigkeit von Zeitpunkt der Infektion
in Fruchtbarkeitsstörungen (Umrindern infolge Fruchtretention), Aborten,
Totgeburten, Missbildungen und Geburt von lebensschwachen Kälbern. Bei
Infektionen zwischen dem 30. und dem 90. Graviditätstag mit BVDV von ncp-Biotyp
werden persistent virämische Kälber geboren, die entweder kümmern, aber sich
auch normal entwickeln können. Innerhalb der ersten 12 Lebensmonate kommt es
bei etwa der Hälfte der PI-Tiere zur Ausbildung von Mucosal Disease.

Mucosal Disease (MD) entsteht, wenn persistent virämische Tiere mit einem cp
BVDV infiziert werden, bzw. (häufiger) wenn der ncp Biotyp im Tier zum cp Virus
mutiert. Chronische Abmagerung, Fieber, Anorexie, blutige, therapieresistente
Durchfälle, Speichelfluss, Erosionen im Bereich des harten Gaumens, am Flotzmaul
und Naseneingang, weniger häufig im Zwischenklauenspalt sowie an Kronsaum und
Euter treten auf.
Die Erkrankung verläuft tödlich. Auf pathogenetisch von der MD abzugrenzende
erosive Veränderungen nach akuter Infektion mit besonders virulenten Virusstämmen
wird hingewiesen (MD-like).

16.1.3. Pathologie
Zur pathologisch-anatomischen Untersuchung gelangen in erster Linie an MD
verendete Tiere. Neben der bereits klinisch sichtbaren erosiven und ulzerativen
Stomatitis (besonders harter Gaumen, Gingiva, Papillen der Backenschleimhaut),

FLI 125
Amtliche Methodensammlung Stand: Mai 2013

finden sich längliche Erosionen im gesamten Oesophagus, an Pansenpfeilern und an


den Rändern der Blättermagenschleimhaut, in Labmagen und im gesamten Darm.
Auch bei ausgeprägten pathomorphologischen Befunden ist mitunter kein Virus
nachweisbar. Hochvirulente ncp-BVDV-Stämme führen zu hochgradiger
Thrombozytopenie mit nachfolgendem hämorrhagischem Syndrom.
Intrauterine Infektionen bis zum 100. Graviditätstag führen zu Tod des Fetus,
Aborten, mumifizierten Früchten bzw. Entstehung von PI-Tieren Zu den nach
Infektionen nach dem 100. Graviditätstag auftretenden Missbildungen zählen
Mikroenzephalie, zerebellare Hypoplasia, Hydranenzephalie, Hydrozephalus,
Mikrophthalmie („okulozerebellares Syndrom“), Thymusaplasie, Hypotrichosis
congenita, Brachygnathie, Wachstumsverzögerung und Hypoplasie der Lungen.

16.1.4. Differentialdiagnostik
Bösartiges Katarrhalfieber, Rinderpest, Maul und Klauenseuche und andere
vesikuläre Erkrankungen, Stomatitis papulosa, Verätzungen, Intoxikationen

16.1.5. Diagnostische Indikation


• Antigen-, Genom- und Antikörperuntersuchungen nach BVD-Verordnung
• Klinischer und/oder pathologischer Verdacht auf MD bzw. Vorliegen eines
hämorrhagischen Syndroms

16.1.6. Zuständige Untersuchungseinrichtungen


• Veterinäruntersuchungseinrichtungen in den Ländern
• Nationales Referenzlabor für BVD/MD am Friedrich-Loeffler-Institut, Insel
Riems (Tel.: 038351 70212) – Abklärungsuntersuchungen

16.1.7. Rechtsgrundlagen
• Verordnung zum Schutz der Rinder vor einer Infektion mit dem Bovinen
Virusdiarrhoe-Virus – BVDV-Verordnung – vom 11.12.2008 in der Fassung der
Bekanntmachung vom 4. Oktober 2010 (BGBl. I S. 1320, 1498), die durch
Artikel 1 der Verordnung vom 17. Dezember 2010 (BGBl. I S. 2131) geändert
worden ist
• Manual of Diagnostic Tests and Vaccines for Terrestric Animals, Chapter
2.10.6., Bovine Viral Diarrhea, 5th edition, 2004

16.2. Untersuchungsmaterialien und Probenschemata


Der diagnostische Nachweis von persistent BVDV-infizierten Rindern kann durch die
Aufnahme von BVDV-antikörperhaltigem Kolostrum beeinträchtigt sein
(Diagnostische Lücke). Die Einschränkungen hängen von den aufgenommen
Antikörpermengen, der angewendeten Methode sowie vom Zeitpunkt der
Probennahme ab. Im Folgenden werden zulässige diagnostische Verfahren zur
Zertifizierung der BVD-Unverdächtigkeit eines Rindes bzw. Rinderbestandes und zur
Bestätigung der Antikörperfreiheit unter Berücksichtigung der Diagnostischen Lücke
aufgeführt. Detaillierte Protokolle sind im Abschnitt Untersuchungsgang beschrieben.

FLI 126
Amtliche Methodensammlung Stand: Mai 2013

16.2.1. Anerkannte Untersuchungen zum BVDV-Nachweis

16.2.1.1. Amtlich zugelassene ERNS-Antigenfänger-ELISA


Probenmaterial: Serum, Plasma, EDTA-Vollblut, Blutleukozyten, Organproben
und Hautbioptate eines Tieres
Probennahme: Vor Aufnahme von Kolostrum sowie im Alter von mehr als 30
Tagen für Blutproben. Vor diesem Zeitpunkt mit negativem
Ergebnis untersuchte Proben sind verwertbar, wenn gleichzeitig
eine Untersuchung auf Antikörper mittel ELISA oder SNT mit
ebenfalls negativem Ergebnis durchgeführt wird. Für
Hautbioptate und andere Organproben gibt es keine
Einschränkung

16.2.1.2. Amtlich zugelassene p80-Antigenfänger-ELISA


Probenmaterial: Blutleukozyten, Hautbioptate, soweit vom Hersteller vorgesehen
Probennahme: Vor Aufnahme von Kolostrum oder im Alter von mehr als 90
Tagen

16.2.1.3. RT-PCR mit amtlich zugelassenen Testkits


Probenmaterial: Serum, Plasma, Vollblut, gereinigte und gewaschene Leuko-
zyten, Milch, Organ- oder Gewebeproben.
Poolproben von bis zu 50 Tieren bzw. nach Herstellerangaben
Probennahme: Für Einzelblutproben keine Einschränkung; für gepoolte
Blutproben Tag 0 bis 7 post partum oder ab einem Alter von
mehr als 40 Tagen, keine Einschränkung für Gewebeproben als
Einzel- oder Poolproben.
Anmerkung: Die analytische Sensitivität der zugelassenen Testkits erlaubt
rechnerisch die Untersuchung größerer Pools. Ein den
Anforderungen an ein akzeptables Qualitätsmanagement
genügendes System der automatisierten Probenvorbereitung ist
bei Pools > 50 bei Blutproben und > 25 bei Ohrstanzproben i.d.R
aber nicht mehr gegeben Bei Sicherung einer ausschließlichen
Bearbeitung von Blutproben aus anerkannt BVD unverdächtigen
Beständen und einer zusätzlichen internen Validierung des
technischen bzw. automatisierten Ablaufes der Poolung und
Gewährleistung von mindestens 5 µl Einzelprobe im Pool ist eine
Erhöhung auf maximal 100 Proben möglich.

16.2.1.4.Virusisolierung auf permissiven bovinen Zellkulturen, z. B. KOP-R-


Zellen oder primäre bovine Zellkulturen
Probenmaterial: Mindestens 1x106 aufgereinigte und gewaschene Leukozyten
(vorzugsweise) bzw. Serum, Organproben (Milz, Lymphknoten,
Thymus)
Probennahme: Vor Aufnahme von Kolostrum oder im Alter von mehr als 40
Tagen
Keine Einschränkung für Organproben

FLI 127
Amtliche Methodensammlung Stand: Mai 2013

16.2.1.5. Antigennachweis mittels Immunfluoreszenz


Probenmaterial: 6-8 mm große Organ- und Gewebeproben (Hautstanzen)
Probennahme: postmortal oder am lebenden Tier (Hautstanzen), keine zeitliche
Einschränkung

16.2.1.6.Durchflusszytometrische Analyse nach Immunfluoreszenzfärbung


mit p80-spezifischen Antikörpern
Probenmaterial: Aufgereinigte Leukozyten aus mindestens 50µl Vollblut
Probennahme: Vor Aufnahme von Kolostrum oder im Alter von mehr als 90
Tagen

16.2.2. Bestätigungsuntersuchung
Bei der Bestätigung von vermutlich persistent infizierten Tieren durch eine zweite
Untersuchung muss die unterschiedliche Sensitivität der beschriebenen Methoden
berücksichtigt werden. Es sind folgende Untersuchungsabstände einzuhalten:
- RT-PCR mindestens 42 Tage
- Virusisolierung: mindestens 28 Tage
- ELISA: mindestens 21 Tage
- Durchflusszytometrie: mindestens 21 Tage

Ein negativer Befund kann bereits vor Ablauf dieser Fristen hoben werden.

16.2.3. Anerkannte Untersuchungen auf BVDV-Antikörper


Alle BVDV-Antikörper-Tests müssen die BVDV-Referenzseren Ref1-BVDV1 und
Ref3-BVDV2 (Bezug: NRL am FLI) sicher erkennen lassen.

16.2.3.1. Testsysteme für die Bestätigung der Antikörperfreiheit


• Neutralisationstest gegen BVDV -T yp 1 und BVDV-Typ 2 mit 100 KID 50 Testvirus
(Goldstandard)
• Zugelassene BVDV-p80 - -blocking-ELISAs.
• Zugelassene indirekte BVDV-Antikörper-ELISAs.

16.2.3.2. Testsysteme für die diagnostische Stichprobe (z. B. „Jungtier-


fenster“)
• Zugelassene indirekte BVDV-Antikörper-ELISA (ab einem Alter von 6 Monaten)
• Neutralisationstest gegen BVDV Typ 1 und BVDV Typ 2 (BVDV-1/2-NT) mit 100
KID 50 Testvirus. (ab einem Alter von 9 Monaten)
• Zugelassene BVDV-p80 blocking ELISA (ab einem Alter von 9 Monaten)
Die unterschiedliche zeitliche Einschränkung erfolgt aufgrund der unterschiedlich
hohen Sensitivität der Testsysteme für kolostrale Antikörper.

FLI 128
Amtliche Methodensammlung Stand: Mai 2013

Ein negativer Befund dieser Teste ist auch im jüngeren Alter für die
Stichprobenbeurteilung geeignet.

16.2.3.3. Testsysteme für die Untersuchung von Einzel- und Tankmilchproben


Alle für die Untersuchung von Milch zugelassenen Testsysteme. Es ist ausschließlich
eine Differenzierung in „Milch-positive“ und „Milch-negative“ Bestände vorzunehmen.

16.3. Untersuchungsgang
16.3.1. Erregernachweis

16.3.1.1. Virusisolierung

Leukozyten
Hämolyse und Waschen der Leukozyten, z.B. 1,5 ml EDTA-Blut + 4,5 ml Lysispuffer
(8,29 g/l NH4CL, 1,0 g/l KHCO3, 1 mM EDTA), 10 min Eis, Zentrifugation bei 1000
rpm für 5 min bei 4oC, 2 mal Waschen mit Zellkulturmedium + Antibiotika (z.B.
Gentamycin, 50 ng/ml; Baytril, 20 µg/ml; oder Penicillin/Streptomycin),
Resuspendierung. In der Aufarbeitung sollten >106 Leukozyten sein.

Alternativ: 5-10 ml EDTA-Blut mit 1 ml Dextransulfatlösung versetzen und nach


vorsichtigem Schwenken etwa 1 bis 2 Stunden bei Raumtemperatur (alternativ 30
Minuten bei 37 °C) stehen lassen. In dieser Zeit setzen sich die Erythrozyten ab. Den
leukozytenhaltigen milchig-trüben Überstand absaugen und für 10 Minuten bei 2000g
zentrifugieren Das Sediment wird nach zweimaligem Waschen in je 5 ml Ca-Mg-
freier phosphatgepufferter Salzlösung (PBS-minus) in 2 ml Kulturmedium
aufgenommen.
Die konzentrierte Leukozytensuspension dient als Inokulum für die weiteren
Arbeitsschritte. Für den späteren Gebrauch kann das Material bei –70 °C gelagert
werden.

Organmaterial
Ca. 1 g Organmaterial wird mit der Schere fein zerkleinert und in 10 Vol serumfreiem
Zellkulturmedium bzw. isotonischem Puffer mit Antibiotika in einem Mörser, bei
Notwendigkeit mit sterilem Seesand homogenisiert. Andere Methoden der
Homogenisierung (Homogenisatoren, tissue lyser) sind möglich. Nach mindestens
einstündiger Aufbewahrung bei 4 – 8 °C wird die Organsuspension für 15 Minuten
bei 3000 rpm zentrifugiert. Der Überstand dient als Inokulum für die weiteren
Arbeitsschritte. Für den späteren Gebrauch kann das Material bei –70 °C gelagert
werden.

Inokulation der Zellkulturen


Wie o.a. aufbereitetes Untersuchungsmaterial wird im Doppelansatz in einem
Volumen, das 1/10 des Zellkulturmediums entspricht (z.B. 0,1 ml für 24 well, 0,3 ml
für 6 well, 0,5 ml für TC12,5 usw.) auf 1-2 Tage gewachsene Zellkulturen, von denen
das Anzuchtmedium vorher entfernt wurde, inokuliert. Nach einer Adsorptionszeit von
30-60 min bei 37oC, wird das Inokulum entfernt (nicht bei frischem Leukozytenpellet)
und nach ein- bis zweimaligem Waschen serumfreies Erhaltungsmedium zugegeben.

FLI 129
Amtliche Methodensammlung Stand: Mai 2013

Positiv- und Negativkontrollen sind mitzuführen. Die Zellkulturen werden 3, besser 5


Tage bei 37 °C inkubiert. Während dieser Zeit werden die Zellkulturen auf das
Auftreten zytopathischer oder zelltoxischer Effekte mikroskopisch kontrolliert. Die
Zellkulturplatten können anschließend einer Immunfärbung unterzogen werden, die
Kulturflaschen werden nach Gefrier-Tau-Zyklus weiter passagiert bzw. auf
Zellkulturplatten mit dem Ziel einer Immunfärbung weiterverimpft. Es werden in der
Regel bis zu drei Passagen durchgeführt.

Immunfärbung

Fixation
Das Kulturmedium wird abgesaugt, der Zellrasen einmal mit Waschpuffer (PBS, IP,
TBST) gewaschen und luftgetrocknet (Fön oder über Nacht bei Raumtemperatur
(RT)). Die Fixierung erfolgt im Wärmeschrank für 2 h bei 80 0C. Alternative
laborübliche Fixationsmethoden (z.B. 80 % Azeton, 4 % Paraformaldehyd) können
angewendet werden, wenn ihre Eignung gezeigt wurde.
Die Platten könne für 2-3 Tage im Kühlschrank gelagert werden oder werden bei -20
o
C über längere Zeit aufbewahrt.

Immunfärbung
Die Immunfärbung kann direkt mit einem geprüften BVDV- bzw. pan-pesti-Konjugat
durchgeführt werden. Alternativ besteht die Möglichkeit, indirekt mit einem
geeigneten monoklonalen Antikörper und einem FITC-, bzw. POD-markierten Anti-
Maus-Konjugat zu färben.

Durchführung der Fluoreszenzfärbung

Direkte Methode
• Zugabe von 50-100 µl eines Fluorochrom- (z.B. FITC-) markierten Antikörpers in
Verdünnungspuffer (PBS, IP, TBST), bei Bedarf 0,001 % Evans blue,
• Inkubation bei für 60 min bei RT, 3x Waschen (2x kurz, 1x 10 min) in
Waschpuffer (PBS, IP, TBST), Puffer absaugen, 1 x Waschen mit Aqua dest,
Überschichten mit A.dest oder Fluoreszenzerhaltungspuffer (1/1 mit A.dest)
• Auswertung im inversen Fluoreszenzmikroskop.

Indirekte Methode
• Zugabe von 50-100 µl eines antigenspezifischen monoklonalen Antikörpers (z. B.
WB103/105, c.c.pro) in Gebrauchsverdünnung in Verdünnungspuffer
• Inkubation bei RT für 60 min, Absaugen des Antikörpers, einmal Waschen in
Waschpuffer
• Zugabe von 50-100 µl FITC-Anti-Maus-IgG (z.B. Firma DAKO Best.-Nr. F0479) in
Gebrauchsverdünnung (bei Zugabe von Evans blue – 0,001 % Endkonzentration)
• Inkubation bei RT für 60 min, Absaugen des Konjugates,
• 3x Waschen mit Waschpuffer (2x kurz, 1x 10 min)
• Absaugen des Puffers, 1 x Waschen mit Aqua dest.
• Überschichten Zellen mit A.dest oder Fluoreszenzerhaltungspuffer (1/1 mit
A.dest)

FLI 130
Amtliche Methodensammlung Stand: Mai 2013

FLI 131
Amtliche Methodensammlung Stand: Mai 2013

Durchführung der Peroxydasefärbung (indirekt)


• Zugabe des 50-100 µl eines antigenspezifischen monoklonalen Antikörpers (z. B.
Wb103/105) in Gebrauchsverdünnung in Verdünnungspuffer (TBST )Inkubation
bei RT für 60 min, Absaugen des Antikörpers, einmal Waschen in Waschpuffer
(TBST)
• Zugabe von 50-100µl POD-Anti-Maus-IgG (z.B. Sigma, A-9044) in
Gebrauchsverdünnung
• Inkubation bei RT für 60 min, Absaugen des Konjugates,
• Waschen der Zellen in Waschpuffer (TBST) (2x kurz, 1x 10 min)
• Absaugen des Puffers,
• Substratreaktion:
− Dazu wird 1 Tablette AEC(3-amino-9-Ethylcarbazol) in 2,5 ml Dimethyl-
formamid (DMF) gelöst (Stammlösung). Zur Anwendung werden für eine
Platte 0,25 ml Stammlösung in 5 ml 0,05 M Natriumazetatpuffer, pH 5,0
verdünnt, mit 15 µl 3 % H 2 O 2 versetzt und je 50 µl /well pipettiert. Nach 15 min
wird die Färbelösung abgesaugt und mit A. dest. aufgefüllt
− Die AEC-Stammlösung wird portioniert bei –20 0C gelagert

Achtung, AEC ist kanzerogen! (Laborhandschuhe tragen)

Phänotypische Differenzierung zwischen BVDV-1 und BVDV-2


Die parallele Anwendung der monoklonalen Antikörper WB103/105 (c.c. pro) und WB
160 (c.c. pro) ermöglichen eine Unterscheidung zwischen den BVDV-Genotypen.
BVDV-1 reagiert mit beiden Antikörpern, während Typ 2 BVD-Viren nur mit
WB103/105 eine positive Reaktion zeigen.

Geräte und Reagenzien


• Zellkulturflaschen (z.B. TC12,5, TC25)
• Pipetten
• Zellkulturplatten (6-, 24, 48, 96-well)
• Sterile Plastikspitzen
• Empfängliche Ziellinien, vorzugsweise KOP-R, MDBK, Klu, (Zellbank des FLI)
oder primäre bovine Zellkulturen
• Spezifische monoklonale Antikörper gegen BVDV bzw. Pestiviren ( z. B.
c.c.pro)
• FITC-markiertes anti-BVD-Konjugat (z.B. BioX, c.c pro)
• Peroxidasemarkierte (POD) bzw. Fluoresceinisothiocyanatmarkierte (FITC)
Anti-Maus-Antikörper (z.B. Sigma, DAKO)
• Waschpuffer, Substrat/Chromogenlösung (Rezeptur siehe Anhang)
• Standardmäßige Laborausstattung für ein Viruslabor (Sterilwerkbank,
Umkehrmikroskop, CO 2 -Schrank (37 °C), Zentrifuge, Inkubator (80 °C),
Kühlschrank, Kühltruhe (-20 °C, -70 °C).

FLI 132
Amtliche Methodensammlung Stand: Mai 2013

Puffer
PBS-: 8g NaCl
0,2 g KCl
1,15 g Na 2 HPO 4 x 2H 2 O
0,2 g KH 2 PO 4
ad 1000 ml Aqua dest

IP pH 7,2-: 8,28 g NaCl


1,186 g Na 2 HPO 4 x 2H 2 O
0,2 g KH 2 PO 4
ad 1000 ml Aqua dest

TBST: 0,05 M Tris


0,138M NaCl
0,0027M KCL, pH 8,0
0,05% Tween20
(SIGMA, T-9039, Tris buffered saline with
Tween 20, pH 8,0)

Fluoreszenzerhaltungspuffer (DABCO):
2,5 g 1,4-Diazobicyclo[2,2,2]-octan (DABCO)
in 90 ml Glycerol lösen (37 °C, Wasserbad)
+ 10 ml PBS
pH mit HCl konz. auf 8,6 einstellen

für rote Kernfärbung: zu 100 ml Fluoreszenzpuffer 100 µl Propidiumiodid-


Stammlösung (2 mg/ml) zugeben.

16.3.1.2. Antigennachweis mittels ELISA


Für den Antigennachweis werden amtlich zugelassene ELISA-Testkits nach
Herstellerangaben unter Berücksichtigung der diagnostischen Lücke eingesetzt. Der
jeweils aktuelle Stand zugelassener Mittel ist der Homepage des FLI zu entnehmen.

http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf.

16.3.1.3. Antigennachweis mittels Indirekter Immunfluoreszenz


Hautstanzen (vorzugsweise mind. 6 mm Ø) werden in flüssigem Stickstoff oder in auf
ca. -70 °C herabgekühltem n-Heptan schockgefrostet und bei -70 °C gelagert.
Etwa 5 µm dicke Kryostatschnitte werden luftgetrocknet (ca. 30 min). Die Fixierung
erfolgt in auf ca. -20 °C vorgekühltem Azeton für 15 bis 20 min bei ca. -20 °C.
Fixierte Kryostatschnitte können mehrere Monate bei ca. -20 °C gelagert werden.
In einem Prüfansatz werden bearbeitet:
1. Schnitte von verdächtigen Organproben,
2. Schnitte von Organproben eines BVDV-freien Rindes ( = negative Kontrollen),
3. Schnitte eines BVDV-positiven Rindes ( = positive Kontrollen).
In jedem Prüfansatz kommen zur Anwendung:
1. Anti-Pestivirus-mAk (z.B. WB 103/105, c.c. pro)
2. Irrelevanter mAk

FLI 133
Amtliche Methodensammlung Stand: Mai 2013

Protokoll
Alle folgenden Schritte erfolgen bei RT.
• Waschen der fixierten Kryostatschnitte in PBS für 5 min
• Blockierung mit 5 % bovinem Serumalbumin (BSA) in PBS für 30 min
• Kurz waschen in PBS
• Inkubation mit mAk in vom Hersteller empfohlener Arbeitsverdünnung in PBS für
60 min
• Waschen in PBS: 3 x 5 min
• Inkubation mit FITC-Anti-Maus-Konjugat) in empfohlener Arbeitsverdünnung für
60 min:
Verdünnung in PBS und Zusatz des Kontrastfarbstoffes Evans blue (3 Teile
Konjugat-Arbeitsverdünnung + 1 Teil 0,005 % Evans blue in PBS).
• Waschen in PBS: 3 x 5 min
• Waschen in A. dest. für mindestens 5 min
• Lufttrocknung
• Eindecken der noch leicht feuchten Schnitte mit PBS-Glycerol-Gemisch (1 Teil
PBS + 9 Teile Glycerol) oder DABCO-Fluoreszenzerhaltungs-Puffer

Mikroskopische Beurteilung der Schnitte


Für die mikroskopische Beurteilung der Schnitte ist ein aufrechtes Mikroskop mit
Auflichtfluoreszenz (Quecksilberdampf-Kurzbogenlampe HBO 100 W) erforderlich.
Die Beurteilung der Schnitte erfolgt im Vergleich mit den negativen und positiven
Kontrollschnitten. Pestivirusantigen-positive Zellen zeigen zytoplasmatische,
weitgehend homogene, leuchtende hellgrüne Fluoreszenz. Die Zellkerne bleiben
dunkel ausgespart. Virusantigen findet sich in Keratinozyten der Epidermis, im
Haarfollikelepithel, in Haarmatrixzellen der Haarzwiebel sowie in der dermalen
Haarpapille

16.3.1.4. Antigennachweis mittels Durchflusszytometrie


Der Virusnachweis mittels Durchflusszytometrie wird nur noch in wenigen Laboren
angewandt. Es sind laborintern validierte Protokolle zu verwenden.

16.3.1.5. Virusgenomnachweis mittels RT-PCR


Für den Nachweis von BVD-Virusgenom werden amtlich zugelassene Testkits nach
Herstellerangaben und Vorgaben der amtlichen Methodensammlung eingesetzt. Der
aktuelle Stand zugelassener Mittel ist der Homepage des FLI zu entnehmen.
http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf

Die Nukleinextraktion ist i.d.R. nicht Gegenstand der Zulassung, es sei denn, sie ist
integrierter Bestandteil des Testkits. Gleiches trifft auf die Schnelllyse von
Ohrstanzproben zu.

Für eine Ermittlung der absoluten Genomlast in der Probe stellt das FLI einen Standard
(DIsyn) zur Verfügung. Auf der Grundlage der Bestimmung der Kopienzahl ist eine
Abschätzung des Status (PI, Nicht-PI) des positiv getesteten Tieres weitestgehend
möglich. Bei Kopienzahlen von ≥10 ^4/well in Serum und Ohrstanzproben nach RNA-
Extraktion bzw. ≥ 10^3,5/well nach Schnelllyse von Ohrstanzproben besteht eine
hinreichende Sicherheit für das Vorliegen eines PI-Status.

FLI 134
Amtliche Methodensammlung Stand: Mai 2013

Die Verwendung validierter in house Protokolle ist möglich, wenn sie den Bedingungen
für eine Ausnahmegenehmigung nach §17c Tierseuchengesetz entsprechen und eine
entsprechende Genehmigung durch die beauftragte Behörde erteilt wurde.
Gegenwärtig trifft das für konventionelle PCR-Protokolle, z.B. mit dem Ziel der
nachfolgenden Sequenzierung und für genotypdifferenzierende Protokolle zu.

Protokolle für eine subtypenspezifische BVD-RT-PCR und eine vom AVID zur
Anwendung empfohlene genotypdifferenzierende real time RT-PCR sind im Folgenden
aufgeführt:

Genotypspezifische RT-PCR (n. Strebelow)


RNA-Isolierung
Die RNA-Isolierung erfolgt üblicher Weise durch chromatographische Trennung an
Silica-Oberflächen. Dafür sind in Abhängigkeit von der Probenart verschiedene
kommerziell erhältliche Kits verwendbar.

One-Tube-RT-PCR

Reagenzien: 1. SuperScriptTMIIIOne-Step RT-PCR with Platinum Taq (Invitrogen)


2. Primer (siehe unten)
3. Mineralöl (Sigma)
4. Rnase-freies Wasser

Ansatz:
RNA 5µl
Reaktionsmix (Kit) 12,5µl
Taq 1µl
Primer 1 1µl
Primer 2 1µl
H2O 4,5µl

Ansatz mit 20µl Öl überschichten

Primer und Temperaturprofil für BVDV I


UTR51 (rev. Primer): 5‘-CAA CTC CAT GTG CCA TGT AC-3‘
BVD I (forw. Primer): 5´-GGT AGC AAC AGT GGT GAG TTC-3´
Temperaturprofil: 30min 50oC; 2min 94oC; 40x 30sek.94oC; 30sek.55oC;
1min 68oC), 5min 68oC; 4oC for ever; Ende (258bp)

Primer und Temperaturprofil für BVDV II


UTR51 (rev. Primer): 5‘-CAA CTC CAT GTG CCA TGT AC-3‘
BVD II (forw. Primer): 5´-AGC GGT AGC AGT GAG TTC ATT-3´
Temperaturprofil: wie für BVDVI (257bp)

Auswertung und Validierung


Die Auswertung der RT-PCR erfolgt durch Analyse der PCR-Produkte mittels
Agarosegelelektrophorese. Die Spezifität positiver Reaktionen wird durch
anschließende Direktsequenzierung der PCR-Fragmente überprüft.

FLI 135
Amtliche Methodensammlung Stand: Mai 2013

Referenz:
SCHARRSCHMIDT, U., SCHIRRMEIER, H., STREBELOW, G. und WOLF, G. (2000):
Nachweis von Border Disease Virus in einem Schafbestand in Sachsen. Berl Münch
Tierarztl Wochenschr 113, 284-288

Real time RT-PCR (n. Gaede, AVID-Methode, Auszug)


Allgemeines
Für den Virusnachweis ohne Speziesdifferenzierung werden Primer und eine Sonde
mit pan-pesti-Spezifität eingesetzt. Positive Resultate werden auch für KSPV und
BDV erzielt.
Der spezifische Nachweis einer Infektion mit BVDV 2 ist mit Hilfe einer spezies-
spezifischen Sonde in Kombination mit einem weiteren pan-pesti-Primerpaar
möglich. Ein analoges spezifisches System für BVDV 1 existiert nicht. Die Sonde
PPV reagiert zwar negativ auf BVDV 2, detektiert aber neben BVDV 1 auch BDV und
KSPV. Indirekt ist die spezifische Bestätigung des Vorliegens von BVDV 1 nur durch
den Ausschluss von BVDV 2, BDV und ggf. KSPV mit für diese Virusspezies
spezifischen Sonden möglich.

RNA-Isolierung
Die RNA-Isolierung erfolgt üblicher Weise durch chromatographische Trennung an
Silica-Oberflächen. Dafür sind in Abhängigkeit von der Probenart verschiedene
kommerziell erhältliche Kits verwendbar
Ansatz der RT-PCR
Die hier beschriebenen Parameter gelten für die Verwendung des Quantitect Probe
RT-PCR Kits (Qiagen, Hilden, Deutschland) auf dem Mx3000 (Stratagene Europe,
Amsterdam, Niederlande) und iCycler (Biorad, Hercules, USA). Bei Verwendung
anderer Geräte-Systeme für die real-time PCR kann eine Anpassung erforderlich
werden, insbesondere wenn diese Geräte nicht im üblichen 96er Blockformat
arbeiten. Die Eignung anderer Enzymkits ist im Bedarfsfall zu prüfen.

• O.I.E. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (2012,
Part 2, Section 2.4, Chapter 2.4.13; Stand 2010).
Reaktionsgemisch (20 µl):
• 10 µl QuantiTect 2x Probe RT-Mastermix,
• 0,2 µl QuantiTect RT
• 1,0 µl forward-primer (Gebrauchslösung: 10 pmol/µl),
• 1,0 µl reversed-primer (Gebrauchslösung: 10 pmol/µl),
• 1,0 µl Sonde (Gebrauchslösung: 4 pmol/µl**** ) und
• 2 µl RNA-Template
**** Die optimale Konzentration der Sonde kann variieren und muss ggf. überprüft werden.

Thermocycler-Programm für one-step RT-PCR:


• reverse Transkription: 50 °C, 30 min,
• Denaturierung und Aktivierung der Taq-Polymerase: 95 °C, 15 min,
• 45 Zyklen: Denaturierung bei 94 °C für 20 sek und Annealing/Primer-
Extension bei 60 °C für 1 min.
• Messung der Fluoreszenz zum Ende der Annealingphase (FAM-Filter)

FLI 136
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 1: Primer für die BVDV real-time RT-PCR

Pestivirus-spezific Quelle Fragment Anwendung


Primers (5´-UTR)
one-step RT-PCR zum
Primer: Pesti 3 simultanen Nachweis
CCT GAG TAC AGG RTA GTC GTC A Hyndman ~171 bp von BVDV 1 und
Primer: Pesti 4 et al. (1998) BVDV 2 in Kombination
GGC CTC TGC AGC ACC CTA TCA mit der Sonde TQ-Pesti
Differenzierung von
Primer: A 11 BVDV 1 und BVDV 2
AGT ACA GGG TAG TCG TCA GTG GTT CG McGoldrick ~220bp in Kombination mit
Primer: A 14 et al. (1998) den Sonden PPV
CAA CTC CAT GTG CCA TGT ACA GCA G oder BVD-2

Tabelle 2: TaqMan-Sonden für den simultanen Nachweis von BVDV 1 und


BVDV 2 sowie zur Differenzierung von BVDV 1 und BVDV 2

TaqMan DNA-probes Quelle Spezifität


(5‘-FAM und 3‘-TAMRA)
Sonde: TQ-Pesti (“Reiting-Sonde”) Gaede et al. Genus Pestivirus
TGC YAY GTG GAC GAG GGC ATG C (2005)
Sonde: BVD-2 McGoldrick BVDV 2
CTG ATA GGG TGT AGC AGA GAC CCT et al. (1999)
Sonde: PPV McGoldrick BVDV 1, außerdem
CTG ATA GGG TGC TGC AGA GGC CCA CT et al. (1999) CSFV und BDV

Referenz:
GAEDE, W., REITING, R., SCHIRRMEIER; H., DEPNER, K.R., BEER, M. (2005):
Nachweis und Spezies-spezifische Differenzierung von Pestiviren mit der real-time RT-PCR.
Berl. Münch. Tierärztl. Wschr. 118, 113-120 bzw. AVID Methodensammlung

16.3.2. Indirekter Erregernachweis

16.3.2.1. Neutralisationstest

Prinzip
Der Test basiert auf einer in vitro Neutralisation einer definierten Virusmenge durch
spezifische (neutralisierende) Antikörper in Seren. Durch logarithmische Verdünnung
der Seren wird der neutralisierende Antikörpertiter bestimmt. Die Visualisierung der
Testergebnisse erfolgt mittels Immunfluoreszenz bzw. Immunperoxydasetest.

Testdurchführung
Probenaufarbeitung
Der Neutralisationstest wird mit Serum durchgeführt. Nur in Ausnahmefällen, wenn
kein Serum zur Verfügung steht oder wenn spezielle Fragestellungen zu beantworten
sind, kann der Test auch mit Plasma durchgeführt werden. Dann ist aber ein höherer
Grenztiter (~ 1:20) anzusetzen.
Serum wird aus Blutproben ohne gerinnungshemmenden Zusatz gewonnen. Für die
Verwendung im Neutralisationstest werden die Seren für 30 min bei 56 °C inaktiviert.
Plasma wird aus Blutproben mit gerinnungshemmenden Zusätzen gewonnen.

FLI 137
Amtliche Methodensammlung Stand: Mai 2013

Verdünnungsreihen
Der Der Test wird in einer 96-Loch-Mikrotiterplatte unter Verwendung von
Zellkulturmedium mit Antibiotikazusatz (siehe Anhang) durchgeführt.
Es wird eine Serumverdünnungsreihe in 2er-Stufen (z.B. von 1:5 bis 1:640) mit je
einem Volumen von 50 µl pro Kavität hergestellt. Pro Serumverdünnungsstufe
werden zwei oder vier Kavitäten (Doppelansatz, bzw. Vierfachansatz) nebeneinander
beschickt. Ein Beispiel für eine Plattenbelegung ist w.u. gezeigt.
In die Kavitäten der ersten Vertiefungsreihe werden 80 µl, in die Kavitäten der
anderen Reihen 50 µl Kulturmedium vorgelegt. Zur ersten Vertiefungsreihe wird dann
20 µl Serumprobe zugegeben. Mit einer Multikanalpipette werden aus der ersten
Verdünnungsstufe (1:5 Verdünnung) 50 µl aufgenommen, in die nächste Reihe
gegeben, durchmischt, und die Verdünnungsreihe fortgesetzt (8 bzw. 12
Verdünnungsstufen). Die letzten 50 µl werden verworfen. Jede Kavität enthält jetzt
50 µl einer Serum-Medium-Verdünnung.
Mindestens zwei positive Referenzseren (BVD-ref1 oder 2 für BVD1-AK; BVD-ref3
für BVD2-AK; Herkunft: BVDV-NRL, FLI Insel Riems) werden in gleicher Weise als
Kontrollen mitgeführt (positive Serumkontrollen).

Testvirus
In jede Kavität werden danach 50 µl mit 100 KID 50 der Testvirussuspension
gegeben. Die Testvirussuspension muss unmittelbar vor Gebrauch mit Kulturmedium
auf 100 KID 50 /50µl (2000 KID 50 /ml) eingestellt werden. Die benötigte Menge an
Testvirus (ca. 5 ml pro Mikrotiterplatte) ist in einem Ansatz herzustellen. Der
Verdünnungsfaktor um die Testvirussuspension auf 100 KID 50 /50 µl einzustellen wird
rechnerisch ermittelt. Ein Rechenbeispiel ist w.u. zu finden.

Kontrollen
Neben den positiven Serumkontrollen werden eine Zellkontrolle (100 µl
Kulturmedium ohne Serum und Virus), je zu testendes Serum eine virusfreie
Serumkontrolle (Grundverdünnung), eine Viruskontrolle und eine Rücktitration des
Testvirus zur Bestimmung der eingesetzten KID 50 mitgeführt. Mit der Rücktitration
kontrolliert man den tatsächlichen Virusgehalt im Test. Hierbei wird die im Test
eingesetzte Virusverdünnung in log-2-Schritten beginnend bei 1:10 bis 1:1280
ausverdünnt. 180 µl Kulturmedium werden vorgelegt, 20 µl Testvirussuspension
dazugegeben (= 1:10) und anschließend ausverdünnt. Pro Verdünnungsstufe
werden zwei oder vier Kavitäten nebeneinander mit 100 µl Virusverdünnung
beschickt.

Neutralisation
Die Mikrotiterplatte inkubiert daraufhin für 2 Stunden bei 37 °C in einer feuchten
Umgebung in einem CO 2 -Schrank (2,5 bzw. 5 % CO 2 ). Während dieser Zeit findet
der Neutralisationsprozess statt.

Zellsuspension
Nach der Inkubationszeit werden in jede Kavität 100µl der entsprechenden
Zellsuspension hinzugefügt. Die Zelldichte muss so eingestellt sein, dass nach 24
Stunden ein konfluenter Zellrasen entsteht. (ca. 300.000 Zellen/ml). Die
Mikrotiterplatte verbleibt für 72h zur Inkubation bei 37 °C in einer feuchten
Umgebung im CO 2 -Schrank (2,5 bzw. 5 % CO 2 ).

FLI 138
Amtliche Methodensammlung Stand: Mai 2013

Immunreaktion
Grundsätzlich, d.h. auch bei Verwendung eines zytopathogenen NT-Virus sollte
die Auswertung des Testes nach Detektion des Virus mittel Immunfluoreszenz-
bzw. Immunperoxydasetest nach 3 Tagen erfolgen

Die Berechnung des Antikörpertiters erfolgt als ND50 nach Behrens und Kaerber.

Neutralisationstiter = V-d(S-0,5)
V: lg der ersten 100 % pos Serumverdünnung
d: lg des Verdünnungsfaktors (0,3)
S: Summe der pos. Reagenten von 0 bis 100 % Reagentenzahl je Verdünnung

Geräte und Reagenzien


• Mikrotiterplatten (96-well)
• Mehrkanalpipetten, Pipetten, sterile Plastikspitzen
• Empfängliche Zellkulturen, z.B.: MDBK, KOP-R, (Zellbank des FLI)
• Zellkulturmedien
• Referenzviren, BVD-1: NADL; BVD2: CS8644; Virusbank des FLI)
• monoklonale Antikörper gegen Pestiviren ( z.B. cc pro)
• Peroxidasemarkierte Anti-Maus-Antikörper ( z.B. Sigma)
• Positiv- und Negativreferenzen
• Standardmäßige Laborausstattung für ein Viruslabor (Sterilwerkbank,
Umkehrmikroskop, CO 2 -Schrank (37 °C), Zentrifuge, Wärmeschrank (80 °C),
Kühlschrank, Kühltruhe (-20 °C, -70 °C).
• Referenzseren: NRL BVD, FLI Insel Riems
• Antibiotikalösung 1,25 g Penicillin
2 g Streptomycin
In 20 ml sterilem Aqua bidest lösen, portionieren
und bei –20 °C einfrieren
oder
Gentamycin, 1 µl/ml Kulturmedium (50 ng/ml)
Amphotericin, 10 µl/ml

Rechenbeispiel zur Berechnung des Verdünnungsfaktors für das Testvirus


Die im Neutralisationstest zum Einsatz kommende Virussuspension (Testvirus) soll
einen Titer von 100 KID 50 /50 µl haben. Folglich muss das Ausgangsvirus entsprechend
verdünnt werden. Die Berechnung des Verdünnungsfaktors erfolgt nach der Formel:

Titer log 10 KID 50/0,1 ml Ausgangsvirus minus 102.3* = log 10 Virusverdünnung;


entlogarithmieren.

Reziproker Wert = Virusverdünnung. (* 102,3 = 200 KID50 pro 0,1 ml)

Beispiel:
Der Titer des Ausgangsvirus beträgt 106,3 KID 50 / ml. Das sind 105,3 KID 50 /0,1ml.

Berechnung: 105,3 - 102,3 = 103


Entlogarithmierung 3,0 log 10 = 1000
 Das Ausgangsvirus muss 1 : 1000 in Kulturmedium verdünnt werden.

FLI 139
Amtliche Methodensammlung Stand: Mai 2013

Plattenbelegungsschema:

Serum 1 Serum 2 Serum 3 Serum 4 Serum 5 Serum 6


1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H

ND50

Serum 7 Serum 8 Serum 9 Serum 10 Rücktitration Serum-/


Zellkontrollen
1 2 3 4 5 6 7 8 9 10 11 12
A S1 S2
B S3 S4
C S5 S6
D S7 S8
E S9 S10
F ZK ZK
G
H VK VK

ND50

16.3.2.2. Antikörper-ELISA
Für den Nachweis von BVD-Antikörper werden amtlich zugelassene Testkits nach
Herstellerangaben und Vorgaben der amtlichen Methodensammlung eingesetzt. Der
aktuelle Stand zugelassener Mittel ist der Homepage des FLI zu entnehmen.

http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf

FLI 140
Amtliche Methodensammlung Stand: Mai 2013

17. Brucellose der Rinder, Schweine, Schafe und Ziegen


(Stand: April 2012)

17.1. Charakterisierung der Infektion


17.1.1. Erreger
Die Brucellose wird durch eine Infektion mit Bakterien der Gattung "Brucella"
verursacht.
• Brucella melitensis (Hauptwirt Schaf und Ziege)
• Brucella abortus (Hauptwirt Rind)
• Brucella suis (Hauptwirt Schwein)
• Brucella ovis (Hauptwirt Schaf)
• Brucella canis (Hauptwirt Hund)*
• Brucella neotomae (Hauptwirt Wüstenratte)*
• Brucella microti (Hauptwirt Feldmaus)*
• Brucella cetaceae (Hauptwirt Delphin)*
• Brucella pinnipedialis (Hauptwirt Robbe)*
* Diese Spezies sind bisher bei landwirtschaftlichen Nutztieren noch nicht nachgewiesen worden.

17.1.2. Klinische Symptomatik


Als Krankheitsanzeichen werden bei Tieren vorwiegend undulierendes Fieber,
Arthritis, Bursitis, Orchitis, Aborte und Puerperalerkrankungen festgestellt, besonders
schwer ist i.d.R. der Urogenitaltrakt betroffen. Deshalb sollten alle Aborte bei
Nutztieren diagnostisch abgeklärt werden. Als Zoonoseerreger kommen Brucella (B.)
melitensis, B. abortus und B. suis in Betracht. Sie führen zu akuten bis chronischen
schweren Erkrankungen bei Menschen und stellen auch heute noch in vielen
wirtschaftlich weniger entwickelten Ländern ein großes gesundheitliches Problem
dar. Menschen infizieren sich i.d.R. durch kontaminierte Lebensmittel oder direkten
Kontakt zu kranken Tieren bzw. tierischen Produkten.

17.1.3. Differentialdiagnostik
Alle anderen bei Rindern, Schweinen, Schafen und Ziegen mit Aborten
einhergehende Krankheiten.

17.1.4. Diagnostische Indikation


• siehe 17.1.6
• klinischer oder epidemiologisch begründeter Verdacht.

17.1.5. Zuständige Untersuchungseinrichtung


• Staatliche Veterinäruntersuchungsämter
• NRL Brucellose am FLI, Jena

FLI 141
Amtliche Methodensammlung Stand: Mai 2013

17.1.6. Rechtsgrundlagen
• Richtlinie 97/12/EG des Rates vom 17. März 1997 zur Änderung und
Aktualisierung der Richtlinie 64/432/EWG zur Regelung
viehseuchenrechtlicher Fragen beim innergemeinschaftlichen Handelsverkehr
mit Rindern und Schweinen (ABl. EG Nr. L 109 S. 1)
• Richtlinie 90/429/EWG zur Festlegung der tierseuchenrechtlichen
Anforderungen an den innergemeinschaftlichen Handelsverkehr mit Samen
von Schweinen und an dessen Einfuhr
• Brucellose-Verordnung in der Fassung der Bekanntmachung vom 23.
Dezember 2005 (BGBl. I S. 3602)
• Entscheidung 2003/467/EG zur Feststellung des amtlich anerkannt tuberkulose-,
brucellose- und rinderleukosefreien Status bestimmter Mitgliedstaaten und
Regionen von Mitgliedstaaten in Bezug auf die Rinderbestände
• Richtlinie 91/68/EWG des Rates vom 28. Januar 1991 zur Regelung
tierseuchenrechtlicher Fragen beim innergemeinschaftlichen Handelsverkehr
mit Schafen und Ziegen

17.2. Untersuchungsmaterial

Zum Nachweis des Erregers:


Die zum Erregernachweis bevorzugten Organe variieren je nach Tierart, Geschlecht
und Alter der Tiere sowie der zu erwartenden Brucellen - Art. Die für die einzelnen
Untersuchungsgänge besonders geeigneten Proben werden dort gesondert aufgeführt.

Auswahl und Entnahme:


Organmaterial frisch verendeter, oder besser von getöteten erkrankten Tieren bzw.
frisch abortierte Feten, Se- und Exkrete, Blut (bei Fieber), veränderte Organe. Auf
sterile Entnahme achten!
Die zu untersuchenden Tiere sollten nicht unmittelbar vor der Probennahme einer
Antibiotikatherapie unterzogen worden sein.

Transport und Lagerung:


Untersuchungsmaterial umgehend vorschriftsmäßig in dicht schließenden
Behältnissen verpackt, gekennzeichnet nach Gefahrgutverordnung Straße und
Eisenbahn, Infektionsschutzgesetz, IATA-DGR in der jeweils gültigen Fassung, DIN
EN 829, zusammen mit Vorbericht und Untersuchungsantrag an die
Untersuchungseinrichtung schicken. Während des Transportes und evtl. notwendig
werdender Lagerung ist das Material kühl (2 bis 7 °C) aufzubewahren.

FLI 142
Amtliche Methodensammlung Stand: Mai 2013

17.3. Untersuchungsgang
17.3.1. Erregernachweis
Der direkte kulturelle Nachweis des Erregers der Brucellose ist als beweisend
anzusehen und daher in jedem brucelloseverdächtigen Tierbestand zu versuchen.
Besondere Bedeutung kommt ihm in Herden zu, in denen serologische
Untersuchungen zu keiner Abklärung führten, ebenso wie bei der Verfolgung
epidemiologischer Zusammenhänge.

17.3.1.1. Mikroskopischer Nachweis


Als Untersuchungsmaterial für den mikroskopischer Nachweis werden folgende Teile
empfohlen:

Feten: Mageninhalt (Bodensatz)


Eihautteile: Kotyledonen (entzündete Areale)
Organteile: Karunkeln (Oberfläche), Hoden, Nebenhoden
Sekrete: Lochialsekret, Milch

Von den genannten Tierkörperteilen werden Ausstrich- und/oder Abklatschpräparate


angefertigt und nach Kіster (Anhang 1.1) und/oder nach Stamp (Anhang 1.2) gefärbt.
Auch immunospezifische Färbungen sind möglich, haben sich aber nicht allgemein
durchgesetzt.

Brucellen sind kleine, kokkoide Bakterien, 0,5 bis 0,7 x 0,6 bis 1,5 µm groß,
gramnegativ und unbeweglich. Sie sind meist einzeln gelagert, oft wird auch
intrazelluläre Lagerung in Phagozyten beobachtet. Brucellen bilden keine Kapseln
oder Sporen und färben sich sowohl in der Kіster- als auch in der Stamp-Färbung rot
an.

Bewertung: der alleinige mikroskopische Nachweis von Bakterien, die wie


Brucellen aussehen, ist als verdächtig zu bewerten.
Differentialdiagnose: Coxiellen und Chlamydien stellen sich im Stamp-gefärbten
Präparat ähnlich wie Brucellen dar (Tabelle 3).

FLI 143
Amtliche Methodensammlung Stand: Mai 2013

17.3.1.2. Kultureller Nachweis


Als Untersuchungsmaterial für den kulturellen Nachweis werden folgende Organteile
empfohlen:

Feten: Labmageninhalt, Lunge, Leber (ersatzweise Niere, Gehirn) evtl.


Darminhalt, Niere, und Placenta fetalis
Eihautteile: Kotyledonen (ersatzweise andere Teile, bes. entzündete Areale);
zur Unterdrückung der Begleitflora kann das Material für 20 - 30
Minuten in 3%ige Kalilauge eingelegt werden.
weibliche Tiere Karunkeln des Uterus, Euter-, und Darmbeinlymphknoten, Euter
(alle Viertel), Milch (Bodensatz und Rahm), Lochialsekret,
Vaginalschleim,
männliche Tiere: Hoden, Nebenhodenkopf und -schwanz (besonders entzündete
Areale), Sperma, Sediment von Präputialspülproben

Bei Bedarf kann Gelenk- und Bursa-Punktate, weitere Lymphknoten, Milz, Leber,
untersucht Lunge, Blut, Tonsillen, Kopf- und Halslymphknoten, Abszesse
werden:

Sämtliche o. g. Materialien werden direkt angelegt und evtl. zusätzlich in flüssige


Anreicherungsmedien verbracht. Ein Zerkleinern des Organmaterials (z. B. mit
Seesand) wird empfohlen.

17.3.1.3. Nährmedien
Probleme in der Anzüchtung von Brucellen ergeben sich mitunter durch ihre oft sehr
geringe Anzahl im Probenmaterial und in ihrem langsamen Koloniewachstum.

Feste Nährmedien

ohne Hemmstoffzusatz: Blutagarplatten (Anhang 1.3)


Brucella - Agar (Anhang 1.4)
mit Hemmstoffzusatz: Selektiv – Agar
(Brucella - Agar mit Antibiotikasupplement, Anhang 1.5)

Für die Anzüchtung von B. ovis, B. abortus Biovar (BV) 2


und B. suis BV 2 ist der Zusatz von 5 % Serum oder Blut
zum Nährmedium erforderlich.

Flüssige Anreicherungsmedien
Brucella-Bouillon, ohne Hemmstoffzusatz (Anhang 1.3)
Selektiv-Bouillon, mit Hemmstoffzusatz (Anhang 1.5)
Blutkultur: handelsübliche Blutkulturmedien (z. B. Micrognost-Blutkulturflaschen,
Biotest AG)

FLI 144
Amtliche Methodensammlung Stand: Mai 2013

Bebrütung:
• sowohl aerob als auch mikroaerophil ( 5 bis 10 Vol% CO 2 ) bei einer
Temperatur von 37 °C
• Agarplatten mindestens 5 bis maximal 21 Tage bebrüten, erste Ablesung nach
1 bis 2 Tagen.
• Flüssiganreicherungen mindestens 10 Tage (bis 6 Wochen) bebrüten,
Subkultur auf feste Medien wöchentlich, beginnend am dritten Bebrütungstag.
• Das Wachstum auf Selektivmedien kann um einige Tage verzögert sein.
• Blutkulturen bis zu 35 Tage bebrüten

Ablesen (im Bedarfsfall mit Stereomikroskop)


• Auf festen Nährböden bilden Brucellen langsam wachsende, runde Kolonien,
die in 2 bis 3 Tagen einen Durchmesser von 0,5 bis 2 mm erreichen; das
Wachstum kann aber auch verzögert sein.
• Die Kolonien der glatten (S-) Form sind konvex, glattrandig, durchscheinend
bis leicht gelblich und nicht hämolysierend.
• Rauh- (R) und M-Formen, wie zum Beispiel die permanent rauhe Art B. ovis
ist grauweiß, opak und leicht granuliert bzw. schleimig.
• Flüssige Nährmedien werden nach 7 Tagen gering gleichmäßig getrübt, es
bildet sich wenig lockerer Bodensatz.

Verdächtige Kolonien sind auf folgende Kriterien zu überprüfen


(siehe auch Tabelle 3):
• Auf welchem Nährboden und bei welcher Atmosphäre wachsen die
verdächtigen Kolonien? Brucellen wachsen aerob und/oder mikroaerophil auf
hemmstofffreiem Agar und Selektiv-Agar
• Auf Blutagar keine Hämolyse.
• nach Gram und/oder Kіster/Stamp
• Oxidase-Test positiv
Kolonien von hemmstofffreiem, blutfreiem Agar prüfen, Glasstab oder
Platinöse benutzen, Positive Reaktion: Testpapier oder -stäbchen verfärbt sich
innerhalb von 2 min. in blauviolett, Ausnahme: B. ovis reagiert im Oxidase-
Test negativ!
• Positiver Katalase-Test
auf einem Objektträger einen Tropfen Wasserstoffperoxyd (Konzentration
3%ig) mit einer Kolonie verreiben. Positive Reaktion: Starke Gasbildung.
• Beweglichkeitsprüfung
Mit der Technik "Hängender Tropfen", möglichst aus gut bewachsener
Bouillon; Brucellen sind unbeweglich
• Dissoziationsprüfung
Mit Trypaflavin (Anhang 1.6) als Objektträgertest. Mit Kristallviolett (Anhang
1.7) Platte für 15 bis 20 Sek. mit Kristallviolett-Gebrauchslösung fluten: glatte
Kolonien nehmen keine Farbe an und sind weiß, raue Kolonien sind rot-violett)

Weiteres Vorgehen
Bakterienstämme mit Brucella - ähnlichen Eigenschaften (Tabelle 3) möglichst einer
Bio-und Genotypisierung zuleiten, die auch der Klärung epidemiologischer
Fragestellungen dient. Das NRL Brucellose führt solche Untersuchungen durch.

FLI 145
Amtliche Methodensammlung Stand: Mai 2013

Regelwidrige Stämme können vorkommen. Bei Erstisolierung liegen mitunter


Stämme in der R-Form vor, die sich dann bei weiteren Passagen in die S-Form
wandeln, besonders bei Isolierung von B. melitensis aus der Milch. Rauformen
können mit den herkömmlichen Tests nicht komplett typisiert werden.

17.3.1.4. Antigen-Nachweis
Antigen-Nachweise mittels Latex-Agglutination und ELISA sind beschrieben. Haben
sich jedoch in der Routinediagnostik nicht durchgesetzt.
In den letzten Jahren sind vermehrt Nukleinsäuredetektionsmethoden (PCR) im
Labor gebräuchlich geworden. Sie sind als Ergänzung zu klassischen
bakteriologischen Methoden geeignet, um z. B. verdächtige Kolonien zu überprüfen,
eine Erstuntersuchung einer Probe oder weitergehende Typisierungen
durchzuführen. Zur Anwendung als alleinige Methode zum Nachweis Brucella
spezifischer DNA in Nativmaterial fehlen bisher ausreichende Validierungsdaten. Hier
besteht vor allem das Problem der Probenaufarbeitung (PCR inhibierende
Inhaltsstoffe). Bei negativen PCR-Befunden muss eine bakteriologische
Untersuchung erfolgen. Eine genusspezifische PCR (siehe Anhang beruht auf dem
BCSP31 Gen (Baily et al., 1992).

17.3.1.5. Antikörpernachweis

Untersuchungsmaterial
• Geeignet sind Blutserum, Plasma, Milch und Milchserum.
• Entnahme möglichst keimarm, um eine lange Haltbarkeit der Proben zu
gewährleisten.
• Blutproben sind zur Gerinnung in den ersten 2 bis 3 Std. nach Entnahme bei
18 bis 20 °C und dann kühl aufzubewahren.
• Frosteinwirkung auf Blut führt zu Hämolyse.
• Trübe, verunreinigte, flockige und hämolytische Seren sowie sinnfällig
veränderte Milchproben (Kolostralmilch, Mastitissekrete, saure Milch,
Eutersekret von altmelkenden und trockenstehenden Tieren) sind für
Untersuchungen ungeeignet.
• Die Proben sind auslaufsicher zu verpacken, zu kennzeichnen wie
Organmaterial, schnell und frostfrei zu transportieren.

Untersuchungsmethoden
Je nach Untersuchungsziel und Tierart sind in Deutschland folgende serologische
Methoden für die staatlich reglementierten Überwachungsuntersuchungen
zugelassen (EU-Richtlinie 64/432/EWG -Rinder und Schweine- vom 24.6.1964
zuletzt geändert durch Verordnung (EG) Nr. 1226/2002 vom 08. Juli 2002,
Verordnung 535/2002/EG, Entscheidung der Kommission 2004/226/EG und EU-
Richtlinie 91/68/EWG -Schafe und Ziegen- vom 28.1.1991):

FLI 146
Amtliche Methodensammlung Stand: Mai 2013

Rind
Antikörpernachweis im Blutserum: SLA, KBR, ELISA, RBT,
Antikörpernachweis in der Milch: ELISA (Poolproben), ABR

Schwein
Antikörpernachweis im Blutserum: RBT, SLA, KBR. Die SLA und die KBR sind
einzusetzen sofern bei der Erstuntersuchung
von in die Besamungsstation einzustallenden
Tieren während der letzten 15 Tage der
Quarantäne mittels RBT ein positives
Ergebnis aufgetreten ist (RL 90/429/EWG,
Anhang A, Kapitel I, 1d).

Schaf und Ziege


Antikörpernachweis im Blutserum: RBT, KBR

SLA: Serumlangsamagglutination
KBR: Komplemtentbindungsreaktion
RBT: Rose - Bengal – Test
ABR: Abortus - Bang – Ringtest
ELISA: Enzyme Linked Immuno Sorbent Assay

Ausführungsrichtlinien und Methodenbeschreibungen über die oben angegebenen


serologischen Methoden sind gesetzlich geregelt. Bei kommerziellen ELISAs richtet
sich die Durchführung nach der beiliegenden Gebrauchsinformation.
Im Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2004
herausgegeben von der OIE ist eine weitere serologische Untersuchungsmethode
als ein möglicher vorgeschriebener Test für den internationalen Handel angegeben.
Es handelt sich dabei um den Fluoreszenzpolarisationsassay (FPA). Bisher ist diese
Methode jedoch nicht in den gesetzlichen Regelungen der EU verankert.

Durchführung der serologischen Untersuchungsmethoden (Anhang 2)

Bewertung der Ergebnisse:


Der Brucella-Antikörpergehalt von Proben und Kontrollseren ist gegenüber einem als
internationales Standardserum anerkanntem Rinderserum (OIEISS, vom CVL
Weybridge), das 1000 Internationale Einheiten/ml (SLA) bzw.1000 Sensibilisierende
Einheiten/ml (KBR) enthält, standardisiert und wird in I.E./ml bzw. SensE/ml
ausgedrückt. Die Bewertung der ELISAs bei Poolmilchproben orientiert sich an den
vom Hersteller mitgelieferten Kontrollen.
Die Bewertung der serologischen Ergebnisse wird durch eine Vielzahl von
serologischen Kreuzreaktionen, die durch Antigenverwandtschaft mit anderen
Erregern, besonders mit Yersinien (Kittelberger et al.; 1998), bedingt werden,
erschwert.

FLI 147
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 2: Infektionsspektrum, Pathogenität und Übertragung von B. melitensis,


B. abortus, B. suis und B. ovis (nach Dedié et al., 1993)

Brucella Untertype Haupt- weitere Übertragung Pathogenitä Infektions-


n und wirts- natürliche zwischen t für quellen für
Kolonie- tiere Wirtstiere Tieren Menschen Menschen
formen
melitensis 3 Biovare, Ziegen, Rind, (konnatal), hoch; mehr Kontakt,
meist S-, Schafe Kamele, Kontakt, akut Tiergeburtshilfe,
auch R- Alpaca, Geburt, (oral) Milch und Käse
Formen Fleischfresse Nachgeburt, (unpasteurisiert)
r, Milch , Laborarbeiten,
Wildwiederkä (genital), Schlachten
uer, Zecken?
(Schwein,
Nagetiere)
abortus 7 Biovare, Rind und Einhufer, (konnatal), erheblich Kontakt,
(1 - 6, 9) andere (Schafe, Kontakt, bis hoch, Tiergeburtshilfe,
meist S-, Bovine Kamele), Geburt mehr Rohmilch,
auch R- Fleischfresse (konjunktival, chronisch Laborarbeiten
Formen r, kutan), oral z.
(Wühlmäuse B. mit
?) Nachgeburt
oder Milch
(genital,
Besamung)
suis 5 Biovare Biovar 1 Wildschwein genital, geringgradi Schlachten,
(auch R- - 3: e, Kontakt, oral: g (Biovar 2) Behandeln von
Formen) Schwein Fleischfresse Fleisch, bis hoch Fleisch und
Biovar 4 Biovar 2: r, Beutetiere, (Biovar1) Wildbret,
syn. B Hase Kleinnagetier Kadaver, Laborarbeiten
rangiferi Biovar 4: e (Biovar 3), (stechende
Rentier (Wiederkäuer Insekten?)
Biovar 5: )
Nagetier
e
ovis stets in R- Schafboc (Ziege?, genital, keine bisher keine
Form k Nagetiere?) (Kontakt) Infektionen
beim Menschen
nachgewiesen

FLI 148
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 3: Differential diagnostische Charakterisierung von Brucellen im Vergleich


zu anderen gramnegativen Mikroorganismen (nach Alton, et al., 1988)

Tests Brucella Bordetella Campylo- Moraxella Acineto- Yersinia


bronchi- bacter bacter enterocolitica
septica fetus O:9
Morphologie kleine kleine Komma diplokokkoid Diplo- Stäbchen
Kokken Kokken förmig kokkoid
Beweglichkeit − + + − − −
bei 37 °C
Beweglichkeit − − − − − +
bei 20 °C
Laktose − − − va v −
Fermentation
auf
Mac Conkey
Agar
Säure −β − − − v +
Produktion auf
Glukoseagar
Haemolyse auf − + − v v −
Blutagar
Katalase + + + v + +
χ
Oxidase + + + + − −
δ
Urease + + − v v +
ε
Nitratreduktion + + + v − +
Zitratverbrauch − + − − v −
a
Positive und negative Reaktionen innerhalb des Genus
b
B. neotomae kann geringgradig Fermentation zeigen
c
Mit Ausnahme von B. ovis, B. neotomae und manchmal B. abortus Stämme, welche negativ sind
d
Mit Ausnahme B. ovis, und manchmal B. abortus Stämme, welche negativ sind
e
Mit Ausnahme von B. ovis, welcher nicht Nitrat reduziert

Literatur
DEDIÉ, K., J. BOCKEMÜHL, H. KÜHN, K.-J. VOLKMER und T. WEINKE (Hrsg.)
(1993): Bakterielle Zoonosen bei Mensch und Tier. Ferdinand Enke Verlag Stuttgart,
S. 49-65, 295-229.

FLI 149
Amtliche Methodensammlung Stand: Mai 2013

Anhang 1

1) Färbung nach Kіster


• Ausstrich fixieren
• Ausstrich mit alkalisierter Safraninlösung* für 1 min. bedecken
• Abspülen mit Wasser
• Präparat kurzzeitig (8 bis 10 Sek.) entfärben in 0,05%iger Schwefelsäure
• Abspülen mit Wasser
• Gegenfärben mit 3%iger wässriger Methylenblaulösung, etwa 8 - 10 Sek.
• Abspülen mit Wasser und Präparat trocknen lassen

*Alkalisierte Safraninlösung:
Unmittelbar vor jeder Färbung frisch herstellen, indem zu 1,5 ml einer 1 molaren KOH-Lösung 5
Tropfen einer 3%igen wässrigen Safraninlösung gegeben werden.

Auswertung: Brucellen färben sich rot an, andere Bakterien und der Untergrund blau.

2) Färbung nach Stamp (modifizierte Ziehl-Neelsen-Färbung)


• Ausstrich hitzefixieren
• Ausstrich mit 1:10 verdünntem Karbolfuchsin nach Ziehl-Neelsen* 10 min.
bedecken
• Abspülen mit Wasser
• Präparat entfärben in 0,5%iger Essigsäure für 30 Sek.
• Abspülen mit Wasser
• Gegenfärben mit 1%iger Methylenblaulösung, etwa 20 Sek.
• Abspülen mit Wasser und Präparat trocknen lassen

* Karbolfuchsin nach Ziehl-Neelsen, Stammlösung:


1,0 g basisches Fuchsin, gelöst in 10 ml absolutem Alkohol, zu 90 ml 5%iger Phenollösung gegeben

Auswertung:
Brucellen färben sich rot an, andere Bakterien und der Untergrund blau. Auch
Coxiellen und Chlamydien färben sich rot an!

3) Blut-Agar
Brucella-Agar mit Zusatz von 5 bis 10 % defibriniertem Blut von Schafen, Pferden,
Rindern oder Kaninchen

oder:

Bacto-Pepton 10.0 g Verwendung:


Natriumchlorid 5.0 g wie Brucella-Agar, zusätzlich ist die Beurteilung
Na 2 HPO 4 x 12 H 2 O 2.0 g von Hämolyse möglich
Fleischextrakt 6.0 g
Aqua dest. ad 1000.0 ml

pH = 7.2

FLI 150
Amtliche Methodensammlung Stand: Mai 2013

4) Brucella-Agar/Bouillon

Trypticase Pepton 10.0 g Verwendung:


Thiotone Pepton 10.0 g Isolierung, Anreicherung und Kultivierung von
Hefeextrakt 2.0 g Brucella-Arten aus klinischem Material und
Glucose 1.0 g Lebensmitteln (auch Milch und Milchprodukte)
Natriumchlorid 5.0 g Brucella-Agar ist ein sehr gutes Basismedium und
Natriumdisulfit 0.1 g wird, auch mit Zusatz von 5 % defibriniertem
Agar (nicht bei Bouillon) 15.0 g Schafblut oder Antibiotika-Supplement, breit
Aqua dest. ad 1000.0 ml eingesetzt. Brucella-Agar ist zur Stammaufbewahrung
geeignet

pH = 7.0

5) Brucella Selektiv-Agar/Selektiv-Bouillon mit Selektiv-Supplement

Polymyxin B 2500 IE Verwendung:


Bacitracin 12500 IE Als Zusatz zum Basismedium zur Hemmung der
Cyclohexemid 50 mg Begleitflora bei Direktkultivierung und Anreicherung
Nalidixinsäure 2,5 mg von Brucellen. Die Zusammensetzung des
Nystatin 50000 IE Supplements variiert je nach Hersteller geringgradig.
Vancomycin 10 mg

Je Röhrchen Supplement aseptisch 10 ml Methanol/Aqua dest. -Mischung (50:50)


zusetzen und 10 - 15 min. bei 37 °C inkubieren. Durch Schütteln vollständig lösen,
die Lösung zu 500 ml auf 50 °C abgekühltem Medium geben, mischen und abfüllen.

Achtung:
Das Produkt ist giftig! Sicherheitshinweise beachten!
Das Produkt hat eine kurze Laufzeit, Verfallsdatum beachten!
Das Produkt ist bei 2 bis 8 °C zu lagern!

6) Trypaflavin zur Dissoziationsprüfung

10 mg Trypaflavin (Acriflavin) auf 10 ml aqua dest. Erst unmittelbar vor Gebrauch


herstellen.

7) Kristallviolett zur Dissoziationsprüfung

Lösung a): Kristallviolett 2,0 g


abs. Alkohol 20,0 ml
Lösung b): Ammoniumoxalat 0,8 g
Aqua bidest. 80,0 ml
Stammlösung: Lösungen a) und b) mischen , Haltbarkeit 3 Monate
Gebrauchslösung: erst unmittelbar vor Gebrauch herstellen
Stammlösung 1:40 mit Aqua bidest. verdünnen

FLI 151
Amtliche Methodensammlung Stand: Mai 2013

Anhang 2

A) Arbeitsanleitung zur Durchführung der Serumlangsamagglutination in


der Mikro-Methode (SLA)

1. Geräte
• Zentrifuge
• Brutschrank (+37 °C ± 1 °C)
• Kühlschrank (+5 °C ± 3 °C)
• Tiefkühlschrank (-21 °C ± 3 °C)
• Präzisionswaage
• Kolbenhubpipetten (10 µl bis 100 µl, 100 µl bis 1000 µl) nach DIN/ISO 9001
• Mehrkanalkolbenhubpipette nach DIN/ISO 9001
• 8-Kanal-Multistepper (50 µl bis 200 µl) nach DIN/ISO 9001
• Dispenser (10 µl bis 5 ml) nach DIN/ISO 9001
• Combitips nach DIN/ISO 9001

2. Gebrauchsmaterialien
• Reagenzgläser
• Messpipetten DIN 12691, 12695, 12700 (1, 5, 10 ml)
• Messzylinder DIN 12680
• Erlenmeyerkolben DIN 12380, 12385, 12387
• Stehkolben DIN 12347, 12348
• Bechergläser DIN 12331
• Mikrotiterplatten (U-Form, 8x12 cups)
• Pipettenspitzen DIN/ISO 9001
• Reagenzglasständer
• feuchte Kammer
• Antigen, zugel. nach §17c TierSG
• Kontrollserum, positiv, zugel. nach §17c TierSG
• Kontrollserum, negativ, zugel. nach §17c TierSG

3. Chemikalien
• Natriumchlorid p.A. (NaCl)
• Safranin
• Aqua bidest.

4. Rezepturen

4.1. Physiologische NaCl-Lösung


• Natriumchlorid p.A. 8,9 g
• Aqua bidest ad 1000,0 ml

20' bei 121 °C autoklavieren, Lagerung bei +5 °C ± 3 °C, Haltbarkeit 6 Monate

FLI 152
Amtliche Methodensammlung Stand: Mai 2013

4.2. Safranin-Lösung
• Safranin 0,5 g
• Aqua bidest ad 100,0 ml

Aqua bidest unter ständigem Schwenken dem Safranin zufügen und bis zur
vollständigen Lösung rühren, Lagerung bei +22 °C ± 3 °C, Haltbarkeit 12 Monate

4.3. Verdünnungsflüssigkeit
1 Tropfen (ca. 50 µl) der 0,5%igen Safranin-Lösung + 20 ml physiologischer NaCl-
Lösung

5. Durchführung

5.1. Antigen
Das Antigen ist in der vom Hersteller angegebenen Gebrauchsverdünnung zu
verwenden.

5.2. Kontrollsystem
• Kontrollseren: In jedem Ansatz wird ein dem Antigen homologes positives (mit
definiertem Titer bzw. Angabe von IE/ml) sowie ein antikörperfreies, d. h.
negatives Kontrollserum mitgeführt.
• Antigenkontrolle

5.3. Serumproben und Antigen auf Raumtemperatur erwärmen

5.4. Serumproben und Kontrollseren werden im Reagenzglas 1:5 vorverdünnt

5.5. Ansatz
In der folgenden Tabelle werden die Arbeitsschritte für eine Probenuntersuchung
dargestellt:

Cup Antigen-
Kontrolle
Arbeitsschritte 1 2 3 : : : 11 12
1. NaCl-Lösg. (µl) - 50 50 : : : 50 50
2. Serum-Verd. 1:5 (µl) 100 - - : : : - -
3. Titration des Serums von 1 nach 11 durch Übertragung von 50 Еl der Serumverdünnung,
50 Еl Serumverdünnung der Reihe 11 verwerfen
4. Antigen- (µl) 50 50 50 : : : 50 50
Gebrauchsverd.
5. Inkubation 18 bis 24 h bei 37 °C ± 1 °C (feuchte Kammer)

FLI 153
Amtliche Methodensammlung Stand: Mai 2013

6. Ablesen der Reaktionen


- Positive Reaktion → Bildung eines auf dem Boden gleichmäßig verteilten,
mitunter an den Rändern leicht eingerolltes Agglutinat
- Negative Reaktion → eindeutige Knopfbildung des Antigens
- Positive Kontrolle → muss dem angegebenen Titer entsprechen (+/- eine
Titerstufe) bzw. dient der Berechnung der IE/ml der zur
untersuchenden Probe
- Negative Kontrolle → in jeder Serumverdünnung muss eine eindeutige
Knopfbildung erkennbar sein
- Antigenkontrolle → eindeutige Knopfbildung

7. Bewertung:
SLA ± 30 IE/ml

8. Validierung:
durch Einsatz des 2, Internationalen Standard Brucella abortus Serum (ISabS) und
Übersetzung der Ergebnisse in Internationale Einheiten (IE)

B) Arbeitsanleitung zur Durchführung der Komplementbindungsreaktion in


der Mikro-Methode Brucellose (KBR)

1. Geräte
• Zentrifuge
• Brutschrank (+37 °C ± 1 °C)
• Wasserbad, Temp. variabel (55 °C bis 65 °C)
• Wasserbad (+37 °C ± 1 °C)
• Kühlschrank (+5 °C ± 3 °C)
• Tiefkühlschrank (-21 °C ± 3 °C)
• Präzisionswaage
• Tafelwaage
• Magnetrührer (heizbar)
• pH-Meter
• Kolbenhubpipetten (10 µl bis 100 µl, 100 µl bis 1000 µl) nach DIN/ISO 9001
• Mehrkanalkolbenhubpipette nach DIN/ISO 9001
• 8-Kanal-Multistepper (50 µl bis 200 µl) nach DIN/ISO 9001
• Dispenser (10 µl bis 5 ml) nach DIN/ISO 9001
• Combitips nach DIN/ISO 9001
• Pipettierhilfe

2. Gebrauchsmaterialien
• Reagenzgläser
• Messpipetten DIN 12691, 12695, 12700 (1, 5, 10 ml)
• Messzylinder DIN 12680
• Erlenmeyerkolben DIN 12380, 12385, 12387
• Stehkolben DIN 12347, 12348

FLI 154
Amtliche Methodensammlung Stand: Mai 2013

• Bechergläser DIN 12331


• Zentrifugengläser DIN 58970, Teil 2
• Mikrotiterplatten (U-Form, 8x12 Cups)
• Pipettenspitzen DIN/ISO 9001
• Reagenzglasständer
• feuchte Kammer
• Klebeband (Breite 8 cm)
• Magnetrührstäbchen PTFE
• Antigen, zugel. nach §17c TierSG
• Kontrollserum, positiv, zugel. nach §17c TierSG
• Kontrollserum, negativ, zugel. nach §17c TierSG
• Ambozeptor
• Komplement
• Hammelblut

3. Chemikalien
• Natriumchlorid p. A (NaCl)
• 5,5 Diethylbarbitursäure • Natrium-Salz (C 8 H 11 N 2 NaO 3 )
• Magnesiumchlorid (MgCl 2 ) • 6H 2 O
• Calciumchlorid (CaCl 2 ) • 2H 2 O
• 1n Salzsäure (HCl)
• D(+)-Glucose-Monohydrat (C 6 H 12 O 6 ) • H 2 O
• Natriumcitrat (C 6 H 5 Na 3 O 7 ) • 2H 2 O
• Kaliumsulfat (K 2 SO 4 )
• Borsäure (H 3 BO 3 )
• Eichlösungen für pH-Meter
• Penicillin
• Aqua bidest.

4. Rezepturen

4.1. Verdünnungslösung (VBD)


Die Verdünnungsflüssigkeit für alle Reagenzien ist Veronal-Puffer-Lösung (veronal-
buffered-diluent = VBD). Zur besseren Haltbarkeit wird ein VBD-Konzentrat im
Verhältnis 5:1 hergestellt und portioniert bei +5 °C ± 3 °C gelagert. Vor Gebrauch ist
es 1:5 mit Aqua bidest. zu verdünnen.

4.1.1 Herstellung des VBD-Konzentrates 5:1, 2000ml


a. Stammlösung 1
• Natriumchlorid p.A. 83,00 g
• 5,5 Diethylbarbitursäure • Natrium-Salz 10,19 g
• Aqua bidest. (heiß) ca. 800,00 ml

b. Stammlösung 2
• Magnesiumchlorid • 6H 2 O 20,30 g
• Calciumchlorid • 2H2O 4,40 g
• Aqua bidest. ad 100,00 ml

→ Die Lösung kann bei +5 °C ± 3 °C 6 Monate aufbewahrt werden.

FLI 155
Amtliche Methodensammlung Stand: Mai 2013

• Substanzen der Stammlösung 1 in einen Erlenmeyerkolben durch Rühren auf


dem Magnetrührer heiß lösen
• tropfenweise Zugabe von 34,58 ml 1n Salzsäure (HCl)
• evtl. ausfallende Salze durch Zugabe von Aqua bidest. in Lösung bringen
• tropfenweise Zugabe von 5ml Stammlösung 2
• nach Abkühlung der Lösung das Volumen mit Aqua bidest. auf 2000 ml
auffüllen

4.1.2 Überprüfung des pH-Wertes pH 7,3 ±0,2


• Verdünnung von 1 ml VBD-Konzentrates mit Aqua bidest. 1:5
• Messung des pH-Wertes

4.2. Alseverlösung zur Konservierung von Hammelbluterythrozyten


• Dextrose (Glucose) 18,66 g
• Natriumchlorid 4,18 g
• Natriumcitrat 8,00 g
• Aqua bidest. ad 1000,00 ml
• Lösen im Dampftopf für 20 min

→ Bei längerer Erhitzung karamellisiert Dextrose in der Lösung

4.3. Hammelblut ("sheep red blood cells", SRBC)


Das Blut wird vom Schaf unter sterilen Bedingungen durch Punktion der Vena
jugularis entnommen und unter leichtem Schütteln zu gleichen Teilen mit
Alseverlösung in einem sterilen Gefäß (im geschlossenen System) aufgefangen. Ein
Zusatz von Penicillin (200.000 IE/l) kann die Haltbarkeit erhöhen. Das konservierte
Hammelblut ist bei +5 °C ± 3 °C ca. drei Wochen haltbar.

4.4. Ambozeptor
Der Ambozeptor wird käuflich erworben und vor erstmaligem Gebrauch jeder Charge
ausgewertet. Bei Titerverlust empfiehlt sich eine erneute Auswertung.

4.5. Komplement
Das Komplement ist ein Mischserum von gesunden Meerschweinchen, die vor dem
Entbluten 24 Stunden nicht gefüttert werden. Es kann portioniert bei -21 °C ±3 °C
aufbewahrt werden. Vor jeder KBR wird eine Komplementauswertung vorgenommen.

Witte-Lösung (Kalium-Borlösung) zur Konservierung von Meerschweinchen-


komplement
• Kaliumsulfat 10,0 g
• Borsäure 4,0 g
• Aqua bidest. ad 100,0 ml
• 1 h bei 100АC im Dampftopf lösen,

Komplement und Konservierungslösung werden zu gleichen Teilen gemischt. Der


Verdünnungsfaktor des Komplements muss beim Ansatz (Komplementauswertung

FLI 156
Amtliche Methodensammlung Stand: Mai 2013

und Hauptversuch) berücksichtigt werden. Haltbarkeit bei geringem Titerabfall ca.


acht Wochen.

Alle Reagenzien sind auch kommerziell erhältlich und sollten möglichst aus
einer Hand bezogen werden. Auf diesem Weg können die ansonsten sehr
umfangreichen (s. o.) Vorarbeiten deutlich minimiert werden, was zu
wesentlichen Kostenersparnissen (v.a. Personalkosten) führt!

5. Durchführung

5.1. Antigen
Antigen ist in der vom Hersteller angegebenen Gebrauchsverdünnung zu
verwenden.

5.2. Kontrollsystem
• Kontrollseren:
In jedem Ansatz wird ein dem Antigen homologes positives (mit definiertem
Titer bzw. Angabe von Sens.E./ml) sowie ein antikörperfreies, d. h. negatives
Kontrollserum mitgeführt. Resuspendierte Seren können portioniert bei -21АC
Б3АC gelagert werden.
• Serumkontrolle für jedes mitgeführte Serum (SK)
• Antigenkontrolle (AK)
• Komplementkontrolle (CK)
• Hämolytisches System-Kontrolle (HS-K)

5.3. Serumproben und Antigen auf Raumtemperatur erwärmen

5.4. Inaktivierung der Seren


Vor der Untersuchung sind alle zu untersuchenden Proben einschließlich
Kontrollseren im Wasserbad in entsprechender Verdünnung wie folgt zu inaktivieren:

Serum- Tierart Temp. (АC) Zeit (min)


verdünnung
B.abortus/ 1:5 Rd., Pfd., 56 - 60 30 - 50
B.melitensis/
Meerschw.,
B.suis
Wildwdk., Hasen,
Schaf, Ziege, 60 - 63 30
Schwein, Wildschwein 60 30 - 50
B. ovis 1:5 und 1:10 Schafe 60 - 63 30

Verunreinigte und hämolytische Seren sind zur Untersuchung nicht geeignet.

FLI 157
Amtliche Methodensammlung Stand: Mai 2013

5.5. Hämolytisches System (HS)


Das mit Alseverlösung versetzte Hammelblut wird 3- bis 5-mal in VBD gewaschen
(bis die überstehende Flüssigkeit wasserklar ist), dazu jedes Mal 10 Minuten bei
1000 g zentrifugieren, den Überstand verwerfen und das Erythrozytensediment mit
VBD aufschwemmen. Aus dem gewaschenen Erythrozytensediment wird eine 1- bis
2%ige Suspension hergestellt. Zum Gebrauch wird diese mit gleichem Volumen
eines gebrauchsfertig verdünnten Ambozeptors vermischt.
Bei getrennter Aufbewahrung von Erythrozytensuspension und Ambozeptor-
verdünnung können diese bis zu 48 h nach Herstellung verwendet werden.

6. Ambozeptorauswertung

6.1. Herstellung einer 2%igen Erythrozytensuspension (siehe. 5.5.)

6.2. Ansatz folgender geometrischer Verdünnungsreihen des Ambozeptors:

Röhrchen 1 2 3 : : : n
Reihe A) 1:500 1000 2000 : : : 32000
Reihe B) 1:750 1:1500 3000 : : : 24000

• Ausgangsverdünnung 1:500 (z. B. 0,2 ml Ambozeptor + 99,8 ml VBD)


• Vorlage von 5 ml VBD für Reihe A ab Röhrchen 2, für Reihe B ab Röhrchen 1
• für Reihe A dem 1. und 2. Röhrchen 5 ml Ambozeptorverdünnung zufügen
und ab Röhrchen 2 durch fortlaufendes Überpipettieren von jeweils 5 ml die
weiteren Verdünnungen anlegen
• für Reihe B dem 1. Röhrchen 10 ml Ambozeptorverdünnung zufügen und
durch fortlaufendes Überpipettieren vom jeweils 5 ml weitere Verdünnungen
anlegen
• beide Titrationsreihen zu einer Verdünnungsreihe zusammenfügen

6.3. Durchführung der Ambozeptorauswertung

Tabelle 4: Ansatzschema der Ambozeptorauswertung

Röhrchen Amb.-Verd. VBD Erythr.-Susp. Kompl. 1:20


(0,5 ml) (ml) (ml) (ml)
1 1:500 1,0 0,5 0,5
2 1:750 1,0 0,5 0,5
3 1:1000 1,0 0,5 0,5
: : : : :
: : : : :
: : : : :
n 1:32000 1,0 0,5 0,5

FLI 158
Amtliche Methodensammlung Stand: Mai 2013

• Kontrollen
a) Erythrozytenkontrolle: 0,5 ml Erythrozytensuspension
2,0 ml VBD
b) Komplementkontrolle: 0,5 ml Erythrozytensuspension
0,5 ml Komplement 1:20
1,5 ml VBD
c) Ambozeptorkontrolle: 0,5 ml Erythrozytenkontrolle
0,5 ml Ambozeptorverdünnung
1,5 ml VBD
• schütteln, Inkubation 30’ bei +37 °C ± 1 °C im Wasserbad

6.4. Bewertung
Ermittelt wird die höchste Ambozeptorverdünnung, die noch eine komplette
Hämolyse bewirkt. Sie gilt als Ambozeptoreinheit (AE). Die Gebrauchsverdünnung
beträgt 4 Einheiten, also die vierfache Konzentration.

Beispiel: 1 AE = 1:6000
Gebrauchsverdünnung = 1:1500

Die Kontrollen dürfen keine Hämolyse aufweisen.

7. Komplementauswertung
Die Komplementauswertung dient der Feststellung der Komplementgebrauchsdosis
für den Hauptversuch in Gegenwart der entsprechenden
Antigengebrauchsverdünnung. Zum Vergleich wird eine zweite Reihe angesetzt, bei
der das Antigenvolumen durch VBD ersetzt ist.

7.1. Durchführung
Das Komplement wird an jedem Untersuchungstag in 8 Konzentrationsstufen in der
Wärmebindung geprüft. In der Tabelle 5, Teil 1, ist die Herstellung der 8
Verdünnungsstufen dargestellt.

Tabelle 5: Komplementauswertung, Teil 1

Komplementkonzentration (%)
0,5 1,0 1,5 2,0 2,5 3,0 3,5 4,0
Kompl. (ml) 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8
1:10
VBD (ml) 1,9 1,8 1,7 1,6 1,5 1,4 1,3 1,2

Die weiteren Arbeitsschritte sind in der Tabelle 5, Teil 2, erklärt.

FLI 159
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 5: Komplementauswertung, Teil 2

Reihe 1 Reihe 2
Komplement je Verd.-Stufe (ml) 0,5 0,5
Antigengebrauchsverdünnung (ml) - 0,5
VBD (ml) 1,0 0,5

- schütteln, Wasserbad 60’ bei +37 °C ± 1 °C


HS (ml) 1,0 1,0

7.2. Bewertung
Es wird das Röhrchen mit der niedrigsten Komplementkonzentration bestimmt, das
eine komplette Hämolyse aufweist. Die Gebrauchsverdünnung für den Hauptversuch
ist die folgende höhere Konzentration.

Beispiel: komplette Hämolyse = 2,0 %


Gebrauchsdosis = 2,5 %

8. Hauptversuch

8.1. Ansatz
In der Tabelle 6 werden die Arbeitsschritte für eine Probe und ein Antigen als Modell
dargestellt.

Tabelle 6: Hauptversuch

Cup
Arbeitsschritte 1 2 3 : : : 10 11 12
1. VBD (µl) - 25 25 : : : 25 - 25
2. Serum (µl) 50 - - : : : - 50 -
3. Titration des Serums von 1 nach 10 und von 11 nach 12 (verwerfen von 25 µl aus den
Cups 10 u. 12)
4. VBD (µl) - - - : : : - 25 25
5. Antigen (µl) 25 25 25 : : : 25 - -
6. Komplement (µl) 25 25 25 : : : 25 25 25
7. abgedeckte Platte 18 bis 24h bei +5 °C ± 3 °C inkubieren und auf Raumtemperatur
erwärmen*)
8. HS (µl) 50 50 50 : : : 50 50 50
9. Inkubation 30’ bei +37 °C ±1 °C im Wasserbad oder im Brutschrank in einer feuchten
Kammer
)
* Beschälseuche-KBR: Inkubation 60’ bei +37 °C ± 1 °C im Brutschrank in einer feuchten Kammer

FLI 160
Amtliche Methodensammlung Stand: Mai 2013

8.2. Kontrollen
Bei der Durchführung des Hauptversuches sind jeweils folgende Kontrollansätze
mitzuführen:
a. Kontrolle der antikomplementären Wirkung des Serums (Serumkontrolle),
angesetzt in den beiden Anfangsverdünnungen (Cup 11 und 12)
• Serumverdünnung : 25 µlBD : 25 µl
• Komplement : 25 µl
• HS : 50 µl
Bewertung : 100 % Hämolyse

b. Kontrollen des Antigens


• VBD : 25 µl
• Antigen : 25 µl
• Komplement : 25 µl
• HS : 50 µl
Bewertung : 100 % Hämolyse

c. Kontrollen des Komplements


• VBD : 50 µl
• Komplement : 25 µl
• HS : 50 µl
Bewertung : 100 % Hämolyse

d. Kontrolle des Hämolytischen Systems (HS)


• VBD : 75 µl
• HS : 50 µl
Bewertung : 0 % Hämolyse

e. Positives Kontrollserum
• Serumverdünnung : 25 µl
• Antigen : 25 µl
• Komplement : 25 µl
• HS : 50 µl
Bewertung :
definierter Titer ± 1 Titerstufe, bei standardisierten Seren =
Berechnungsgrundlage für die Sensibilisierungseinheiten/ml

f. Negatives Kontrollserum
• Serumverdünnung : 25 µl
• Antigen : 25 µl
• Komplement : 25 µl
• HS : 50 µl
Bewertung : 100 % Hämolyse (jede Serumverdünnung)

FLI 161
Amtliche Methodensammlung Stand: Mai 2013

9. Auswertung
• Bei der Ablesung wird unterschieden:
• 100 % Hämolysehemmung = 4 (++++)
• 75 % Hämolysehemmung = 3 (+++)
• 50 % Hämolysehemmung = 2 (++)
• 25 % Hämolysehemmung = 1 (+)
• keine Hämolysehemmung = negativ

Bewertung: ≥ 20 sens.E./ml = positiv

B. ovis: ≥ 50 sens.E./ml bezogen auf das Nationale Referenzserum. Dieses ist


eingestellt am internationalen Brucella ovis Standardserum (Weybridge).

C) Arbeitsanleitung zur Durchführung des Rose-Bengal-Tests (RBT)

1. Geräte
• Zentrifuge
• Kühlschrank (+5 °C ± 3 °C)
• Tiefkühlschrank (-21 °C ± 3 °C)
• Kolbenhubpipetten (10 µl - 100 µl) nach DIN/ISO 9001
• Tafelwaage

2. Gebrauchsmaterialien
• Tüpfelplatten (eben oder mit Vertiefungen)
• Glasstäbe
• Pipettenspitzen nach DIN/ISO 9001
• RBT-Antigen, zugel. nach § 17c TierSG
• Brucellose-Kontrollserum, positiv, zugel. nach §17c TierSG
• Brucellose-Kontrollserum, negativ, zugel. nach §17c TierSG

3. Durchführung

3.1. Kontrollsystem
In jedem Ansatz wird ein Brucellose-Kontrollserum, positiv, und ein Brucellose-
Kontrollserum, negativ, mitgeführt. Resuspendierte Seren können portioniert bei -
21 °C ± 3 °C gelagert werden.

3.2. Serumproben und Antigen auf Raumtemperatur erwärmen

3.3. Übertragen von Serum auf Tüpfelplatten: 25 µl auf Platten mit Vertiefung, 30 µl
auf ebene Platten

3.4. 25 µl bzw. 30 µl Antigen jedem Serum hinzufügen. Das Volumen des Antigens
muss dem Volumen des Serums entsprechen.

FLI 162
Amtliche Methodensammlung Stand: Mai 2013

3.5. Serum und Antigen mit Glasstab mischen

3.6. Serum-Antigen-Gemisch 4' kreisend schwenken

4. Ablesen der Reaktionen

- Positive Reaktion → Bildung von Agglutinaten jeder Reaktionsstärke


innerhalb der Beobachtungszeit
- Negative Reaktion → Serum-Antigen-Gemisch bleibt innerhalb der
Beobachtungszeit homogen rot gefärbt
- Positive Kontrolle → Agglutination
- Negative Kontrolle → Serum-Antigen-Gemisch bleibt innerhalb der
Beobachtungszeit homogen rot gefärbt

Brucella abortus-Antigen für die SLA, amtl. Zulassungsnummer BFAV-B370, kommerziell erhältlich
Brucella abortus-Antigen für die KBR, amtl. Zulassungsnummer BFAV-B371, kommerziell erhältlich
Brucellose-Kontrollserum, positiv, amtl. Zulassungsnummer BFAV-K076, kommerziell erhältlich
RBT-Antigen, amtl. Zulassungsnummer BFAV-B368, kommerziell erhältlich

Zusätzlich wird vom FLI ein positives und ein negatives Nationales Referenzserum für Brucellose
bereitgestellt.

Nähere Auskünfte:
FLI, NRL Brucellose, Naumburger Str. 96a, D-07743 Jena
Tel.: +49 (0)3641 804 466

Anhang 3

Nachweis von Brucella spp. genuss-spezifischer DNA mittels der Primer B4


und B5 aus Kulturmaterial (nach Baily et al., 1992)

1. Arbeitsvorschrift

1.1. Material
Verdächtige Kolonie direkt von Platte picken und in Eppendorf-Tube in ca. 200 µl
PCR-Grade Wasser einbringen und für 2 h bei 90 °C im Thermoschüttler schütteln
(Abtötung und Zellaufschluss)

Tabelle 1:

Primer Nukleotidsequenz 5'-3'


B4 TGG-CTC-GGT-TGC-CAA-TAT-CAA
B5 CGC-GCT-TGC-CTT-TCA-GGT-CTG

FLI 163
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 2:

PCR Mastermix Je Probe Thermocycler-Programm


Wasser 18,3 µl "BRUC"
10x PCR-Puffer 2,5 µl 93 °C 5 min, 35 x (90 °C 1 min,
dNTP 10mM 1 µl 60 °C 1 min, 72 °C 1 min),
Primer B4 10 pmol/µl 1 µl 72 °C 5 min
Primer B5 10 pmol/µl 1 µl
Taq-DNA-Polymerase 5U/µl 0,2 µl
Template 1 µl

1.2. Ergebnis und Kontrolle


Bei jedem Ansatz wird eine Negativ-Kontrolle (Wasser statt DNA) und mind.
eine Positiv-Kontrolle (DNA von Referenzstamm) mitgeführt.

Die Analyse der PCR- Produkte erfolgt nach ihrer Größe (siehe Tabelle 3) in einem
1,5%igen Agarose-Gel.

Tabelle 3:

Größe des Fragmentes Ergebnis


B4/B5 223 bp Brucella ssp. nachgewiesen

Die Positivkontrollen müssen positiv entsprechend ausfallen, die Negativ-Kontrolle


bei der PCR muss negativ sein.

Literatur
Alton, G.G., L.M. Jones, R.D. Angus, J.M. Verger (1988): Techniques for the
Brucellosis Laboratory. Institute National de la Recherche Agronomique (INRA),
Paris.
Baily GG, Krahn JB, Drasar BS, Stoker NG.: Detection of Brucella melitensis and
Brucella abortus by DNA amplification. J Trop Med Hyg. 1992 Aug; 95(4):271-5.
Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2004:
http://www.oie.int/Eng/Normes/Mmanual/A_summry.htm

FLI 164
Amtliche Methodensammlung Stand: Mai 2013

18. Campylobacteriose (thermophile Campylobacter)


(Stand: April 2012 – nächste Änderung erfolgt im Herbst 2013)

18.1. Charakterisierung der Infektion


18.1.1. Erreger
Campylobacter bilden mit den Gattungen Arcobacter und Sulfospirillum die Familie
Campylobacteraceae innerhalb der Ordnung der Campylobacterales der Epsilon-
Proteobakterien. Das Genus Campylobacter besteht gegenwärtig aus 17 Spezies
und 6 anerkannten Subspezies. Neben dem mikroaerophilen Metabolismus zeichnen
sich Campylobacter-Isolate durch die Unfähigkeit, Kohlenhydrate zu verwerten sowie
ihren geringen (Guanin + Cytosin)-Gehalt aus.
Campylobacter sind zarte, Gram-negative, spiralig gewundene Stäbchen (0,5 bis
8 µm lang und 0,2 bis 0,5 µm breit), die unter Sauerstoff-Einwirkung oder bei
Alterung der Kulturen auch kokkoide oder sphäroide Gestalt annehmen können. Sie
sind keine Sporenbildner und besitzen in der Regel je eine mono- oder bipolar
angeordnete Geißel, woraus die Beweglichkeit des Mikroorganismus resultiert. Die
Wachstumstemperatur ist ein hilfreiches Differenzierungskriterium. Die Spezies C.
jejuni, C. coli, C. lari und C. upsaliensis werden aufgrund ihres Wachstumsoptimums
bei 42 °C als thermophile Campylobacter bezeichnet.
Campylobacter-Spezies sind ubiquitär verbreitet und kolonisieren die Schleimhäute
des Intestinaltrakts, die Mundschleimhaut oder den Urogenitaltrakt bei Tier und
Mensch. Verschiedene Spezies sind pathogen und führen zu Erkrankungen sowohl
beim Tier als auch beim Menschen. 12 der 17 Campylobacter-Spezies sind mit
humanen Erkrankungen assoziiert. Unter diesen Spezies besitzen die thermophilen
C. jejuni und C. coli als wichtigste Erreger der Campylobacter-Enteritis
(Campylobacteriose) die größte gesundheitspolitische Bedeutung. Die
Campylobacteriose ist eine Zoonose, die im Gegensatz zum Menschen bei Vögeln,
Geflügel und vielen Säugetieren meist asymptomatisch verläuft.

18.1.2. Klinische Symptomatik


Thermophile Campylobacter gehören weltweit zu den häufigsten Verursachern
bakteriell bedingter Durchfallerkrankungen beim Menschen. Dabei reicht das
klinische Spektrum von asymptomatischen Infektionen über wässrige bis zu
schweren blutigen Durchfällen. Symptome eines „akuten Abdomens“ werden
beobachtet. Die Erkrankung verläuft meist selbstlimitierend, allerdings können
Personen, die nicht antibiotisch behandelt worden sind, über 2 bis 4 Wochen
infektiös sein. Eine Campylobacteriose steht vielfach auch am Beginn der Ausbildung
des Guillain-Barre-Syndroms, einer neurodegenerativen Erkrankung. Als Hauptquelle
humaner Infektionen gelten Geflügelprodukte, aber auch Rind, Schwein, Hund und
Katze stellen ein Keimreservoir dar.
Campylobacter coli wurde bei einer Vielzahl warmblütiger Tiere gefunden und kommt
häufig als Kommensale beim Schwein vor. Dieser Mikroorganismus wird beim
Menschen mit Gastroenteritis und Septikämie in Verbindung gebracht. Bei Geflügel
wird er als Ursache einer hepato-enteralen Erkrankung betrachtet.
Campylobacter jejuni nutzt ein sehr breites Wirtsspektrum. Das Bakterium kommt
häufig in verschiedenen Geflügelarten vor, wurde in vielen Säugetierarten

FLI 165
Amtliche Methodensammlung Stand: Mai 2013

festgestellt, aber auch in Insekten. Beim Menschen führt eine Infektion mit C. jejuni
meist zu einer Gastroenteritis, aber auch Meningitis, Abort oder Proktitis sind
beschrieben worden. Beim Nutzgeflügel treten enterale und hepato-enterale
Erkrankungsformen auf, bei Säugern wurden zusätzlich Aborte bei verschiedenen
Spezies beschrieben.
Campylobacter lari wurde im Intestinaltrakt verschiedener Seevögel, Säugetiere,
aber auch in Muscheln nachgewiesen. Es sind keine Beziehungen zu Erkrankungen
bei Tieren bekannt. Beim Menschen kann C. lari Enteritis und Septikämie
verursachen.
Campylobacter upsaliensis wurde bisher bei Hund, Katze, Ente und Mensch
nachgewiesen. Die Spezies wird häufiger bei Hunden als bei Katzen nachgewiesen.
In beiden Arten kann C. upsaliensis eine Gastroenteritis auslösen. Beim Menschen
sind folgende Erkrankungen durch C. upsaliensis beschrieben worden: Enteritis,
Septikämie, Abszess, Abort.

18.1.3. Zuständige Untersuchungseinrichtungen


Zuständig für die Untersuchung auf thermophile Campylobacter sind die jeweiligen
Landesuntersuchungsämter.

Am BfR ist das NRL für Campylobacter etabliert, welches sich vornehmlich mit
Untersuchungen von Campylobacter im Zusammenhang mit der
Lebensmittelproduktion und dem Handel beschäftigt (Leiter: Dr. Lüppo Ellerbroek).

Am FLI wurde das NRL für Campylobacteriose (thermophile Campylobacter) errichtet.


Gegenstand der Arbeiten sind u. a.
• Ausarbeitung, Aktualisierung von methodischen Empfehlungen zur Labordiagnostik
• Untersuchungen zur Prävalenz von Campylobacter in Tierbeständen
• Untersuchungen zu Virulenzfaktoren thermophiler Campylobacter
• Erarbeitung von Kontrollstrategien zur Reduktion der Campylobacter-Belastung
in Beständen

18.1.4. Rechtsgrundlagen
Campylobacteriosen bei verschiedenen Tierarten, verursacht durch die thermophilen
Spezies C. jejuni, C. coli, C. lari und C. upsaliensis sind meldepflichtig (Verordnung
über meldepflichtige Tierkrankheiten vom 20. Dezember 2005).

FLI 166
Amtliche Methodensammlung Stand: Mai 2013

18.2. Untersuchungsmaterial
18.2.1. Untersuchungsmaterial für den Erregernachweis
Als Untersuchungsmaterial finden neben kultivierten Bakterienkulturen auch
Materialien wie Milch, Kotproben oder Kloakentupfer Verwendung.

18.2.2. Beförderung der Proben


Wegen der Empfindlichkeit der Campylobacter gegenüber Sauerstoff sollten für den
Transport spezielle Transport-Medien Verwendung finden (z. B. Amies Agar Gel with
Charcoal).

18.3. Untersuchungsgang
18.3.1. Erregernachweis
Der Erregernachweis aus den unterschiedlichen Ausgangsmatrizes erfolgt nach den
Festlegungen von ISO 10272-1:2006: „Microbiology of food and animal feeding stuffs
-- Horizontal method for detection and enumeration of Campylobacter spp. -- Part 1:
Detection method and Part 2: Colony-count technique“.

Diese ISO-Norm ist eigentlich gedacht für die Untersuchung von Produkten, die für
die menschliche Ernährung oder als Tierfutter Verwendung finden. Sie gilt auch für
Umwelt-proben aus dem Bereich der Nahrungsmittelproduktion und Proben aus dem
Handel. Sie wird aber auch zum Nachweis von Campylobacter aus oben
beschriebenen Matrizes verwendet.

Die Anzucht der thermophilen Campylobacter-Spezies erfolgt über einen


Anreicherungsschritt in Bolton-Bouillon durch Kultivierung auf mCCD-Agar. Die
Einzelheiten sind in der DIN 10272 beschrieben.
Anschließend werden die Campylobacter-Isolate phänotypisch und
molekularbiologisch charakterisiert.

In den meisten konventionellen biochemischen Tests sind Campylobacter relativ


inaktiv und es gibt keine geeigneten Methoden, die eine einfache Differenzierung
aller Spezies ermöglichen. Die Tests zur Differenzierung sind bisher nur teilweise
standardisiert und in der Literatur weit verstreut (On, 1996). Methodische Hinweise
zur Durchführung und Bewertung der Reaktionen finden sich bei Lander u. Gill
(1985) sowie Nachamkin (1999). Die Anwendbarkeit kommerzieller
Differenzierungssysteme (z. B. API Campy, bio Merieux) wird unter-schiedlich
bewertet. Diese Systeme erreichen aber nicht die Aussagekraft konventioneller
Tests.

FLI 167
Amtliche Methodensammlung Stand: Mai 2013

18.3.1.1. Identifizierung von Campylobacter-Spezies


• Wuchsformen:
In der Primärkultur wachsen Campylobacter sp. nach 2-5-tägiger Inkubation –
beeinflusst durch die Feuchtigkeit des Nährmediums – in zwei Wuchsformen
als flache, grau-glänzende Kultur mit Neigung zum Schwärmen und
Zusammenfließen oder als runde, konvexe, glatte, glänzende Einzelkolonien
von 1 – 3 mm Durchmesser. Auf Blutagar ist keine Hämolyse nachweisbar.
• Oxidase-Reaktion:
Es stehen handelsübliche Oxidase-Teststreifen zur Verfügung, z. B. Bactident
Oxidase-Test-Strips. Campylobacter-Spezies reagieren positiv. Bei positiver
Reaktion verfärbt sich das Koloniematerial in 5 bis 10 Sek. ultramarinblau.

• Nativpräparat:
Campylobacter sp. sind beweglich und zeigen im Phasenkontrastmikroskop
eine typische, „schießende“ Beweglichkeit, die bei Subkultivierung verloren
gehen kann.

• Gramfärbung:
Im Grampräparat handelt es sich um gramnegative, dünne, gebogene
Stäbchen, 0,3 bis 0,4 µm breit und 0,5 bis 8,0 µm lang. Kurze Formen
(kommaförmig), mittlere Formen (S-förmig) und lange Formen (spiralförmig mit
mehreren Windungen) können gleichzeitig in einer Kultur beobachtet werden.

18.3.1.2. Phänotypische Differenzierung von Campylobacter-Isolaten


Da Campylobacter sp. anspruchsvolle Keime sind, können bereits geringfügige
Änderungen der Medienzusammensetzung die Differenzierungsergebnisse
beeinflussen. Es müssen daher Kontrollstämme entsprechender Spezies parallel
mitgeführt werden (Tab. 1). Die wichtigsten kulturellen und biochemischen Merkmale
von Campylobacter-Arten zeigt Tabelle 2.

• Katalase-Probe:
Auf einen Objektträger wird ein Tropfen einer 3%igen Wasserstoffperoxidlösung
gegeben und in diesem mit der Öse Koloniematerial verrieben. Bei positiver
Reaktion tritt nach wenigen Sekunden eine starke Bläschenbildung ein.

• H 2 S-Nachweis:
Triple-Sugar-Iron (TSI)-Agar wird mit 48 h altem Kulturmaterial beimpft und 2 d
bei 37 °C mikroaerob bebrütet. Die positive Reaktion führt zu einer Schwärzung
des Agar.

• Natrium-Selenit-Reduktion:
Nährbouillon (z. B. Nr. 2 von Oxoid) mit Zusatz von 0,1 % Natriumselenit wird mit
Kulturmaterial beimpft und 4 d bei 37 °C mikroaerob bebrütet. Jede, noch so
geringgradige Rotfärbung gilt als positive Reaktion.

FLI 168
Amtliche Methodensammlung Stand: Mai 2013

• Kochsalztoleranz:
Thioglykolatbouillon oder Blutagar, jeweils mit einem Gehalt von 3,5 % NaCl,
werden mit Kulturmaterial beimpft, 3 bis 4 Tage bei 37 °C mikroaerob bebrütet
und auf Wachstum (Trübung) kontrolliert.

• Glycintoleranz:
Thioglykolatbouillon oder Blutagar, jeweils mit einem Gehalt von 1 % Glycin,
werden mit Kulturmaterial beimpft, 3 bis 4 Tage bei 37 °C mikroaerob bebrütet
und auf Wachstum (Trübung) kontrolliert.

• Nalidixinsäure-Resistenz:
Der Test wird in der üblichen Weise auf Mueller-Hinton-Agar mit Nalidixinsäure-
Testblättchen (30 µg) angesetzt und nach 4 Tagen mikroaerober Inkubation bei
37 °C abgelesen. Eine Hemmzone von wenigstens 3 mm um das Testblättchen
zeigt, dass der Stamm sensitiv ist. Auf Grund der ansteigenden Quinolonresistenz
bei C. jejuni und C. coli ist die Aussagekraft dieser Reaktion stark eingeschränkt.

• Cephalotin-Resistenz:
Der Test wird mit Cephalotin-Testblättchen (30 µg) in Analogie zur Prüfung auf
Nalidixinsäure-Resistenz angesetzt und ausgewertet.

• Hippurat-Hydrolyse:
Für die Durchführung dieser Reaktion sind zahlreiche Modifikationen
beschrieben. Zur Bewertung der Reaktion ist es erforderlich, einen positiven (C.
jejuni) und negativen Kontrollstamm (C. coli) mitzuführen. Folgendes Vorgehen
hat sich bewährt: Ein Filterpapierstreifen wird mit 1%iger, frischer
Natriumhippuratlösung getränkt (Lösung kann portioniert werden und ist bei –18
°C sechs Monate haltbar). Die zu differenzierenden Isolate werden in 2 bis 3 cm
Abständen knöpfchenförmig auf die Papieroberfläche aufgerieben. Nach 3-
stündiger Inkubation bei 37 °C in der feuchten Kammer werden einige Tropfen
3,5%iger frischer Ninhydrinlösung aufgetragen und die Reaktion nach 15- bis 45-
minütiger Einwir-kungszeit – in Abhängigkeit von der Färbung der
Negativkontrolle – abgelesen (Ninhydrin-Reagens: 350 mg Ninhydrin in 10 ml
Aceton-Butanol-Mischung (1 : 1)). Die positive Reaktion ist durch eine
Dunkelpurpurverfärbung der Bakterien und des Papiers um die aufgetragene
Probe herum gekennzeichnet (Hofbildung). Die Negativkontrolle zeigt eine
schmutzig-graue Färbung ohne Hofbildung.

• Indoxylazetat-Hydrolyse:
Es wird eine 10%ige Indoxylazetatlösung in Azeton hergestellt, auf Teststreifen
gegeben, Koloniematerial aufgebracht und ein Tropfen steriles Aqua dest.
zugegeben. Die positive Reaktion zeigt sich nach 5 bis 10 min als tiefblaue
Färbung.

• Temperaturtoleranz:
Die Prüfung kann auf Blutplatten oder in Bouillonkulturen erfolgen. Es ist 2 d
(42 °C) bzw. 5 d (25 °C) mikroaerob im Brutkühlschrank zu inkubieren und das
Wachstum zu kontrollieren.

FLI 169
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 1: Campylobacter-Typ und -Referenzstämme

Spezies Typ/Ref. Herkunft


C. fetus ssp. venerealis Typ NCTC 010354
C. fetus ssp. fetus Typ DSMZ 5361
C. sputorum biovar sputorum Typ DSMZ 5363
(alte Bezeichnung: Biovar bubulus)
C. sputorum biovar fecalis Ref. NCTC 011415
C. jejuni ssp. jejuni Typ DSMZ 4688
C. jejuni ssp. doylei Typ NCTC 011951
C. coli Typ DSMZ 4689
C. lari Typ DSMZ 11375
C. upsaliensis Typ DSMZ 5365
C. helveticus Typ NCTC 012470

Literatur
Lander, K. P. u. Gill, K. P. W. (1985): Campylobacters. In: C. H. Collins and J. H.
Grande (eds.). Isolation and identification of microorganisms of medical and
veterinary importance. London, Acad. Press. p. 123-142.
Nachamkin, I. (1999): Campylobacter and Arcobacter. In: Manual of Clinical
Microbiology. 7th Edition. Eds. Murray, P.R., Baron, E.J., Pfaller, M. A., Tenover, F. C.
u. Yolken, R. H. Am. Soc. Microbiol., Washington, D. C. 716-726.
On, S. L. W. (1996): Identification methods for Campylobacters, Helicobacters, and
related organisms. Clin. Microbiol. Rev. 9, 405-422.
On, S. L. W., Atabay, H. I., Corry, J. E. L., Harrington, C. S. u. Vandamme, P. (1998):
Emended description of Campylobacter sputorum and revision of its infrasubspecific
(biovar) divisions, including C. sputorum biovar paraureolyticus, an urease-producing
variant from cattle and humans. Int. J. System. Bacteriol. 48, 195-206.
Ursing, J. B., Lior, H. u. Owen, R. J. (1994): Proposal of minimal standards for
describing new species of the family Campylobacteraceae. Int. J. System. Bacteriol.
44, 842-845.
Vandamme, P. u. De Ley, J. (1991): Proposal for a new family, Campylobacteraceae.
Int. J. System. Bacteriol. 41, 451-455.

FLI 170
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 2: Kulturelle und biochemische Merkmale von Campylobacter spp. (Nachamkin, 1999; Vandamme und De Ley, 1991;
Ursing et al., 1994; On et al., 1998)

Reduktion Na- Hydrolyse Toleranz gegen Resistenz gegen Wachstum


Sele- H2
Kata- Nitrat Nitrit H 2 S nit-Re- Hippu- Indoxyl- Kochsalz Glycin Nalidixin- Cepha- 25 °C 42 °C erfor-
Spezies lase (TSI) duktion rat azetat 3,5 % 1% säure lothin derlich
C. jejuni
ssp. jejuni + + - - + + + - + S R - + -
ssp. doylei v - - - v + - + S S - - -
C. coli + + - - + - + - + S R - + -
C. lari + + - - - - - + R R - + -
C. upsaliensis -/± + - - - + - v S S - + -
C. helveticus - + - - - + S S - + -
C. fetus
ssp. fetus + + - - + - - - + R S + - -
ssp. venerealis + + - - - - - - - R S + - -
C. sputorum
biovar sputorum - + + + + - - V + R/S S ± + -
biovar fecalis + + + + + - - V + R S ± + -
biovar - +/V +/V - - + R R/V
paraureolyticus1)
C. hyointestinalis + + - + - - - + R S + + v
C. concisus - + + + - - - + R R - +
C. mucosalis - + + + - - - + R S - + +
C. curvus - + + + - + - + S - + +
C. rectus - + + + - + - + S - ± +
C. showae + + + - + - v R S - + +
1)
V = variabel, unterschiedliche Reaktion ± = schwache Reaktion TSI= Triple-Sugar-Iron-Agar Urease-positiv

FLI 171
Amtliche Methodensammlung Stand: Mai 2013

18.3.1.3. Molekularbiologische Identifizierung von Campylobacter jejuni und


Campylobacter coli
Zur molekularbiologischen Identifizierung von Campylobacter jejuni und
Campylobacter coli hat sich eine Multiplex-PCR bewährt (Denis, M., J. Refregier-
Petton, M.-J. Laisney, G. Ermel und G. Salvat (2001) „Campylobacter contamination
in French chicken production from farm to consumers. Use of a PCR assay for
detection and identification of Campylobacter jejuni and Campylobacter coli”, J. Appl.
Microbiol. 91, 255-267).
Ausgangsmaterial können Campylobacter-Kulturen, aber auch Milch- oder Kotproben
sein.

Im ersten Schritt wird die Campylobacter-DNA durch Extraktion mit kommerziell


erhältlichen DNA-Extraktionskits nach Angaben der Hersteller gewonnen.

Die Multiplex-PCR wird unter folgenden Bedingungen durchgeführt:


Pro 50 µl Ansatz werden die folgenden Lösungen als Mastermix (Tabelle 3) in der
beschriebenen Reihenfolge eingesetzt. Die Mengen gelten für den Einsatz von 1
µl Template einer DNA-Extrakt-Konzentration von ca. 100 ng/µl. (Bei geringerer
DNA-Ausbeute der Extraktion können 2 bis 5 µl eingesetzt werden; entsprechend
weniger Wasser ist zu verwenden.)

Tabelle 3: Zusammensetzung des Mastermix zur Verwendung in der


Multiplex-PCR

Komponenten Volumen Endkonzentration

steriles Wasser ad 45-49 µl

PCR-Pufferlösung (10-fach), 5 µl PCR-Puffer einfach, enthaltend


enthaltend c = 15 mmol/l MgCl 2 c = 1,5 mmol/l MgCl 2
Desoxynukleosidtriphosphat-Mix 2 µl je 200 µmol/l
(dATP, dCTP, dGTP, dTTP)
Primer MD 16S1/S2 je 1 µl 0,125 µmol/l

Primer MD mapA1 /A2 je 1 µl 0,5 µmol/l


MD COL2/COL3
Taq-DNA-Polymerase 0,2 µl 1 U pro Reaktionsansatz

Zum Ausschluss einer PCR-Inhibition sind externe Amplifikationskontrollen (DNA der


Typstämme C. jejuni DSMZ 4688 und C. coli DSMZ 4689) mitzuführen. Tabelle 4
gibt eigene Details zum PCR-Assay an.

FLI 172
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 4: Target-Gene und Primersequenzen der Multiplex-PCR

Target Primer Primersequenz (5`- -3´) Ampli- Spezifität


kon
16SrRNA MD16S1 ATC TAA TGG CTT AAC CAT TAA AC 857 bp Genus
MD16S2 GGA CGG TAA CTA GTT TAG TAT T Campylobacter
mapA MDmapA1 CTA TTT TAT TTT TGA GTG CTT GTG 589 bp C. jejuni
MDmapA2 GCT TTA TTT GCC ATT TGT TTT ATT A
ceuE COL 3 AAT TGA AAA TTG CTC CAA CTA TG 462 bp C. coli
MDCOL2 TGA TTT TAT TAT TTG TAG CAG CG

Folgendes Temperatur-Zeit-Programm wird für die Multiplex-PCR verwendet:

Inititiale Denaturierung der DNA: 60 Sek. bei 95 °C

35-maliger Durchlauf des folgenden Zyklus: 30 Sek. bei 95 °C (Denaturierung)


90 Sek. bei 59 °C (Annealing)
60 Sek. bei 72 °C (Elongation)

abschließende Elongation: 5 min bei 72 °C.

Die PCR-Produkte werden auf einem 1,5%igem Agarose-Gel charakterisiert.

C. jejuni und C. coli gelten als identifiziert, wenn in der PCR das Genus-spezifische
Amplikon (857 bp) und das Spezies-spezifisches Amplifikat (589 bp für C. jejuni
bzw. 462 bp für C. coli) detektiert werden.

Für alle thermophilen Campylobacter-Arten sind in der Literatur spezifische und


„real-time“-PCRs beschrieben; diese Methoden wurden allerdings vom NRL nicht
validiert.

FLI 173
Amtliche Methodensammlung Stand: Mai 2013

19. Chlamydiose

19.1. Charakterisierung der Infektion


19.1.1. Erreger
Der Erreger der Psittakose/Ornithose gehört zur Familie der Chlamydiaceae, zum
Genus Chlamydophila und zur Spezies Chlamydophila (C.) psittaci. Bei den Aves
wurden ursprünglich sechs verschiedene Serovare unterschieden (A und F =
Psittaziden-Serovare I und II, B und E = Tauben-Serovare I und II, C = Enten- und D
= Puten-Serovar; nach ANDERSEN, 19971). In einer Vergleichsstudie konnte gezeigt
werden, dass den Serovaren äquivalente Genotypen zugeordnet werden können, die
über die variablen Domänen II und IV des ompA-Gens definiert sind (VANROMPAY,
19972). Mittlerweile wurden noch ein weiterer aviärer Genotyp (EB; Geens, 20053)
und zwei nicht-aviäre Genotypen eingeführt. Tabelle 1 fasst die gegenwärtig
akzeptierten Typen zusammen, wobei anzumerken ist, dass die Wirtsspezifität nicht
hoch ist und mit steigenden Untersuchungszahlen das Spektrum der genannten
Wirtstierarten noch erweitert werden wird.

Tabelle 1: Einteilung der Serovare bzw. Genotypen von Chlamydophila psittaci


Serovar / Genotyp Vorkommen Humanpathogenität / Anmerkungen
A Psittaciformes, Taube, hoch
Kanarienvogel, Pute (insbesondere bei virulenten Stämmen)
B Taube, Kanarienvogel, mittel
Küken, Fasan, Pute
C Ente, hoch
Schwan, Gans (insbesondere in Farmen, Schlacht- und
Federverarbeitungsbetrieben)
D Pute hoch
(insbesondere in Farmen, Schlacht- und
Federverarbeitungsbetrieben)
E Taube, Ente hoch
Pute, Strauß, Nandu (identisch mit humanem Isolat von 1934;
Tauben sind Reservoir; 20 % der
Taubenisolate gehören zum Serovar II; eng
verwandt mit A und B)
F Sittich (bisher ein Isolat) nicht bekannt
(evtl. neuere Mutation; evtl. Vorkommen in
noch wenig untersuchten
Vogelpopulationen)
EB Ente vorhanden (genaue Abschätzung noch
nicht möglich)
WC Rind nicht bekannt
M 56 Nager (Bisamratte) nicht bekannt

Schon jetzt ist bekannt, dass aviäre Serovare/Genotypen auch bei anderen Tierarten
wie z. B. Schwein, Rind und Schaf vorkommen. Prinzipiell sind alle aviären C.-
psittaci-Serovare humanpathogen.

Chlamydien gehören weltweit zu den am meisten verbreiteten pathogenen


Mikroorganismen. Das Wirtsspektrum von C. psittaci umfasst Arthropoden,

FLI 174
Amtliche Methodensammlung Stand: Mai 2013

Mollusken, Vögel (bei ca. 140 Arten nachgewiesen), eine Vielzahl von Säugetieren
und den Menschen. Psittakose wird als Infektionskrankheit bezeichnet, die bei
Psittaciformes (Papageien und Sittichen) vorkommt. Sie ist anzeigepflichtig4. Die
Ornithose definiert der Gesetzgeber als eine Infektionskrankheit, die bei
Nutzgeflügel sowie bei Wild- und Ziervögeln vorkommt. Sie ist meldepflichtig5.
Allerdings handelt es sich vom wissenschaftlichen Standpunkt bei den historisch
entstandenen Begriffen Psittakose und Ornithose um ein und dieselbe Krankheit mit
dem gleichen Erreger. Man verwendet daher in der neueren Fachliteratur den
übergreifenden Terminus aviäre Chlamydiose.

Morphologisch gesehen erscheinen Chlamydien als unbewegliche kokkoide


Bakterien. Die Zellwand enthält nur Spuren von Muraminsäure und ähnelt der
Zellwand gramnegativer Bakterien. Der zweiphasige Entwicklungszyklus
kennzeichnet sie als obligat intrazelluläre Mikroorganismen.

Man unterscheidet zwei unterschiedliche Chlamydienformen:


• die 0,2 bis 0,3 µm großen infektiösen Elementarkörperchen (EK), die
extrazellulär überleben können. Sie enthalten das Genom und die Ribosomen.
Für das Eindringen in die Wirtszelle sind spezifische Wirtszell- und
Erregerrezeptoren verantwortlich. Unterschiede in Größe und Struktur der
antigenwirksamen EK-Oberflächenproteine (Major Outer Membrane Protein -
MOMP) sind verantwortlich für Wirtsspezifität, Organotropismus und
Virulenzverhalten. Nach Adsorption der EK an die Zellmembran der Wirtszelle
gelangen diese durch Endozytose in die Zelle.

• die 0,8 bis 1,5 µm großen Retikularkörperchen (RK) entstehen durch
Reorganisation der EK und vermehren sich durch binäre Teilung in den
endozytoplasmatischen Vakuolen (Einschlusskörperchen). Eine Interaktion mit
extrazellulären Abwehrmechanismen ist dadurch erschwert. Die RK reifen
über sog. "kondensierte Formen" zu den infektiösen EK. Diese können durch
Lysis der Zelle (Krankheit) oder durch kontinuierliches Ausschleusen aus der
Zelle (klinisch inapparente Form) freigesetzt bzw. in der Zelle zurückgehalten
werden (latente Verlaufsform).

19.1.2. Klinische Symptomatik


Die Psittakose/Ornithose verläuft beim Vogel akut, subakut bis protrahiert oder
chronisch in Abhängigkeit von Infektionsdosis, Virulenz der Chlamydienstämme,
Empfänglichkeit und Immunstatus des Wirtes sowie von Umwelteinflüssen. Die
häufigste Form ist die subklinisch-persistierende Verlaufsform bei adulten Vögeln.
Sie verläuft ohne klinische Symptome (siehe Tabelle 2).

Nach einer Chlamydieninfektion kann zwischen perakutem Verlauf und völliger


Unauffälligkeit klinisch gesunder Tiere eine breite Palette an mehr oder weniger
unspezifischen Symptomen beobachtet werden. Das artspezifische Verhalten kann
sich bei chlamydieninfizierten Vögeln verändern. Apathie, Schwäche, Schläfrigkeit,
Hängenlassen der Flügel, Appetitlosigkeit, anfallartiges Zittern, tonisch-klonische
Krämpfe und Lähmungserscheinungen können beobachtet werden.

FLI 175
Amtliche Methodensammlung Stand: Mai 2013

Die ältere Bezeichnung "Pneumo-Enteritis" für Psittakose/Ornithose weist darauf hin,


dass Respirations- und Verdauungstrakt gleichzeitig betroffen sind. Es wird hellgrün-
oder grau-wässriger Kot abgesetzt. In Verbindung mit Nasenausfluss wird
angestrengte Atmung beobachtet. Konjunktivitis und Keratokonjunktivitis treten bei
manchen Vogelarten nicht auf, bei anderen (Tauben, Neophemaarten, Enten) sind
es oft die einzigen auf Psittakose deutenden Befunde. Das unspezifische klinische
Bild wird häufig durch die Symptome struppiges Gefieder und Abmagerung ergänzt.

6
Tabelle 2: Verlaufsformen der aviären Chlamydiosen (zit. nach KALETA, 1997 )
Verlaufsform Inkubations- Krankheits- Symptome, Bemerkungen
zeit in Tagen dauer
Akute, letale 3-7 8 - 14 Tage Anorexie, Apathie, Diarrhoe; junge
systemische Form Vögel
Subakute bis 7 - 14 > 3 Wochen Anorexie, Apathie, Diarrhoe; adulte
protrahierte Form Vögel
Chronische Form 30 - 90 > 2 Monate Apathie, Kachexie, Diarrhoe, Atemnot;
adulte Vögel
Subklinische keine ohne Häufigste Form, ohne Symptome;
persistierende Form adulte Vögel
Aktivierte persistierende > 3 Monate bis > 2 Monate Aktivierung durch endogene u.
Form Jahre exogene Faktoren, dann Apathie,
Anorexie, Diarrhoe, Kachexie,
respiratorische Symptome

Vögel mit chronischer Psittakose sind meistens anämisch. Das Serum-


Gesamtprotein bewegt sich, bedingt durch Dehydration und Anstieg von g - und b -
Globulinen Globulinen, an der Obergrenze der Norm oder ist leicht erhöht. Bei
infizierten Vögeln können Leukozytenzahlen von über 10.000/mm3 festgestellt
werden. Erhöhte Lactat-Dehydrogenase (LDH) und Aspartat-Aminotransferase (AST)
Serumwerte weisen auf eine Schädigung der Leber hin, erhöhte Harnsäure- und
Kreatininwerte auf eine renale Dysfunktion (zit. nach JANECZEK, 19987).

19.1.3. Differentialdiagnostik
Differentialdiagnostisch ist bei Durchfall an Salmonellose, bei Schnupfen an
Mykoplasmeninfektionen zu denken.

19.1.4. Diagnostische Indikation


• Klinischer oder epidemiologisch begründeter Verdacht
• Einfuhruntersuchungen
• siehe auch 33.1.6

19.1.5. Zuständige Untersuchungseinrichtungen


• Staatliche Veterinäruntersuchungsämter
• Friedrich-Loeffler-Institut (Nationales Referenzlabor für Psittakose)

FLI 176
Amtliche Methodensammlung Stand: Mai 2013

19.1.6. Rechtsgrundlagen
• Tierseuchengesetz in der Fassung der Bekanntmachung vom 22. Juni 2004
(BGBl. I S. 1260; 3588), zuletzt geändert durch Artikel 3 des Gesetzes vom
21. Dezember 2006 (BGBl. I S. 3294) Stand: Neu gefasst durch Bek. v. 22.
6.2004 I 1260; 3588; zuletzt geändert durch Art. 3 G v. 21.12.2006 I 3294
• Verordnung über das innergemeinschaftliche Verbringen sowie die Einfuhr
und Durchfuhr von Tieren und Waren (Binnenmarkt-Tierseuchenschutz-
verordnung - BmTierSSchV). In der Fassung der Bekanntmachung vom 6.
April 2005 (BGBl. I S. 997) zuletzt geändert durch: Artikel 1 der Verordnung
vom 11. Dezember 2006 (BGBl. I S. 2921)
• Verordnung zum Schutz gegen die Psittakose und Ornithose-Psittakose vom
20. Dezember 2005 (BGBl. I Nr. 74 vom 23.12.2005 S. 3532) Gl.-Nr.: 7831-41-4
• Verordnung über meldepflichtige Tierkrankheiten vom 20. Dezember 2005

19.2. Untersuchungsmaterial
1. Untersuchungsmaterial für direkten Antigennachweis und Chlamydien-
anzüchtung
• Verendete Vögel bzw. deren Organe (Milz, Lunge, Leber, Niere, Luftsäcke,
Herzbeutel)
• Möglichst zellreiche Tupferproben9 (okulo-nasale, tracheale Tupfer oder
Kloakentupfer),
Kotproben (ca. 2 - 5 g/Vogel), Sammelkotproben von bis zu 20 Vögeln

Tupferproben sollten für den Nachweis von C. psittaci mittels Zellkulturmethode


möglichst frisch entnommen werden. Probenmaterial jeder Art sollte gekühlt und auf
dem schnellsten Weg zum Untersuchungsort transportiert werden. Zusätzlich können
kommerziell verfügbare Transportmedien10 bzw. das in der Anlage 1 angegebene
Medium verwendet werden. Können die Proben nicht innerhalb von 24 h
aufgearbeitet werden, müssen sie bei < -76 °C eingefroren werden (ohne
Transportmedium!).

2. Untersuchungsmaterial für den Antikörpernachweis


• Nativblutproben11 (Blut ohne Stabilisator), Serum

19.3. Untersuchungsgang
Beachte:
Alle Laborarbeiten zum Erregernachweis sind mit entsprechenden
Sicherheitsvorkehrungen (Biohazard-Werkbänke bzw. L3-Laboratorien)
vorzunehmen. Aufgrund der aerogenen Übertragbarkeit der Erreger haben
Ultraschallarbeiten, Zentrifugationsschritte u. a. grundsätzlich im geschlossenen
System zu erfolgen.

19.3.1. Antigennachweismethoden
Für den Nachweis von Chlamydophila psittaci-Antigen werden folgende drei
Labormethoden beschrieben:

FLI 177
Amtliche Methodensammlung Stand: Mai 2013

19.3.1.1. Direktnachweis12 von C.-psittaci-Einschlusskörperchen durch


histologische Färbemethoden bzw. von C.-psittaci-Antigen mittels
Immunfluoreszenz

1. Herstellung der Abklatsch bzw. Tupferpräparate

Bewährt hat sich folgendes Verfahren:


• Herstellung von Abklatschpräparaten auf fettfreien Objektträgern (Organe,
Tupfer). Bei Einsendung von Tupfern ohne Transportmedium sind die Tupfer
direkt auf die Objektträger auszustreichen. Werden diese mit
Transportmedium eingesandt, so sind sie 15 Sek. auf einem Vortex-Schüttler
zu mischen, die Suspension ist nach Entfernen des Tupfers für 5 bis 10 min
bei 800 x g zu zentrifugieren und nach vorsichtigem Abhebern des Mediums
das Sediment z. B. mit einer Platinöse auf Objektträger auszustreichen.
• Präparate lufttrocknen
• Präparate fixieren: Fixierung für Giménez-Färbung: 30 min in 96%igem
Ethanol p.A.,
lufttrocknen; Fixierung für Immunfluoreszenz: 10 min Aceton p.A., lufttrocknen
bzw. nach Anweisung des Konjugatherstellers verfahren

2. Färbung nach Giménez


• Fixierte Präparate gründlich mit Aqua dest. spülen und 6 min mit
Karbolfuchsin-Gebrauchslösung färben
• Farblösung abgießen und zweimal in Aqua dest. spülen
• mit 0,8%iger Malachitgrün-Lösung 30 bis 60 Sek. gegenfärben
• Malachitgrünlösung abgießen
• zweimal in Aqua dest. spülen
• Färbung mit Malachitgrün-Lösung wiederholen
• Malachitgrünlösung abgießen
• mit Aqua dest. spülen
• zwischen Fließpapier unter mäßigem Druck trocknen
• lichtmikroskopische Beurteilung bei 400- bis 1000-facher Vergrößerung

Beurteilung: Als positiv werden eindeutig im Zellplasma liegende


Einschlusskörperchen gewertet. Die unterschiedlich großen Einschlusskörperchen
(Elementarkörperchen: 0,2 bis 0,3 µm; Retikularkörperchen: 0,8 bis 1,5 µm) färben
sich intensiv rot an. Der Hintergrund zeigt eine grünliche Färbung. Die
Einschlusskörperchen sind von Artefakten einmal durch ihre Lage in der Zelle und
zum anderen durch ihre Form und Anordnung zu unterscheiden. Eine negative
Färbung schließt nicht aus, dass eine Chlamydieninfektion vorliegt, da die
Erregermenge zu gering sein kann bzw. die Erreger in anderen Organen lokalisiert
sein können. Bei negativen Ergebnissen ist zum sicheren Ausschluss einer
Chlamydieninfektion ein Zellkulturverfahren durchzuführen.

FLI 178
Amtliche Methodensammlung Stand: Mai 2013

19.3.1.2. Anzüchtung und Vermehrung von C.-psittaci mittels


Zellkulturmethode und Nachweis mittels histologischer Färbung
bzw. Immunfluoreszenz

Beachte:
Alle Laborarbeiten zum Erregernachweis sind mit entsprechenden
Sicherheitsvorkehrungen (Biohazard-Werkbänke bzw. L3-Laboratorien)
vorzunehmen. Bei Ultraschallarbeiten sind zusätzlich Atemschutzmasken zu
tragen.

1. Vorbereitung des Untersuchungsmaterials

1.1. Tupferproben

Tupfer mit Transportmedium10


• für 15 Sek. auf einem Vortex-Schüttler homogenisieren
• Suspension zur sicheren Freisetzung der Chlamydien aus den Zellen mit
Ultraschall (Becherresonator z. B. Fa. Branson, Amplitude 80 %, 8 Sek. mit 10
Schlägen und 0,2 Sek. Pause) behandeln.
• Tupfer ausdrücken und entsorgen

Tupfer ohne Transportmedium


• Röhrchen mit 2 ml Transportmedium auffüllen, 10 min bei Zimmertemperatur
stehen lassen und anschließend wie die mit Transportmedium versandten
Tupfer behandeln

1.2. Organmaterialien
Ca. 1 g Organmaterial im Mörser unter Zusatz von sterilem Seesand oder mit einem
Ultraturrax homogenisieren, in 10 ml Transportmedium aufnehmen und in 15-ml-
Zentrifugenröhrchen überführen. Zur sicheren Freisetzung der Chlamydien aus den
Zellen die Proben dreimal mit Ultraschall behandeln.
• ca. 10 min stehen lassen (Sedimentation der "groben" Bestandteile) und
Überstand in ein Zentrifugenröhrchen (mit Schraubverschluss) überführen
• Zentrifugation der Organanreibung bei 500 x g für 15 min bei 18 °C
• Überstand zum Beimpfen der vorbereiteten Zellkulturen verwenden
Hinweis: Zellkultur möglichst gleich beimpfen; bei Leberanreibungen Vorverdünnung
von 1:10 vornehmen (Material sehr aggressiv für Zellen)

1.3. Einzel- und Sammelkotproben


• 1 g Kot im Mörser unter Zusatz von sterilem Seesand oder mit einem
Ultraturrax homogenisieren; Herstellung einer 10%igen Suspension mit
Transportmedium
• Homogenisate ca. 10 min stehen lassen (Sedimentation der "groben"
Bestandteile) und Überstand in ein Zentrifugenröhrchen (möglichst mit
Schraubverschluss) überführen
• Zentrifugation bei 500 x g für 15 min bei 18 °C
• Probe möglichst gleich auf die Zellkultur bringen

FLI 179
Amtliche Methodensammlung Stand: Mai 2013

Kotproben sind oftmals so stark kontaminiert, dass auch die obligat zugesetzten
Antibiotika eine Verunreinigung der Zellkultur nicht verhindern können. Eine
vorherige Filtration durch einen Spritzenfilter der Porengröße 0,45 µm ist deshalb zu
empfehlen.

1.4. Einzel- und Sammelkotproben in Transportmedium


• Homogenisierung der im Transportmedium eingesandten Kotmaterialien mit
einem Vortexschüttler
• Herstellung einer 10%igen Lösung mit Transportmedium
• Homogenisate ca. 10 min stehen lassen (Sedimentation der "groben"
Bestandteile)
• Überstand in ein Zentrifugenröhrchen (mit Schraubverschluss) überführen
• weiteres Vorgehen wie oben beschrieben

2. Beimpfen der Zellkulturen

2.1. Vorbereitung der Zellkultur


Verwendet wird die permanente Buffalo-Green-Monkey (BGM)-Zelllinie (siehe
Anhang 2). Die Zellen werden bei 37 °C bebrütet und ein- bis zweimal wöchentlich im
Verhältnis 1:3 bis 1:10 gesplittet.

Es empfiehlt sich, die Zellen einmal pro Monat auf Mykoplasmen zu untersuchen.

Für die Isolierung der Chlamydien in Zellkulturen können verschiedene


Kultursysteme verwendet werden (z. B. sterile Flachbodenröhrchen mit
Deckgläschen oder 24-Loch-Gewebekulturplatten, in die sterile Deckgläschen mit
entsprechendem Durchmesser gegeben werden). Die Zelldichte wird auf die
gewünschte Zellzahl (z. B. 1x105 Zellen/ml) eingestellt. Nach Aussaat werden die
Kulturen bis zur Beimpfung mindestens 24 Stunden bei 37 °C im CO 2 -Brutschrank
bebrütet. Der Zellrasen wird mikroskopisch auf Konfluenz geprüft (evtl. erst nach 2
Tagen konfluenter Zellrasen erreicht).

2.2. Beimpfung der Zellkulturen


• im ersten Ansatz je Probe mindestens vier Röhrchen der vorbereiteten BGM-
Zellkulturen (Deckglasröhrchen mit jeweils 1 ml Zellsuspension von 1x105 ml)
entsprechend folgendem Schema beimpfen:
- 1 Rö: 30 µl Überstand
- 2 Rö: 100 µl Überstand
- 1 Rö: 300 µl Überstand

• Aufzentrifugation des Überstandes auf die Zellen zur Unterstützung der


Anheftung von Chlamydien an die Zellen bei 3,400 x g für 1 h bei 37 °C im
geschlossenem System, dafür z. B. Zentrifuge Rotanta 96 RS mit
ausschwingbarem Rotor verwenden
• Inkubation für zwei Stunden bei 37 °C und 5 % CO 2 (Deckel für Gasaustausch
etwas aufschrauben) (Anhang 1)

FLI 180
Amtliche Methodensammlung Stand: Mai 2013

• Mediumwechsel: Überstand absaugen, je nach Bedarf mit PBS (mit Ca und


Mg-Ionen) waschen, je Röhrchen 2 ml Medium einfüllen, Zusätze zur
Unterdrückung der Begleitflora (siehe Anhang 1)
• Inkubation der beimpften Zellkulturen bei 37 °C und 5 % CO 2
• Nächster Mediumwechsel nach 18 h
• Nach weiteren 48 h Zellrasen mikroskopisch beurteilen: wenn Zellrasen bei
allen drei Beimpfungsmengen noch fest ist, Deckgläschen von Röhrchen mit
100 µl Überstand anfärben

Bei positivem Nachweis: Anreicherung der Chlamydien durch Anlegen einer Passage
ausgehend vom Röhrchen mit der größten Beimpfungsmenge bei intaktem Zellrasen;
dafür Zellen durch Ultraschallbehandlung im Becherresonator (Fa. Branson) ablösen
bei einer Amplitude von 80 %, 8 Sek. mit 10 Schlägen und 0,2 Sek. Pause,
Ultraschallbehandlung wiederholen bis Zellrasen abgelöst ist, mit je 200 µl
Zellsuspension die gewünschte Anzahl Röhrchen beimpfen, Inkubation und
Nachweis wie beschrieben (außer Mediumwechsel nach 18 h),
Chlamydiensuspension zum Typisieren geben, chlamydieninfizierte
Zellkulturröhrchen bei £ -76 °C lagern und gegebenenfalls als Vorkultur für eine
Stammkonservierung einsetzen

Bei negativem Nachweis: Anlegen einer Passage ausgehend vom Röhrchen mit der
größten Beimpfungsmenge bei intaktem Zellrasen, dafür Zellen im Becherresonator
(Fa. Branson) ablösen bei einer Amplitude von 80 %, 8 Sek. mit 10 Schlägen und 0,2
Sek. Pause, Ultraschallbehandlung wiederholen bis Zellrasen abgelöst ist, mit 200 µl
Zellsuspension je drei Röhrchen beimpfen, alle Passageröhrchen nach der
Beimpfung weiterbearbeiten wie beim ersten Ansatz beschrieben (außer
Medienwechsel nach 18 h), nach zwei erfolglosen Passagen Isolierungsversuch
beenden

2.3. Kontrollen
Bei allen Anzuchtversuchen wird als Positivkontrolle ein Zellkulturröhrchen mit einem
Chlamydienstamm infiziert (definierte Infektionsdosis) und als Negativkontrolle ein
unbeimpftes Zellkulturröhrchen mitgeführt.

3. Nachweis der Chlamydien in Zellkulturen


• Infizierten Überstand aus den Röhrchen pipettieren und für Passagierung in
sterile Röhrchen überführen bzw. direkt auf vorbereitete BGM-Zellen geben
• einmal kurz mit Methanol spülen und anschließend 10 min mit Methanol
fixieren
® Zellen vor dem Fixieren nicht trocken werden lassen, da sonst Ruptur der
Einschlüsse möglich
® Deckglaskulturen im Röhrchen fixieren

3.1. Färbung nach Giménez


Der Test ist valide, wenn Negativ- und Positiv-Kontrollen entsprechend ausgewertet
werden können.

FLI 181
Amtliche Methodensammlung Stand: Mai 2013

3.2. Nachweis mittels Immunfluoreszenz

Für den Immunfluoreszenz-Nachweis von Chlamydienantigen stehen verschiedene


kommerzielle Konjugate zur Verfügung. Die Durchführung ist nach der
entsprechenden Produktinformation durchzuführen13.
• Test der Firma Dako: Der Fluoresceinisothiocyanat (FITC) - konjugierte,
gattungsspezifische monoklonale Antikörper richtet sich gegen das auf der
Oberfläche aller bekannten Chlamydienstämme vorkommende
Lipopolysaccharid (LPS).
• Deckgläser mit Pinzette dem Röhrchen entnehmen, mit Mikroskopierkleber
(Entellan) auf dem Objektträger befestigen (Zellschicht nach oben) und
trocknen lassen.
• Probe mit 25 µl Testreagenz überschichten
− in feuchter Kammer 15 min bei 37 oC inkubieren
− Objektträger mit PBS abspülen und anschließend 5 min im PBS-
Schüttelbad waschen
− Flüssigkeit auf Fließpapier etwas ablaufen lassen
− einen Tropfen IMAGEN TM - Eindeckmedium auf Probe geben
− mit Deckglas eindecken
− Auswertung unter einem Auflicht-Fluoreszenzmikroskop bei 400- bis
1000-facher Vergrößerung

Der Test ist valide, wenn Negativ- und Positiv-Kontrollen entsprechend ausgewertet
werden können.

19.3.1.3. Nachweis Chlamydophila-psittaci-spezifischer DANN mittels rtPCR


1. Grundlagen
Das nachstehende Verfahren wurde am CVLUA Stuttgart in Zusammenarbeit mit
dem nationalen Referenzlabor für Psittakose (NRL) entwickelt und beruht auf der
Amplifikation eines spezifischen Fragments aus dem ompA-Gen von C. psittaci. Es
stellt eine Duplex-PCR mit interner Amplifikationskontrolle (IC2) dar und wurde im
NRL bei einer Vielzahl von Untersuchungen eingesetzt. Die bei der internen
Validierung erzielten Ergebnisse weisen es als spezifische, sensitive und
reproduzierbare Methode aus. Darüber hinaus hat sich diese Methode in einem
bundesweiten Ringversuch des NRL Psittakose im Jahre 2006 als sehr zuverlässig
erwiesen. Benötigte Reagenzien und Geräte sind dem Anhang 3 zu entnehmen.

2. Probenaufarbeitung (DNA-Extraktion)
a) INFIZIERTE ZELLKULTUREN:
1ml Kultur werden in einem Eppendorf-Tube 10 min bei 14,000 rpm zentrifugiert. Das
Pellet wird in 200 µl PBS-Puffer (10 mM Na 2 HPO 4 , 10 mM NaH 2 PO 4 , 0,145 M NaCl,
pH 7,0) resuspendiert. Zur DNA-Extraktion verwendet man das High Pure PCR
Template Preparation Kit (Roche), bei welchem die DNA nach der Zelllyse über eine
Minisäule gereinigt wird, oder vergleichbare Erzeugnisse anderer Hersteller, wie das
QIAamp DNA Mini Kit. Nach Abarbeitung des mitgelieferten Protokolls erhält man ein
Eluat von 200 µl, welches zur Aufkonzentrierung der DNA mit 0,6 VT Isopropanol (30
min, RT) gefällt werden kann. Das durch Zentrifugation (mind. 12,000 g, 10 min)

FLI 182
Amtliche Methodensammlung Stand: Mai 2013

gesammelte Präzipitat löst man dann in 20 µl Tris-Puffer (10 mM) und setzt davon 1
µl direkt in der PCR ein.

b) KLINISCHES MATERIAL
Ein Gewebestück von ca. 25 mg wird in 200 µl Lysepuffer des High Pure PCR
Template Preparation Kit suspendiert und nach dem Protokoll des Herstellers
verarbeitet. Nach Abarbeitung dieses Protokolls erhält man ein Eluat von 200µl,
welches zwecks Aufkonzentrierung der DNA mit 0,6 VT Isopropanol (30 min, RT)
gefällt werden kann. Das durch Zentrifugation (mind. 12,000 g, 10 min) gesammelte
Präzipitat löst man dann in 20 µl Tris-Puffer (10 mM) und setzt davon 1 µl direkt in
der PCR ein.
Tupferproben können nach einem alternativen Verfahren aufgearbeitet werden.
Dazu vermischt man die Tupfer mittels Vortex-Schüttler in einem 2ml-Eppendorf-
Reagenzröhrchen mit 500 µl Lysepuffer (100 mM Tris, pH 8.5, 0.05 % Tween 20)
und zentrifugiert 30 Sek. bei 12,000 rpm. Um sämtliche Flüssigkeit aus dem Tupfer
zu gewinnen, wird dieser in einer halb abgeschnittenen 1-ml-Pipettenspitze in einem
zweiten Röhrchen nochmals 2 min zentrifugiert. Die Probenflüssigkeit wird vereinigt
und 15 min bei 14,000 rpm zentrifugiert. Das Pellet ist in 50 µl Lysepuffer
aufzunehmen und mit 20 µl 1%iger Proteinase K zu verdauen (2 h bei 60 °C, dann
Inaktivierung 15 min bei 97 °C). Nach 5-minütiger Zentrifugation wird 1 µl des
Überstandes als Template eingesetzt. Eine Aufarbeitung des Pellets mit einem
kommerziellen DNA-Präparationskit ist ebenfalls möglich.

3. Amplifikation
Folgende Primer und Sonden kommen zum Einsatz:

Tabelle 3: Chlamydophila-psittaci-spezifische Primer und Sonde

Primer Sonde Nukleotidsequenz (5'-3')


Cpps-F CAC TAT GTG GGA AGG TGC TTC A
Cpps-R CTG CGC GGA TGC TAA TGG
Cpps-S FAM-CGC TAC TTG GTG TGA C-BHQ1 (MGB-Sonde)
Amplikonlänge: 76 bp

Tabelle 4: Primer und Sonde für die interne Amplifikationskontrolle

Template- IC2 Dosierung 0,25 µl je Reaktion (2500 Kopien)


DNA*
Primer 1 EGFP-1-F GAC CAC TAC CAG CAG AAC AC
Primer 2 EGFP-10-R CTT GTA CAG CTC GTC CAT GC
Sonde EGFP-HEX HEX-AGC ACC CAG TCC GCC CTG AGC A-BHQ1
Amplikonlänge: 177 bp
* Kloniert und präpariert von Dr. Bernd Hoffmann, FLI Insel Riems

FLI 183
Amtliche Methodensammlung Stand: Mai 2013

Die Amplifikation wird in für Real-Time-PCR geeigneten 96-Well-Platten in 25 µl-


Ansätzen durchgeführt. Ein Reaktionsansatz enthält:
12,5 µl rtPCR Mastermix 2X (enthält Taq DNA-Polymerase, dNTPs,
MgCl 2,
Enhancer u. a.)
je 2,0 µl Primerlösung Cpps-F/R (Endkonzentration 800 nM)
1,0 µl Sonde Cpps-S (Endkonzentration 200 nM)
2 µl IC2-Primer-Sonden-Mix
(F:R:S=1:1:2; Endkonz. 400 nM:400 nm:200 nM)
0.25 µl IC2 DNA-Template (enthält 250 Kopien)
2,0 µl Proben-DNA
3,25 µl H 2 O entionisiert

Für jede Probe sind mindestens zwei Wells vorzusehen (Doppelbestimmung). Nach
erfolgter Pipettierung werden die Platten an der Oberseite mit Plastikfolie versiegelt
und 30 Sek. bei 1000 rpm zentrifugiert.
Als Kopienstandards benutzt man die Verdünnungsreihe eines DNA-Extraktes aus
der Zellkultur eines bekannten Chlamydienstammes mit definiertem Gehalt an
Einschluss-bildenden Einheiten (EBE). Wenn eine quantitative Auswertung
beabsichtigt ist, werden Konzentrationen von 104 bis 10-1 Kopien pro µl jeweils
doppelt aufgetragen.
Die Reagenzienkontrollen (NTC, non-template controls) enthalten die gleichen
Volumina an universellem Master Mix, Primern und Sonde, aber 1 µl Wasser anstelle
des DNA-Templates.

Folgendes Temperatur-Zeit-Profil wird gefahren (Standardprogramm des Cyclers):


2 min 50 °C
10 min 95 °C
45 Zyklen: 15 Sek. 95 °C
60 Sek. 60 °C.

Auswertung
Als positives Ergebnis gilt, wenn eine Probe in beiden Ansätzen einen Ct-Wert
(Schnittpunkt der Amplifikationskurve mit dem Schwellenwert) von unter 36 erreicht.
Werden höhere Ct-Werte erreicht (36,0 bis 40,0), gilt das Ergebnis als fraglich und
die jeweilige Probe muss nochmals gefahren werden.
Falls die NTC-Kontrollen in mindestens einem Falle einen Ct-Wert unter 40 zeigen,
ist die betreffende Probenserie zu wiederholen.
Die Ct-Werte der internen Amplifikationskontrolle (IC, Signal HEX) sollen sich in
einem Bereich von 26,0 bis 32,0 bewegen und untereinander relativ einheitlich sein
(Variationsbreite unter den Proben eines Laufes max. 2 Ct-Einheiten). Sobald eine
als Chlamydien-negativ beurteilte Probe einen stark abweichenden Ct-Wert der IC
zeigt, ist diese zu wiederholen.

FLI 184
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 5: Richtlinie für die Bewertung

Ct-Wert des spezifischen Signals (hier: Bewertung FAM)


2x <36 positiv
2x >36 fraglich positiv (Wiederholung)
1x <36, 1x kein Ct fraglich positiv (Wiederholung)
1x 36-40, 1x kein Ct fraglich negativ (Wiederholung)
2x kein Ct negativ

19.3.1.4. Chlamydophila-psittaci-Antigennachweis mittels Enzyme-linked


Immunosorbend Assay (ELISA)

Weiterhin ist der Nachweis von C.-psittaci-Antigen mittels Enzyme-linked Immuno-


Sorbent Assay (ELISA) möglich. Hier müssen bei der Durchführung die Vorgaben der
jeweiligen Anbieter beachtet werden (Antigen-ELISAs14). Der Einsatz dieser
Testsysteme, insbesondere zur Diagnose der anzeigepflichtigen Psittakose, kann nur
unter Vorbehalt empfohlen werden, da infolge der gegenüber anderen Methoden
eingeschränkten Spezifität falsch-positive Reaktionen auftreten können15, 16.

1. Vorbereitung des Untersuchungsmaterials


• Die Vorbereitung von Tupferproben ohne Transportmedium, Organmaterialien
und Kotproben entspricht den unter 29.3.1.2.1 beschriebenen Arbeitsschritten
(dem Transportmedium wird 0,1 % Tween 20 zugefügt, es enthält keine
Antibiotika und Antimykotica).
• Proben sind in hitzebeständige Röhrchen zu überführen.
• Bei Tupferproben mit Transportmedium erfolgt keine weitere Aufarbeitung.
• Die Proben können bis zu 7 Tage bei 2 bis 8 °C aufbewahrt werden. Bei
längeren Aufbewahrungszeiten empfiehlt es sich, die Proben bei -20 °C
einzufrieren.

2. Antigen-ELISA-Testdurchführung
Die Testdurchführung ist nach der Gebrauchsinformation des Herstellers durchzuführen.

Einige wichtige Punkte bei der Durchführung des IDEIAâ Chlamydia Tests14:
• tiefgefrorene Proben auftauen
• Proben 15 Min bei 100 °C in Wasserbad erhitzen (dabei ist sicherzustellen,
dass kein Wasser in die Probenröhrchen gelangen kann)
• Proben auf Zimmertemperatur abkühlen
• vor Einfüllen in die ELISA-Platten die vorbereiteten Proben für 15 Sek., die
Positiv-Kontrolle für 1 min auf einem Vortexschüttler gut mischen
(gleichmäßige Verteilung von Antigenkonglomeraten)
• beim Waschen der ELISA-Platten nach der 2. Inkubation bei jedem der 4
Waschschritte eine Standzeit von jeweils 2 min einhalten
• in Abweichung zur Gebrauchsinformation errechnet sich der Grenzwert aus
dem Extinktionsmittelwert der Negativ-Kontrollen zuzüglich des Wertes von
0.130

FLI 185
Amtliche Methodensammlung Stand: Mai 2013

JANECZEK7 (1998) konnte aufgrund epidemiologischer Untersuchungen, in denen


Antikörperstatus und Antigenausscheidung von Psittaciformes analysiert wurden,
zeigen, dass die Grenzwertberechnung, wie sie laut Produktinformation zur
Ermittlung von Chlamydia trachomatis-Infektionen herangezogen wird, für die
Diagnose von Chlamydophila psittaci-Infektionen nicht geeignet ist. Aufgrund dieser
Grenzwert-Erhöhung konnte die Anzahl falsch positiv befundeter Chlamydien-
Aussscheider von 6,4 % auf 1,6 % reduziert werden.

• Insbesondere bei Kotmaterialien sind aufgrund evtl. Kreuzreaktionen mit


Bakterien-LPS Probenextinktionen bis 0.250 OD über dem Grenzwert
vorsichtig zu interpretieren. Dagegen können Probenextinktionen von ³
0.250 OD über dem Grenzwert als sicher positive Chlamydienbefunde
gewertet werden (siehe AVID-Mitteilung II/1997, Anlage 8).

19.3.2. Chlamydophila-psittaci-Antikörpernachweise
Serologische Untersuchungen dienen vor allem zur Diagnose von subklinischen
persistierenden Chlamydieninfektionen, da bei dieser Verlaufsform i.d.R. keine
Erreger ausgeschieden werden. Sie ist die häufigste Form bei adulten Vögeln. Zum
Nachweis von Antikörpern gegen C. psittaci dienen die Komplementbindungsreaktion
(KBR) oder ELISA-Verfahren. Lange Zeit stellte die KBR den einzigen Test zum
Nachweis von Antikörpern dar. Da bei Vögeln nach einer Chlamydieninfektion nur
geringe Mengen an komplementbindenden Antikörpern gebildet werden, ist die
Methode allerdings wenig sensitiv. Sie erlaubt weder eine Speziesunterscheidung
noch eine Differenzierung zwischen den Antikörperklassen.

Positive serologische Befunde besitzen keine seuchenrechtliche Relevanz und


dienen nicht zur Seuchenfeststellung.

FLI 186
Amtliche Methodensammlung Stand: Mai 2013

Anhang 1

1. Medien, Puffer, Chemikalien

1.1. Transportmedien (SPGA-Stabilisator)


Bovarnick, M.R.; Miller, J.C., and Snyder, J.C. (1950) Journal of Bacteriology, 59,
509-522

→ Medium zum Transport von Tupfern, Herstellen von Organanreibungen und


Kryokonservieren von Chlamydienstämmen

Saccharose 74,60 g
KH 2 PO 4 0,52 g
K 2 HPO 4 1,25 g
L-Glutaminsäure (Na-Salz) 0,92 g
bovines Albumin, Fraktion V 1,00 g
Aqua bidest ad 1000 ml

→ Substanzen in angegebener Reihenfolge in Aqua bidest. lösen (außer bovines


Albumin)
→ bis zum Eichstrich auffüllen, danach bovines Albumin zugeben und lösen
→ sterilfiltrieren, portionieren und bei -20 °C lagern

- Bevorratung ohne antibiotische und antimykotische Zusätze


- Zusätze frisch zugeben und Medium innerhalb von 24 h verbrauchen

Nystatin-Stammlösung:
45 mg in 5 ml Aqua dest. lösen → Endkonzentration im Medium 25 E/ml

Gentamicin-Stammlösung:
400 mg in 10 ml Aqua dest. lösen → Endkonzentration im Medium 40 µg/ml

Vancomycin-HCL-Stammlösung:
250 mg in 10 ml PBS lösen → Endkonzentration im Medium 25 µg/ml

- Stammlösungen mischen und in Portionen zu je 250 µl abfüllen


- Zugabe von 250 µl zu 100 ml Medium ergibt die gewünschte Endkonzentration

FLI 187
Amtliche Methodensammlung Stand: Mai 2013

1.2. Karbolfuchsinlösung für Färbung nach Giménez


Karbolfuchsin:
Stammlösung
100 ml 10%ige Fuchsinlösung
(10 g Fuchsin gelöst in 100 ml 95%igem Ethanol)
+ 650 ml Aqua dest.
+ 250 ml 4%iges wässriges Phenol

- vor Gebrauch 48 h bei 37 oC stehen lassen


- Stammlösung 10 Monate haltbar

Gebrauchslösung
40 ml Stammlösung
+ 100 ml PBS pH-Wert 7,2

- Haltbarkeit 40 h
- direkt vor Gebrauch filtrieren

1.3. Malachitgrünlösung für Färbung nach Giménez

Malachitgrünlösung (0,8%ig):
8g Malachitgrünoxalat in 1000 ml Aqua dest. lösen
- vor Gebrauch filtrieren

1.4. Medien für Zellkulturen, Suspensionsmedien und Puffer

1.4.1 Zellkulturmedium EMEM


500 ml Minimum Essential Medium Eagle (EMEM) mit Earle’s
Salzen und NaHCO 3 ohne L-Glutamin
+ 5 ml einer 200 mmol Glutaminstammlösung (siehe 1.4.2)
→Endkonz. 2 mmol/ml
+ 5% fetales Kälberserum (FKS) (derzeit Fa. PAA)
→ fest verschlossen im Kühlschrank bei 4 °C ± 2 °C lagern, nicht unnötig
erwärmen und innerhalb von 4 Wochen nach Zugabe der Zusätze
verbrauchen

1.4.2. Glutaminstammlösung
2,922 g L-Glutamin (zellkulturgetestet) in 100 ml Aqua bidest.
lösen, sterilfiltrieren, portionieren und bei ≤ -18 °C
einfrieren

1.4.3. EMEM mit Zusätzen für Chlamydienanzüchtung


- EMEM-Herstellung siehe unter 1.4.1
- Zusätze frisch zugeben und Medium am Tag der Zugabe verbrauchen

Amphotericin B-Stammlösung:
25 mg in 10 ml Aqua dest. lösen → Endkonzentration im Medium 2,5 µg/ml

FLI 188
Amtliche Methodensammlung Stand: Mai 2013

Gentamicin-Stammlösung:
100 mg in 10 ml Aqua dest. lösen → Endkonzentration im Medium 10 µg/ml

Vancomycin-HCL-Stammlösung:
250 mg in 10 ml Aqua dest. lösen → Endkonzentration im Medium 25 µg/ml

- Stammlösungen mischen und in Portionen zu je 300 µl abfüllen


und bei ≤ -18 °C einfrieren
- Zugabe von 300 µl zu 100 ml Medium ergibt die gewünschte Endkonzentration

1.4.4. Trypsin-EDTA-Lösung (pH-Wert 7,2-7,3)

8,0 g
NaCL
0,8 g
KCL
1,0 g
Glucose
0,58 g
NaHCO 3
0,5 g
Trypsin
0,2 g
EDTA
ad
Aqua bidest.
1000 ml
→ Substanzen in angegebener Reihenfolge in Aqua bidest. lösen, dann pH-
Wert einstellen
→ bis zum Eichstrich auffüllen, sterilfiltrieren, portionieren und bei ≤ -18 °C
einfrieren

1.4.5. PBS (pH-Wert 7,2-7,4) ohne Ca- und Mg-Ionen


→ Puffer zum Waschen der Zellen vor dem Umsatz

8,0 g
NaCL
0,2 g
KCL
2,31g
Na 2 HPO 4 x 12
0,2 g
H2O
ad
KH 2 PO 4
1000
Aqua bidest.
ml
→ Substanzen in angegebener Reihenfolge in Aqua bidest. lösen, dann pH-
Wert einstellen
→ bis zum Eichstrich auffüllen, sterilfiltrieren, portionieren und im Kühlschrank
lagern

FLI 189
Amtliche Methodensammlung Stand: Mai 2013

1.4.6. PBS (pH-Wert 7,2-7,4) mit Ca- und Mg-Ionen


→ Puffer zum Waschen der Zellen ohne Umsatz

NaCL
8,0 g
KCL
0,2 g
Na 2 HPO 4 x 12
2,31g
H2O
0,2 g
KH 2 PO 4
0,0468 g
MgCl 2
0,132 g
CaCl 2 x 2 H 2 O
ad 1000 ml
Aqua bidest.
→ Substanzen in angegebener Reihenfolge in Aqua bidest. lösen, dann pH-
Wert einstellen
→ bis zum Eichstrich auffüllen, sterilfiltrieren, portionieren und im Kühlschrank
lagern

1.5. Suspensionsmedium für Verreibungen (Antigen-ELISA)


Basismedium mit 0.1 % Tween 20, jedoch ohne Zusatz von NEAA, Antibiotika und
Antimycotika

Anhang 2
Zellkultur
Verwendet wird die permanente Buffalo Green Monkey (BGM)-Zelllinie
(ATCC CCL 26, BS-C-1 [Kidney, African Green Monkey, ceropithecus aethiops])
(Angaben in Klammern für Zellkulturflaschen T75)

• bewachsene Zellkulturflasche leicht schwenken, umdrehen und Medium


absaugen
• 1x mit 5 ml (10 ml) PBS - Puffer waschen, um abgestorbene Zellen,
Medienbestandteile und Stoffwechselprodukte zu entfernen ® absaugen
• 2 ml (5 ml) Trypsin-EDTA-Lösung auf Zellrasen geben und 5 bis 10 min bei
37 °C einwirken lassen,
• gelegentlich schwenken und klopfen
→ Zeitangabe nur Richtwert
→ Einwirkzeit abhängig von dem Alter der Zellen und dem Alter der Trypsin-
EDTA-Lösung
→ Sichtkontrolle makroskopisch: Zellen fließen mit der Flüssigkeit am
Flaschenboden herunter
→ Sichtkontrolle mikroskopisch: Großteil der Zellen schwimmt in abgekugelter
Form in der Flüssigkeit
• 2 ml (5 ml) Zellkulturmedium zugeben
• das im Medium enthaltene Serum neutralisiert sofort die Wirkung des Trypsins
und teilweise den zytotoxischen Einfluss des EDTA)
• Zellen mittels Pipette gründlich suspendieren und in Röhrchen geben
• Suspension 12 min bei 1500 U/min und 18oC zentrifugieren
• Überstand sofort vorsichtig absaugen
→ sonst Zellschädigung durch EDTA

FLI 190
Amtliche Methodensammlung Stand: Mai 2013

→ Anwesenheit von EDTA erschwert außerdem die erneute Anheftung der Zellen
bei der Aussaat
• 2 ml (4 ml) Kulturmedium auf Zellpellet geben und gründlich resuspendieren, um
die Zellen zu vereinzeln
• Zellen nach Umsatzrate (z. B. 1:5) umsetzen oder Zellzahl mittels Neubauer-
Zählkammer bestimmen
• Kulturmedium in Zellkulturflasche vorlegen und errechnete Menge
Zellsuspension zugeben und durch Schwenken gleichmäßig verteilen
→ Inkubation im Brutschrank bei 37 °C und 5 % CO 2
• bei Zellkulturflaschen ohne Sterilfilter in der Verschlusskappe diese ca. eine
halbe Umdrehung aufschrauben, um den Gasaustausch zu gewährleisten
• nach zwei bis vier Tagen erfolgt die Ausbildung eines geschlossenen Zellrasens
(abhängig von der Einsaatdichte der Zellen)

Anzucht in Röhrchen mit Deckglas


• Zelle umsetzen wie oben beschrieben
• nach Bedarf entsprechende Menge Zellsuspension mit einer Zelldichte von
1x105/ml herstellen
• 1ml / Röhrchen einfüllen
→ auf gleichmäßige Durchmischung achten, da Zellen sich schnell absetzen
• Röhrchendeckel etwas aufschrauben, um Gasaustausch zu gewährleisten
• Inkubation bei 37 °C und 5 % CO 2
• nach 1h kontrollieren, ob noch alle Deckel locker sind
→ Bei festgesaugtem Deckel und dadurch verhindertem Gasaustausch bleibt die
Mediumfarbe unverändert, während sich das Medium durch den
Gasaustausch etwas orange verfärbt.
• nach 2 bis 3 d Ausbildung eines geschlossenen Zellrasens (mikroskopische
Kontrolle)

Anhang 3

Materialien und Geräte für die Real-Time-PCR

Verzeichnis der Reagenzien


• PBS-Puffer (10 mM Na 2 HPO 4 , 10 mM NaH 2 PO 4 , 0,145 M NaCl, pH 7,0)
• High Pure PCR Template Preparation Kit (Roche Diagnostics) od. vergleichbares
Produkt zur DNA-Extraktion aus klinischen Proben
• Isopropanol z.A.
• Tris-Puffer 10 mM
• Lysepuffer (100 mM Tris, pH 8.5, 0.05 % Tween 20)
• Proteinase K (1%ige Lösung, w/v)
• Reinstwasser
• TaqMan Universal MasterMix (Fa. Applied Biosystems, Weiterstadt) od.
gleichwertiges Produkt eines anderen Herstellers, enthält Hot-Start Taq-DNA-
Polymerase, Reaktionspuffer, dNTPs und Farbstoffe

FLI 191
Amtliche Methodensammlung Stand: Mai 2013

• Primer: Stammlösung 100 pmol/µl, Arbeitsverdünnung 1:20, ergibt


Arbeitskonzentration 5 pmol/µl) (Sequenzen und andere Angaben siehe Tabellen
3 und 4)
• Sonde: lösen in 1mM Tris-HCl pH 8.0/0,01mM EDTA, so dass sich eine
Konzentration von 5 pmol/µl bzw. 5 µM ergibt; in Portionen zu je 200µl einfrieren.
(Sequenzen und andere Angaben siehe Tabellen 3 und 4)

Es handelt sich um eine MGB®-Sonde.

Verzeichnis der Geräte


• GeneAmp® 7700 (oder 5700) Sequence Detection System (Applied Biosystems)
oder Mx3000 Real-Time PCR System (Stratagene, Amsterdam)
• Vortexschüttler
• Tischzentrifuge
• Laborzentrifuge mit Rotor für Mikrotiterplatten, z. B.Biofuge Stratos (Kendro
Laboratory Products, Langenselbold)
• Automatische Pipetten, 0,1-2,5 µl, 0,5-10µl, 2-20 µl, 10-100 µl, 20-200 µl und 100-
1000 µl
• Mehrkanalpipette, z. B. 8-Kanalpipette 10-100 µl

Verzeichnis der Verbrauchsmaterialien


• MicroAmp® Optical 96-Well Reaction Plates (Applied Biosystems) oder andere für
Real-Time-PCR geeignete Mikrotiterplatten
• Thermische Verschließfolie, z. B. MicroAmp Clear Adhesive Films (Appl.
Biosystems) od. Adhesive Plate Seal (Biodeal, Markkleeberg)
• Filterspitzen für o. g. automatische Pipetten
• Reaktionsgefäße 0,2 ml, dünnwandig (für PCR)
• Reaktionsgefäße 1,65 ml und 2,0 ml (für Probenaufbereitung)
• Einmalhandschuhe (bei allen Arbeitsschritten zu tragen)

Literatur (siehe Fußnoten)

1 ANDERSEN, A.A (1997): Two new serovars of Chlamydia psittaci from North American birds.
J Vet Diagn Invest 9:159-164
2 VANROMPAY, D., BUTAYE, P., SAYADA, C., DUCATELLE, R., HAESEBROUCK, F. (1997):
Characterization of avian Chlamydia psittaci strains using omp1 restriction mapping and
serovar-specific monoclonal antibodies. Res Microbiol 148:327-333
3 GEENS, T., DESPLANQUES, A., VAN LOOCK, M., BÖNNER, B.M., KALETA, E.F.,
MAGNINO, S., ANDERSEN, A.A., EVERETT, K.D.E., VANROMPAY, D. (2005):
Chlamydophila psittaci ompA sequencing reveals the new genotype E/B and the need for a
rapid discriminatory genotyping method. J Clin Microbiol 43:2456-2461
4 Verordnung zum Schutz gegen die Psittakose und Ornithose -Psittakose-Verordnung vom
20. Dezember 2005 (BGBl. I Nr. 74 vom 23.12.2005 S. 3532-3537) Gl.-Nr.: 7831-41-4
5 Verordnung über meldepflichtige Tierkrankheiten vom 20. Dezember 2005
6 KALETA E.F. (1997): Aktuelle Fragen der Diagnose und Bekämpfung der Psittakose.
Tierärztl Umschau 52, 36-44
7 JANECZEK, F. (1989): Chlamydia psittaci - Diagnostik bei Psittaciformes: Vergleichendes
Untersuchungen zum Antigennachweis in der Zellkultur und im ELISA sowie zum
Antikörpernachweis in der Komplementbindungsreaktion und im Blocking ELISA. Vet Diss
München
8 NÜCHTER, H., SACHSE, K., KALETA, E.F. (2004) Die aviäre Chlamydiose und ihre
Bekämpfung in der Europäischen Union. Amtstierärztlicher Dienst und Lebensmittelkontrolle,

FLI 192
Amtliche Methodensammlung Stand: Mai 2013

11, 97-102 (Teil 1) und 189-194 (Teil 2)


9 Bei der Gewinnung der Tupferproben ist darauf zu achten, dass möglichst viele Epithelzellen
gewonnen werden. ACHTUNG: Baumwolltupfer mit HOLZSCHAFT sind UNGEEIGNET, da
das nachzuweisende Antigen an Holz adsorbiert und dadurch Ergebnisse verfälscht werden.
z. B. IDEIA Chlamydia-Probenentnahmeset (2 unterschiedlich große Tupfer und
Transportmedium in Schraubflasche) der Fa. DAKO Diagnostika, Hamburg.
10 Kommerziell verfügbare Transportmedien, z. B. von Dako oder SPGA-Stabilisator, siehe
Anhang 1 (1.1)
11 Blut ist aus der Vena jugularis zu entnehmen. Bei kleineren Vögeln (z. B. Wellensittiche)
können etwa 0,5 ml und bei größeren Vögeln bis zu 1,5 ml Blut entnommen werden (Kanüle
0,70 x 30 mm). Blutproben möglichst nicht aus der Vena ulnaris entnehmen, da es häufig zu
Hämatombildung kommt.
12 Bedingung für den direkten Nachweis von Chlamydienantigen mittels histologischer bzw.
fluoreszenzserologischer Methoden ist eine ausreichende Anzahl von Zellen. Da bei
negativem Ergebnis weitere Untersuchungen (Zellkulturmethode bzw. Antigen-ELISA)
durchzuführen sind, sollten die ohne Medium eingesandten Tupfer in geeignetes Medium
verbracht werden. Bei den mit Transportmedium zu untersuchenden Tupfer, sollte das
restliche Zellpellet im abgesaugten Transportmedium wieder resuspendiert werden.
13 Bei den Konjugaten z. B. der Fa. Medac, Hamburg bzw. DAKO, Hamburg handelt es sich um
FITC (Fluorescein-Iso-Thio-Cyanat)-gebundene, monoklonale Antikörper gegen ein allen
Chlamydienarten gemeinsames, genus-spezifisches Lipopolysaccharid (LPS).
14 ELISA Erfahrungen liegen für den IDEIA Chlamydia Test der Fa. DAKO, Hamburg, vor. Die
Ausführungen gelten nur für diesen Test.
15 Siehe dazu AVID-Mitteilung II/1997, Anlagen 8 bis 10
16 SACHSE, K., GROSSMANN, E., JÄGER, C., DILLER, R., HOTZEL, H. (2003): Detection of
Chlamydia suis from clinical specimens: Comparison of PCR, antigen ELISA and culture. J
Microbiol Meth 54:233-238

FLI 193
Amtliche Methodensammlung Stand: Mai 2013

20. Echinokokkose

20.1. Charakterisierung der Infektion


20.1.1. Erreger
Die Echinokokkose wird durch Zestoden der Gattung Echinococcus hervorgerufen –
die zystische Echinokokkose durch den Kleinen Hundebandwurm (E. granulosus s.l.)
und die alveoläre Echinokokkose durch den Kleinen Fuchsbandwurm
(E. multilocularis). E. oligarthrus und E. vogeli kommen in Zentral- und Südamerika
vor, Infektionen beim Menschen sind sehr selten. Die Taxonomie des
E. granulosus s.l. ist derzeit im Umbruch begriffen. Eine Abgrenzung des früher als
Rinderstamm bezeichneten E. ortleppi (Genotyp G5) und des so genannten
Pferdestammes E. equinus (Genotyp G4) hat sich inzwischen weitgehend
durchgesetzt.

Die Gattung Echinococcus ist durch einen obligaten Wirtswechsel charakterisiert, bei
dem die geschlechtsreifen, sehr kleinen Bandwürmer im Dünndarm von Endwirten
(Fleischfresser, in Europa vor allem Hundeartige, selten Katzen) parasitieren,
während sich das Larvenstadium in Organen von Zwischenwirten (meist Nagetiere
und Schafe sowie Tiere, die den Endwirten als Nahrung dienen) entwickelt. Der
Mensch kann als Fehlwirt von dem Larvenstadium befallen werden.

E. granulosus s.l. ist ein 4 bis 7 mm langer Bandwurm (Cestoda) mit


häkchenbesetztem Skolex, er besteht typischerweise aus 3 (2 bis 6) Gliedern
(Proglottiden). Diese enthalten einen mit seitlichen Aussackungen versehenen
Uterus, der in reifem Zustand bis zu 1.500 Eier beherbergt. Die eigefüllten reifen
Endglieder lösen sich vom Wurm ab und werden mit dem Kot ausgeschieden. Nach
oraler Aufnahme der Eier durch den Zwischenwirt bilden sich Larven, die in der
Regel hämatogen in die Leber, aber auch in die Lunge und sehr selten in andere
Organe gelangen und dort verbleiben. Es bildet sich eine Zyste (Hydatide), die einen
Durchmesser von einigen Dezimetern erreichen kann. Im Gegensatz zur alveolären
Echinokokkose induziert die zystische Echinokokkose die Bildung einer wirtsseitigen
Bindegewebskapsel. Die Zystenwand besteht aus mehreren Schichten – einer
äußeren Bindegewebsschicht, die vom Wirt gebildet wird, einer laminierten Membran
(Cuticula) und einer Keimschicht. Aus der Keimschicht entwickeln sich Knospen
(Brutkapseln), in denen sich die Protoscolices (Kopfanlagen) entwickeln. E.
granulosus ist weltweit verbreitet. In Europa kommt der Parasit vor allem in
Mittelmeerländern und auf dem Balkan vor, wo die Schafhaltung von großer
Bedeutung ist. Hauptendwirt von E. granulosus ist der Hund, selten die Katze. Nach
Fressen von rohen larvenhaltigen Innereien entwickeln sich beim Hund die adulten
Bandwürmer. Wiederkäuer (vor allem Schafe) dienen als Zwischenwirt. Sie nehmen
die Eier beim Grasen auf kontaminierten Weiden auf.

E. multilocularis ist ein 2 bis 4 mm langer Bandwurm (Cestoda), der typischerweise 5


(2 bis 6) Glieder (Proglottiden) aufweist und einen sackförmigen Uterus, der ca. 200
Eier enthält, besitzt. Zwischen- und Fehlwirte infizieren sich durch orale Aufnahme
der Eier. Fast stets ist ausschließlich die Leber von der Larve befallen. Im Gegensatz
zu E. granulosus bildet sich jedoch keine geschlossene Zyste, sondern es kommt zu

FLI 194
Amtliche Methodensammlung Stand: Mai 2013

einem infiltrativen Wachstum der Larve, vergleichbar mit dem Wachstum eines
malignen Tumors. Das Keimepithel bildet Sprossen, die das Lebergewebe
durchsetzen. Im natürlichen Zwischenwirt bilden sich zahlreiche Protoscolices
(Kopfanlagen) aus, beim Menschen (Fehlwirt) kommt dies nur in Ausnahmefällen vor.
E. multilocularis ist nur auf der nördlichen Hemisphäre verbreitet. In Europa gilt
insbesondere das Gebiet als hochendemisch, das Süddeutschland (Baden-
Württemberg, Bayern), die Nordschweiz, Westösterreich und Ostfrankreich umfasst.
Der Großteil der in Deutschland bekannt gewordenen Fälle menschlicher Infektionen
stammt aus ländlichen Regionen der südlichen Bundesländer, einzelne
Erkrankungen wurden aber auch aus anderen Bundesländern gemeldet. Als Folge
der zunehmenden Besiedlung von Städten und bewohnten Gebieten durch Füchse,
aber auch durch Infektionen bei Hunden oder Katzen können Eier des Kleinen
Fuchsbandwurms auch in das städtische Umfeld des Menschen gelangen.
Hauptendwirt für E. multilocularis ist der Fuchs. Die epidemiologische Rolle der vor
allem in Ostdeutschland neu etablierten, für den Erreger empfänglichen
Marderhundpopulation ist noch offen. Infektionen bei Hunden sind möglich, Katzen
scheinen als Wirt eine untergeordnete Bedeutung zu haben, da der Parasit sich in
ihrem Darm nur langsam entwickelt und nur wenige Eier produziert. Das
Larvenstadium (Metazestode) befällt Nagetiere als Zwischenwirt (z. B. Feld-,
Wühlmäuse, Bisamratten) oder auch den Menschen als Fehlwirt. Die Infektion der
Endwirte erfolgt durch den Verzehr infizierter Nagetiere.

20.1.2. Klinische Symptomatik


Die Infektionen verlaufen beim Endwirt in der Regel klinisch inapparent.

20.1.3. Differentialdiagnostik
Adulte Echinokokken im Darm können kaum mit anderen Parasiten verwechselt
werden. Proglottiden sind von denen anderer Zestoden zu unterscheiden (Bauer, C.,
1998).

20.1.4. Diagnostische Indikation


Monitoring, Überwachung

20.1.5. Zuständige Untersuchungseinrichtungen


• Untersuchungsämter der Länder
• NRL für Echinokokkose am FLI, Institut für Epidemiologie, Seestr. 55,
16868 Wusterhausen; Tel. 033979 80176; E-Mail: franz.conraths@fli.bund.de

20.1.6. Rechtsgrundlagen
Bei der Echinokokkose handelt es sich um eine meldepflichtige Tierkrankheit
(Verordnung über meldepflichtige Tierkrankheiten in der Fassung der
Bekanntmachung vom 20.12.2005). Gemäß Artikel 4 Absatz 1 bis 3 der Richtlinie
2003/99/EG gehört die Echinokokkose zu den überwachungspflichtigen Zoonosen.

FLI 195
Amtliche Methodensammlung Stand: Mai 2013

20.2. Untersuchungsmaterial
Für die Untersuchung von Endwirten wird deren Dünndarm benötigt. Aus Gründen
der Arbeitssicherheit (Vermeiden von Infektionen mit Echinococcus spp.) werden die
zu untersuchenden Tierkörper sowie die Därme von sezierten Tierkörpern für
mindestens eine Woche bei -80 °C eingefroren.

20.3. Untersuchungsgang
20.3.1. Erregernachweis
20.3.1.1. Nachweis adulter Stadien im Darm von Endwirten

Intestinal Scraping Technique (IST)


Aus Gründen der Arbeitssicherheit (Vermeidung von Infektionen mit Echinococcus
spp.) werden die zu untersuchenden Tierkörper sowie die Därme von sezierten
Tierkörpern für mindestens eine Woche bei -80 °C eingefroren.

Das Protokoll der Intestinal Scraping Technique (IST) beruht auf einer von Eckert et
al. (1984) beschriebenen Methode. Dabei werden Abstriche der Darmschleimhaut mit
Hilfe von Objektträgern gefertigt und mikroskopisch ausgewertet. Mehrere Varianten
dieses Protokolls werden genutzt. Eine Evaluierung der hier beschriebenen Variante
zur Untersuchung von Füchsen wurde veröffentlicht (Tackmann et al., 2006).

Durchführung
1. Entnahme des Darmkonvoluts
2. Auslegen des Dünndarms in drei Teilen gleicher Länge (vorderer, mittlerer und
kaudaler Dünndarmabschnitt)
3. Longitudinales Eröffnen des Darmlumens mit Hilfe einer Darmschere und
visuelle Untersuchung auf E. multilocularis und andere Helminthen.
4. Vorsichtiges Entfernen der groben Anteile des Darminhalts, ohne die
Darmschleimhaut zu beeinträchtigen.
5. Entnahme von mindestens 9 Darmschleimhaut-Abstrichen in regelmäßigen
Abständen von 5 – 10 cm in Abhängigkeit von der Gesamtlänge des
Dünndarms (kürzere Abstände bei kürzerer Länge des Dünndarms, größere
Abstände bei größerer Dünndarmlänge. Entnahme der tiefen
Schleimhautabstriche mit Hilfe von Objektträgern.
6. Aufdrücken der Objektträger mit den Schleimhautabstrichen auf quadratische
Petrischalen aus Polystyren (Falcon, 100 mm x 100 mm)
7. Untersuchung der kompletten Schleimhautabstriche mit Hilfe eines
Stereomikroskops bei 8- bis 50-facher Vergrößerung.
8. Dokumentation der Anzahle der in jedem Schleimhautabstrich gefundenen
Exemplare von E. multilocularis.

FLI 196
Amtliche Methodensammlung Stand: Mai 2013

Literatur
BAUER, C., 1998: Praktikum der veterinärmedizinischen Parasitologie. Gießen, ISBN
3927835099
ECKERT, J., GEMMELL, M. A., MATYAS, Z., and E.J.L. SOULSBY, 1984:
Guidelines for surveillance, prevention and control of echinococcosis/hydatidosis,
2nd ed. Geneva: WHO, VPH/81.28
TACKMANN, K., MATTIS, R., CONRATHS, F.J., 2006: Detection of Echinococcus
multilocularis in foxes: evaluation of a protocol of the intestinal scraping technique.
J. Vet. Med. B 53, 395-398.

20.3.2. Nachweis von Lavalstadien im Zwischenwirt

Histologische Untersuchung von Gewebeproben nach PAS-Färbung (Hotchkis)

Lösungen:
10%iges gepuffertes Formaldehyd
1350 ml Formaldehyd
82 g Di-Natriumhydrogenphosphat 12H 2 O (Na 2 HPO 4 12H 2 O)
20 g Na-Dihydrogenphosphat H 2 O (NaH 2 PO 4 H 2 O)
Mit Aqua bidest auf 5000 ml auffüllen

Perjodsäure: Im Handel erhältlich

SCHIFF'S Reagenz: Im Handel erhältlich

Hämalaun nach MAYER


1 g Hämatoxylin in 1000ml Aqua dest lösen
200mg Natriumjodat(NaJO 3 )
50 g Kalialaun
unter schütteln lösen, Lösung soll blauviolett sein.
50 g Chloralhydrat
1 g Zitronensäure
zugeben. Der Farbton schlägt nach rotviolett um.

oder
1 g Hämatein in 50 ml Ethanol 96 % erwärmen und lösen
50 g Kalialaun in 1000 ml bidest. Wasser lösen
Beide Lösungen vereinigen und etwas Thymol zugeben.

FLI 197
Amtliche Methodensammlung Stand: Mai 2013

Durchführung:
• Gewebestücke (gesundes und makroskopisch verdächtiges Gewebe in einem
Stück) in 10%iges gepuffertes Formaldehyd bringen
- 1 Teil Gewebe
- 20 Teile 10%iges gepuffertes Formaldehyd
• mindestens 1,5 bis 2 Wochen (besser länger) fixieren lassen (dunkel stellen,
öfter bewegen)
• Gewebe in höchstens 0.5 bis 1 cm dicke Stücke schneiden, in beschriftete
Kassetten füllen
• mindestens 2 Stunden unter fließendem Wasser wässern
Proben in Kassetten entwässern (Histokinette)
- 2x 70%iges Ethanol ca. 2h = 4h
- 2x 96%iges Ethanol ca. 2h = 4h
- 2x 99%iges Ethanol ca. 1h = 2h
- 3x Chloroform oder Toluol ca. 2h = 6h
- 2x Paraffin (reinst) ca. 4h = 8h
Insgesamt 24 h

• Kassetten in das Kassettenbad des Einbettautomaten bringen


• Gewebe in Paraffin einbetten
• Paraffinschnitte anfertigen, trocknen

PAS – Färbung nach HOTCHKIS

• Schnitte in absteigender alkoholischer Reihe bis zu Aqua bidest. bringen.


• Perjodsäure 10 min
• Leitungswasser (fließend) 10 min
• Aqua bidest kurz spülen
• SCHIFF'S Reagenz 20 - 30 min (muss rot anfärben)
• Aqua bidest spülen
• Hämalaun nach MAYER 7 min
• Leitungswasser 3 x kurz spülen
In gesonderten Küvetten in aufsteigender alkoholischer Reihe entwässern:
• 70 % Ethanol 10 Sek.
• 80 % Ethanol 1 - 2 min
• 95 % Ethanol 3 - 4 min
• 99 % Ethanol 5 min
• 99 % Ethanol 5 min
• Xylol 5 - 10 min
• Xylol 10 min

• Eindecken

Ergebnis: Zellkerne blau, Aldehyde rot

• mikroskopische Untersuchung auf Larvalstadien („Metazestoden“) von


E. multilocularis

FLI 198
Amtliche Methodensammlung Stand: Mai 2013

Larvalstadien von Echinococcus multilocularis in der Leber einer Maus,


PAS-Färbung n. Hotchkis

FLI 199
Amtliche Methodensammlung Stand: Mai 2013

21. Enzootische Leukose der Rinder

21.1. Charakterisierung der Infektion


21.1.1. Erreger
Die enzootische Rinderleukose (ERL) ist eine bei allen Rinderrassen und vereinzelt
beim Schaf auftretende virusbedingte Tumorerkrankung des retikuloendothelialen
Systems. Das infektiöse Agens ist das bovine Leukosevirus (BLV), ein exogenes B-
Zell-lymphotropes Retrovirus.

21.1.2. Klinische Symptomatik


Nach einer unterschiedlich langen Inkubationszeit sind ein klinisch inapparentes, ein
präleukotisches und ein tumoröses Stadium zu unterscheiden. Die Ausbildung von
Tumoren stellt das eigentliche Krankheitsbild dar, welches aber nur bei wenigen
infizierten Tieren als Endstadium der Erkrankung auftritt und je nach Lokalisation der
Veränderung und in unterschiedlichen Zeiträumen zum Tode führen kann. Plötzliche
Todesfälle können durch Milzrupturen verursacht werden.
Die Diagnostik erfolgt
• pathologisch-anatomisch durch den Nachweis des Tumorstadiums
(Leukoseverdacht),
• histologische Tumordifferenzierung (pathognomonisch)
• serologisch durch den Nachweis von Antikörpern in Blut- und/oder Milchserum,
• durch den elektronenoptischen Nachweis des Erregers,
• durch den Provirusnachweis mit Hilfe der PCR

Eine persistierende Lymphozytose mit sehr hohen Lymphozytenwerten wird als


pathognomonisch angesehen.

21.1.3. Differentialdiagnostik
Je nach Verlauf des Tumorstadiums kann es zu Leistungsdepressionen, Inappetenz,
Lahmheit, Exophthalmus und Blutbildveränderungen kommen, die von
entsprechenden Veränderungen vielfältiger anderer Genese (Formen der
sporadischen Rinderleukose, wie sporadisch auftretende Jungtierleukose,
Hautleukose und Thymusleukose) unterschieden werden müssen.

21.1.4. Diagnostische Indikation


Siehe Punkt 6. Zusätzlich: Abklärung von Tumorerkrankungen beim Einzeltier, als
Handels oder Quarantäneuntersuchung (Import/Export, Sanierungsbetriebe u. ä.).

FLI 200
Amtliche Methodensammlung Stand: Mai 2013

21.1.5. Zuständige Untersuchungseinrichtungen


Auf der Grundlage der Leukose-Verordnung und der Zuständigkeitsregelungen der
Bundesländer erfolgt durch staatliche Untersuchungseinrichtungen und in
Tiergesundheitsämtern die Antikörperdiagnostik im
• Enzyme-linked immunosorbent assay (ELISA) und /oder
• Agargel-Immundiffusionstest (AGIDT, IDT)

Die amtlich zugelassenen, kommerziell erhältlichen Tests und entsprechend


freigegebenen Chargen sind in der Liste der nach § 17 c TierSG zugelassenen Mittel
bei der Zulassungsstelle des FLI einzusehen
(http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf).

Abklärungsuntersuchungen bei zweifelhaften Antikörper-Befunden werden durch das


NRL für ERL am FLI, Institut für Infektionsmedizin, Insel Riems u. a. mittels PCR zum
BLV-Provirusnachweis durchgeführt.
Die amtliche Feststellung der Seuche obliegt der zuständigen Veterinärbehörde.
Impfungen und Heilversuche sind verboten.

21.1.6. Rechtsgrundlagen
Die eRL ist in Deutschland als Tierseuche anzeigepflichtig und eine bei der OIE
gelistete Erkrankung. Bestehende Rechtvorschriften sind dargelegt in:

• international:
EG-Richtlinie 64/432,
Anlage G der EWG Direktive 88/406,
Änderungsrichtlinie 97/12/EG des Rates v. 17.03.1997

• national:
Rinder-Leukose-Verordnung vom 02.04.1980, BGBl. I, S.417 und vom
13.03.1997, BGBl. I, 16; geändert durch Art. 2 V v. 20.12.2005 I 3499

Empfehlungen enthält das OIE-Manual of Diagnostic Tests and Vaccines for


Terrestrial Animals, 2009.

FLI 201
Amtliche Methodensammlung Stand: Mai 2013

21.2. Untersuchungsmaterial

Vollblut, Serum, Plasma


Durch die einschlägigen Untersuchungseinrichtungen werden Blutröhrchen zur
Gewinnung von gerinnungsgehemmtem Vollblut (EDTA) bzw. Serum auf
Anforderung bereitgestellt.
Zur Einzeltierdiagnostik wird 3 bis 5 ml venöses Vollblut möglichst steril
entnommen. Das Serum bzw. Blutplasma wird auf das Vorhandensein von
Antikörpern gegen BLV untersucht.
EDTA-Blut wird zur Untersuchung BLV-spezifischer proviraler DNA in den
Lymphozyten verwendet. Der Transport der Blutproben zur
Untersuchungseinrichtung erfolgt vorzugsweise per Kurierdienst. Das Serum sollte
frühestens einen Tag nach der Blutentnahme zur Untersuchung verwendet werden.
Stark hämolytische oder offensichtlich veränderte Seren sind zur Untersuchung
ungeeignet. Im Kühlschrank können Serumproben ca. eine Woche, bei mindestens -
20 °C mehrere Monate aufbewahrt werden.

Einzelmilch, Poolmilch, Sammelmilch (Tankmilch, Kannenmilch)


Zur Untersuchung ist die weitgehend fettfreie, flüssige Sekretfraktion des
Einzelgemelkes zu verwenden.
Bis zu 50 Einzelgemelke können zu gleichen Teilen zusammengeführt werden
(Poolmilch). Aus Milchtanks oder Milchkannen können Sammelgemelke entnommen
werden. Hierfür dürfen in der Probe nicht mehr als 50 Gemelke laktierender
Milchkühe enthalten sein. Die Milchproben können mit oder ohne
Konservierungsmittel versetzt untersucht werden. Die Proben sind vor der
Untersuchung zum Zwecke der Aufrahmung kühl zu lagern. Nicht genügend
aufgerahmte Proben sind 20 min bei 2000 g zu zentrifugieren. Anschließend wird die
Rahmschicht durch Absaugen oder Dekantieren entfernt oder mit der Pipettenspitze
durchstoßen.

Untersuchungsmenge: 1 bis 2 ml Milch

Verunreinigte oder zersetzte Proben sind zur Untersuchung ungeeignet.


Unkonserviert sind die Proben bei Kühlschranktemperatur bis zu fünf Tagen zur
Untersuchung verwendbar. Eine längere Lagerfähigkeit ist bei mindestens -20 °C
gegeben.

Präkolostrum, Erstkolostrum
Im geburtsnahen Zeitraum kann im Blutserum der Antikörperspiegel unter die
verfahrensbedingte Nachweisgrenze des Agargel-Immundiffusionstests (AGIDT)
sinken. Im Stadium der Hochträchtigkeit erfolgt ein zunehmender Transfer von
Antikörpern in das Eutersekret. Vier Wochen ante partum (Präkolostrum) bis zum
ersten Gemelk post partum (Erstkolostrum) ist der BLV-Antikörperspiegel im
Eutersekret bis zu fünfmal höher als im Blutserum. Zur Abklärung des
Leukoseverdachtes, bei Handelsuntersuchungen und während der Quarantäne von
hochträchtigen Einzeltieren oder Frischabkalbern ist diese Besonderheit bei der
diagnostischen Untersuchung mit dem AGIDT zu beachten.

FLI 202
Amtliche Methodensammlung Stand: Mai 2013

21.3. Untersuchungsgang
Dem indirekten Nachweis der Infektion durch die Bestimmung spezifischer Antikörper
kommt eine zentrale Bedeutung zu. Die direkten Nachweisverfahren werden bei
besonderen Fragestellungen am Nationalen und OIE-Referenzlabor für EBL am
Friedrich-Loeffler-Institut bei serologisch zweifelhaften Befunden eingesetzt.

21.3.1. Direkter Virusnachweis


Nachweis des BLV-Provirus durch PCR
Bei infizierten Rindern ist das BLV in seiner proviralen Form in die DNA der
Wirtszelle integriert und kann mit Hilfe der Polymerase-Kettenreaktion (PCR)
nachgewiesen werden. Die Methodik wird kontinuierlich weiterentwickelt. Eine
Etablierung als diagnostische Methode zum Nachweis der BLV-Infektion wird
international empfohlen (siehe "OIE-Manual of Diagnostic Tests and Vaccines for
Terrestrial Animals", 2008).

Die Dauer der Untersuchung beträgt ca. 24 bis 36 Stunden.

Andere Verfahren zum direkten Erregernachweis


Der direkte Erregernachweis (BLV) kann erfolgen durch:
• Elektronenmikroskopie
• Virusisolierung mit Nachweis synzytienbildender Eigenschaften des BLV
• kompetitiven Radioimmunoassay (cRIA)
• Tierversuch

Von praktischer Bedeutung ist die


• in vitro-Kultivierung von Lymphozyten mit anschließender Erregerisolierung
und -charakterisierung.

Diese Methoden werden ausschließlich im Rahmen der experimentellen


Leukoseforschung angewendet (Nationales Referenzlabor für ERL am FLI).

21.3.2. Indirekter Erregernachweis (Antikörpernachweis)


Antikörper können im Serum, Plasma und/oder in der Milch bei infizierten Rindern mit
Hilfe kommerziell erhältlicher und zugelassener Testsysteme nachgewiesen werden.
Die Diagnose erfolgt in staatlichen Untersuchungseinrichtungen.
Die Liste der nach § 17c TierSG zugelassenen Mittel bzw. freigegebenen Chargen
ist bei der Zulassungsstelle des Friedrich-Loeffler-Instituts einzusehen
(http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_Mittel.pdf).
Der einheitlichen Diagnostik liegen die Rinder-Leukose-Verordnung vom 02.04.1980
in der aktuellen Fassung sowie die Zuständigkeitsregelungen der Bundesländer
zugrunde. Gemäß Ausführungshinweisen zur Leukose-VO-Rinder werden folgende
Testsysteme, deren Antigen gegen ein Standardserum geprüft sein muss, zum
Antikörpernachweis gegen BLV eingesetzt:

Diagnostischer Standard:
• amtliches OIE-Referenzserum E05, geliefert vom NRL des FLI.
• Nationale Referenzseren und Milch, geliefert vom NRL des FLI.

FLI 203
Amtliche Methodensammlung Stand: Mai 2013

Enzyme-linked Immunosorbent Assay (ELISA) zum Nachweis von Antikörpern


gegen BLV in Blutserum und Milch, in Einzel- und Sammelproben gemäß Richtlinie
88/406/EWG des Rates zur Änderung der Richtlinie 64/432/EWG vom 14.06.1988.
Die Empfindlichkeit des ELISA muss so hoch sein, dass das OIE-Referenzserum
(E05) positiv reagiert, wenn es zehnmal (Blutserum) bzw. 250-mal (Milchproben)
mehr verdünnt wird als die Lösung, die Einzelproben ergeben, wenn diese in Pools
zusammengefasst werden.
Die Sensitivität des ELISA ist ca. 100-mal höher als die des IDT.
Eine Befundmitteilung ist innerhalb von 24 Stunden möglich.

Die Bewertung der Untersuchungsbefunde bei Milchuntersuchungen ergibt sich aus


dem jeweiligen Einsatz einer Positivkontrolle auf der Grundlage des diagnostischen
Standards. Die Einsatzverdünnung für den positiven Serumstandard E05 in negativer
Milch als Bezugsreferenz für Milchproben beträgt: 1: (250 x n x 2)

Somit ergeben sich folgende Einsatzverdünnungen:


• E05/50.000 bzw. E05/100.000 für Tankmilch aus Beständen mit einer
Obergrenze von 100 Milchkühen (bzw. 200 nach Konzentrierung der Milch),
• E05/25.000 für Tankmilch aus Beständen mit max. 50 laktierenden Kühen,
• E05/12.500 für Tankmilch aus Beständen mit max. 25 laktierenden Kühen
oder für Laborpools aus 50 Einzelmilchproben,
• E05/5.000 für Laborpools aus 20 Einzelmilchproben,
• E05/2.500 für Laborpools aus 10 Einzelmilchproben,
• E05/250 für eine Einzelmilchprobe.

Die Durchführung der Tests erfolgt nach den Gebrauchsinformationen der Hersteller.

Agargel-Immundiffusionstest (AGID) zum Nachweis von Antikörpern im Blutserum


bei Einzeltieren. Die Dauer der Untersuchung beträgt 4 Tage. Diese
Untersuchungsmethode ist auch zur Untersuchung von Prä- und/oder Erstkolostrum
bei Einzeltieren geeignet.

FLI 204
Amtliche Methodensammlung Stand: Mai 2013

22. Epizootische Hämatopoetische Nekrose (EHN)

22.1. Charakterisierung der Infektion


22.1.1. Erreger
Die Epizootische Hämatopoetische Nekrose (EHN) wird durch das Virus der
Epizootischen Hämatopoetischen Nekrose (EHNV) verursacht.

Bislang wurde dieser Erreger in Deutschland nicht nachgewiesen. Das EHNV wurde
erstmals 1984 in Victoria (Australien) von juvenilen Flussbarschen (Perca fluviatilis)
nach akuten Verlusten isoliert (Langdon et al., 1986). Als weitere empfängliche
Fischspezies erwiesen sich in Aquakultur gehaltene Regenbogenforellen
(Oncorrhynchus mykiss) mit vergleichbaren pathologischen Symptomen, jedoch nicht
vergleichbaren Mortalitätsraten. Experimentell lassen sich der Marquarie-Buntbarsch
(Macquaria australasica), der Mosquitofisch (Gambusia affinis), der Silberbarsch
(Bidyanus bidyanus), der Galaxias (Galaxias olidus), Murraydorsch (Maccullochella
peelii peelii) und der Atlantische Lachs (Salmo salar) infizieren (Langdon 1989).

Das EHNV ist verwandt mit Krankheitserregern der Kröten und Frösche und wird
dem Genus Ranavirus der Familie Iridoviridae zugeordnet. Infektionen mit dem nah
verwandten European Sheatfish Virus (ESV, Welsiridovirus) wurden beim
Europäischen Wels (Silurus glanis) beschrieben. Das European Catfish Virus (ECV),
welches nicht vom ESV unterschieden werden kann, infiziert den Amerikanischen
Katzenwels (Ictalurus melas), den Channel Catfish (Ictalurus punctatus), den
Goldfisch (Carassius auratus) und den Kurzflossen-Aal (Anguilla australis). ESV und
ECV führten in Deutschland bzw. Frankreich und Italien zu Verlusten in der
Aquakultur. Systemische Infektionen mit nicht näher untersuchten Iridoviren wurden
beim Steinbutt (Scophthalmus maximus) beschrieben.

EHN wurde bislang nicht in Europa nachgewiesen und ist seit 2006 EHNV als
exotischer Tierseuchenerreger in der EU gelistet und damit anzeigepflichtig (Directive
2006/88/EC Part II Annex IV; OIE Diagnostic Manual EHN Chapter 2.3.1.; Diagnostic
manual for EHN, CRL For Fish Diseases).

22.1.2. Klinische Symptomatik


Empfänglich sind Regenbogenforellen und Flussbarsche aller Altersklassen.
Das klinische Bild der EHN ist unspezifisch und eher bei juvenilen Fischen stärker
ausgeprägt. Bei Flussbarschen (Perca fluviatilis), offenbar dem Hauptwirt in
Australien, äußert sich die Infektion durch plötzliche Todesfälle ohne jegliche äußere
und innere Anzeichen.
Symptome können Dunkelfärbung der Haut, Inappetenz, Ataxie, Lethargie,
Blutungen an den Flossenrändern, Geschwürbildung, Rötung und/oder Ablösung der
Haut sein.
Betroffene Organe und Gewebe sind Leber, Kopfniere, Milz und andere
parenchymale Gewebe. Der Erreger wurde bislang nicht aus Ovarialgewebe oder
Brut isoliert.

FLI 205
Amtliche Methodensammlung Stand: Mai 2013

Die Inkubationszeit ist abhängig vom Alter der Fische, von der Wassertemperatur,
von der Infektionsdosis und von der Virulenz des Erregers und beträgt in der Regel 3
bis 32 Tage. Bei experimentell infizierten Regenbogenforellen betrug die
Inkubationszeit 3 bis 10 Tage bei 19 bis 21 °C bzw. 14 bis 32 Tage bei 8-10 °C
Wassertemperatur. In Flussbarschen wurden Todesfälle nach 10 bis 11 Tagen bei 19
bis 21 °C und nach 10 bis 28 Tagen bei 12 bis 18 °C beobachtet.

22.1.3. Diagnostische Kriterien


Ein Verdacht auf EHN besteht, wenn in scheinbar gesunden, moribunden oder toten
im parenchymalen Gewebe histologisch der Nachweis von fokalen, multifokalen oder
lokal extensiv verflüssigter oder koagulierender Nekrose mit oder ohne
intracytoplasmatischen basophilen Einschlusskörpern erfolgte.
Als diagnostische Verfahren werden derzeit die Virusisolierung in Zellkultur,
immunologische Verfahren zum Antigen-Nachweis (Immunhistochemie,
Immunofluoreszenz), serologische Methoden (ELISA) oder der Genomnachweis
(PCR) empfohlen. Vorgaben zur Diagnose von EHNV und Ranaviren der Amphibien
sind im Manual of Diagnostic Tests for Aquatic Animals des OIE sowie im Diagnostic
Manual for EHN des CRL for Fish Diseases aufgelistet.
Mit Ausnahme der Grouper Iridoviren besitzen Ranaviren gruppenspezifische
Antigene. Somit ist eine eindeutige Differenzierung der Ranaviren, d.h., eine
Identifizierung des EHNV, ausschließlich basierend auf ihrem Antigenprofil, nicht
möglich.

Verschiedene diagnostische PCR wurden zur Identifizierung von EHNV entwickelt.


Diese basieren auf der Analyse von Genabschnitten, kodierend für das MCP, die
Thymidinkinase, die virale DNA Polymerase oder das Neurofilament triplet H1-like
Protein (NF-H1). Insgesamt sind die Unterschiede zwischen den spezifischen
genomischen Regionen der Ranaviren gering.
Das MCP Gen ist hoch konserviert, und durch seine Stabilität besonders zur
genetischen Differenzierung der Ranaviren geeignet (Hyatt et al., 2000). Es weist
eine Länge von 1392 bp auf und kodiert für ein ca. 49 kDa Protein. Partielle und
vollständige MCP Gensequenzen von Ranaviren sind bereits in der Genbank
verfügbar.

22.1.4. Zuständige Untersuchungseinrichtungen


Die Untersuchungen zum Nachweis des EHNV werden im Nationalen
Referenzlaboratorium für EHN am Friedrich-Loeffler-Institut auf der Insel Riems
durchgeführt. Bei Verdacht auf Vorliegen der EHN ist das NRL zu verständigen und
es sind Proben, wie im Teil „Untersuchungsmaterial“ ausgeführt, zu entnehmen und
einzusenden.

22.1.5. Rechtsgrundlagen
• Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und
zur Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU
Nr. L 328 S. 14)

FLI 206
Amtliche Methodensammlung Stand: Mai 2013

• Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über


anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

22.2. Untersuchungsmaterial
22.2.1. Wahl und Entnahme der Proben
Für die Untersuchung gemäß Entscheidung 2001/183/EG werden die Organe: Leber,
Kopfniere, Milz, Herz und Kiemen entnommen.

Der Transport des Materials erfolgt in Biosicherheitscontainern der Klasse II.

Die Probennahme erfolgt entsprechend der Größe der Fische:


Fische > 60 mm: 0.1 g Leber, Kopfniere, Milz und andere betroffene Organe
Fische 30-60 mm: alle inneren Organe
Fische < 30 mm: ganze Fische ohne Kopf und Schwanz

Der Effekt von Poolproben verschiedener Fische auf die Sensitivität der
diagnostischen Tests ist noch nicht evaluiert. Es wird eine Poolgröße von max. 5 bis
10 Fischen je Test empfohlen.

22.2.2. Aufbereitung und Einsendung der Proben


Unter sterilen Kautelen entnommene Organe (Milz, Kopf- bzw. Vorderniere, Herz
oder Gehirn) sind in ein steriles Kunststoffröhrchen zu füllen, das steriles
Transportmedium (Zellzuchtmedium für Fischzelllinien mit 10 % Kälberserum und
Antibiotika, z. B. 200 I.E. Penicillin, 200 μg Streptomycin und 200 μg Kanamycin oder
50 μg Enrofloxacin pro ml) enthält.
Die Röhrchen sind in Isolationsbehälter (z. B. dickwandige Styroporkästen mit Eis
oder Kühlelementen) zu packen Es ist zu gewährleisten, dass die Proben beim
Transport zum Labor bei einer Temperatur von 0 bis 5 °C gehalten werden. Ein
Anfrieren ist zu vermeiden. Während des Transportes darf die Temperatur zu keiner
Zeit mehr als 10 °C betragen. Bei der Ankunft sollten im Transportbehälter noch Eis
oder gefrorene Kühlelemente vorhanden sein.

Fische können unzerteilt (ganz) zum Labor gesandt werden, sofern die
Temperaturanforderungen während der Beförderung erfüllt sind. Ganze Fische
müssen, unter Umständen mit saugfähigem Papier umhüllt und auslaufsicher
verpackt werden.
Verpackung und Beschriftung müssen den nationalen und internationalen
Transportregeln entsprechen.

22.2.3. Entnahme von zusätzlichem Probenmaterial


Im Einvernehmen mit dem Diagnoselaboratorium kann weiteres Probenmaterial
entnommen und für weitere Untersuchungen aufbereitet werden.

FLI 207
Amtliche Methodensammlung Stand: Mai 2013

22.3. Untersuchungsgang
22.3.1. Labordiagnostischer Nachweis
Der eindeutige Nachweis von EHNV mit serologischen Methoden
(Immunoperocxidase-Test, ELISA, Immunofluoreszenz-Test) ist nicht möglich, da
Ranaviren gruppenspezifische Antigene besitzen.

Deshalb erfolgen der eindeutige Nachweis und die Bestätigung des Verdachtes
durch:
1. Anzucht des Erregers in der Zellkultur nach Ausprägung eines
cytopathogenen Effektes mit anschließendem Nachweis des Erregergenoms
in der PCR
2. Nachweis des Genoms in der PCR mit anschließendem Restriktion-
Endonuklease-Verdau oder Sequenzierung und Identifizierung des PCR
Produktes

Mit der diagnostischen Untersuchung ist so schnell wie möglich zu beginnen,


spätestens jedoch 48 Stunden, in Ausnahmefällen 72 Stunden nach der Entnahme,
sofern das Untersuchungsmaterial durch das Transportmedium geschützt war und
die Temperaturanforderungen während der Beförderung erfüllt wurden.

Dauert der Transport länger als 48 Stunden, müssen die Proben gefroren (weniger
als -10 °C) transportiert werden. Dabei darf die Kühlkette bis zum Eintreffen im Labor
nicht unterbrochen werden. Ist in Ausnahmefällen eine virologische Untersuchung
des Probenmaterials innerhalb von 48 Stunden nach Probennahme nicht möglich
(z.B.: ungünstige Witterungsverhältnisse, Feiertage etc.) so kann das Material im
Transportmedium (Zellkulturmedium mit 10 % Kälberserum und Antibiotika) bei –
20 °C und kälter eingefroren werden. Die virologische Untersuchung sollte dann
innerhalb von 14 Tagen erfolgen.

22.3.2. Aufarbeitung der Organproben


Das Probenmaterial wird unabhängig voneinander aufgearbeitet. Nach jeder Probe
werden Arbeitsplatz und Zubehör desinfiziert. Die Untersuchungen werden unter
sterilen Bedingungen durchgeführt.

Das Gewebematerial wird unter Verwendung von Stomacher, Mixer, Mörser,


Mikrohomogenisator o.ä. homogenisiert und in Medium suspendiert. 300 mg des
homogenisierten Organmaterials werden mit 1 ml Enrofloxacin haltigem
Zellkulturmedium (0.01 % Endkonzentration) gründlich mit dem Vortexer vermischt
und über Nacht bei 10 °C im Intervallschüttler (Intervall von 5 min 30 sec schütteln)
inkubiert. Nach Zentrifugation des Materials für 5 min bei 3.500 rpm werden
Fischzellen mit dem geklärten Überstand inokuliert.

22.3.3. Virusanzucht in der Zellkultur


Die Virusvermehrung erfolgt auf der Zelllinie EPC CCLV Rie 173 bei 20 °C. Eine
Anzucht auf BF-2 (ATCC CCL 91), FHM (ATCC CCL 42) oder CHSE-214 (ATCC
CRL 1681) ist ebenfalls möglich.

FLI 208
Amtliche Methodensammlung Stand: Mai 2013

Vom Organmaterial wird je Probe oder Pool eine 1:10 und 1:100 Verdünnung unter
Verwendung von Zellkulturmedium angelegt. Jede Zellkultur wird mit 100 µl der
entsprechend verdünnten Probe pro ml Kulturmedium inokuliert. Dies entspricht einer
Endverdünnung von 1:100 bzw. 1:1000. Ein separater Adsorptionsschritt ist nicht
erforderlich.

Jede Verdünnung wird auf mindestens zwei Zelllinien in einem 24-well Kulturgefäß
oder größer inokuliert.
Alternativ können zwei bis drei Zellkulturen direkt mit 10 µl des homogenisierten
Probenmaterials je ml Zellkulturmedium inokuliert werden.

Die Virusvermehrung erfolgt bei 20 °C für 7 bis 10 Tage.


Die inokulierte Zellkultur wird regelmäßig (mind. 3x wöchentlich) auf die Ausbildung
eines CPE kontrolliert.

Nach Ausbildung eines CPE so erfolgt anschließend der Nachweis des


Erregergenoms in der PCR.

Bei Ausbleiben eines CPE nach Primärinkubation von 7 bis 10 Tagen erfolgt die
Subkultivierung auf frischen Zellkulturen. Homologe Zellkulturen werden mit
unverdünntem bzw. 1:10 verdünntem Material der ersten Passage inokuliert.
Empfohlen werden Zellkulturgefäße von mind. 24 well Format.

Wird nach mindestens zwei Zellkulturpassagen mit jeweils 7 bis 10 Inkubation bei
20 °C kein CPE beobachtet, ist die Probe als negativ zu deklarieren.

22.3.4. Virus-Genomnachweis
Aus der virushaltigen Suspension (Zellkulturüberstand bzw. geklärter
Organüberstand) wird die DNA bevorzugt unter Verwendung des QIAamp DNA Kit
(Qiagen) bzw. einer vergleichbaren standardisierten Methode nach Vorschrift des
Herstellers isoliert (Protokoll: siehe Isolierung viraler DNA).

Virales Genom wird in der PCR nach Amplifizierung von MCP-Genabschnitten


(hochkonservierter Bereich der Iridoviren) nachgewiesen. Dazu wird die DNA mit
EHNV MCP-Gen spezifischen Primern, dem PCR Reaktionspuffer einschließlich
dNTP’s und Magnesiumchlorid sowie der thermostabilen DNA Polymerase versetzt.
Bevorzugt werden folgende kommerziell erhältlichen Kits: HotStar Taq Master Mix
Kit, HotStar HiFidelity PCR Kit, Taq PCR Kit von Qiagen. Die Amplifizierung erfolgt
nach Angaben des Herstellers.

Zur Amplifizierung werden die spezifischen Primer Rana MCP for und Rana MCP rev
empfohlen. Das resultierende Produkt weist eine Länge von 516 bp auf.

Das reguläre PCR Programm besteht aus einem Denaturierungsschritt, einem


Annealingsschritt und einem Elongationsschritt und 40 Zyklen. Je nach Hersteller ist
u.U. ein initialer Inkubationsschritt für 15 min bei 95 °C erforderlich. Die
Annealingtemperatur ist von der Schmelztemperatur der verwendeten Primer
abhängig (Tm = 4 (G bzw. C + 2 (A bzw. T). Die Elongationszeit ist an die Länge des
zu erwartenden Produktes angepasst (30 sec < 1 kb bzw. 3 min > 1 kb) (Protokoll:
siehe Polymerase-Ketten-Reaktion).

FLI 209
Amtliche Methodensammlung Stand: Mai 2013

Zur Identifizierung von EHNV und Differenzierung dieses Erregers von anderen
Ranaviren z.B. FV3, ESV, ECV wird das Amplifikat der Rana MCP PCR (= 516 bp)
mit der Restriktionsendonuklease Sal I verdaut. Ein EHNV spezifisches Rana MCP
PCR Produkt wird nach Sal I Verdau in Fragmente von 365 und 151 bp Größe
gespalten. Das Ergebnis unterscheidet sich eindeutig vom entsprechenden
Restriktionsmuster für ECV, ESV und FV3.

Virus Sal I
EHNV 365/ 151
ESV 516
ECV 516
FV 3 516
SERV 332/ 184

(Protokoll: siehe Restriktionsendonuklease-Test)

Wird kein Restriktionsendonuklease Verdau durchgeführt, sollte das PCR Produkt


direkt sequenziert und mit publizierten Daten verglichen werden.

Protokoll: Isolierung viraler DNA

Isolierung viraler DNA aus Zellkulturüberstand mit QIAamp DNA Kit (Qiagen)

Je nach Ausprägung des CPE werden 30 µl bis 300 µl Zellkulturüberstand unter


sterilen Bedingungen in ein 1.5 ml Reaktionsgefäß überführt und für 2 Minuten bei
2.500 UpM zentrifugiert.
20 µl bis max. 200 µl des geklärten Überstandes werden für die DNA Isolierung in
ein neues Reaktionsgefäß überführt und mit PBS auf insgesamt 200 µl aufgefüllt.
Es erfolgt die Zugabe von 20 µl Proteinase K (Proteinase K solution 600 mAU / ml,
Qiagen) und von 4 µl RNAse A (100 mg / ml, Qiagen). Nach gründlicher
Durchmischung mit anschließender Inkubation von 1 Minute folgt die Zugabe von
200 µl Puffer AL.
Zur Homogenisierung und vollständigen Lyse wird die Suspension 15 sec im Intervall
mit dem Vortexer gemischt und anschließend für 10 min bei 56 °C inkubiert.
Nach Zugabe von 230 µl 96-98 % Ethanol wird der Reaktionsansatz mit dem
Vortexer gemischt, auf die Säule (QIAamp Spin Column) verbracht und für 1min bei
8.000 UpM zentrifugiert.
Wichtig ist, dass nach jedem folgendem Zentrifugationsschritt der Säulendurchfluss
verworfen und die Säule in ein sauberes DNAse freien Reaktionsgefäß verbracht
wird.
Die auf der Säule gebundene DNA wird mit 500 µl Puffer AW1 versetzt und 1min bei
8.000 UpM und mit 500 µl Puffer AW2 für 3 min bei 14.000 UpM gewaschen.
Auf der Säule verbliebene Flüssigkeitsreste werden durch eine Zentrifugationsschritt
von 1 min bei 14.000 UpM entfernt.
Die Elution der DNA erfolgt mit 60 µl Puffer AE nach 5 min Inkubation bei
Raumtemperatur und anschließender Zentrifugation für 1 min bei 8.000 UpM.
Die Lagerung der DNA ist bei - 20 °C möglich.

FLI 210
Amtliche Methodensammlung Stand: Mai 2013

FLI 211
Amtliche Methodensammlung Stand: Mai 2013

Isolierung viraler DNA aus Organmaterial (Qiagen, QIAamp DNA Mini Kit, Tissue
Protokoll)

Zur Gewinnung viraler DNA aus Organen (Herz, Kopfniere, Leber, Milz, Kiemen)
werden diese mittels steriler chirurgischer Instrumente entnommen und mit Hilfe
steriler Scheren fein zerkleinert. Entsprechend den Herstellerangaben werden 25 mg
des homogenisierten Materials unter Verwendung des QIAamp DNA Mini Kits
(Qiagen) weiterverarbeitet. Zur Vermeidung im Gefäßdeckel verbliebener Tropfen ist
vor jedem erneuten Öffnen des Gefäßes ein kurzer Zentrifugationsschritt einzuhalten,
um die Kontaminationsgefahr zu minimieren. Die Extraktion der viralen DNA erfolgt
nach dem DNA Mini Kit Tissue Protokoll (Qiagen).

Zunächst erfolgt die Zugabe von 180 µl Puffer ATL sowie 20 µl Proteinase K
(Proteinase K solution 600 mAU / ml, Qiagen). Zur gründlichen Durchmischung wird
die Suspension mit Hilfe des Vortexers 15 s gemischt. Es folgt eine Inkubationsphase
bei 56 °C bis zur vollständigen Lyse des Organmaterials. Die Lyse wird durch
regelmäßiges Vortexen der Suspension unterstützt. Enthaltene RNA wird durch
Zugabe von 4 µl RNAse A (100 mg / ml, Qiagen) mit anschließender Inkubation bei
Raumtemperatur für 2 min minimiert. Nach Zugabe von 200 µl Lysispuffer AL wird
die Suspension erneut mit Hilfe des Vortexers gründlich durchmischt und
anschließend bei 70°C für 10 min inkubiert. Durch Zugabe von 200 µl 99,8 % Ethanol
wird die DNA präzipitiert. Nach gründlicher Durchmischung mittels Vortexer wird der
Reaktionsansatz auf die Säule (QIAamp Spin Column) gegeben. Durch
Zentrifugation bei 8000 UpM für 1 min wird die präzipitierte DNA auf der Säule
adsorbiert. Nach Zugabe von 500 µl Waschpuffer AW1 wird die DNA durch
Zentrifugation bei 8000 UpM für 1 min gewaschen. Es folgt ein zweiter Waschschritt
durch Zugabe von 500 µl Waschpuffer AW2 und anschließender Zentrifugation bei
14.000 UpM für 3 min. Zur Entfernung enthaltener Alkoholreste wird ein zusätzlicher
Zentrifugationsschritt bei 14.000 UpM für 1 min durchgeführt. Durch Zugabe von 60
µl Elutionspuffer AE, Inkubation bei Raumtemperatur für 1 min und Zentrifugation der
Probe bei 8000 UpM für 1 min wird die DNA von der Säule eluiert. Die DNA wird bei -
20 °C gelagert.

Isolierung viraler DNA aus Organüberstand (Qiagen, QIAamp DNA Mini Kit)

Zur Extraktion viraler DNA aus Organüberstand werden zunächst die


entsprechenden Organe (Herz, Kopfniere, Leber, Milz, Kiemen) steril entnommen
und mittels steriler Scheren fein zerkleinert. 300 mg des homogenisierten
Organmaterials werden in 1 ml Zellkulturmedium (ZB23) mit einem effektiven
Enrofloxacingehalt von 0.01 % aufgenommen und mittels Vortexer gründlich
durchmischt und anschließend über Nacht bei 10 °C im Intervallschüttler mit 30-
sekündigem Schütteln im Intervall von fünf Minuten inkubiert. Nach Zentrifugation der
Probe bei 3500 UpM für 5 min werden 200 µl des Überstandes für die DNA
Extraktion entnommen.

Es wird empfohlen, die Extraktion mit Hilfe des QIAamp DNA Mini Kits (Qiagen) nach
Herstellerangaben durchzuführen.

Nach Zugabe von 20 µl Proteinase K (Proteinase K solution 600 mAU / ml, Qiagen)
und 4 µl RNAse A (100 mg / ml, Qiagen) erfolgt eine gründliche Durchmischung

FLI 212
Amtliche Methodensammlung Stand: Mai 2013

mittels Vortexer und anschließender Inkubation bei Raumtemperatur für 1 min. Zur
Homogenisierung und vollständigen Lyse wird die Suspension nach Zugabe von 200
µl Lysispuffer AL für 15 s mit Hilfe des Vortexers gemischt und anschließend für 10
min bei 56 °C inkubiert. Nach Zugabe von 230 µl 99,8 % Ethanols wird die DNA
präzipitiert. Nach gründlicher Durchmischung mittels Vortexer wird die gesamte
Probe auf die Säule (QIAamp Spin Column) gegeben. Nach Zentrifugation bei 8000
UpM für 1 min wird der Durchfluss verworfen und die Säule in ein neues Tube
überführt. Die auf der Säule adsorbierte DNA wird mit 500 µl Puffer AW1 bei 8000
UpM für 1 min und mit 500 µl Puffer AW2 bei 14.000 UpM für 3 min gewaschen. Zur
Entfernung von Alkoholrückständen der Waschpuffer wird ein zusätzlicher
Zentrifugationsschritt bei 14.000 UpM für 1 min durchgeführt. Durch die Zugabe von
60 µl Elutionspuffer AE und einer Inkubationszeit von 5 min bei Raumtemperatur und
einen letzten Zentrifugationsschritt bei 8000 UpM für 1 min wird die DNA von der
Säule eluiert. Die DNA wird bei -20 °C gelagert.

Protokoll: Polymerase-Ketten-Reaktion (PCR)

Die Amplifizierung von DNA-Fragmenten erfolgt unter Verwendung des HotStarTaq


Master Mix Kits (Qiagen) oder eine vergleichbaren standardisierten Methode nach
Vorschrift des Herstellers. Folgende kommerziell erhältlichen Kits sind ebenfalls
geeignet: HotStar HiFidelity PCR Kit, Taq PCR Kit von Qiagen. Das verwendete
Protokoll wurde gemäß den Angaben des HotStarTaq PCR Handbuchs etabliert.

In einem 25 µl Ansatz werden 12.5 µl HotStarTaq Master Mix, 9.5 µl steriles Wasser
und jeweils 0.5 µl der spezifischen Primer (10 pmol/ µl), sowie 2 µl der
entsprechenden DNA gemischt.

Genfragmenten mit einer Größe von weniger als 1000 bp werden nach einem
initiativen Aktivierungsschritt bei 95 °C für 15 min in 40 Zyklen (Denaturierung bei 93
°C für 1 min, Annealing bei 55 °C für 2 min und Extension bei 72 °C für 0,5 min)
amplifiziert.

Genfragmente mit einer Größe von mehr als 1000 bp wird die Extension bei 72 °C
auf 3 min verlängert.

Empfohlen werden die Primer Rana MCP for und Rana MCP rev. Das amplifizierte
Produkt hat eine Größe von 516 bp.

Positiv- und Negativkontrollen sind in allen Schritten mitzuführen.

Empfohlen werden als Positivkontrolle EHNV und als Negativkontrolle ESV bzw.
ECV und eine DNA negative Probe.

PCR: HotStar Taq Master Mix Kit (Qiagen)


25 µl Ansatz: X µl Wasser
12.5 µl HotStar Taq Master Mix
0.5 µl Primer 1 (10 pmol/ µl)
0.5 µl Primer 1 (10 pmol/ µl)
Y µl DNA (i.d.R. 2 µl; < 1 µg Gesamt-DNA)

FLI 213
Amtliche Methodensammlung Stand: Mai 2013

FLI 214
Amtliche Methodensammlung Stand: Mai 2013

PCR: HotStar HiFidelity PCR Kit (Qiagen)


25 µl Ansatz: X µl Wasser
5.0 µl 5 x HotStar HiFidelity PCR Puffer
0.5 µl Primer 1 (10 pmol/ µl)
0.5 µl Primer 1 (10 pmol/ µl)
1.0 µl HotStar HiFidelity DNA Polymerase (2.5 units/ µl)
Y µl DNA (i.d.R. 2 µl; < 1 µg Gesamt-DNA)

PCR: Taq PCR Kit (Qiagen)


50 µl Ansatz: X µl Wasser
5.0 µl 10 x PCR Puffer
2.0 µl dNTP mix (each 10mM)
1.0 µl Primer 1 (10 pmol/ µl)
1.0 µl Primer 1 (10 pmol/ µl)
0.5 µl Taq DNA Polymerase (5 units/ µl)
Y µl DNA (i.d.R. 2 µl; < 1 µg Gesamt-DNA)

Amplifizierung: 1. Initiation 95 °C 15 min


2. Denaturierung 93 °C 1 min
3. Annealing 55 °C 2 min
4. Extension 72 °C 30 sec (< 1 kb)/ 3 min (> 1 kb)
5. Wiederholung 2.-4. 40x
6. Ende Hold 20 °C

Primer:
PCR PCR-Primer PCR-Produkt (bp)
RANA-MCP Rana MCP for + 516
rev
MCP MCP 1 + MCP 6R 1.392
MCP 1 MCP 1 + MCP 2R 543
MCP 2 MCP 3 + MCP 4R 530
MCP 3 MCP 5 + MCP 6R 585

Rana MCP for 5’ CCA GTC CAC ATG GTC AAC CC 3’


Rana MCP rev 5’ GAT AAT GTT GTG GTT GAT GGC C 3’
MCP 1 5’ CAG CGT GTA TCT TAT AAT AAA AAG AAA TG 3’
MCP 2R 5’ GGC TCC GTC CTG GCC TGT G 3’
MCP 3 5’ GAG GCC AAG CGC ACA GGC TAC 3’
MCP 4R 5’ TTG GAG CCG ACG GAA GGG TG 3’
MCP 5 5’ CGC AGT CAA GGC CTT GAT GT 3’
MCP 6R 5’ AAA GAC CCG TTT TGC AGC AAA C 3’

FLI 215
Amtliche Methodensammlung Stand: Mai 2013

Protokoll: Restriktionsendonuklease Test


In einem Gesamtansatz von 10 µl werden 2 µl der isolierten Gesamt-DNA unter
Verwendung eines geeigneten Spaltpuffers mit 1 bis 2 Einheiten der
Restriktionsendonuklease Sal I bei 37 °C für 1 bis 2 Stunden inkubiert. Nach Zugabe
von 2 µl DNA Gel Ladepuffer (50 % Glyzerin, 1mM EDTA pH 8.0) werden die
Spaltprodukte elektrophoretisch im Agarosegel aufgetrennt.

Protokoll: Agarosegel Elektrophorese


In Abhängigkeit der Größe der DNA Fragmente erfolgt die Auftrennung in 1-1.5 %
Agarosegelen in Tris-Acetat-EDTA (TAE) Puffer.

Fragmentlänge Agarosekonzentration Bromphenolblau Xylencyanol


1 -30 kb 0.5 % 1000 bp 10 kb
0.8 – 12 kb 0.7 % 700 bp 6 kb
0.5 – 7 kb 1.0 % 300 bp 3 kb
0.4 - 6 kb 1.2 % 200 bp 1.5 kb
0.2 – 3 kb 1.5 % 120 bp 1 kb
0.1 – 2 kb 2.0 % < 100 bp 0.8 kb

Literatur
Directive 2006/88/EC Part II Annex IV; OIE Diagnostic Manual EHN Chapter 2.3.1.
Diagnostic manual for EHN, CRL for Fish Diseases
Ohlemeyer et al.: Dis Aquat Org 2011, 96, 195-207

FLI 216
Amtliche Methodensammlung Stand: Mai 2013

23. Epizootische Hämorrhagie der Hirsche

23.1. Charakterisierung der Infektion


Die Krankheit wird vor allem in Weißschwanzhirschen und anderen frei lebenden
Huftieren (z. B. Antilopen) ausgelöst. Allerdings können auch Rinder an EHDV
erkranken. Die Klinischen Symptome sind dann von denen bei BTV-Infektionen nicht
zu unterscheiden. Schafe sind gar nicht oder nur ganz schwer infizierbar.
Trotz des hohen Verwandtschaftsgrades ist eine molekulargenetische und
serologische Differenzierung von BTV möglich.

23.1.1. Erreger
Das Virus der Epizootischen Hämorrhagie der Hirsche (EHDV) ist ein Vertreter des
Orbivirus Genus der Reoviridae. Acht EHDV Serotypen sind bisher durch
Neutralisationstests festgelegt worden. Überträger sind wie bei BTV Culicoides-
Insekten.

23.1.1. Klinische Symptomatik


Die Krankheit zeigt einen ähnlichen Verlauf wie Bluetongue mit dem Unterschied,
dass Antilopen und Weißschwanzhirsche die höchste Empfänglichkeit aufweisen und
die Mortalität bei diesen Tieren am höchsten ist.

23.1.2. Differentialdiagnostik
Wichtigste Differentialdiagnostik ist Bluetongue und die bei BTV angegebenen
Viruskrankheiten.

23.1.3. Diagnostische Indikation


siehe Richtlinie 92/119/EWG

23.1.4. Zuständige Untersuchungseinrichtung


Friedrich-Loeffler-Institut, Institut für Virusdiagnostik
Südufer 10, 17493 Greifswald - Insel Riems

23.1.5. Rechtsgrundlagen
Richtlinie 92/119/EWG

FLI 217
Amtliche Methodensammlung Stand: Mai 2013

23.2. Untersuchungsmaterial
Gerinnungsgehemmtes Blut von Tieren. Das EDTA-Blut sollte im gekühlten (+4 °C)
Zustand versendet werden. Lagerung über längere Zeit sollte bei -70 °C erfolgen,
weil das EHDV bei -20 °C nicht lange stabil bleibt.
Post mortem sind Milz und Lymphknoten die Organe der Wahl zur Virusisolierung,
schnellstmöglicher Versand erfolgt bei +4 °C.
Für den Antikörpernachweis können EDTA-Blut oder mindestens 500 μl
Serum/Plasma eingesendet werden.

23.3. Untersuchungsgang
23.3.1. Erregernachweis
Ein kommerzieller real-time RT-PCR Kit der Firma LSI wurde in Zusammenarbeit mit
dem Pirbright Institute (UK) validiert. Dieser Test ist geeignet um EHDV-RNA sensitiv
und spezifisch nachzuweisen, allerdings ist er in Deutschland noch nicht zugelassen.
Darüber hinaus wurden am FLI weitere EHDV-real-time RT-PCR-Verfahren etabliert

23.3.2. Antikörpernachweis
Ein kommerzieller kompetitiver ELISA Kit der Firma LSI wurde in Zusammenarbeit
mit dem Pirbright Institute (UK) validiert. Dieser Test ist geeignet um EHDV-AK
sensitiv und spezifisch nachzuweisen, allerdings ist er in Deutschland noch nicht
zugelassen.

FLI 218
Amtliche Methodensammlung Stand: Mai 2013

24. Equine Virus Arteritis

24.1. Charakterisierung der Infektion


24.1.1. Erreger
Die equine Virus Arteritis wurde erstmalig im Jahre 1953 in einem Gestüt in Bucyrus,
Ohio, USA beschrieben. Aufgrund der charakteristischen Blutgefäßentzündungen
und -veränderungen erhielt das Virus den Namen Equines Arteritisvirus (EAV). Das
behüllte, positiv orientierte Einzelstrang-RNA Virus wird zusammen mit dem
Lactatdehydrogenasevirus (LDH), dem Porcine Reproductive and Respiratory
Syndrome Virus (PRRSV) und dem Simian Haemorrhagic Fever Virus (SHFV) in das
Genus Arterivirus der Familie der Arteriviridae eingeordnet. Empfänglich für die
Infektion sind Equiden wie Pferde, Ponys, Zebras und Esel (nach experimenteller
Infektion). Der Hauptübertragungsweg ist die sexuelle Transmission. Virusreservoir
sind chronisch infizierte Hengste, die das Virus mit dem Ejakulat über lange
Zeiträume ausscheiden können.

24.1.2. Vorkommen
Die equine virale Arteritis ist mit Ausnahme von Japan und Island in global verbreitet
z. B. in Nord- und Südamerika, Europa, Russland, Australien und Nordafrika. EAV
wurde 1976 erstmals in der BRD nachgewiesen. Im Zuge der gesteigerten Mobilität
und Globalisierung von Handel mit Pferden und Sperma gewinnt die Infektion immer
stärker an Bedeutung.

24.1.3. Klinische Symptomatik


Die Erkrankung wird auch als „pink eye“, Pferdestaupe oder Rotlaufseuche
bezeichnet. Die systemische Infektion manifestiert sich nach einer Inkubationszeit
von 2-6 (2-14) Tagen als Allgemeinerkrankung mit Fieber, Depression, Ödembildung
(Gliedmaßen, Präputium) und Urtikaria. Ausgeprägte respiratorische Symptome
(Rhinitis, Pneumonie) und okuläre Erkrankung mit supra- und periorbitale Ödemen
und Konjunktivitis sowie Enteritiden (Obstipation, Kolik, Diarrhoe) können auftreten.
Bei einer Affektion des Genitaltraktes werden durch direkte Schädigung des Fetus
oder durch Veränderungen des Uterus bzw. der Plazenta Resorption, Aborte,
Frühgeburten und die Geburt lebensschwacher Fohlen beobachtet. Bei natürlichen
Infektionen können 10 bis 60% der infizierten Stuten abortieren. Aborte sind in allen
Trächtigkeitsstadien möglich, treten jedoch gehäuft in der ersten Hälfte der
Trächtigkeit auf. Die Symptome können einzeln oder in Kombination auftreten.
Schwere klinische Verläufe mit Todesfolge sind bei sehr jungen Fohlen möglich,
jedoch bei adulten Tieren ist die Mortalitätsrate niedrig und die Infektion verläuft
häufig inapparent. Bei Hengsten kommt es zu Entzündungen der Arteriolen der
Geschlechtsorgane, in deren Folge Entzündungen von Skrotum und Präputium
sowie mangelnde Spermaqualität und Deckunlust auffallen. Das Virus persistiert in
den akzessorischen Geschlechtsdrüsen und wird mit dem Sperma ausgeschieden.

Epidemiologie
Nach der initialen Vermehrung von EAV in Alveolarmakrophagen kommt es zur
Ausbreitung über den Blutkreislauf und zur Infektion von Makrophagen und

FLI 219
Amtliche Methodensammlung Stand: Mai 2013

Endothelien von Blut-und Lymphgefäßen. Durch generalisierte Nekrosen, vor allem


der kleinen Arterien, kommt es zur erhöhten Gefäßdurchlässigkeit mit Blutungen und
Ödembildung besonders an den Hintergliedmaßen und am Unterbauch. In der Folge
ist das Virus etwa 2-14 (28) Tage post infectionem (p.i.) im Körper nachweisbar, in
dieser Zeit sind alle Organe virushaltig. Nach dieser Zeit erfolgt keine
Virusausscheidung mehr außer beim geschlechtsreifen Hengst über das Ejakulat.
Die Virusausscheidung bei der akuten Infektion erfolgt in Nasen- und Augensekret,
Speichel, Kot, Sperma und Abortmaterial. Die Übertragung ist auch über
kontaminierte Vektoren möglich (Einstreu, Futtermittel, Geräte, Kleidung, Schuhe).
Durch die zeitlich versetzte horizontale Virusübertragung kann das Virus über
Monate im Bestand persistieren. Bei 30-40% der Infektionen von Hengsten entwickelt
sich ein unterschiedlich lange andauernder Carrierstatus, der in Kurzausscheidung
(2-5 Wochen), mittelfristige Ausscheidung (3-8 Monate) bis Langzeitausscheidung
über Jahre differenziert werden kann. Bei chronisch infizierten Hengsten treten keine
Fertilitätsstörungen auf. Die Virusausscheidung ist vom Testosteronspiegel abhängig,
d.h. nach chemischer oder chirurgischer Kastration sistiert die Virussekretion. Bei
Wallachen kommt es nicht zur Dauerausscheidung, bei präpubertären Hengsten nur
in seltenen Fällen.

24.1.4. Bekämpfung
Von entscheidender Wichtigkeit sind Biosicherheitsmaßnahmen wie Deck- und
Besamungshygiene mit Identifizierung und Isolierung von Carrier-Hengsten,
Quarantäneregelungen, Isolierung trächtiger Stuten, Überwachung von
Deckhengsten und Sperma. Im Falle eines Seuchenausbruchs ist ein
Verbringungsverbot bis 4 Wochen nach Auftreten der letzten klinischen Anzeichen im
Bestand indiziert. Seit 2002 sind in Deutschland inaktivierte Vakzinen zugelassen,
die eine klinische Erkrankung sowie die Dauerausscheidung beim Hengst zuverlässig
verhindern sollen. Es handelt sich dabei jedoch nicht um Marker-Vakzinen, d. h. eine
serologische Unterscheidung zwischen geimpften und feldvirus-infizierten Tieren ist
nicht möglich. Hengste sollten im präpubertären Alter vakziniert werden. Im Zuge der
Impfung sollten Quarantänemaßnahmen zur Verhinderung einer Infektion vor
Ausbildung einer schützenden Immunität ergriffen werden. Der Impfung sollte eine
zweimalige serologische Bestimmung des Infektionssstatus vorangehen, die unter
tierärztlicher Aufsicht exakt dokumentiert wird.

24.1.5. Differentialdiagnostik
Generell müssen Erreger respiratorischer Infektionen wie Equine Influenza,
Rhinopneumonitis (Herpesviren), Rhinoviren und equine Adenoviren in Betracht
gezogen werden. Equine infektiöse Anämie, Purpura hämorrhagica, Graukresse-
(Berteroa incana)-Intoxikation und Urtikaria allergischer Genese sind
auszuschließen.
Bei exotischen Infektionserregern kommen Trypanosoma equiperdum, Getah-Virus
und Afrikanische Pferdepest in Betracht.
Bei Herpesvirus-induzierten Aborten werden in der Regel keine klinischen
Erkrankungen der trächtigen Stuten beobachtet. Darüber hinaus sind EAV infizierte
Feten eher autolytisch und zeigen kaum typische grob pathologische Läsionen.

FLI 220
Amtliche Methodensammlung Stand: Mai 2013

24.1.6. Diagnostische Indikation


Untersuchung vor Impfung, Untersuchung von Zuchttieren, Untersuchung von
Deckhengsten (EU-anerkannte Besamungsstationen).

24.1.7. Zuständige Untersuchungseinrichtungen


• private Veterinäruntersuchungseinrichtungen
• staatliche Veterinäruntersuchungseinrichtungen der Länder
• Friedrich-Loeffler-Institut, Bundesforschungsinstitut für Tiergesundheit, Insel
Riems: Nationales Referenzlabor für EVA am Institut für Virusdiagnostik

24.1.8. Rechtsgrundlagen
• Die EAV-Infektion gehört zu den meldepflichtigen Erkrankungen der Einhufer
(Verordnung über meldepflichtige Tierkrankheiten in der Fassung der
Bekanntmachung vom 11. Februar 2011. (BGBl. I S. 252).
• EU-Recht: Richtlinie 92/65/EWG – es dürfen in EU-anerkannten
Besamungsstationen keine Virusausscheider aufgestallt sein. Anonym.
Richtlinie 92/65/EWG vom 13. Juli 1992 über die tierseuchenrechtlichen
Bedingungen
• für den Handel mit Tieren, Samen, Eizellen und Embryonen in der
Gemeinschaft sowie für ihre Einfuhr in die Gemeinschaft, soweit sie
diesbezüglich nicht den spezifischen Gemeinschaftsregelungen nach Anhang
A Abschnitt I der Richtlinie 90/425/EWG unterliegen
• Nationales Recht: Anonym. Verordnung über die Gewinnung, Abgabe und
Verwendung von Samen, Eizellen und Embryonen von Zuchttieren
(Samenverordnung – SamEnV –) vom 14. 10.2008

24.2. Untersuchungsmaterial
Für die serologische Untersuchung:
• Nativblutprobe, Serum

Für die virologische Untersuchung:


• gerinnungsgehemmte Blutprobe (EDTA, Citrat, nicht Heparin!)
• Nasentupfer/ Konjunktivaltupfer/ Vaginaltupfer

Entnahme früh in Fieberphase


• Sperma
• fetales Organmaterial (Lunge, Thymus, Leber, Milz, Niere), Fruchtwasser,
Eihäute
• Organmaterial (Lunge, Bronchial- und Lungenlymphknoten, Leber, Milz,
abdominale Lymphknoten)
• Urin

Rascher Transport, unbedingt gekühlt oder gefroren

FLI 221
Amtliche Methodensammlung Stand: Mai 2013

24.3. Untersuchung
Die Untersuchungen erfolgen nach dem „O.I.E. Manual of Diagnostic Tests and
Vaccines for Terrestrial Animals“ (2012, Part 2, Section 2.5, Chapter 2.5.10; Stand
2008 Seite 904-918). Weiterführende Ergänzungen können der AVID-
Methodensammlung entnommen werden (www.dvg.net).

24.3.1. Antikörpernachweis
Es existieren zwar unterschiedlich virulente Stämme, jedoch verhält sich das Virus
serologisch einheitlich. Serokonversion tritt 4-21 Tage nach der Infektion ein.
Durch den möglichen Einsatz nicht markierter Impfstoffe sowie durch die Bedeutung
der Differenzierung zwischen akutem Infektionsgeschehen und überstandener
Infektion insbesondere bei Stuten spielt der Nachweis/Ausschluss einer akuten EAV
Infektion durch die Untersuchung eines Serumpaares (21-28 Tage) eine besondere
Rolle.

24.3.1.1. Antikörpernachweis mittels Serumneutralisationstest


(vorgeschriebener Test für internationalen Handel
• Serumproben 30 Minuten bei 56° C inaktivieren,
• log2 Serumverdünnungsreihe 1:2 bis 1:256 (in Medium) herstellen
(Mikrotiterplatte), 2 Parallelwerte pro Verdünnungsstufe,
Start mit 1:2 Verdünnung; berechnet als 1:4 (Serum+Virus+Zellkultur),
• Testvirus CVL-Bucyrus (Weybridge): Virusverdünnung (100 KID 50 pro 25 µl) in
serumfreien Zellkulturmedium mit Zusatz von 10 % Meerschweinchen- oder
Kaninchenserum als Komplementquelle herstellen,
Rücktitration in log10 Verdünnungsstufen in 4 Parallelwerten,
valider Bereich 50 bis 300 KID 50 pro 25 µl,
• je 25 µl Serumverdünnung und Virusgebrauchssuspension mischen,
• Inkubation 60 Minuten bei 37°C,
• 3 bis 5 Tage alte RK13-Zellen abtrypsinieren,
Einsaat in passender Dichte, damit Monolayer 18 bis 24 h nach Aussaat dicht
sind (z. B. 1:3), 100 µl Zellsuspension pro Vertiefung der Mikrotiterplatten
ausbringen,
• Inkubation bei 37 °C und 5% CO2,
• tägliche mikroskopische Kontrolle (Serumtoxizität, Sterilität), nach ca. 3-5
Tagen mikroskopische Auswertung des Testes,
• Titerberechnung nach Spearman-Kärber: Titer ≥ 1:4 positiv
NACH O.I.E. MANUAL: positiv: 75-100% Reduktion der Infektiosität im Well
negativ: cpe <25% oder gar nicht reduziert
Bei der Untersuchung von gepaarten Serumproben gilt ein Titeranstieg von
mehr als 2 log2-Stufen (>1:4) als beweisend für den Ablauf eines akuten
Infektionsgeschehens.

Kontrollen
• Zellkultur/Verdünnungsmittel: Zellkultur mit Medium beimpfen
• Toxizität von Serumproben: 1 bis 2 Replikate der Serumproben in einer
Verdünnung von 1:2 und 1:4 mitführen;

FLI 222
Amtliche Methodensammlung Stand: Mai 2013

Bei auftretender Serumtoxizität 1 d vorher ausgesäte RK13-Kulturen beimpfen


oder vorzugsweise Präadsorption der Serumproben für mindestens 1 Stunde
an gepackte RK13 Zellen.
Vorsicht: falsch positive Reaktionen nach kurz zurückliegender EHV-Impfung
wegen Antikörpern gegen RK13-Zellen („falscher“ cpe)
• Virus: Virus-Rücktitration auf die Zellkultur verimpfen (unverdünnt und in
log10-Schritten bis 10-4; mindestens 4 Parallelwerte)
• Neutralisation: bekannt positives und bekannt negatives Serum im Test
mitführen

24.3.1.2. EAV-Antikörper-ELISA (Enzyme Linked Immunosorbent Assay)


Aktuell wurden keine kommerziellen ELISA-Tests in Deutschland zugelassen. Die
Übereinstimmungen zu den Ergebnissen im Neutralisationstest als Goldstandard
sind bislang nicht zufriedenstellend

24.3.2. Virusnachweis

24.3.2.1. Virusnachweis mittels Anzüchtung in der Zellkultur – Vorbereitung


des Untersuchungsmaterials

24.3.2.1.1. Tupferproben
• Tupferprobe in geeignetem Transportmedium (z.B. Zellkulturmedium mit FCS
und Antibiotika/Antimykotika) gekühlt transportieren;
• Transportmedium niedertourig abzentrifugieren (10 Min. bei 450 x g, 4 °C);
• Überstand abnehmen (eventuell verdünnen; eventuell sterilfiltrieren, Sterilfilter
mit 0,45 μm)

24.3.2.1.2. Stabilisiertes Blut


• mit EDTA oder Citrat stabilisiertes Blut zunächst niedertourig abzentrifugieren
(10 Minuten bei 450 x g, 4 °C), Heparin kann den Virusnachweis
beeinträchtigen.
• Leukozytenanteil großzügig entnehmen, Erythrozyten durch Zugabe von zwei
Volumen kaltem Lysispuffer (siehe ANHANG), lysieren
• nach 50 Sekunden Zugabe von einem Volumen Isopuffer (siehe ANHANG),
• Zellen abzentrifugieren (s.o.),
• Leukozytenpellet in Zellkulturmedium aufnehmen.

24.3.2.1.3. Sperma: Virusisolierung aus Sperma (vorgeschriebener Test für


internationalen Handel
EAV befindet sich im Seminalplasma; nicht im Vorejakulat (pre-sperm fraction), ist
assoziiert mit spermienreicher Fraktion.
• Nach Gewinnung Kühlen oder Einfrieren.
• Kein negativer Einfluss möglicher Antikörper im Seminalplasma evident

FLI 223
Amtliche Methodensammlung Stand: Mai 2013

Testung von Antikörper-positiven Hengsten mittels 2 Probenentnahmen;


• O.I.E. Terrestrial Manual: gleicher Tag, Folgetag oder Tage/Wochen-Intervall:
Beprobungsintervall ist egal! kein Einfluss von Absamungsintervall oder
Jahreszeit;
• Verordnung über die Gewinnung, Abgabe und Verwendung von Samen,
Eizellen und Embryonen von Zuchttieren (Samenverordnung– SamEnV –)
vom 14. 10.2008: Freitestung seropositiver Hengste ist möglich, wenn
zweimal hintereinander im Abstand von 1 Woche der Virusnachweis aus
Sperma negativ erbracht wird.

- Ultraschall (3X15sec), Spermaprobe zum Sedimentieren der Spermatozyten


niedertourig abzentrifugieren (10 Minuten bei 1800 x g, 4 °C)

Methodensammlung des AVID:


• Seminalplasma mit gleichem Volumen FKS 30 Minuten bei Raumtemperatur
inkubieren,
• zentrifugieren (s.o.),
• FKS-Behandlung und Zentrifugation wiederholen,
• Überstand (entspricht einer Verdünnung von 1:4) kann nun direkt oder noch
weiter verdünnt auf die Zellkultur gegeben werden.

O.I.E Terrestrial Manual:


1. Inokulation von konfluenten RK13-Monolayern, die 3-5 Tage alt sind, in
Sechslochplatten oder 25cm2 Flaschen
2. Medium abnehmen, 1 ml 10-1 bis 10-3 Verdünnung inokulieren (ZK Medium mit
2% FCS und Antibiotika), mindestens 2 Parallelansätze pro Verdünnung,
gleichmäßig verteilen
3. 1 h bei 37°C inkubieren
4. *Überstände nicht abnehmen, mit Medium mit 0,75% Methylcellulose (3,75g/
500ml), 2% FCS und Antibiotika überschichten
5. Inkubation bei 37°C, cpe täglich überprüfen (durchschnittlich nach 2-6 Tagen)
6. Ggf. bis zu 2 Passagen der Überstände nach 5-7 Tagen, Zellrasen mit
Kristallviolett färben
*HIER hat sich der Methylcellulose-Overlay eindeutig nicht bewährt;
Entfernung des Inokulums und Zugabe von ZK-Medium ist für die Zellvitabilität
essentiell.

Zytotoxizität des Spermas: besonders 10-1 Verdünnung, selten bei 10-2


Behandlung des Seminalplasmas mit 10% Polyethylenglykol (Endkonzentration 10%
PEG 6000):
Verdünnungen 10-1 bis 10-3, PEG ad 10%, über Nacht bei 4°C unter sanftem
Schütteln inkubieren, Zentrifugieren 2000 x g, 30min, 4°C, Überstände verwerfen,
Virus im Pellet resuspendieren in 1/10 des Ausgangsvolumens der Verdünnungen
und gut homogenisieren.

24.3.2.1.4. Organe
• Herstellen einer 10- bis 20%igen Organsuspension in Zellkulturmedium,
• niedertourig abzentrifugieren (10 Minuten bei 450 x g, 4°C),
• Überstand abnehmen; eventuell sterilfiltrieren (Sterilfilter: 0,45 μm).

FLI 224
Amtliche Methodensammlung Stand: Mai 2013

24.3.2.1.5. Urin
• Urinprobe niedertourig abzentrifugieren (10 Minuten bei 450 x g, 4 °C),
• Überstand ultrazentrifugieren, um vorhandenes Virus zu pelletieren (1 Stunde
bei 80 000 x g, 4°C),
• Pellet in Zellkulturmedium aufnehmen

Zellkulturen und deren Beimpfung


• Zellkulturen in Zellkulturfläschchen (25 cm2, 5 ml Medium) oder
Sechslochplatten (3 ml Medium) anlegen,
• Zellkulturmedium absaugen,
• subkonfluenten Zellrasen mit 0,5-1 ml Probenmaterial beimpfen,
• Inkubation (Adsorption) 1 Stunde bei 37 °C,
• Inokulum absaugen,
• Zellkulturmedium zugeben,
• tägliche mikroskopische Beobachtung,
• sichtbarer zytopathischen Effekt (cpe) tritt meist nach 2-6 Tagen auf:
Zellkulturüberstand bei ca. 80-90% cpe abnehmen, niedertourig
abzentrifugieren (10 Minuten bei 450 x g, 4 °C) und bei –70 °C lagern,
• bei Ausbleiben eines cpe: nach 5-7 Tagen mindestens zwei Subpassagen
durchführen;
• Virusidentifizierung mittels Mikroneutralisationstest oder RT-PCR (siehe x3.2.2
und 3)

Kontrolle
• als Negativkontrolle dient eine mit Medium inokulierte Zellkultur.

24.3.2.2. Virusidentifizierung mittels Mikroneutralisationstest


• Zellkultur in einer Mikrotiterplatte anlegen (siehe ANHANG),
• Virusverdünnungsreihe in Zehnerpotenzen herstellen,
• gleiche Mengen Virusverdünnung und EAV-spezifisches Antiserum
(Gebrauchsverdünnung muss pro Gebrauchsvolumen mindestens 100 KID 50
Virus neutralisieren) mischen und 30 Minuten bei 37 °C inkubieren,
• in gleicher Weise Virusverdünnungen mit Zellkulturmedium mischen und
inkubieren,
• Zellkulturmedium in der Mikroplatte absaugen,
• jeweils 50 μl der Virus-Serum- bzw. Virus- Zellkulturmedium-Gemische auf die
Zellkultur übertragen (pro Gemisch 2-4 Parallelansätze),
• Inkubation 30 Minuten bei 37 °C,
• Zellkulturmedium zugeben (150 μl pro Vertiefung),
• Inkubation bei 37 °C und 5% CO2,
• mikroskopische Auswertung nach ca. 3-5 Tagen,
• Infektiositätstiter des Virus/Serum- und des Virus/Zellkulturmedium-Gemischs
berechnen.
Ein statistisch signifikant niedrigerer Infektiositätstiter des Virus/Serum-Gemischs
gegenüber dem Virus/Medium-Gemisch spricht für das Vorliegen von EAV.
Signifikant ist eine Differenz (bei 4 Parallelansätzen) von mindestens 1 log10.

FLI 225
Amtliche Methodensammlung Stand: Mai 2013

Kontrollen
• Zellkultur/Verdünnungsmittel: Zellkultur mit Zellkulturmedium beimpfen;
• Antiserum: Zellkultur mit Antiserum-Gebrauchsverdünnung beimpfen;
• Virus: EAV Bucyrus wird ebenso wie das Virusisolat getestet.

24.3.2.3. Virusnachweis mittels real-time RT-PCR


Nasopharyngeale, konjunktivale, vaginale Tupfer
Buffy coat, Sperma, Urin, Organe
RNA-Extraktion
Zielsequenzen: virale Polymerase, Envelope M, Nukleokapsid N
am stärksten konserviert zwischen US und europäischen Isolaten: ORF 7
Keine Determinierung des momentanen infektiösen Status! (Handel, Sperma)
molekulare Epidemiologie M, GL, GS Hüllprotein- und N-Protein-kodierende
Sequenzen
RNA-Isolierung:
Die RNA-Isolierung erfolgt mit Extraktionsverfahren, die für die Aufreinigung von
viraler RNA aus den verschiedenen Ausgangsmaterialien geeignet sind.
 zellfreie Proben: z.B QIAamp RNA viral Mini Kit (Qiagen), Trizol (Invitrogen)
 zellhaltige Proben: z.B. RNeasy Mini Kit (Qiagen), Trizol (Invitrogen)

Die gleichzeitige Aufreinigung von sicher negativen Proben zur Kontrolle des
kreuzkontaminationsfreien Arbeitens während der RNA-Extraktion ist empfohlen. Für
die Aufreinigung von bis zu 7 Feldproben sollte mindestens eine RNA-Isolierungs-
Kontrolle (RIC) mitgeführt werden. Bei einer größeren Anzahl von Proben sollte die
Anzahl der RIC entsprechend erhöht werden.
Die RNA-Extraktion erfolgt nach den Vorgaben der Hersteller.
 Lagerung der RNA: kurzfristig auf Eis; mittelfristig bei –20°C; langfristig bei –70°C

Primer- und Sondensequenzen:


EAV_B-Mix:
20 µl EAVb7.53F(100pmol/µl)
5`-GGC GAC AGC CTA CAA GCT ACA-3´
20 µl EAVb7.256R (100pmol/µl)
5`-CGG CAT CTG CAG TGA GTG A-3´
2,5 µl EAV_b7.92P-FAM_Probe (100pmol/µl)
5`-FAM-TTG CGG ACC CGC ATC TGA CCA A-BHQ1-3´
157,5 µl 0,1x TE (pH=8,0)
200 µl
Primer und Sonde nach UB Balasuriya, 2002 (ORF7)

PCR-Bedingungen:
3-5µl RNA, 25 µl Reaktionsansatz
Kommerzielles One-Step RT-PCR Kit z. B.
Superscript III One-Step RT-PCR

FLI 226
Amtliche Methodensammlung Stand: Mai 2013

RNase freies Wasser 3,5 µl


2x Reactions Mix 12,5 µl
MgSO 4 (5 mM) 1,5 µl
SS III RT/Platinum Taq-Mix 0,5 µl
Primer-Sonden-Mix: 2,0 µl
Balasuriya

Gesamtvolumen Mastermix: 20 µl

RT für 30 min bei 50°C


Inaktivierung/Denaturierung 10 min 94°C
40x 20’’ 94°C
30’’ 60°C
60’’ 72°C
Finale Elongation 10 min 72°C
Hold 12°C

Auswertung:
FAM-Kanal:
a) Für die Positivkontrolle (PC) sollte ein Cq-Wert um 30 feststellbar sein. Hiermit
wird die Funktion des Genom-Detektionssystems sichergestellt. Ist für die PC
kein Cq-Wert feststellbar, ist die RT-PCR mit einem neuen PS-Mix und/oder
einer neuen PC zu wiederholen.
b) Für die RIC und die No Template Control sollte kein Cq-FAM-Wert feststellbar
sein.
c) Wenn alle eingesetzten Kontrollen in richtiger Weise reagieren ist eine
Auswertung der Feldproben-Ansätze möglich.
d) Eine Feldprobe wird dann als positiv/verdächtig in der RT-PCR gewertet, wenn
ein Cq-FAM-Wert für die entsprechende Probe festgestellt wird oder ein
signifikanter Anstieg der FAM-Fluoreszenz über das Basislevel festzustellen ist.
e) Bei einem positiven real-time RT-PCR-Ergebnis in einer differentialdiagnostisch
abzuklärende Feldprobe ist eine Wiederholung der real-time RT-PCR und / oder
eine Verifizierung des Ergebnisses mit einer zweiten RT-PCR angezeigt. Die
Bestätigung durch die Virusisolierung.

Kontrollen:
Es sind stets Positiv (PC)- und Negativkontrollen (NTC) mitzuführen und auch
sogenannte Extraktionskontrollen/Inhibitorenkontrollen (RIC) einzusetzen. Im
Regelfall ist daher je PCR-Ansatz mindestens eine negative Probe mitzuextrahieren.
Der Einsatz der Kontrollen ist für jede Proben mit dem Laborleiter oder seinem
Stellvertreter abzustimmen.
Die Untersuchungen sind nur valide, wenn die vorgeschriebenen Negativ- und
Positiv-Kontrollen korrekt detektiert werden. Zur Überprüfung der erfolgreichen
Nukleinsäuren-Extraktion und Amplifikation sollte der Assay mit einem internen
Kontrollsystem, z. B. basierend auf dem beta-Aktin-Gen, gekoppelt werden. Die

FLI 227
Amtliche Methodensammlung Stand: Mai 2013

Ergebnisse der spezifischen RT-PCR können nur als valide gelten, wenn eine
erfolgreiche Amplifikationskontrolle durchgeführt wurde.

Die ebenfalls publizierte real-time RT-PCR nach DG Westcott, 2003 (ORF7)


ist geringfügig weniger sensitiv.

Anhang
Zellkulturmedium: EMEM mit Zusatz von
• 0,1 mg Streptomycin pro ml,
• 100 I.E. Penicillin pro ml,
• 5% fetales Kälberserum.

Lysispuffer: 13,2 mM Na 2 HPO 4


Isopuffer: 13,2 mM Na 2 HPO 4 , 460 mM NaCl

Zellkulturen:
Zur Virusisolierung und für den Mikroneutralisationstest eignen sich folgende
permanente Zelllinien:
1) RK-13, ATCC-Nr. CCL 37,
2) Vero, ATCC-Nr. CCL 81,
3) BHK-21 ATCC Nr. CCL 10

Die Zellen werden im Abstand von ca. 2-7 Tagen 1:3 bis 1:5 geteilt:
• Zellkulturmedium abgießen,
• Zellrasen mit warmer Trypsin (0,0625 %)-Versen (0,53 mM)-Lösung spülen,
• wenig Trypsin/Versen-Lösung (1 ml pro 25cm2-Zellkulturflasche) zugeben,
• Inkubation bei 37 °C, bis sich die Zellen durch leichtes Klopfen von der
Oberfläche ablösen lassen,
• Zellen durch mehrmaliges Resuspendieren vereinzeln,
• Zellsuspension auf Zellkulturflaschen verteilen,
• Medium zugeben.

Literatur
Balasuriya UB, Leutenegger CM, Topol JB, McCollum WH, Timoney PJ, MacLachlan
NJ. (2002): Detection of equine arteritis virus by real-time TaqMan reverse
transcription-PCR assay. J Virol Methods.;101(1-2):21-8.
CHIRNSIDE, E. D. und W. J. SPAAN (1990): Reverse transcription and cDNA
amplification by the polymerase chain reaction of equine arteritis virus (EAV). J.
Virol. Methods 30 (2), 133-140.
COLLINS, J. K.; S. KARI; S. L. Ralston; D. G. BENNETT; J. L. TRAUBDARGATZ
und A. O. MCKINNON (1987): Equine viral arteritis at a veterinary teaching
hospital. Preventive Vet. Med. 4, 389-397.
COOK, R.F.; S. J. GANN und J. A. MUMFORD (1989): The effects of vaccination
with tissue culture-derived viral vaccines on detection of antibodies to equine
arteritis virus by enzyme-linked immunosorbent assay (ELISA). Vet. Microbiol. 20,
181-189.

FLI 228
Amtliche Methodensammlung Stand: Mai 2013

CRAWFORD, T. B. und J. B. HENSON (1973): Immunofluorescent, light microscopic


and immunologic studies of equine viral arteritis. In: "Equine Infectious Diseases
3" edited by J. T. Bryans and H. Gerber. S. Karger, Basel; 282-302.
FUKUNAGA, Y. und W. H. MCCOLLUM (1977): Complement-fixation reactions in
equine viral arteritis. Am. J. Vet. Res. 38 (12), 2043-2046.
KAADEN, O.-R.; L. HAAS und M. KLOPRIES (1990): Equine Virusarteritis. Tierärztl.
Prax. 18, 277-282.
MC COLLUM, W. H.; M. E. PRICKETT und J. T. BRYANS (1971): Temporal
distribution of equine arteritis virus in respiratory mucosa, tissues and body fluids
of horses infected by inhalation. Res. Vet. Sci. 12, 459-464.
SENNE, D. A.; J. E. PEARSON und E. A. CARBREY (1985): Equine viral arteritis:
standard procedure for the virus neutralization test and comparison of results of a
proficiency test performed at five laboratories. Proc. U.S. Animal Health Assoc. 89,
29-34
TIMONEY, P. J.; W. H. McCOLLUM und A. W. ROBERTS (1987): Detection of the
carrier state in stallions persistently infected with equine arteritis virus. Proc. Am.
Assoc. Equine Pract. 32, 57-65
Westcott DG, King DP, Drew TW, Nowotny N, Kindermann J, Hannant D, Belák S,
Paton DJ. (2003): Use of an internal standard in a closed one-tube RT-PCR for the
detection of equine arteritis virus RNA with fluorescent probes. Vet
Res.;34(2):165-76.

Überarbeitet nach
Prof. Dr. O.-R. Kaaden und M. Klopries

FLI 229
Amtliche Methodensammlung Stand: Mai 2013

25. Infektion mit Bonamia exitiosa

25.1. Charakterisierung der Infektion

25.1.1. Klinische Symptomatik


Für die Bonamia exitiosa-Infektion wird kein differenziertes klinisches Bild
beschrieben. Ein Zeichen für die Infektion mit dem protozoären Parasiten ist die stark
erhöhte Mortalität in der betroffenen Muschel-Population. Zeichen können offene
Schalen bzw. Abfallen vom Hafthintergrund (Felsen, Stricke, Holzpfähle) sein.
Während die Infektion im australischen Raum beschrieben wird, wurde der Parasit
auch in Spanien und Frankreich gefunden. Empfängliche Arten sind die Ostrea
chilensis und die O. angasi. Histologisch kann der Parasit meist in Hämozyten, selten
auch extrazellulär beobachtet werden.

25.1.2. Rechtsgrundlagen
• Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und
zur Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU
Nr. L 328 S. 14)
• Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über
anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

25.2. Labordiagnostischer Erregernachweis


Positiver Befund kann mit mindestens einer der folgenden Methoden erhoben
werden:
• Histologie nach HE-Färbung
• Abklatschpräparate vom Herzen und Hemacolor-Färbung

FLI 230
Amtliche Methodensammlung Stand: Mai 2013

26. Infektion mit Bonamia ostrea

26.1. Charakterisierung der Infektion


26.1.1. Erreger
Die Bonamiose wird durch den protozoären Parasiten Bonamia ostrea verursacht.

26.1.2. Klinische Symptomatik


Für die Bonamiose wird kein klinisches Bild beschrieben. Ein Zeichen für die
Infektion mit dem Parasiten ist die stark erhöhte Mortalität in der betroffenen
Muschel-Population. Bonamia ostrea befällt die Europäische Flachauster (Ostrea
edulis) letal. Empfängliche Spezies sind O. pulchana, O. angasi, O. conchiphila,
Crassostrea angulata und C. ariakensis. Alle Entwicklungsstadien der Austern sind
empfänglich. Der Parasit wird in der Regel in agranulären Hämozyten gefunden. In
nekrotischen Bereichen des Bindegewebes, des Epithels von Mund, Magen und
Verdauungsdrüsen sowie im Kiemengewebe kann der Parasit auch extrazellulär
beobachtet werden. Bonamia ostrea wird in Europa (Frankreich, Irland, Italien, den
Niederlanden, Spanien und dem Vereinigten Königreich außer Schottland), in
Kanada und den USA nachgewiesen.

26.1.3. Rechtsgrundlagen
• Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und
zur Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU
Nr. L 328 S. 14)
• Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über
anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

26.2. Labordiagnostischer Erregernachweis


• Abklatschpräparate vom weißen Teil des Herzens und vom Bindegewebe und
Haemacolor ® -Färbung
• Histologie nach HE-Färbung
• PCR zum Nachweis der DNA des Parasiten
• Elektronenmikroskopie

FLI 231
Amtliche Methodensammlung Stand: Mai 2013

27. Infektion mit Marteilia refringens

27.1. Charakterisierung der Infektion

27.1.1. Erreger
Die Marteiliose wird durch den protozoären Parasiten Marteilia refringens verursacht.

27.1.2. Klinisches Bild


Für die Marteiliose wird kein differenziertes klinisches Bild beschrieben. Ein Zeichen
für die Infektion mit dem Parasiten ist die stark erhöhte Mortalität in der betroffenen
Muschel-Population. Marteilia refringens befällt die Europäische Flachauster (Ostrea
edulis) und Miesmuschelarten (Mytilus edulis, M. galloprovincialis) wobei die
Mortalitäten bei der Europäischen Flachauster am höchsten sind. Weitere
empfängliche Spezies sind O. pulchana, O. angasi und O. chilensis. Alle
Entwicklungsstadien der Austern und Muscheln sind empfänglich. Der Parasit wird in
der Regel im Verdauungstrakt der Austern und Muscheln gefunden. Plasmodien
können auch in Kiemen- und Mantelzellen vorhanden sein. Sprorangien werden über
den Kot ausgeschieden. M. refringens (auch Variante M. maurini in Mytilus
galloprovincialis) wurde in Europa (Kroatien, Frankreich, Griechenland, Italien,
Spanien, Portugal) und Afrika (Marokko) nachgewiesen.

27.1.3. Differentialdiagnostik
Artverwandte Parasiten wie M. sydneyi, M. lenghei oder M. christenseni können von
M. refringens mittels Histologie, Elektronenmikroskopie oder PCR differenziert werden.

27.1.4. Rechtsgrundlagen
• Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und zur
Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU Nr. L 328
S. 14)
• Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über
anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

27.2. Labordiagnostischer Nachweis


Positiver Befund mit mindestens einem der folgenden Verfahren:
• Histologie nach HE-Färbung (Verdauungsdrüsen)
• in-situ Hybridisierung
• PCR zum Nachweis der DNA des Parasiten

FLI 232
Amtliche Methodensammlung Stand: Mai 2013

• Elektronenmikroskopie

FLI 233
Amtliche Methodensammlung Stand: Mai 2013

28. Infektion mit Microcytos mackini

28.1. Charakterisierung der Infektion


28.1.1. Klinisches Bild
Für die Infektion mit dem Parasiten Microcytos mackini wird kein differenziertes
klinisches Bild beschrieben. Es können jedoch gelblich-grüne Pusteln in allen
sichtbaren Geweben sowie in der Schale der Austern auftreten. Ein Zeichen für die
Infektion mit dem protozoären Parasiten ist die stark erhöhte Mortalität in der
betroffenen Muschel-Population. Zeichen können offene Schalen bzw. Abfallen vom
Hafthintergrund (Felsen, Stricke, Holzpfähle) sein. Befallen werden die Austernarten
Crassostrea gigas, C. virginica, Ostrea edulis und O. conchaphila. Histologisch kann
der Parasit in allen Geweben beobachtet werden. Die Infektion wurde bisher
ausschließlich im nordamerikanischen Raum beschrieben.

28.1.2. Rechtsgrundlagen
• Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und zur
Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU Nr. L 328
S. 14)
• Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über
anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

28.2. Labordiagnostischer Erregernachweis


• Histologie nach HE-Färbung
• PCR zum spezifischen DNA-Nachweis des Parasiten

FLI 234
Amtliche Methodensammlung Stand: Mai 2013

29. Infektion mit Perkinsus marinus

29.1. Charakterisierung der Infektion


29.1.1. Klinisches Bild
Für die Perkinsose wird kein differenziertes klinisches Bild beschrieben. Ein Zeichen
für die Infektion mit dem protozoären Parasiten Perkinsus marinus ist die stark
erhöhte Mortalität in der betroffenen Muschel-Population. Histologisch stehen
multifokale Läsionen im Epithel des Verdauungstraktes und im Bindegewebe im
Vordergrund. In schweren Fällen der Infektionen können diese Gewebe komplett
zerstört werden. Die Infektion wurde bis jetzt ausschließlich im nordamerikanischen
Raum an der Ostküste (Main bis Karibik) beschrieben. Befallen werden die
Austernarten Crassostrea virginica, C. gigas, C. ariakensis und C. hizophorae.

29.1.2. Rechtsgrundlagen
• Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und
Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und zur
Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (ABl. EU Nr. L 328
S. 14)
• Fischseuchenverordnung und Verordnung zur Änderung der Verordnung über
anzeigepflichtige Tierseuchen vom 24. November 2008 (BGBl. I S. 2315)

29.2. Labordiagnostischer Erregernachweis


• Histologie nach HE-Färbung
• Thioglykolat-Kultur (anerkannte Methode)
• PCR zum spezifischen DNA-Nachweis des Parasiten

FLI 235
Amtliche Methodensammlung Stand: Mai 2013

30. Infektiöse Hämatopoetische Nekrose der Salmoniden


(IHN), Virale Hämorrhagische Septikämie der
Salmoniden (VHS)

30.1. Charakterisierung der Infektion


Die VHS (Viral Haemorrhagic Septicaemia), auch bezeichnet als "Forellenseuche"
oder „Egtved-Krankheit“, und die IHN (Infectious Haematopoietic Necrosis)
verursachen in Europa große wirtschaftliche Schäden durch Verluste von bis zu 100
%, vor allem bei in der Aquakultur gehaltenen Regenbogenforellen.

30.1.1. Erreger
Die Erreger der IHN (IHNV) und der VHS (VHSV) gehören innerhalb der Ordnung
Mononegavirales zur Familie der Rhabdoviridae. Das Genom der Rhabdoviren ist
einfach strukturiert und besteht aus einer einzelsträngigen RNA negativer Polarität
von ca. 11.000 Basen. Insgesamt werden fünf Strukturproteine von einer gleichen
Anzahl monocistronischer mRNAs gebildet. IHNV und VHSV unterscheiden sich von
anderen Rhabdoviren durch die Bildung des Nichtstrukturproteins NV („non virion“).
Basierend auf der Genomorganisation und der Bildung des NV-Proteins werden
IHNV und VHSV taxonomisch dem Genus Novirhabdovirus zugeordnet.
Die Mehrzahl der VHS-Ausbrüche in der Aquakultur Europas wird durch Isolate des
Serotyps 1 (F1) verursacht. IHNV-Isolate sind serologisch einheitlich. Unterschiede
lassen sich nur bedingt mit verschiedenen mAk feststellen. Auf der Grundlage der
Gensequenz werden die Isolate in verschiedene Genogruppen unterteilt. Eine
sichere Differenzierung von identifizierten IHNV- bzw. VHSV-Isolaten ist mit den
bislang vorhandenen mAk oft nicht möglich. Die molekularbiologische
Charakterisierung (Genotypisierung) einschließlich der phylogenetischen Analyse
ermöglicht eine eindeutige Identifizierung der Erreger. Basierend auf den
Sequenzanalysen werden Veränderungen dieser Virusstämme verfolgt und
Rückschlüsse auf die Herkunft des Erregers gezogen.

30.1.2. Klinische und pathologisch-anatomische Symptomatik


VHSV und IHNV replizieren u. a. in den Endothelzellen der Blutkapillaren, den
Leukozyten, in Zellen der hämatopoetischen Organen und der Niere.

Das klinische Bild einer VHS ist definiert als eine mit Ödemen und Hämorrhagien
einhergehende Krankheit mit folgenden Kriterien:
• Lethargie (Randsteher) und sporadische Hyperaktivität,
• Dunkelverfärbung (Abb. 1A),
• Exophthalmus (Abb. 1B),
• Anämie,
• Auftreiben des Leibes (durch Aszites),
• Pseudofaeces (lange weißliche, aus dem Rektum heraushängende Auswürfe),
• Hämorrhagien (Abb. 1C),
• Inappetenz.

FLI 236
Amtliche Methodensammlung Stand: Mai 2013

Die klinischen Symptome werden unter natürlichen Bedingungen bei


Wassertemperaturen von 2 bis 14 °C ausgebildet. Bei perakuten Todesfällen können
diese Symptome fehlen.
Die Inkubationszeit beträgt bei Wassertemperaturen von 8 bis 10 °C etwa 7 Tage.
Sie ist abhängig vom Alter der Fische, von der Wassertemperatur, von der
Infektionsdosis und von der Virulenz des Erregers.

Bei einem VHS-Ausbruch in einer bis dahin virusfreien Population unterscheidet man
gewöhnlich 3 Phasen. An die erste, akute Phase, gekennzeichnet durch hohe
Fischverluste in einer relativ kurzen Zeit, schließt sich eine zweite Phase mit
chronischem Verlauf an. In der dritten, sogenannten "nervösen" Phase zeigen die
Fische zentralnervöse Störungen, die durch Drehung um die Längsachse oder
plötzliche, spiralförmige Schwimmbewegungen der Fische gekennzeichnet sind.

Abbildung 1: An VHS erkrankte Forellen mit Dunkelfärbung der Haut (A), Exophthalmus (B) und
petechialen Hämorrhagien in der Muskulatur und auf inneren Organen (C)

Das klinische Bild einer IHN ist charakterisiert als eine ebenfalls mit Ödemen und
Hämorrhagien einhergehende Krankheit gleicher Symptomatik:
• Lethargie und sporadische Hyperaktivität,
• Dunkelverfärbung,
• Exophthalmus,

FLI 237
Amtliche Methodensammlung Stand: Mai 2013

• Anämie,
• Auftreiben des Leibes (durch Aszites),
• Pseudofaeces (lange weißliche, aus dem Rektum heraushängende Auswürfe),
• Hämorrhagien,
• Inappetenz.

Die klinischen Symptome werden bei Wassertemperaturen von 4 bis 15 °C


ausgebildet. Bei perakuten Todesfällen können die Symptome fehlen.

Die Inkubationszeit beträgt 5 bis 15 Tage und ist auch abgängig vom Alter der
Fische, von den Wassertemperaturen, von der Infektionsdosis und von der Virulenz
des Erregers.

Die auffälligsten klinischen bzw. pathologisch-anatomischen Symptome bei beiden


Krankheiten sind Absonderung der Fische vom Schwarm, Dunkelverfärbung der Haut
und Exophthalmus sowie vielfältige hämorrhagische Diathesen und katarrhalische
Enteritis. Auf Grund klinischer und pathologisch-anatomischer Symptomatik lassen
sich VHS und IHN nicht unterscheiden.

30.1.3. Vorkommen
Die VHS hat als Infektionskrankheit vor allem Bedeutung bei Salmonidenarten.
Empfängliche Arten sind im Süßwasser: Regenbogenforelle, Bach-, Meer-,
Seeforelle, Hecht, Äsche, Atlantischer Lachs. Coregonen (Felchen/Maräne) und
Saiblinge erkranken normalerweise nicht, sind aber Überträger.
Die aktuellen Listen der empfänglichen und Überträger-Arten sind im Anhang IV Teil
II der Richtlinie 2006/88/EG und im "Diagnostic Manual for Aquatic Animal Diseases"
des OIE aufgeführt.
Bei Wildfischen wurden natürliche Epizootien selten festgestellt. Große Bedeutung
haben die für VHS empfänglichen Wildfische allerdings als Carrier und Überträger
des Erregers.
In den letzten Jahren wurden von zahlreichen marinen Spezies aus dem
nordamerikanischen Teil des Pazifischen Ozeans, aus dem Nordatlantik und aus der
Ostsee VHS-Viren isoliert. Empfänglich Arten sind im Meerwasser z. B. Hering,
Steinbutt, Kabeljau, Schellfisch, Coho, Chinook und Flunder. Eine zentrale Stellung
bei den Infektketten nimmt der Pazifische - und Atlantische Hering ein. Die marinen
Isolate gelten bisher für Süßwasserfische als nicht oder nur schwach virulent.
IHN ist eine Infektionskrankheit der Regenbogenforellen, verschiedener Pazifischer
Lachse und des Atlantischen Lachses. Seeforelle, Saibling, Äsche, Hecht und
Felchen sind empfänglich, erkranken aber nicht. Die Bachforelle gilt als resistent.
Nachweise des Virus aus erkrankten Aalen erfolgten bei Wassertemperaturen über
22 °C. Der Europäische Aal ist aber nicht als empfängliche Art im Anhang IV Teil II
der Richtlinie 2006/88/EG gelistet.
Seit 1953 ist die IHN in den USA an der pazifischen Küste bekannt. Der Erreger
kommt dort in wildlebenden Lachspopulationen sowie in Zuchtanlagen vor. Von der
Westküste Amerikas wurde der Erreger in andere Staaten der USA, 1977 nach
Japan und 1987 über Frankreich, Italien in die Schweiz und nach Deutschland
eingeschleppt

FLI 238
Amtliche Methodensammlung Stand: Mai 2013

30.1.4. Diagnostische Indikation


In Abhängigkeit von der Art der Überwachung oder, wenn als Ergebnis der klinischen
und pathologisch-anatomischen Untersuchung oder auf Grund epizootiologischer
Erhebungen der Verdacht des Ausbruchs der IHN oder VHS geäußert wird, sind
Fische an die zuständige diagnostische Einrichtung zur virologischen Prüfung
einzusenden.
In den folgenden methodischen Hinweisen wird zwischen den Probennahme- und
Analyseverfahren zur VHS- und IHN-Überwachung und den Maßnahmen zur
Isolierung und Identifizierung von VHSV und IHNV aus Fischen bei Ausbruch oder
Verdacht des Ausbruchs der VHS bzw. IHN unterschieden.

30.1.5. Bekämpfung
Derzeitig konzentrieren sich die Maßnahmen EU-weit auf die Bekämpfung und die
Verhinderung der weiteren Ausbreitung der VHS und IHN. Die Strategie basiert dabei
auf der Schaffung anerkannt seuchenfreier Aquakulturbetriebe bzw. Kompartimente,
Zonen oder Länder.
In Deutschland sind nach der Fischseuchenverordnung alle Fischhaltungsbetriebe,
die nicht einer Genehmigung bedürfen, registrierungspflichtig, sofern sie in den
Geltungsbereich der Fischseuchen-Verordnung fallen.
Es ist zu gewährleisten, dass der Gesundheitsstatus der Fische durch das
Inverkehrbringen von Tieren aus Aquakultur und deren Erzeugnisse nicht gefährdet
wird. Gemäß dem Ergebnis der Beurteilung im Rahmen des
Genehmigungsverfahrens wird der Betrieb für die zukünftige risikobasierte
Überwachung sowie für tierseuchenrechtliche Maßgaben im Hinblick auf den Handel
und den Transport in Kategorien eingestuft.
• Kategorie I: als seuchenfrei erklärt,
• Kategorie II: unterliegt einem genehmigten Überwachungsprogramm, um den
Seuchenfreiheitsstatus (Kategorie I) zu erreichen,
• Kategorie III: Infektionen sind nicht bekannt, der Betrieb unterliegt aber keinem
genehmigten Überwachungsprogramm,
• Kategorie IV: Infektionen sind bekannt, die Betriebe unterliegen aber einem
genehmigten Tilgungsprogramm,
• Kategorie V: Infektionen sind bekannt, es werden aber nur die festgelegten
Mindestvorschriften zur Bekämpfung von Fischseuchen realisiert.

Bei amtlicher Feststellung der IHN oder VHS in einem Aquakulturbetrieb sind
Maßnahmen zur Vermeidung der Verschleppung, wie Bestandssperre, Tötung
seuchenkranker oder seuchenverdächtiger Fische sowie ein Sperr- und
Beobachtungsgebiet um das Seuchenobjekt festzulegen.

30.1.6. Zuständige Untersuchungseinrichtungen


Die virologischen Untersuchungen zum Nachweis der Erregerfreiheit für die
Anerkennung seuchenfreier Gebiete bzw. Fischhaltungsbetriebe, zur Überwachung
der Seuchenfreiheit bzw. zur Bestätigung von IHN- bzw. VHS-Verdachtsfällen
werden in den zugelassenen, regionalen Untersuchungsämtern der Bundesländer
durchgeführt. Das Nationale Referenzlaboratorium für IHN und VHS am Friedrich-
Loeffler-Institut auf der Insel Riems koordiniert die Diagnose von Fischseuchen auf
der Grundlage der EU- und nationalen Gesetzgebung. Zur Klärung fraglicher

FLI 239
Amtliche Methodensammlung Stand: Mai 2013

Befunde oder zur Bestätigung der Ergebnisse der regionalen Diagnoselaboratorien


bei Ausbruch einer Fischseuche in einem als seuchenfrei erklärten Bestand oder
Gebiet sind die Virusisolate zur Identifizierung und molekularbiologischen
Charakterisierung an das Referenzlabor einzusenden. Repräsentative Isolate werden
an das EU-Referenzlaboratorium übergeben, das die Diagnose der Fischseuchen
auf EU-Ebene koordiniert.

30.1.7. Rechtsgrundlagen
IHN und VHS sind lt. Verordnung über anzeigepflichtige Tierseuchen
anzeigepflichtig. Die Diagnose und Bekämpfung der VHS und IHN sind in
Deutschland durch die "Fischseuchenverordnung und Verordnung zur Änderung der
Verordnung über anzeigepflichtige Tierseuchen vom 24. November 2008
(Fischseuchen-Verordnung)" geregelt. Diese Verordnungen dienen zur Umsetzung
der Aquakultur-Richtlinie 2006/88/EG, die zur Harmonisierung der Diagnose und
Bekämpfung von Fischseuchen innerhalb der Europäischen Union erlassen wurden.
Die Entscheidung 2001/183/EWG der Kommission in der jeweils gültigen Fassung, in
der die Probennahmepläne und Diagnoseverfahren zur Überwachung und zum
Nachweis der VHS und IHN festgelegt sind, ist für die Diagnose dieser Fischseuchen
in Deutschland verbindlich und wurde deshalb für die Erstellung der folgenden
methodischen Hinweise zugrunde gelegt. Dabei sind die anzuwendenden Methoden
zum Nachweis von VHSV und IHNV identisch. Eine Anleitung zur Diagnose der VHS,
IHN und weiterer, gegebenenfalls differentialdiagnostisch abzugrenzender
Fischkrankheiten findet man auch im "Diagnostic Manual for Aquatic Animal
Diseases" des OIE in der jeweils aktuellen Ausgabe.
Der “Draft COMMISSION DECISION of Diagnostic Manual for certain aquatic animal
diseases (SANCO/6084/2009)” ist bisher nicht bestätigt. Gegenwärtig liegt der „Draft
COMMISSION DECISION of implementing Directive 2006/88/EC as regards
requirements for surveillance and diagnostic methods (SANCO/6084/2009 rev4)” den
Mitgliedsländern der EU zur Begutachtung vor. Beide Dokumente enthalten
zusätzlich oder alternativ den Genom-Nachweis mit molekularbiologischen Methoden
(RT-PCR und Sequenzidentifizierung) zum Nachweis von VHSV und IHNV.

30.2. Untersuchungsmaterial
(Probennahme bei Fischen, übernommen aus dem speziellen Teil des
Tierseuchenbekämpfungshandbuches, Kapitel Fischseuchen)

30.2.1. Einführung
Die Probennahme bei Fischen zwecks virologischer Untersuchung wird in der
Entscheidung 2001/183/EG zur Festlegung der Probennahmepläne und
Diagnoseverfahren und zum Nachweis bestimmter Fischseuchen und zur Aufhebung
der Entscheidung 92/532/EWG beschrieben.
Wer eine genehmigungspflichtige Tätigkeit nach § 3 Fischseuchenverordnung
ausübt, hat empfängliche Fischarten nach Maßgabe des Anhangs III Teil B der
Richtlinie 2006/88/EG in geeigneter Weise untersuchen zu lassen. Sofern eine
Laboruntersuchung hierfür erforderlich ist, ist diese von einem von der zuständigen

FLI 240
Amtliche Methodensammlung Stand: Mai 2013

Behörde benannten Laboratorium durchzuführen. Für eine etwaige Probennahme


und Laboruntersuchung gelten die Anforderungen der Entscheidung 2001/183/EG.
Ferner müssen bei Ansteckungsverdacht und im Rahmen epizootiologischer
Nachforschungen sowie bei der Erlangung und Aufrechterhaltung eines EU-Status
als zugelassener Betrieb oder zugelassenes Gebiet Probennahmen zwecks
virologischer Untersuchung erfolgen.

30.2.2. Probennahme

30.2.2.1. Probenauswahl
Bei der Begehung des Fischhaltungsbetriebes müssen alle Produktionsanlagen
(Teiche, Becken, Netzgehege, usw.) auf verendete, geschwächte oder
verhaltensgestörte Fische kontrolliert werden. Besondere Beachtung ist dem
Wasserabflussbereich sowie den Teichrändern zu widmen, wo sich geschwächte
Fische häufig aufhalten. Sind geschwächte, verhaltensgestörte oder frisch verendete
Fische (noch blassrote Kiemen) vorhanden, so sind hauptsächlich solche Fische für
die Beprobung auszuwählen. Sind solche Fische nicht vorhanden, müssen die
Fische so ausgewählt werden, dass sich die Probe proportional aus normal
erscheinenden, gesunden Fischen aller Produktionseinheiten des Betriebes sowie
aller Jahresklassen zusammensetzt.
Die Auswahl erfolgt entsprechend der klinischen Symptomatik. Dunkelverfärbung
(Abb. 1A), Apathie und am Teichrand stehenden Fische sind Hinweise auf
Konditionsschwäche. Exophthalmus (Abb. 1B) kann auf eine Erkrankung viraler
Genese hindeuten.
Im Rahmen einer Untersuchung sollten in Betrieben mit Regenbogenforellen nur
Fische dieser Art für die Probennahme gewählt werden. Sind keine
Regenbogenforellen vorhanden, so muss die Probe Fische aller für das VHS
und/oder IHN empfänglichen Arten des Betriebes umfassen.
Wird für die Fischproduktion mehr als eine Wasserquelle verwendet, so müssen bei
der Probennahme alle Wasserquellen berücksichtigt werden.
Eine Probe sollte aus maximal 10 Fischen bestehen.

Routineuntersuchung:
Die klinische Untersuchung und die Entnahme von Gewebeproben im Rahmen von
Routineuntersuchungen sind durchzuführen, immer dann wenn die
Wassertemperatur unter 14 °C liegt. Die Wassertemperatur des zu beprobenden
Wasserkörpers sollte dokumentiert werden. Bei Betrieben, die zweimal jährlich im
Rahmen eines Untersuchungsprogramms zur Erlangung oder Aufrechterhaltung des
EU-Status (Zulassungsuntersuchung) klinisch untersucht werden, müssen die
Abstände zwischen den Untersuchungen mindestens vier Monate betragen.
Bei Brütlingen muss die Probe aus mindestens 20, bei Fischen über 5 cm Länge aus
mindestens 10 Fischen bestehen.

30.2.2.2. Organentnahme
Die zu untersuchenden Fische müssen tierschutzgerecht, vorzugsweise mittels
Kopfschlag, betäubt werden. Unmittelbar nach Betäubung hat die Organentnahme zu
erfolgen. Dieses geschieht mit Hilfe von sterilen Sektionsinstrumenten (Schere,
Skalpell, Pinzette, Mikrolöffel). Nach einem Querschnitt vor dem After, wird die
Bauchseite mit einer geraden Schnittführung bis zur Kopfunterseite geöffnet

FLI 241
Amtliche Methodensammlung Stand: Mai 2013

(Ventralschnitt). Die Körperwand wird mit Hilfe eines bogenförmigen Lateralschnittes


vom After bis zur Seitenlinie, dann dieser entlang bis in die Kiemenhöhle entfernt und
die Organe der Leibeshöhle freigelegt. Herz, Milz und Vorderniere können jetzt
entnommen werden. Zur Entnahme der Vorderniere (Kopfniere), die unter der
Wirbelsäule liegt, werden Magen, Darm, Leber, viscerales Fett, Pylorusschläuche
und die Schwimmblase entfernt.
Der Kiemendeckel wird entfernt (Operkularschnitt) und der Schädel wird mit Hilfe
eines Sagitalschnittes aufgespalten, um das Gehirn freizulegen.
Besteht die Probe aus Fischen von weniger als 4 cm Länge, so sollten diese mit Hilfe
einer sterilen Schere oder einem sterilen Skalpell nach Entfernen der hinter den
Darmöffnungen liegenden Körperteile zerlegt werden. Wenn die Fische zwischen 4
und 6 cm lang sind, sollten die Innereien einschließlich der Nieren entnommen
werden.
Die Gewebeproben werden in sterile Gefäße verbracht, die ein Transportmedium
(Nährmedium mit 10 % Kälberserum und Antibiotika) enthalten. Empfehlenswert ist
ein Gemisch aus 200 IE Penicillin, 200 µg Streptomycin und 200 µg Kanamycin je ml;
es können aber auch andere erprobte Antibiotika verwendet werden. Untersucht
werden Milz, Vorderniere sowie entweder Herz oder Gehirn.
In Betrieben mit Laichfischen muss auch Ovarliquor untersucht werden (siehe
Entscheidung 2001/183/EG). Ovarliquor fällt nur beim Abstreifen von laichreifen
Salmoniden (Forellenartigen) in ausreichender Menge an.
Ovarliquor oder Organteile von zehn Fischen sind als Sammelprobe in ein Gefäß mit
Transportmedium zu verbringen, das mindestens 4 ml Transportmedium enthält. Das
Transportmedium muss in jedem Fall die Sammelprobe vollständig bedecken. Jede
Gewebeprobe sollte mindestens 0,5 g wiegen.

30.2.2.3. Transport
Proben müssen nach Voranmeldung direkt zur Untersuchungsstelle verbracht
werden.
Fische können getötet, unzerteilt und gekühlt (maximal 10 °C) ohne Wasser in einem
Plastikbeutel transportiert werden.
Ferner können Fische auch lebend verbracht werden. Dazu werden Transportbeutel
mit geeigneter Beschaffenheit und Größe zu einem Drittel mit sauberem
Transportwasser und zu zwei Drittel mit technischem Sauerstoff befüllt. Die Beutel
werden sicher verschlossen, indem das obere Ende durch Drehen verschlossen und
mit Hilfe eines Kabelbinders oder starken Gummibandes fixiert wird. Das so
verschlossene Ende wird umgeschlagen und abermals mit einem Kabelbinder oder
Gummiband wie oben beschrieben fixiert. Die Beutel werden in liegender Position in
einen Transportkarton oder in eine Styroporkiste verbracht. In der warmen Jahreszeit
sollte für zusätzliche Kühlung gesorgt werden. Es ist darauf zu achten, dass das
Transportwasser in ständiger Bewegung bleibt, damit das Wasser während des
Transportes ausreichend Sauerstoff aufnehmen kann.

Die Entnahme von Gewebeproben kann im Fischhaltungsbetrieb vorgenommen


werden. Das Probenmaterial muss auf dem schnellsten Weg zum
Untersuchungslabor verbracht werden. Die Probengefäße sollten in
Isolationsbehälter (z. B. dickwandige Styroporkästen) mit ausreichend Eis oder
Kühlelementen gegeben werden, zur Gewährleistung einer ununterbrochenen
Kühlung bis ins Labor. Ein Anfrieren ist zu vermeiden. Während des Transports sollte
die Temperatur im Behälter zu keiner Zeit mehr als 10 °C betragen.

FLI 242
Amtliche Methodensammlung Stand: Mai 2013

Mit der virologischen Untersuchung ist baldmöglichst zu beginnen, spätestens jedoch


48 Stunden nach der Probennahme.

Abbildungen zur Probennahme sind im speziellen Teil des


Tierseuchenbekämpfungshandbuches, Kapitel Fischseuchen, enthalten.

30.3. Untersuchungsgang
(für die VHS- und IHN-Überwachung)

30.3.1. Aufbereitung der Proben für die virologische Untersuchung


Nach dem Homogenisieren (z. B. Stomacher, Mixer, Mörser, Mikrohomogenisator-
stempel) wird der Organbrei im Volumenverhältnis von 1:10 in dem ursprünglichen
Transportmedium suspendiert. Ganze Fische mit weniger als 6 cm Länge werden
nach Entfernung des hinter der Darmöffnung liegenden Körperteils in toto
homogenisiert.
Das Homogenisat wird bei 2000 bis 4000 x g und 2 bis 5 °C für 15 Min. zentrifugiert.
Wurde die Probe nicht in einem antibiotikahaltigem Medium versandt, ist der
Überstand für 4 Stunden bei 15 °C oder über Nacht bei 4 °C antibiotisch (z. B. 1
mg/ml Gentamycin) zu behandeln.
Bakteriell kontaminierte Proben können filtriert werden.
Erfolgt die virologische Untersuchung ausnahmsweise nicht sofort oder sind
Wiederholungsuntersuchungen notwendig, kann die Probe bei -80 °C gelagert
werden. Die Untersuchung ist jedoch innerhalb von 14 Tagen vorzunehmen.
Um einen IPNV-bedingten CPE auszuschließen, kann der Überstand vor der
Zellkultur-Beimpfung mit IPNV-Antiseren (Titer im 50 %-Plaquetest mindestens
1:2000 gegen die einheimischen IPNV-Serotypen) gemischt und für mindestens 1
Stunde bei 15 °C oder für höchstens 18 Stunden bei 4 °C inkubiert werden.

30.3.2. Virologische Untersuchung

30.3.2.1. Zellkulturen und Nährmedien


BF-2- oder RTG-2- und EPC- oder FHM-Zellen werden bei 20 bis 30 °C mit
geeigneten Medien (z. B. Eagles Minimum Essential Medium) bei Notwendigkeit mit
10 % Rinderfetenserum und Antibiotika in Standardkonzentrationen angezüchtet. Die
Medien sind bei Zellvermehrung in geschlossenen Flaschen mit Bikarbonat oder bei
Zellzüchtung in offenen Systemen (z. B. Zellzuchtplatten) mit Tris-HCl (23 mM) und
Natriumbikarbonat auf einen pH Wert von möglichst genau 7,6 zu puffern.
Zum Zeitpunkt der Beimpfung sollten die Zellkulturen frisch (4 bis 48 Stunden alt) und
noch nicht zusammengewachsen (Zellen vermehren sich noch) sein.
Die Empfänglichkeit (Infektionsanfälligkeit) der Zellkulturen ist alle 6 Monate durch
Titration mit VHS- und IHN-Referenzvirusproben (Lagerung bei -80 °C) zu
überprüfen.

FLI 243
Amtliche Methodensammlung Stand: Mai 2013

30.3.2.2. Beimpfen der Zellkultur


Die mit Antibiotikum versetzte Organsuspension wird unverdünnt und 1:10 verdünnt
auf die Zellkultur gegeben, wobei das Verhältnis Inokulum : Zellkulturmedium etwa
1:10 betragen sollte. Dadurch entsteht eine Endverdünnung des Organmaterials im
Zellkulturmedium von etwa 1:100 und 1:1000. Es sind mindesten 2 Zelllinien zu
beimpfen. Für jede Verdünnungsstufe und Zelllinie ist eine Zellkulturfläche von
mindestens 2 cm2 (entspricht einer Mulde einer 24-Well-Zellkulturplatte) zu
verwenden.

30.3.2.3. Bebrüten der Zellkulturen


Die beimpften Zellkulturen sind für 7 bis maximal 10 Tage zu bebrüten. Bei
Übersäuerung des Mediums ist der pH-Wert mit steriler Bikarbonatlösung zu
korrigieren. Die Zellkulturen sind täglich auf das Auftreten eines CPE zu prüfen. Bei
offenkundigem CPE ist ein Virusnachweis durchzuführen.

30.3.2.4. Subkultivierung
Tritt nach 7- bis 10-tägiger Erstbebrütung kein CPE auf, so ist die Stammkultur auf
frische Zellkulturen abzuimpfen, wobei eine ähnliche Zellfläche zu verwenden ist wie
bei der Stammkultur. Die Zellen können durch einen Gefrier-Tau-Prozess zerstört
werden. Aliquote Volumina von sämtlichen Kulturen (Flaschen oder Mulden) jeder
Zelllinie werden zu einer Sammelprobe vereint. Die Sammelproben werden wie vorn
beschrieben unverdünnt und 1:10 verdünnt im Verhältnis 1:10 (wodurch
Endverdünnungen des Überstandes von 1:10 bzw. 1:100 erreicht werden) in
homologe Zellkulturen verimpft. Vor dem Abimpfen können die Sammelproben mit
IPNV-Antiserum gemäß Punkt 3.1.1. inkubiert werden. Die Passagen werden erneut
bei 15 °C für 7, maximal 10 Tage bebrütet.

Tritt bei der Stammkultur ein toxischer CPE innerhalb der ersten 3 Tage des
Bebrütens auf, so ist die Kultur in diesem Stadium zu passagieren. Jedoch muss
diese Passage für 7 Tage und die 3. Passage nach erneuter Abimpfung für weitere 7
Tage bebrütet werden. Wenn sich der toxische CPE später als 3 Tage entwickelt, so
sollte die Stammkultur nur einmal abgeimpft werden und so lange bebrütet werden,
dass eine Gesamtzeit von 14 Tagen ab der Erstbeimpfung erreicht wird. In den
letzten 7 Tagen des Bebrütens sollte keine Toxizität mehr auftreten.

30.3.3. Virusnachweis

30.3.3.1. Virusnachweisverfahren
Bei offenkundigem Auftreten eines CPE erfolgt die Virusidentifizierung mit
mindestens einem der folgenden Verfahren: Virusneutralisationstest,
Immunfluoreszenztest, Enzymimmuntest.

Haben diese Tests nach einer Woche keinen eindeutigen Virusnachweis erbracht, ist
das Isolat an das nationale Referenzlaboratorium für Fischkrankheiten einzusenden.
Die zum Virusnachweis verwendeten Diagnostika müssen bezüglich Qualität, Titer
und Spezifität vom nationalen Referenzlaboratorium zugelassen sein.

FLI 244
Amtliche Methodensammlung Stand: Mai 2013

30.3.3.2. Virusneutralisation (VNT)


Das zellfreie (Zentrifugation bei 2000 bis 4000 x g oder Filtration mit 0,45 μm-
Membranfilter), virushaltige Medium wird 1:1000 und 1:10000 verdünnt. Aliquote
Mengen der Verdünnungen werden jeweils mit folgenden Reagenzien versetzt und
für 60 Minuten bei 15 °C bebrütet:
• gruppenspezifische VHSV (Egtved-Virus)-Antikörper, 1:50 verdünnt,
• gruppenspezifische IHNV-Antikörper, 1:50 verdünnt,
• spezifisches Antiserum (gepoolt) gegen einheimische IPNV-Serotypen
(Referenzstämme Sp, Ab, VR299), 1:50 verdünnt (oder wie vom Hersteller
oder vom Referenzlabor angegeben),
• Zellkulturmedium.

Von jedem Virus-Serum-Gemisch werden 50 μl in mindestens 2 Kavitäten einer 24-


Well-Zellkulturplatte (oder im Verhältnis von etwa 1:10 in andere Zellkulturgefäße)
verimpft und bei 15 °C bebrütet.

Alternativ können auch andere erprobte Neutralisationsteste angewandt werden.

30.3.3.3. Immunfluoreszenztest (IFT)


Für jedes Isolat sind jeweils 8 (bei Untersuchung auf IHNV und VHSV) oder 12 (bei
Untersuchung auf IHNV, VHSV und IPNV) Kavitäten (Multitest-Objektträger, 24-, 48-
oder 96-Well-Zellkulturplatten) oder Deckgläser mit Zellsuspension (EPC-Zellen
haften besonders gut auf Glasflächen) zu versehen. Sobald sich die Zellen auf dem
Untergrund angeheftet haben (nach etwa 1 Stunde) oder nach 24-stündiger
Inkubation werden je 4 (bei Untersuchung auf IHNV und VHSV) oder 6 (bei
Untersuchung auf IHNV, VHSV und IPNV) Kulturen in einem Volumenverhältnis von
1:10 und 1:100 mit dem zu identifizierenden Isolat beimpft. Frühestens nach einer
Bebrütungsdauer von 20 Stunden werden die Kulturen mit PBS gespült, mit Azeton,
mit einem gekühltem (-20 °C) Azeton-Ethanol-Gemisch (gleiche Volumina) bei -20 °C
oder durch Hitze (60 Minuten bei 70 °C) fixiert und z. B. in einem Zweischichten-IFT
(indirekter IFT) angefärbt. Die erste Reagenzschicht besteht aus poly- oder
monoklonalen Antikörpern gegen IHNV bzw. VHSV (sowie IPNV). Die zweite
Reagenzschicht ist ein FITC-markiertes Antiserum gegen das in der ersten Schicht
verwendete Immunglobulin. Für jeden zu prüfenden Antikörper sind mindestens 2
hochdosierte und 2 niedrigdosierte Impfkulturen anzufärben. Bei der Untersuchung
sind geeignete Negativ- und Positivkontrollen mitzuführen. Die Präparate sind bei
UV-Bestrahlung mikroskopisch zu beurteilen (Abb. 2 und 3). Alternativ können auch
andere IFT-Techniken (Zellsysteme, Fixierung, Antikörper, direkte Verfahren)
angewandt werden.

FLI 245
Amtliche Methodensammlung Stand: Mai 2013

Abbildung 2: Indirekter Immunfluoreszenztest zum Nachweis von IHNV in EPC-Zellen


(1 d p. i., Anti-IHNV mAk BioX 1:20, Anti-Maus-Ig-Serum mit FITC DAKO 1.100,
Kernfärbung mit Propdiumiodid)

Abbildung 3: Indirekter Immunfluoreszenztest zum Nachweis von VHSV in RTG-2-Zellen


(1 d p. i., Anti-VHSV mAk BioX 1:20, Anti-Maus-Ig-Serum mit FITC DAKO 1.100,
Kernfärbung mit Propdiumiodid)

30.3.3.4. Enzymimmuntest (ELISA)


Beispielsweise kann ein ELISA auf Biotin-Streptavidin-Basis angewandt werden. Am
Vortag der Untersuchung werden die einzelnen Vertiefungen (Wells) der
Mikrotiterplatte mit über Protein-A-Säulen gereinigten Antikörpern (Fangantikörper) in
der empfohlenen und geprüften Verdünnung beschichtet. Nachdem ungebundene
Antikörper durch einmaliges Waschen mit PBS-Tween-20-Puffer entfernt werden,
erfolgt die Zugabe des zu identifizierenden Virus in der Verdünnung 1:2 oder 1:4 für
60 Minuten bei 37 °C. Nach erneutem Waschen mit PBS-Tween-20-Puffer werden
mit Biotin konjugierte, spezifisch gegen das gesuchte Virus gerichtete Antikörper
zugegeben und für 60 Minuten bei 20 °C inkubiert. Nach nochmaligem Waschen, wie

FLI 246
Amtliche Methodensammlung Stand: Mai 2013

vorstehend beschrieben, wird POD-konjugiertes Streptavidin zugegeben und die


Mikrotestplatte für eine Stunde bei 20 °C inkubiert. Die Mikrotestplatte wird letztmalig
gewaschen und das gebundene Enzym durch Substratumsatz (z. B. OPD oder TMB)
sichtbar gemacht.
Weitere erprobte Antigen-ELISA-Varianten können angewandt werden.

30.3.3.5. Weitere Nachweismethoden


Mit folgenden Methoden, die allerdings in der EU-Gesetzgebung noch nicht
zugelassen sind, kann bei besonderen Fragestellungen IHNV oder VHSV ebenfalls
nachgewiesen werden:
• Reverse Transkriptase-abhängige Polymerase-Kettenreaktion (RT-PCR),
• Immun-Elektronenmikroskopie oder
• Immunoblot.

30.3.4. Probennahme und Diagnoseverfahren zur Bestätigung von


VHS und IHN im Verdachtsfall

30.3.4.1. Probennahme
Zur Untersuchung sind mindestens 10 Fische mit IHN- bzw. VHS- spezifischen
Symptomen auszuwählen. Bei chronischem Verlauf der Krankheit sind Fische mit
zentralnervösen Störungen (Drehbewegungen um Längsachse, spiralförmige
Schwimmbewegungen) zu untersuchen. Von zentralnervös gestörten Fischen ist das
Gehirn zu entnehmen.
Dem zur virologischen Untersuchung eingesandten Organmaterial sind unter
Umständen zusätzliche Proben für die bakteriologische, parasitologische oder
sonstige Untersuchung zur Differentialdiagnose beizufügen (siehe "Diagnostic
Manual for Aquatic Animal Diseases" des O.I.E.)..

30.3.4.2. Nachweisverfahren
Zur IHN- und VHS-Diagnose können folgende Verfahren angewandt werden:
• Herkömmliche Virusisolierung mit anschließendem Virusneutralisationstest,
• Virusisolierung mit gleichzeitigem Virusneutralisationstest,
• andere Diagnoseverfahren (IFT, ELISA).

Der Virusnachweis hat wie unter Punkt 3.3. beschrieben zu erfolgen.

Beim Virusneutralisationstest wird nach der Zentrifugation der Organsuspension und


der Behandlung mit Antibiotika und IPNV-Antiserum der Überstand in
Zellkulturmedium jedoch 1:10 und 1:10000 verdünnt und anschließend mit gleichen
Mengen VHSV- und IHNV-Antikörpern bzw. als Kontrollansatz mit Zellkulturmedium
versetzt.
Die zuletzt genannten Schnellverfahren (IFT und ELISA) müssen durch den
Virusneutralisationstest (siehe Punkt 3.3.) innerhalb von 48 Stunden nach der
Probennahme ergänzt werden, wenn
• ein negatives Ergebnis vorliegt oder
• ein positives Ergebnis vorliegt und das Probenmaterial von einem IHN- oder
VHS-Erstausbruch in einem zugelassenen Gebiet stammt.

FLI 247
Amtliche Methodensammlung Stand: Mai 2013

Organmaterial kann nach anderen Diagnoseverfahren (z. B. IFT mit Gefrierschnitten


oder immunhistochemische Analysen mit Formalin-fixiertem Material) untersucht
werden. Diese Verfahrenstechniken müssen stets durch Verimpfung von nicht
fixiertem Material auf Zellkulturen ergänzt werden.

30.3.4.3. Indirekter Nachweis von IHN und VHS


Serologische Methoden zur Ermittlung von Antikörpern für den indirekten Nachweis
der VHS und IHN sind gegenwärtig in der europäischen Gesetzgebung noch nicht
zugelassen, jedoch insbesondere für epidemiologische Untersuchungen notwendig.

Folgende Methoden können angewandt werden:


• Serumneutralisationstest in verschiedenen Modifikationen,
• indirekter Immunfluoreszenztest,
• verschiedene Enzymimmunteste (ELISA).

30.3.5. Abkürzungen
BF-2 Bluegill fry-2 (Zelllinie)
EPC Epithelioma papulosum cyprini (Zelllinie)
FHM Fathead minnow (Zelllinie)
HRP Meerrettich-Peroxidase
IHN(V) Infektiöse Hämatopoetische Nekrose (Virus)

IPN(V) Infektiöse Pankreasnekrose (Virus)


MEM Minimal Essential Medium
OPD Ortho-Phenyldiamin
PBS Phosphat-gepufferte Kochsalzlösung
RTG-2 Rainbow trout gonad-2 (Zelllinie)
VHS(V) Virale Hämorrhagische Septikämie (Virus)
VNT Virusneutralisationstest

30.3.6. Bezugsquellen für diagnostische Reagenzien und Zellkulturen


FLI, Insel Riems, Institut für Infektionsmedizin - Nationales Referenzlaboratorium für
IHN und VHS:
VHS-Referenzvirus
IHN-Referenzvirus
IPN-Referenzviren (Serotypen Ab, Sp, VR299)
VHSV-Antiserum
IHNV-Antiserum
IPNV-Antiserum

FLI, Insel Riems, Zentralabteilung - Zellbank:


Zelllinien FHM, Katalog-Nr. CCLV RIE 57
Zelllinien RTG-2, Katalog-Nr. CCLV RIE 686
Zelllinien BF-2, Katalog-Nr. CCLV RIE 290

FLI 248
Amtliche Methodensammlung Stand: Mai 2013

Kommerziell erhältliche Diagnostika:


Monoklonale Antikörper Anti-VHSV
Monoklonale Antikörper Anti-IHNV
Monoklonale Antikörper Anti-IPNV
Monoklonale Antikörper Anti-VHSV FITC-konjugiert
Monoklonale Antikörper Anti-IHNV FITC-konjugiert
Monoklonale Antikörper Anti-IPNV FITC-konjugiert
VHSV-Antigen-ELISA
IHNV-Antigen-ELISA
IHNV-VHSV-Antigen-ELISA

FLI 249
Amtliche Methodensammlung Stand: Mai 2013

31. Koi-Herpesvirus-Infektion (KHV-I)

31.1. Charakterisierung der Infektion


Seit Ende der 90er Jahre verursacht das Koi-Herpesvirus (KHV) Massensterben bei
Nutzkarpfen und bei Kois (Cyprinus carpio) weltweit.
Die KHV-Infektion (KHV-I) hat sich durch den unkontrollierten Handel mit infizierten
Kois aber auch mit Speisekarpfen verbreitet und stellt zunehmend einen Risikofaktor
für die Produktion von Nutzkarpfen dar.
Vor diesem Hintergrund wurde in Deutschland 2005 für die Feststellung der KHV-I
bei Nutzkarpfen und 2006 für Kois die Anzeigepflicht eingeführt. Die KHV-I wurde
außerdem in die Liste der bedeutsamen, nicht exotischen Krankheiten in der
Neufassung der Aquakulturrichtlinie (EU-Richtlinie 2006/88/EG) aufgenommen. Auch
das OIE empfiehlt für die KHV-I die Meldepflicht.
.

31.1.1. Erreger
Als Erreger dieser neuartigen Krankheit wurde ein Herpesvirus isoliert und später als
KHV bezeichnet. Die Erkrankung wird international „KHV Disease (KHVD)“, in
Deutschland aber KHV-I genannt. Wissenschaftlich wird das Virus, in Abgrenzung
vom Karpfenpockenvirus (carp pox virus, CyHV-1) und dem Goldfisch-
Hämatopoetischen-Nekrosevirus (GHV, CyHV-2), als Cyprinid Herpesvirus-3 (KHV,
CyHV-3) benannt.
Die erste Isolierung des KHV erfolgte mit der Zelllinie von der Flosse eines Kois (koi
fin cell line) KF-1. Eine weitere Zelllinie vom Gehirn des Karpfens, die common carp
brain cell line (CCB), ist ebenfalls zur Anzüchtung von KHV geeignet. Beide Zelllinien
befinden sich unter den Registriernummern 843 und 816 in der Zellbank für Zelllinien
in der Veterinärmedizin (CCVM) des FLI und stehen den Untersuchungsämtern zur
Verfügung.
Die elektronenmikroskopischen Ultradünnschnittuntersuchungen infizierter Zellen
zeigten zahlreiche Stadien einer Virusproduktion, wie sie für bisher untersuchte
Herpesviren beschrieben wurden (Abb. 1). Dazu gehörten vor allem
Nukleokapsidbildung im Zellkern, primäre Umhüllung an der inneren Kernmembran
und die sekundäre Umhüllung im Bereich des Golgi-Apparats. Morphogenetisch
besonders auffällig war allerdings die vergleichsweise große Zahl akkumulierter
Nukleokapside im Zellkern bzw. Zytoplasma. Dies führte zu zahlreichen
pseudokristallinen Einschlüssen im Zellkern, die häufig aus inkompletten
Nukleokapsiden bestanden.
Die große Anzahl produzierter Nukleokapside stand in deutlichem Widerspruch zur
geringen Ausbeute an reifen Virusnachkommen. Dieses Missverhältnis dürfte auch
die Beobachtung erklären, dass bei elektronenmikroskopischer Untersuchung der
Virusanzüchtungen bzw. Organanreibungen infizierter Tiere im
Negativkontrastverfahren nur sehr selten komplette Virionen nachzuweisen sind.
Eine relativ hohe Empfindlichkeit kompletter Virionen gegenüber äußeren Einflüssen
zeigt sich besonders im Nachweis zahlreicher‚ deformierter Nukleokapside, wie sie
für andere Vertreter der Herpesviridae bisher nicht bekannt sind.
Das doppelsträngige DNA-Genom des KHV ist mit etwa 295 kbp größer als die
Genome aller anderen bisher bekannten Herpesviren.

FLI 250
Amtliche Methodensammlung Stand: Mai 2013

Abbildung 1:
A: KHV markiert mit polyklonalem Hyperimmunserum vom Kaninchen und kolloidalem Gold
(10 nm, GAR 10)
B: KHV markiert mit monoklonalem Antikörper mab 11A4 und kolloidalem Gold
(10 nm, GAM 10). Die Markerlänge entspricht 100 nm (Fotos: Granzow, FLI Insel Riems)

31.1.2. Klinische und pathologisch-anatomische Symptomatik


Die Krankheit zeigt sich klinisch bei Wassertemperaturen zwischen 16 und 29 °C, in
einigen Fällen auch bei Temperaturen zwischen 4 und 12 °C.
Die Inkubationszeit beträgt, abhängig von der Wassertemperatur, der Virulenz des
Erregers und der Empfänglichkeit der Fische, 4 bis 21 Tage, kann aber auch einige
Monate dauern. In latent infizierten Fischen kann der Viruseintrag Jahre zurück
liegen. Die Morbidität beträgt bei Wassertemperaturen zwischen 18 und 26 °C meist
100 %, die Mortalität ist in der Regel sehr hoch und kann ebenfalls bis zu 100 %
erreichen. Bei den erkrankten Fischen sind die wichtigsten Symptome Atemnot,
Kiemenverfärbungen und -nekrosen (Abb. 2), Inappetenz bis hin zur Anorexie,
Enophthalmus (Abb. 3), Flossenerosionen, Hautläsionen (meist mit verstärkter
milchig-grauer Schleimbildung zu Beginn der Erkrankung), später Blutungen,
Schleimhautablösung (Sandpapierhaut) und großflächige Entzündungen (Abb. 4).
Inapparente latente Infektionen können auftreten.

Das klinische Bild einer KHV-I ist definiert als eine mit Haut- und
Kiemenveränderungen einhergehende Krankheit der Karpfen mit folgenden
Anzeichen, die nicht in jedem Fall klinisch manifest sein müssen:
• Mortalität: 10-100 %
(u. a. abhängig von der Wassertemperatur und der Virulenz des Erregers)
• Apathie
• Atemnot
• Inappetenz / Anorexie
• Kiemenblässe und -nekrosen
• Enophthalmus, selten aber auch Exophthalmus
• Blutungen am Flossenansatz und in der Haut
• kreisrunde bis konfluierende Schleimhautläsionen verbunden mit
Schleimhautablösungen

Bei akutem Krankheitsgeschehen sind die Fische apathisch, inappetent, liegen


teilweise regungslos am Teichboden oder befinden sich in strömungsschwachen
Zonen in der Nähe des Wassereinlaufes bzw. an der Wasseroberfläche.

FLI 251
Amtliche Methodensammlung Stand: Mai 2013

Abbildung 2:
Kieme eines erkrankten Kois mit umfangreicher
Nekrose (Foto Kleingeld, LAVES Hannover

Abbildung 3:
Enophthalmus beim Karpfen
(Foto: Bergmann, FLI, Insel Riems)

Abbildung 4: Moribunder Karpfen mit vermehrter Schleimbildung (Rücken) und Blutungen


an Bauch und den Flossen. (Foto: Bergmann, FLI, Insel Riems)

FLI 252
Amtliche Methodensammlung Stand: Mai 2013

31.1.3. Vorkommen
Der erste Ausbruch der Krankheit bei Nutzkarpfen wurde im Mai 1998 in Israel
beobachtet. Bis zum Ende des Jahres 2000 hat die Krankheit bis zu 90 % der
Fischfarmen Israels erfasst und verursachte in der Aquakultur jährlich Kosten von
300 Mill. US$. In den USA wurde die Krankheit erstmals Ende 1998 bei einem aus
Israel importierten Koi beobachtet.
Erste Hinweise über „Massensterben“ bei Nutzkarpfen in Verbindung mit dem KHV
wurden 1997 und 1998 in Deutschland beobachtet. In den Folgejahren wurde das
KHV weltweit in zahlreichen Ländern nachgewiesen.

Die wirtschaftliche Bedeutung des KHV als Erreger einer Fischseuche unterstreichen
zwei Ausbrüche in Deutschland. Im Sommer 2003 kam es zu Ausbrüchen in 3
Teichwirtschaften in Sachsen. Die Mortalität betrug zwischen 20 und 100 %. Die
Gesamtverluste betrugen 48 t Karpfen. Der direkte Schaden durch Fischverluste
wurde mit etwa 130.000 € beziffert. Für Folgeschäden wurden nochmals 200.000 €
errechnet. Ein weiterer KHV-I-Ausbruch wurde 2004 in einer Teichanlage in
Thüringen festgestellt. Die Gesamtverluste betrugen 80 t Karpfen, mit einem direkten
Schaden in Höhe von 310.000 € und Folgeschäden von insgesamt 106.000 €. Die
KHV-I-Ausbrüche setzten sich seither vor allem im Freistaat Sachsen fort.

Nach bisherigen Kenntnissen können nur Nutzkarpfen und Kois an der KHV-I klinisch
erkranken. Offensichtlich wird das KHV in weiteren Spezies, wie z. B. in Goldfischen,
Karauschen, Schleien und Graskarpfen, vermehrt und weitere Fischarten stehen in
Verdacht, das Virus als Carrier zu beherbergen und an empfängliche Karpfen
weiterzugeben

31.1.3.1. Voraussetzungen für den Verdacht


• Gehäufte Todesfälle mit charakteristischen pathologisch-anatomischen Befunden
• Typische klinische Symptome
• Todesfälle in Verbindung mit epidemiologischen Zusammenhängen zu einem
labordiagnostisch bestätigten KHV-I-Fall

31.1.3.2. Epidemiologischer Zusammenhang


• Lebendfischbewegungen (u. a. Transporte, Zukäufe, Abgaben, Umsetzungen)
• Kontakte (Personen, Geräte, Wasser) zu anderen Betrieben
• Aussetzen KHV-infizierter Karpfen / Koi-Karpfen in Gewässer
• weitere Spezies (u. a. Goldfische, Schleien, Graskarpfen, Karauschen, Störe)
können Überträger des KHV sein, ohne selbst zu erkranken.

31.1.4. Bekämpfung
Derzeitig konzentrieren sich die Maßnahmen in der EU auf die Bekämpfung und die
Verhinderung der weiteren Ausbreitung der KHV-I. Die Strategie zur Zurückdrängung
dieser Fischseuche basiert auf der Schaffung anerkannt seuchenfreier
Aquakulturbetriebe, Zonen oder Länder.
In Deutschland hat nach der neuen Fischseuchen-VO vom 24.11.2008 eine
Registrierung aller Fischhaltungsbetriebe zu erfolgen. Nach Prüfung der Unterlagen
ist zu entscheiden, ob von dem Betrieb eine Seuchengefahr ausgehen kann und

FLI 253
Amtliche Methodensammlung Stand: Mai 2013

deshalb das Halten von Fischen genehmigungspflichtig ist. Nach der Registrierung
sind die Fischhaltungsbetriebe in die Kategorien I „als seuchenfrei erklärt“ bis V
„Infektionen nachgewiesen“ einzuordnen. Die Kategorisierung dient in erster Linie
der Feststellung der Kontrollhäufigkeit und der Feststellung der möglichen
Lebendfischbewegungen. Fische dürfen zum Zwecke des Besatzes grundsätzlich nur
in Betriebe gleicher oder niedrigerem Kategorie-Status (höhere Kategorie-Nr.)
verbracht werden. Kategorie IV- und Kategorie II-Betriebe dürfen Fische allerdings
ausschließlich nur aus Kategorie I-Betrieben, also keine Fische aus Betrieben mit
gleichem Status, zukaufen.
Bei amtlicher Feststellung der KHV-I in einem Fischhaltungsbetrieb sind die
seuchenkranken oder seuchenverdächtigen Fische zu töten und unschädlich zu
beseitigen. Es werden Sperr- und Beobachtungsgebiete festgelegt und Maßnahmen
zur Tilgung des Seuchenherdes erlassen. Bei der KHV-I werden in Ergänzung zu
den Festlegungen in der Fischseuchen-Verordnung gesonderte Maßnahmen
getroffen.

31.1.5. Zuständige Untersuchungseinrichtungen


Die labordiagnostischen Untersuchungen (virologisch/molekularbiologisch) zum
Nachweis der Freiheit der Fischbestände von diesen Krankheitserregern bzw. zur
Überwachung der Seuchenfreiheit sowie zur Bestätigung von KHV-I-Verdachtsfällen
werden in den zugelassenen und akkreditierten Laboren und
Untersuchungseinrichtungen in den Bundesländern durchgeführt. Das Nationale
Referenzlaboratorium für die KHV-I (NRL KHV-I) am Friedrich-Loeffler-Institut Insel
Riems koordiniert die Diagnose auf der Grundlage der EU- und nationalen
Gesetzgebung. Zur Klärung verdächtiger Befunde oder zur Bestätigung der
Ergebnisse der regionalen Diagnoselaboratorien bei Ausbruch der KHV-I in einem
bisher freien Gebiet sind Virusisolate bzw. Amplifikate / Organmaterial / extrahierte
DNA zur Identifizierung oder weiteren Charakterisierung an das NRL KHV-I
einzusenden. Repräsentative Isolate oder Nukleinsäure-Präparationen werden dem
EU-Referenzlaboratorium übergeben, das die Diagnostik der Fischseuchen auf EU-
Ebene koordiniert.

31.1.6. Rechtsgrundlagen
KHV-I wurde in Deutschland im Dezember 2005 in die Verordnung über
anzeigepflichtige Krankheiten aufgenommen. Die Anzeigepflicht für KHV-I wurde
zunächst nur auf den Nachweis bei Nutzkarpfen beschränkt, 2006 jedoch auch auf
Kois ausgedehnt.

In der EU-Richtlinie 2006/88/EG ist die KHV-I im Anhang IV in der Liste der nicht-
exotischen Krankheiten aufgeführt, für die bei Feststellung
Mindestbekämpfungsmaßnahmen festgelegt wurden. Die Überführung der EU-
Richtlinie in nationales Recht erfolgte durch die „Fischseuchenverordnung und
Verordnung zur Änderung der Verordnung über anzeigepflichtige Tierseuchen vom
24. November 2008 (Fischseuchen-Verordnung)“.

Seit Januar 2006 besteht auch Meldepflicht beim OIE.

FLI 254
Amtliche Methodensammlung Stand: Mai 2013

KHV-I wurde in Deutschland im Dezember 2005 in die Verordnung über


anzeigepflichtige Krankheiten aufgenommen. Die Anzeigepflicht für KHV-I wurde
zunächst nur auf den Nachweis bei Nutzkarpfen beschränkt, 2006 jedoch auch auf
Kois ausgedehnt.
In der EU-Richtlinie 2006/88/EG ist die KHV-I im Anhang IV in der Liste der nicht-
exotischen Krankheiten aufgeführt, für die bei Feststellung
Mindestbekämpfungsmaßnahmen festgelegt wurden. Die Überführung der EU-
Richtlinie in nationales Recht erfolgte durch die „Fischseuchenverordnung und
Verordnung zur Änderung der Verordnung über anzeigepflichtige Tierseuchen vom
24. November 2008 (Fischseuchen-Verordnung)“.

Seit Januar 2006 besteht auch Meldepflicht beim OIE.

Die Diagnose und Bekämpfung der KHV-I wird in Deutschland durch die
Fischseuchen-Verordnung in Verbindung mit der Verordnung über anzeigepflichtige
Krankheiten auf der Grundlage der EU-Richtlinie 2006/88/EG geregelt.

Eine Anleitung zur Diagnose der KHV-I und weiterer, gegebenenfalls


differentialdiagnostisch abzugrenzender Fischkrankheiten ist auch im "Manual for
Diagnostic Tests for Aquatic Animals" des OIE erschienen. Eine derartige Diagnose-
Richtlinie für die Harmonisierung der KHV-Diagnostik in der EU in Form eines
Handbuches ist bisher nur als Entwurf erschienen.

31.2. Untersuchungsmaterial
31.2.1. Zeitplan
Der Betreiber eines Fischhaltungsbetriebes hat seinen Fischbestand regelmäßig
durch die zuständige Behörde und durch die „mit der Gesundheit von Wassertieren
befassten qualifizierten Dienste“, in Deutschland sind das i. d. R. die
Fischgesundheitsdienste, klinisch und ggf. auch virologisch untersuchen zu lassen.
Die Kontrollhäufigkeit ist abhängig von der Einordnung des Aquakulturbetriebes in
die Kategorien und der damit festgelegten Art der Überwachung laut EU-Richtlinie
2006/88/EG und im Anhang III, Teil B dieser Richtlinie festgelegt.
Es wird empfohlen, die Probennahme an Fischen, die mindestens vier Monate alt
sind, durchzuführen. Dabei sollte während einer Zeitspanne von wenigstens 4
Wochen eine Wassertemperatur von 16-18 °C oder höher gewährleistet sein. Neuere
Untersuchungen zeigen, dass sich das Virus auch bei niederen Wassertemperaturen
ab 4-5 °C im Karpfen vermehren kann. Es wird angeraten, dass zu untersuchende,
gesunde Fische mindestens 24 h vor der Beprobung separat gesetzt werden. Wird
als Ergebnis der klinischen und pathologisch-anatomischen Untersuchung oder
aufgrund epizootiologischer Erhebungen der Verdacht des Ausbruchs einer KHV-I
geäußert, sind Fische oder Organproben an die zuständige diagnostische
Einrichtung zur labordiagnostischen Prüfung einzusenden.

31.2.2. Wahl und Entnahme der Proben


Die Probennahme ist beim Nutzkarpfen und beim Koi und gegebenenfalls bei
weiteren empfänglichen Arten durchzuführen.

FLI 255
Amtliche Methodensammlung Stand: Mai 2013

Alle Produktionseinheiten (Teiche, Rinnen, Behälter, Netzkäfige usw.) sind auf


verendete, geschwächte oder verhaltensgestörte Fische zu kontrollieren. Proben sind
je nach Fischalter und -herkunft gesondert zu entnehmen. Bei der Probenauswahl
sind bevorzugt geschwächte, verhaltensgestörte, moribunde oder frisch verendete
Fische (ohne Anzeichen der Zersetzung) zu berücksichtigen.
Die zu untersuchenden Proben sollten bei klinisch kranken Tieren unter 5 cm aus
mindestens 20 Tieren (4 Pools á 5 Fische), bei klinisch kranken Fischen über 5 cm
Länge aus mindestens 10 Fischen (5 Pools á 2 Fische) bestehen. Klinisch
unauffällige Fische sollten mindestens 24 h, aber höchsten 4 Tage vor der
Beprobung, separat gehältert werden. Zur Beprobung sollten bei Fischen unter 5 cm
mindestens 20 Tiere (4 Pools á 5 Fische), bei Fischen über 5 cm mindestens 10
Tiere in 5 Pools mit 2 Tieren verwendet werden.
Von den Fischen sind Organe bzw. Organteile (Kiementeile und Rumpfniere) zu
entnehmen. Bei Laichfischen oder anderen Fischen, bei denen eine Tötung
vermieden werden soll, kann sich die Probennahme am Einzeltier auf Blutentnahme
zur Leukozytenseparation bzw. auf Kiemenabstriche / -bioptate nach mindestens 24-
stündiger aber höchsten 4 Tage separater Haltung beschränken, wenn die
zuständige Behörde nichts anderes anordnet. Die Aussagekraft solcher
Lebendfischuntersuchungen ist jedoch u. U. eingeschränkt.

31.2.2.1. Kiemenabstriche
Zur zusätzlichen Absicherung können Kiemenabstriche mit sterilen Ohrtupfern von
umgesetzten Tieren (24 Stunden bis 4 Tage nach der Umsetzung,
Einzeltieruntersuchungen) bzw. beim Ausbruch (Abb. 5 a) in Isopropanol (1 ml
Isopropanol), besser jedoch direkt in einen PCR-Lysis-Puffer (z. B. 180 µl ATL mit 20
µl Proteinase K, Qiagen) in einem sterilen 2 ml Eppendorfgefäß ungekühlt versandt
werden. Auf den Tupfern muss Blut zu erkennen sein (Abb. 5 b). Bei der
Verwendung von PCR-Lysis-Puffer muss die DNA-Extraktion spätestens 48 h nach
Probennahme erfolgen. Werden die Kiemenabstriche in Isopropanol transportiert
oder gelagert, müssen die Eppendorfröhrchen zentrifugiert (3000 U / Min., 10 Min., 4
°C), das Isopropanol unter Erhalt des entstandenen Pellets abgegossen und des
Ohrtupfers kurz (5-10 Min.) getrocknet werden. Der getrocknete Ohrtupfer wird
anschließend zum Pellet gegeben und mit z. B. 180 µl ATL-Lysispuffer mit
Proteinase K für mindestens 3 h bei 56 °C inkubiert. Während der Vorbereitung für
die DNA-Extraktion mit dem z. B. Qiagen-Kit wird der Ohrtupfen danach bis zur
Überführung der Lösung auf die Silikat-Säulchen immer im Eppendorfgefäß
belassen.

Abbildung 5a:
Kiemenabstrich
beim Karpfen
Abbildung 5b:
Blutiger Tupfer
(Fotos:
Bergmann, FLI,
Insel Riems)

Zum
Ausschluss
einer latenten Infektion mit dem KHV sollten die

FLI 256
Amtliche Methodensammlung Stand: Mai 2013

Fische mittels eines simulierten (Abkeschern und für 30 Sek. bis 1 Min. an der Luft
halten) oder eines tatsächlichen Transports dazu gebracht werden, das latente KHV
zu reaktivieren. Die Probennahme soll frühestens nach 24 h, spätestens jedoch nach
4 Tagen nach dem Transport wie beschrieben erfolgen.

31.2.3. Aufbereitung und Einsendung der Proben


Lebende Fische sind in geeigneten Transportbehältnissen gekühlt (mind. 10 °C) und
auf dem schnellsten Weg zur Untersuchungsstelle zu transportieren.
Frisch-tote Fische können unzerteilt zum Labor gesandt werden, sofern die
Temperaturanforderungen (Kühlung, mind. 10 °C im Transportgefäß) während der
Beförderung erfüllt werden können (nicht einfrieren).
Organe/Organteile (Kieme und Niere) und/oder Blutproben (Gerinnungshemmer, z.
B. Heparin) sind unter sterilen Kautelen zu entnehmen und in ein steriles
Kunststoffröhrchen mit Transportmedium (z. B. Zellzuchtmedium mit 10-fachem
Antibiotika-Zusatz) zu geben. Die Proben sind sofort auf unter 10 °C zu kühlen.
Während Blutproben und Abstriche von Einzeltieren einzusenden sind (keine
Poolproben), können Organe als Sammelproben zur Untersuchung übergeben
werden.

Eine Sammelprobe kann Organteile von höchstens 5 klinisch erkrankten Fischen


über 5 cm und von höchstens 10 klinisch erkrankten Fischen unter 5 cm (2 Pools á
10 Fische, insgesamt mindestens 0,5 g) je Probengefäß beinhalten. Bei klinisch
unauffälligen Fischen sollten bei Tieren über 5 cm höchstens 2 Fische und bei Tieren
unter 5 cm höchstens 5 Fische im Pool untersucht werden.
Im Gegensatz dazu empfiehlt das OIE-Referenzlabor umgekehrt beim klinischen
KHV-I-Ausbruch nicht mehr als 2 Fische zu poolen, bei unauffälligen, gesunden
Fischen bis zu 5 Tieren im Pool.

Die Probengefäße sind in Isolierbehältern gekühlt zum Labor zu transportieren.


Der Einsendetermin soll mit der Untersuchungsstelle abgesprochen sein.
Im Einvernehmen mit dem Diagnoselaboratorium kann weiteres Probenmaterial
entnommen und für weitere Untersuchungen aufbereitet werden.
Für den Versand von Probenmaterial in Alkohol, wenn nicht innerhalb von 48 h
untersucht werden kann, wird Isopropanol (100 %) bzw. ein PCR-Lysis-Puffer
empfohlen. Ethanol in jeglicher Konzentration scheint ungeeignet zu sein und kann
nach einer kurzen Lagerungszeit der Proben von über 7 Tagen zu falsch-negativen
Ergebnissen führen.

31.3. Untersuchungsgang
31.3.1. Aufbereitung der Proben für die Untersuchung
Die Methode der Wahl ist die molekularbiologische Untersuchung mittels PCR
(Genomnachweis). Organteile sind zu entnehmen, anzureiben (mindestens 4 h bei
15 °C oder über Nacht bei 4 °C) oder mit einem Tissue-Lyser zu zerkleinern und für
die Extraktion zu zentrifugieren. Der Überstand kann für die virologische
Untersuchung und das Zentrifugat (Pellet) für den Genomnachweis verwendet
werden. Die DNA ist sofort z. B. mit der DNAzol ®-Methode (Invitrogen) oder mittels

FLI 257
Amtliche Methodensammlung Stand: Mai 2013

Silikatsäulchen (Qiagen) zu extrahieren. Die extrahierte DNA kann bei -20 °C für
mindestens drei Monate eingefroren bleiben.
Für den Genomnachweis können bei Fischen über 5 cm Länge die Organe von bis
zu 2 Fischen (insbesondere Kieme und Niere) zusammen bearbeitet werden. Fische
unter 5 cm können zu je 5 Exemplaren zusammen bearbeitet werden. Von den
heparinisierten Blutproben ist für den Virusgenom-Nachweis die Leukozytenfraktion
unter Verwendung von Histopaque 1077 (Sigma), Percoll (Sigma) oder Lympho-Prep
(AXIS-SHIELD PoC AS, Dänemark) nach Angaben der Hersteller zu gewinnen.

31.3.1.1. Gewinnung der Leukozytenfraktion aus heparinisiertem Blut


Fische werden betäubt und aus der Schwanzvene (Abb. 6) oder dem Herzen wird
Blut mit einer passenden Spritze (je kleiner die Fische, desto kleiner die Spritze und
die Kanüle) gewonnen. Mengen zwischen 0,5 und 1 ml sind optimal für die
Fraktionierung. Es können aber auch wesentlich kleinere Mengen (50 bis 200 μl Blut)
verwendet werden. Das Blut wird sofort nach der Entnahme in ein isotonisches
Medium, bestens geeignet ist Zellkulturmedium, im Verhältnis 1:3 bis 1:4 gegeben,
geringere Mengen sind möglich. Die Suspension ist sofort auf unter 10 °C zu kühlen.
Die weitere Bearbeitung sollte spätestens nach 30 Min. bis maximal 1 h erfolgen, da
das Blut gerinnen könnte. Die Suspension wird auf 3 ml z. B. Histopaque 1077
überschichtet und danach für 40 Min. bei 800 g und 4 °C zentrifugiert. Die
Leukozytenfraktion befindet sich i. d. R. deutlich sichtbar im klaren Überstand. Nach
Abnahme der Leukozyten (ca. 1 bis 2 ml) mit einer Pipette sind diese mit 10 ml PBS-
zu waschen. Nach vorsichtiger Mischung wird erneut zentrifugiert (10 Min., 900 bis
1000 g, 4 °C). Gegebenenfalls ist dieser Waschvorgang zu wiederholen. Das
entstehende Pellet wird in 1 ml PBS- aufgenommen und es erfolgt eine Zählung der
weißen Blutzellen. Zur weiteren Untersuchung bzw. zur Verwendung in der PCR
bzw. der Zellkultivierung werden die Leukozyten auf 1x107 Zellen/ml eingestellt.
Geringere Zellzahlen sind möglich, bei höheren Zellzahlen kann z. B. die PCR
inhibiert werden. Für die PCR wird anschließend 1 ml mit eingestellter Zellzahl
abgenommen, die Zellen wiederum pelletiert (1000 g, 10 Min., 4 °C), der Überstand
entfernt und das Pellet in 200 μl PBS- resuspendiert. Diese Leukozyten-Präparation
kann für die IFT, die in-situ Hybridisierung (ISH) und für die PCR verwendet werden.

Abbildung 6:
Blutentnahme aus der Schwanzvene eines Koi
(Foto Kleingeld, LAVES Hannover)

FLI 258
Amtliche Methodensammlung Stand: Mai 2013

Leukozytenproben müssen einzeln bearbeitet werden. Es wird empfohlen, die


Leukozyten auf maximal 1 x 107 Zellen/ml einzustellen. Für die PCR sollten
anschließend 200-300 µl für die Extraktion der DNA verwendet werden.

31.3.2. Genomnachweis in Organanreibungen und in Leukozyten-


Präparationen
Empfohlen wird die Aufarbeitung von 25 bis 50 mg Organmaterial oder 1x 107
Leukozyten/ml von einem Fisch. Die DNA wird mittels DNAzol®-Methode (Invitrogen)
bzw. Silikatsäulen (Qiagen) gewonnen. Bei der Extraktion ist darauf zu achten, dass
es, entsprechend der Herstellerangaben, zu keiner Überladung der Säulchen mit
DNA kommt, dies besonders bei Poolproben.

Die sensitivsten genomischen Methoden zum KHV-Nachweis sind:


1. die realtime PCR nach Gilad et al., 2004 (5),
2. die PCR nach Gilad et al., 2002 (4) gefolgt von der
3. nested PCR (Bergmann et al., 2006 (2)) mit den Primerpaaren KHV-1Fn-1Rn
nach der Gilad-PCR (4) oder
4. zur Bestätigung im NRL für die KHV-I die „one-tube“ semi-nested PCR nach
Bergmann et al., 2010 (3).

Einige gegenwärtig in Europa und Asien auftretende KHV reagieren nicht in allen
PCR gleichmäßig mit einem positiven Ergebnis. Im negativen Fall bei eindeutiger
Klinik sind weitere publizierte PCRs zur Sicherstellung der Diagnose heranzuziehen.
Das OIE empfiehlt die PCR nach Bercovier et al., 2005 (1) bzw. die PCR nach Yuasa
et al., 2005 oder die „one-tube“ semi-nested PCR nach Bergmann et al., 2010 (3).
Weitere im NRL etablierte PCR-Methoden zum Nachweis verschiedener Gene des
KHV stehen zur Verfügung.

31.3.2.1. PCR zum KHV-Genomnachweis


Neben der empfohlenen real-time PCR (5) kann die Untersuchung auch
entsprechend der Empfehlungen des OIE-Referenzlabors in Weymouth (UK) mit
einer konventionellen PCR, der sich eine nested PCR anschließt, durchgeführt
werden. In diesem Untersuchungsgang besteht allerdings eine hohe
Kontaminationsgefahr im Labor. Um diese Gefahr zu minimieren, wurde eine „one-
tube“ semi-nested PCR (3) entwickelt, welche die gleiche Sensitivität und Spezifität
wie die real-time PCR (5) besitzt und ca. 5 bis 10 Viruspartikeln in 25 bis 30 mg
Gewebe bzw. in 107 Leukozyten/ml nachweisen kann.

Vom OIE-Referenzlabor wird weiterhin die Verwendung der GoTaq® DNA-


Polymerase (Promega) empfohlen. Als Mastermix für die PCR kann folgende
Reaktionsmischung verwendet werden:

FLI 259
Amtliche Methodensammlung Stand: Mai 2013

25 μl PCR-Ansatz mit verschiedenen DNA-Template-Volumina (Angaben in μl, alle


Primer mit 50 pmol/µl))

PCR- 5x MgCl 2 * dNTP’s Primer Primer (s-) GoTaq* DNA


Wasser buffer* (25 mM) (s+)
13,7 5 2,5 0,25 0,5 0,5 0,125 2,5 μl
11,2 5 2,5 0,25 0,5 0,5 0,125 5,0 μl
* im GoTaq ® Flexi-Kit (Promega) enthalten

Folgende Primerpaare werden für die PCR empfohlen:

Gen des Vorwärtsprimer Rückwärtsprimer Referenz /


KHV Fragmentgröße
Fragment 5’-GAC GAC GCC GGA 5‚-CAC AAG TTC AGT Gilad et al. (2002
(ORF 89- GAC CTT GTG-3’ CTG TTC CTC AAC-3‚ (4) / 484 bp
90)

Für die nested PCR im Anschluss an die PCR nach Gilad et al. (2002) werden
folgende Primer empfohlen (Bergmann et al. 2006 (4)):

Gen des Vorwärtsprimer Rückwärtsprimer Referenz


KHV
Fragment 5’-CTC GCC GAG CAG 5’-TCA TGC TCT CCG Bergmann et al.
(ORF 89- AGG AAG CGC-3’ AGG CCA GCG G-3’ (2006 (2)) / 414 bp
90)

Um eine Vergleichbarkeit der Reaktionen zu gewährleisten, wurde die PCRs so


adaptiert, dass sie nur ein Programm benötigen.

Als PCR-Programm wird empfohlen:

PCR nested PCR


Initiale Denaturierung 5 Min., 95 °C 5 Min., 95 °C
Denaturierung 1 Min., 95 °C 30 Sek., 95 °C
Annealing 1 Min., 68 °C 34 Zyklen 30 Sek., 68 °C 25 Zyklen
Polymerisation 1 Min., 72 °C 30 Sek., 72 °C
Finale Polymerisation 7 Min., 72 °C 7 Min., 72 °C

Die real-time PCR ist entsprechend der Publikationen (Gilad et al., 2004 (5) und
Bergmann et al., 2010 (3)) einzusetzen.

Bei negativem PCR-Ergebnis, aber verdächtiger Klinik, aber auch zur


Routinediagnostik, kann die „one-tube“ semi-nested PCR (2) vor allem im NRL
verwendet werden. In diesem Fall werden 4 Primer (ein Vorwärts- und 3 Rückwärts-
Primer) eingesetzt.

FLI 260
Amtliche Methodensammlung Stand: Mai 2013

Für die „one-tube“ semi-nested PCR (sn PCR) wird folgender Mastermix (Primer je
50 pmol/µl) empfohlen (alles in µl):

PCR- 5x MgCl 2 dNTP’s Sn F Sn R Sn R Sn R GoTaq DNA


Wasser buffer 1 1 2 3
1x 10 5 5 0,5 1,0 0,2 0,3 0,6 0,125 2,5
1x 7,5 5 5 0,5 1,0 0,2 0,3 0,6 0,125 5

Als Primer werden verwendet:

Gen des Sn F 1 Sn R 1 Sn R 2 SnR 3 Referenz


KHV
ORF 56 ggtacttgttgg cgg ttg tca gca gcg agg agc cgt ggt ggc Bergmann et
cgtacatggc gca cct caa aca tcg cgc cgt cgc al. (2010 (3))

Als Programm wird empfohlen:

sn PCR
Initiale Denaturierung 5 Min., 95 °C
Denaturierung 1 Min., 95 °C
Annealing 1 Min., 68 °C 5 Zyklen
Polymerisation 1 Min., 72 °C
Denaturierung 1 Min., 95 °C
Annealing 1 Min., 65 °C 20 Zyklen
Polymerisation 1 Min., 72 °C
Denaturierung 1 Min., 95 °C
Annealing 1 Min., 60 °C 20 Zyklen
Polymerisation 1 Min., 72 °C
Finale Polymerisation 7 Min., 72 °C

Mögliche Produkte sind: 462 bp (F1-R1), 372 bp (F1-R2), aber hauptsächlich 182 bp
(F1-R3).

31.3.3. Virologische Untersuchung und Isolierung der KHV in Zellen


Virologische Nachweise in Zellkulturen sind zum Nachweis und Charakterisierung
von KHV ungeeignet, da sich das Virus selten in den zur Verfügung stehenden
Zelllinien KF-1 und CCB isolieren lässt.

31.3.4. Antigen- und Erregernachweis


Der Antigennachweis und die Identifizierung des Virus können nach erfolgreicher
Isolierung in der Zellkultur mittels Immunfluoreszenztest erfolgen. Es wird die
Verwendung monoklonaler Antikörper gegen das KHV empfohlen.
Virus-Antigen kann bei akuten Ausbrüchen mit hoher Viruslast mit einem
kommerziellen KHV-Antigen-ELISA (Kovax, Israel) bzw. mit einem Lateral-Flow-
Assay (FastTest ® Koi HV, Megacor, Österreich) nachgewiesen werden. Beide Tests
benötigen jedoch große Mengen an KHV (mindestens 105 bis 106 Partikeln / ml) im
Organ bzw. den Fäces für den Nachweis. Nur ein positiver Befund ist aussagekräftig.

FLI 261
Amtliche Methodensammlung Stand: Mai 2013

An einem sensitiveren Antigen-ELISA wird derzeit im NRL gearbeitet.


Die zum Nachweis verwendeten Diagnostika müssen zugelassen und vom NRL für
die KHV-I geprüft sein.

31.3.5. Weitere Angaben zum Genom-, Virus- und Antikörpernachweis


1. Bercovier H., Fishman Y., Nahary R., Sinai S., Zlotkin A., Eyngor M., Gilad O.,
Eldar A. and R. Hedrick (2005) Cloning of the koi herpesvirus (KHV) gene
encoding thymidine kinase and its use for a highly sensitive PCR based
diagnosis. BMC Microbiology 5, 13.
2. Bergmann, S. M., Kempter, J., Sadowski, J. and Fichtner, D. (2006) First
detection, confirmation and isolation of koi herpesvirus (KHV) in cultured
common carp (Cyprinus carpio L.) in Poland. Bulletin of European Association
of Fish Pathologists 26: 97-104.
3. Bergmann Sven. M., Meike Riechardt, Dieter Fichtner, Peiyu Lee, Jolanta
Kempter (2010) Investigation on the diagnostic sensitivity of molecular tools
used for detection of koi herpesvirus (KHV). Journal of Virological Methods 163:
229-233.
4. Gilad, O., Yun, S., Andree, K.B., Adkinson, M.A., Zlotkin, A., Bercovier, H.,
Eldar, A. and Hedrick, R.P. (2002). Initial characteristics of koi herpesvirus and
development of a polymerase chain reaction assay to detect the virus in koi,
Cyprinus carpio koi. Dis. Aquat. Org. 48: 101-108.
5. Gilad O, Yun S, Zagmutt-Vergara FJ, Leutenegger CM, Bercovier H, Hedrick
RP (2004) Concentrations of a koi herpesvirus (KHV) in tissues of
experimentally infected Cyprinus carpio koi as assessed by real-time TaqMan
PCR. Dis Aquat Org 60:179-187.

Abkürzungen
PCR Polymerase-Kettenreaktion
PBS Phosphat-gepufferte Salzlösung
CCB common carp brain cells
KF-1 koi fin-1 cells
CPE Cytopathischer Effekt
NRL Nationales Referenzlabor

Bezugsquellen für diagnostische Reagenzien und Zellkulturen


FLI, Institut für Infektionsmedizin, Insel Riems, NRL für die KHV-I:
• KHV-Referenzvirus (KHV-I, USA)
• KHV-Nukleinsäure-Präparation
• KHV-Antiserum (vom Kaninchen, begrenzte Abgabe)
• Zelllinien RIE 816 (CCB) und RIE 843 (KF-1) vom CCLV Insel Riems

Kommerziell erhältliche Diagnostika


• Monoklonale Antikörper Anti-KHV (BioX Belgien)
• Monoklonale Antikörper Anti-KHV (Aquadiagnostics, ADL, UK)

FLI 262
Amtliche Methodensammlung Stand: Mai 2013

32. Lumpy-skin-Krankheit (Dermatitis nodularis)

Die Lumpy skin Erkrankung wird durch das Capripoxvirus bovis nodularis aus der
Gattung Capripoxvirus verursacht. Das Virus gehört zu den Pockenviren und ist nah
mit den Erregern der Schaf- und Ziegenpocken verwandt. Für weitere Informationen
siehe Kapitel zur Pockenseuche der Schafe und Ziegen.

In Deutschland anzeigepflichtig seit: 23.05.1991

FLI 263
Amtliche Methodensammlung Stand: Mai 2013

33. Lungenseuche der Rinder

33.1. Charakterisierung der Infektion


33.1.1. Erreger
Mycoplasma mycoides subspecies mycoides Small Colony Type (MmmSC). Es
handelt sich dabei um die kleinsten auf zellfreiem Medium wachsenden Bakterien
(0,3 bis 0,8 µm), die zur Klasse Mollicutes gehören. Sie besitzen keine Zellwand und
bilden auf festem Nährmedium typische spiegeleiförmige Kolonien.

33.1.2. Klinische Symptomatik


Die Lungenseuche ist eine hochkontagiöse bakterielle Erkrankung der
Rindergattung, bei der erwachsene Tiere in erster Linie am Atmungsapparat und
Kälber vor allem an den Gelenken erkranken. Außer beim Hausrind kommt die
Lungenseuche auch beim Büffel, Yak und Bison vor. Die Lungenseuche ist weit
verbreitet in Afrika und einigen Ländern Asiens (aktuelles Vorkommen der Krankheit
siehe unter http://www.oie.int/hs2/report.asp ). In Europa traten die letzten Fälle
1999 in Portugal auf. Weitere Ausbrüche gab es bis in den 90er Jahren in Spanien
und Italien. Deutschland ist seit vielen Jahren frei von Lungenseuche. Der letzte Fall
in Deutschland stammt aus dem Jahre 1926. Aufgrund des verbreiteten Tierhandels
besteht allerdings jederzeit Einschleppungsgefahr für Deutschland.
Der Erreger der Lungenseuche wird primär über ausgehustetes Sekret (aerogene
Infektion) übertragen.
Während der Inkubationszeit von 2 bis 6 Wochen (teilweise bis zu 6 Monate) wird der
Erreger von den gesund erscheinenden Tieren bereits ausgeschieden. Die Krankheit
beginnt mit trockenem, kurzem Husten und Fieber. Nach weiteren Wochen zeigen
sich deutliche Atembeschwerden gekennzeichnet durch schmerzhaften Husten,
Auswurf, schleimig-serumhaltigen Nasenausfluss, hohe Pulsfrequenz, Verstopfung
und Durchfall im Wechsel, Abmagerung, geringe Harnausscheidung (dunkelgelb bis
braun). Die Futteraufnahme, das Wiederkauen sowie die Milchleistung gehen zurück.
Bei jungen Tieren verläuft die Krankheit oft schnell, bei älteren Tieren häufig
langsamer. 50 bis 80 % der Fälle enden tödlich, wobei die Mortalitätsrate in neu
infizierten Beständen höher ist als in Herden, in denen die Lungenseuche bereits
vorher auftrat. Die Seuche breitet sich innerhalb eines Bestandes relativ langsam
aus. Genesene chronisch infizierte Tiere bleiben jahrelang Ausscheider und sind
eine ständige Ansteckungsquelle.

Bei Kälbern bis zu einem Alter von ca. 6 Monaten stehen meistens Polyarthritiden im
Vordergrund. Bei ihnen führt die Krankheit schnell zu schmerzhaften und heißen
Umfangsvermehrungen der Gelenke an den Gliedmaßen verbunden mit Lahmheiten
(besonders Karpal- und Tarsalgelenke).

Gleichzeitiges Auftreten von Pneumonie-Symptomen bei erwachsenen Rindern


und Arthritiden bei Kälbern geben einen wichtigen Hinweis auf das Vorliegen
von Lungenseuche bei der klinischen Verdachtsdiagnose.

FLI 264
Amtliche Methodensammlung Stand: Mai 2013

Grundsätzlich kann zwischen akuten und chronischen Verläufen unterschieden


werden, wobei die klinische Diagnose bei chronischem Verlauf ungleich schwieriger
ist als bei akuter Lungenseuche. Allerdings gibt es hier viele Übergangsformen.

33.1.3. Differentialdiagnostik
Für die Differentialdiagnostik relevant sind unspezifische katarrhalische und fibrinöse
Pneumonien, Wurmbefall, Rinderpest, Tuberkulose und die pektorale Form der
Pasteurellose.

33.1.4. Diagnostische Indikation


Die Einleitung diagnostischer Untersuchungen wird auf der Grundlage folgender
Feststellungen getroffen:
a) klinische Symptome
b) pathologische Veränderungen
c) serologische Befunde
d) epidemiologische Befunde

33.1.5. Zuständige Untersuchungseinrichtungen


• benannte Veterinär- und Lebensmitteluntersuchungsämter der Länder (siehe
Anhang 1)
• FLI, NRL für die Lungenseuche der Rinder, 07743 Jena
Telefon: 03641/8040
Telefax: 03641/804228

33.1.6. Rechtsgrundlagen
Verordnung über anzeigepflichtige Tierseuchen in der jeweils gültigen Fassung

33.2. Untersuchungsmaterial
33.2.1. Von lebenden Tieren
• ca. 10 ml Nativblut zur Serumgewinnung oder 5 ml Serum
• 5 ml Pleuralexsudat (Entnahme zwischen 7. und 8. Rippe im unteren Brustbereich)
• Nasenabstriche (mit sterilen Nasentupfern)

33.2.2. Von getöteten oder verendeten Tieren


• verändertes Lungengewebe am Übergang zum gesunden Gewebe (ca. 4x 4x 4 cm)
• Lnn. mediastinalis in toto, tributäre Lymphknoten
• 5 bis 10 ml Brusthöhlenexsudat
• 10 ml Blut (Herzblut)
• von Kälbern auch Gelenkflüssigkeit

FLI 265
Amtliche Methodensammlung Stand: Mai 2013

33.2.3. Transport
Die Proben sind schnellstmöglich in gekühltem, nicht gefrorenem Zustand an die
untersuchende Stelle zu senden.
Das Untersuchungsmaterial muss vorschriftsmäßig in dicht schließenden
Behältnissen verpackt und zusammen mit dem Vorbericht und dem
Untersuchungsantrag an die zuständige Untersuchungseinrichtung geschickt
werden. Versandbehältnis und Probengefäße müssen eindeutig beschriftet sein.
Dabei sind folgende Vorschriften einzuhalten:

• Gefahrgutverordnung für den Transport auf der Straße bzw. mit der Eisenbahn
• Infektionsschutzgesetz
• IATA-DGR in der jeweils gültigen Fassung für den Transport auf dem Luftweg
• DIN EN 829

Wegen möglicher Gefährdungen während des Transportes sollte das


Untersuchungsgut durch einen Kurier übermittelt werden.
Der Einsender sollte zum frühestmöglichen Zeitpunkt das
Untersuchungslaboratorium von der bevorstehenden Sendung in Kenntnis setzen.

33.3. Untersuchungsgang

Die Lungenseuche gilt als nachgewiesen, wenn der Erreger in der zuständigen
Untersuchungseinrichtung zweifelfrei identifiziert wurde. Die zuständige
Untersuchungseinrichtung ist das nationale Referenzlabor für die Lungenseuche der
Rinder in Jena.
Serologische Reaktionen in Verbindung mit einem epidemiologischem Kontakt zu
einem Lungenseuche-Ausbruch oder mehrere serologisch positive Befunde in einer
Rinderherde führen, unabhängig vom Vorliegen klinischer bzw. pathologisch-
anatomischer Befunde, zu einem Lungenseuche-Verdacht. Der Verdacht kann nur
durch den Amtstierarzt ausgesprochen werden. Dies gilt ebenfalls für die amtliche
Feststellung eines Lungenseuche-Ausbruchs. Die KBR ist laut OIE das
vorgeschriebene serologische Testverfahren. Alternativ kann ein kommerziell
verfügbarer kompetetiver ELISA nach den Vorgaben der OIE angewendet werden.
Dieser ist allerdings für Deutschland nicht zugelassen und somit nur im nationalen
Referenzlabor Jena bzw. nur nach Ausnahmegenehmigung in den entsprechenden
Landesbehörden anwendbar.

Erregernachweis bei Verdacht auf Lungenseuche


Die Anzucht von Mykoplasmen ist in den meisten Untersuchungsämtern möglich und
dauert im Durchschnitt 5 bis 7 Tage, die darauf folgende Erregerdifferenzierung noch
weitere 10 bis 12 Tage. Ein negatives Ergebnis wird innerhalb von 10 Tagen
ausgewiesen. Der positive Nachweis kann bis zu 20 Tagen in Anspruch nehmen.

Wichtiger Hinweis: Bei Verdacht eines Erstausbruchs ist Organmaterial


einschließlich evtl. vorhandener oder verdächtiger bereits isolierter Kulturen,
verdächtige Seren bzw. Blutproben parallel direkt an das Referenzlabor für die
Lungenseuche der Rinder zu senden (FLI, Standort Jena, Naumburger Str. 96a,
07743 Jena, Tel. 03641-8040). Die Proben sind vorher telefonisch anzumelden
(siehe auch unter Untersuchungsmaterial).

FLI 266
Amtliche Methodensammlung Stand: Mai 2013

Im positiven Fall ist mittels PCR ein sicherer Nachweis innerhalb von 48 Stunden
möglich. Die PCR wird im nationalen Referenzlabor für Lungenseuche durchgeführt.

Werden in den Untersuchungsämtern bei der serologischen Untersuchung auf


Lungenseuche mittels KBR positive Proben festgestellt, so sind diese Tiere bis zur
Abklärung im nationalen Referenzlabor als Verdachtsfälle einzustufen und der
entsprechende Bestand ebenfalls als verdächtig für die Lungenseuche zu behandeln,
auch wenn keine weiteren Hinweise für das Vorliegen eines
Lungenseucheausbruchs sprechen. Dem Referenzlabor sind in diesem Fall neue
Blutproben (ohne Gerinnungshemmer) sowie Nasentupfer der entsprechenden Tiere
zuzuleiten.

33.3.1. Erregernachweis

33.3.1.1. Anzüchtung mit anschließender Immunfluoreszenz

Anzüchtung:
Als Mykoplasmen-Nährmedien werden Medium B-Bouillon (Anhang 2) und -Agar
(Anhang 3) verwendet. Zur Unterdrückung der bakteriellen Begleitflora muss bei der
Primärisolierung dem flüssigen Nährmedium unmittelbar vor der Beimpfung Penicillin
(1000 IE/ml) zugesetzt werden.
Zur Beimpfung sind möglichst kleine Stücke des Untersuchungsmaterials in das
flüssige Nährmedium einzubringen, d. h. je ein stecknadelkopfgroßes
Organstückchen (Die Ausgangsproben sollten vor dem Zerkleinern zwecks
Beseitigung von Begleitflora kurz abgeflammt werden.)
Das beimpfte flüssige Nährmedium wird 4 bis 5 Tage bei 37 °C bebrütet. Danach
wird die Kultur auf Medium B-Agar übertragen und anschließend 2 bis 4 Tage bei
37 °C in feuchter Umgebung und bei 3 bis 5 % CO 2 inkubiert.
Das Mykoplasmenwachstum kann auf der Agarplatte mikroskopisch mit einer
Lupenvergrößerung bei leicht dezentriertem grünem Licht beurteilt werden. MmmSC
entwickelt auf festen Nährmedien durchscheinende Kolonien von 0,1 bis 1 mm
Durchmesser, welche meist als raue, vakuolisierende granuläre Formen erscheinen.

Immunfluoreszenztechnik (IFT):
In der Regel wird die IFT dem nationalen Referenzlabor vorbehalten bleiben, da den
meisten Untersuchungsämtern nicht alle notwendigen Antiseren und
Mykoplasmenstämme zur Verfügung stehen und das Referenzlabor diese Seren und
Bakterienstämme nicht zur Verfügung stellen kann.

Geräte/Gebrauchsmaterialien
Brutschrank 37 °C ± 2 °C und 3 bis 5 % CO 2 , Fluoreszenzmikroskop
Spezialküvette, Spatel, Skalpell, Messpipetten 10 ml; Ampullensäge

FLI 267
Amtliche Methodensammlung Stand: Mai 2013

Rezepturen/Reagenten

lyophilisierte Stämme: - die Ampulle mit dem lyophilisierten Stamm mit einer
vorher 1 min mit Sterillium desinfizierten Ampullensäge
öffnen, in die Ampulle 0,5 ml Bouillon (Medium B)
pipettieren
- nachdem sich der Inhalt der Ampulle gelöst hat:
a) - eine Platte davon ausstreichen, Inkubation 2 bis 4
Tage bei 37 °C und 5 % CO 2 und
b) - den Rest der Ampulle in ein Röhrchen mit Bouillon
geben,
Inkubation 2 bis 4 Tage bei 37 °C, weiter wie a)
eingefrorene Stämme: - Kryo-Röhrchen auftauen lassen, und je nach Bedarf
auf Platte ausstreichen und Bouillon beimpfen,
Inkubation 2 bis 4 Tage bei 37 °C und 5 % CO 2
Antiglobulin: - Es handelt sich um mit Fluoresceinisothiocyanat (FITC)
konjugierte Anti-Kaninchen-IgG-Antikörper von der Ziege.
- nur nach vorheriger Austestung der jeweiligen
Gebrauchsverdünnung bei jeder neuen Charge (wenn es
optimal leuchtet) den Inhalt des Fläschchens
entsprechend mit Aqua dest. verdünnen
1: 5 0,2 ml konz. A.-Glob. + 0,8 ml PBS
1:10 0,5 ml 1: 5 A.-Glob. + 0,5 ml PBS
1:20 0,5 ml 1:10 A.-Glob. + 0,5 ml PBS
usw. bis 1:80
- Kontrollstämme zur Ermittlung der optimalen Verdünnung
des Antikaninchenglobulins: M. bovis und M. arginini

PBS:
NaCl 8g
Na 2 HPO 4 x 12 H 2 O 2,9 g
KH 2 PO 4 0,2 g
KCL 0,2 g
Aqua dest. ad 1000 ml
auf pH 7,2 einstellen.

NaCl - Puffer:
Na 2 HPO 4 x 2 H 2 O 1,72 g
Na 2 HPO 4 x 12 H 2 O 3,46 g
KH 2 PO 4 0,50 g
NaCl 7,20 g
Aqua dest. ad 1000 ml
auf pH 7,1 einstellen

Medium B: siehe Anhang 2 und 3

FLI 268
Amtliche Methodensammlung Stand: Mai 2013

Durchführung
• zu testende Stämme auf Platten ausstreichen (neben der eigentlichen Probe
auch eine Positivkontroll- und Negativkontrollstämme)
Positivkontrolle: ein -Stamm
Negativkontrolle: hierzu eignen sich beispielsweise Stämme von
Mycoplasma arginini oder Mycoplasma bovis

• Inkubation ca. 2 Tage bei 37 °C und 5 % CO 2


• gut bewachsene Agarblöckchen (ca. 1,5 x 0,5 cm) mit Skalpell ausschneiden,
und zur Kennzeichnung obere linke Ecke abschneiden
• Blöckchen in je einen Einsatz der Spezialküvette legen (Kolonien nach oben!)
• auf jedes Blöckchen 1 Tropfen Antiserum eines bekannten Stammes pro
Spezialküvette, bzw. bei Negativ-Kontrollen 1 Tropfen NaCl-Lösung bringen
• zu jedem bekannten Antiserum entsprechenden Stamm als Positivkontrolle
mitführen
• in feuchter Kammer 30 min bei 37 °C inkubieren
• 2 x 10 min mit unsterilem NaCl-Puffer (pH 7,1) waschen
• auf jedes Blöckchen 1 Tropfen Anti-Kaninchen-Globulin, FITC-markiert geben
• in feuchter Kammer 30 min bei 37 °C inkubieren
• 2 x 10 min mit NaCl-Puffer (pH 7,1) waschen und mit Aqua dest. spülen
• nach Beschriftung der Objektträger die Blöckchen auflegen

Ergebnis und Kontrolle

• Mikroskop: Fluoreszenzeinrichtung (Blaulicht, UV-Anregung) im Auflicht


• ⊕ Positiv: Kolonien, die bei normalem Licht gut zu erkennen sind und
nach dem Umschalten auf Fluoreszenz in apfelgrüner Farbe
leuchten, schwache Eigenfluoreszenzen lassen sich durch
Positivkontrollen als Störfaktoren ausschließen
• ∅ Negativ: Kolonien, die bei normalem Licht gut zu erkennen sind und
nach dem Umschalten auf Fluoreszenz nicht leuchten

Durch Mitführen einer Positiv- sowie Negativkontrolle können falsch-positive sowie


falsch-negative Ergebnisse ausgeschlossen werden.
Bei jeder neuen Charge eines Reaktionspartners wird das Testsystem mit
Positivkontrolle und Negativkontrolle neu geeicht.

Differentialdiagnostisch sollten im Immunfluoreszenztest die angezüchteten Erreger


neben dem MmmSC-Antiserum gegen folgende weitere Antiseren getestet werden:

M. mycoides ssp. mycoides LC M. bovis


M. bovirhinis M. gatae
M. Gruppe 7 (Leach) A. laidlawii
A. modicum A. axanthum
M. arginini M. bovigenitalium
M. alkalescens M. canadense
M. californicum
M. gallina rum

FLI 269
Amtliche Methodensammlung Stand: Mai 2013

33.3.1.2. Polymerase-Kettenreaktion (PCR)


Der Nachweis wird nur im nationalen Referenzlabor durchgeführt.

DNA-Isolierung

Geräte, Materialien und Reagenzien


Eppendorf-Zentrifuge (wenn möglich mit Kühlung)
Vortexer
Eppendorf BioPhotometer
Präzisionspipetten, verschiedene Größen
passende Tips, steril und DNase-frei (PCR-clean), z. B. Eppendorf
Handschuhe
Eppendorf-Tubes, 1,5 ml, 2 ml, steril und DNase-frei (PCR-clean)
High Pure PCR Template Preparation Kit von Roche oder äquivalente Kits

Zellpuffer, steril (pH 7,4):


1000 ml 0,1M Na 2 HPO 4 -Lösung
+ 222 ml 0,1M KH 2 PO 4 -Lösung

DEPC-Wasser

Durchführung

Vorbereitungsschritte für alle Isolierungen:


mit Handschuhen arbeiten
• Proteinase K (Gefäß 3 aus Roche-Kit) in 4,5 ml bidest. H 2 O aufnehmen,
aliquotieren und bei -20 °C lagen
• vor Erstgebrauch 80 ml Ethanol p.A. zu dem Waschpuffer (Gefäß 4, blauer
Deckel) geben
• bei Beginn der DNA-Isolierung den Elutionspuffer (Gefäß 5) auf 70 °C vorwärmen

a) DNA-Isolierung aus Gewebe


• 25 bis 50 mg Gewebe im 1,5-ml-Tube einwiegen und mit der Schere soweit wie
möglich zerkleinern
• 200 µl Gewebe-Lysepuffer (Gefäß 1, weißer Deckel) und 40 µl Proteinase K-
Lösung zugeben
• mindestens 1 h bei 55 °C inkubieren (eventuell auch 2 bis 3 h oder bei 37 °C über
Nacht)
• 200 µl Bindungspuffer (Gefäß 2, grüner Deckel) zugeben, mischen und 10min bei
72 °C inkubieren (Elutionspuffer 5 kann dabei mit vorgewärmt werden)
• mit 100 µl Isopropanol vermischen
• nicht lösliche Gewebestücke mittels einer Pipettenspitze entfernen, restliche
Flüssigkeit mittels einer 1ml-Pipette in das zusammengesetzte Filter-Tube ( →
Säule auf Sammelbehälter setzen) geben
• 1min bei 8000 rpm zentrifugieren (eventuell auch länger und bei höherer
Drehzahl, falls der Filter vom Gewebe verstopft wird)
• Durchlauf verwerfen, Sammelbehälter wiederverwenden
• 500 µl Waschpuffer in das Filter-Tube pipettieren (Gefäß 4, blauer Deckel)
• 1min bei 8000rpm zentrifugieren

FLI 270
Amtliche Methodensammlung Stand: Mai 2013

• anschließend 10 Sek. bei max. Geschwindigkeit (13000rpm) zentrifugieren


• Filter-Tube in ein sauberes 1,5-ml-Tube einsetzen
• Zur Elution der Nukleinsäuren 200 µl des auf 70 °C vorgewärmten Elutionspuffers
in das Filter-Tube pipettieren
• 1 min bei 8000rpm zentrifugieren
• die Nukleinsäuren sind stabil und können direkt in der PCR analysiert oder bei
4 °C gelagert werden

b) DNA-Isolierung aus Körperflüssigkeit


• 200 µl Körperflüssigkeit (bei weniger Volumen mit Zellpuffer auffüllen) in ein
1,5ml-Tube pipettieren
• 200 µl Bindungspuffer (Gefäß 2, grüner Deckel) und 40 µl Proteinase K-Lösung
zugeben
• nach Proteinase K-Zugabe sofort gut mischen und 10 min bei 72 °C inkubieren
(Elutionspuffer 5 kann dabei mit vorgewärmt werden)
• mit 100 µl Isopropanol vermischen
• in das zusammengesetzte Filter-Tube ( → Säule auf Sammelbehälter setzen)
geben
• weiter wie bei DNA-Isolierung aus Gewebe

c) DNA-Isolierung aus Nasentupfern


• Tupferprobe in einem 2ml-Tube mit je 500 µl Bindungspuffer (Gefäß 2, grüner
Deckel) versetzen und 30 Sek. bei 1200rpm zentrifugieren
• 1ml-Pipettenspitze zur Hälfte abschneiden, in dieser halben Spitze im Tube
Tupfer nochmals 2 min bei 1200rpm zentrifugieren, um die gesamte Flüssigkeit
aus dem Tupfer zu gewinnen
• Probenflüssigkeit vereinigen und 15 min bei 14000rpm (höchste Drehzahl)
zentrifugieren
• Pellet in 200 µl Zellpuffer aufnehmen
• 200 µl Bindungspuffer (Gefäß 2, grüner Deckel) und 40 µl Proteinase K-Lösung
zugeben
• nach Proteinase K-Zugabe sofort gut mischen und 10 min bei 72 °C inkubieren
(Elutionspuffer 5 kann dabei mit vorgewärmt werden)
• mit 100 µl Isopropanol vermischen
• in das zusammengesetzte Filter-Tube ( → Säule auf Sammelbehälter setzen) geben
• weiter wie bei DNA-Isolierung aus Gewebe
Photometrische Messung:
• erfolgt zur Überprüfung der Reinheit und zur Einstellung eines definierten DNA-
Gehaltes bei 260 nm gegen Leerwert Aqua dest. am Eppendorf-BioPhotometer in
den dazugehörigen Einweg-Küvetten
• die Probe wird 1:10 verdünnt (6 µl Probe + 54 µl DEPC- Wasser)
• die Absorption von 1 OD entspricht ca. 50 µl/ml DNA mit dem Verhältnis A 260 /A 280
kann die Reinheit der DNA abgeschätzt werden, dieser Wert sollte zwischen 1,6
und 1,8 liegen

FLI 271
Amtliche Methodensammlung Stand: Mai 2013

PCR

Geräte, Materialien und Reagenzien


Thermocycler (z. B. Biometra)
Eppendorf-Zentrifuge (wenn möglich mit Kühlung)
Vortexer
Präzisionspipetten, verschiedene Größen
passende Tips, steril und DNase-frei (PCR-clean), z. B. Eppendorf
Handschuhe
Eppendorf-Tubes, 0,2 ml, steril
HotStarTaq Master Mix (Qiagen) oder
dNTP-Mix, Taq-Polymerase, 10 x Taq-Polymerase-Puffer (z. B. Boehringer
Mannheim) oder äquivalente Reagenzien anderer Firmen
DEPC-H 2 O

Primer:
MW 28/29 und SC3NEST1-L/R

Sequenzen: siehe Tabelle 1

Tabelle 1: Primersysteme zur Untersuchung von Lungenseucheproben

Primer Sequenz Spezifität

MW 28 5`-CCA GAC TCC TAC GGG AGG CA-3´ Klasse


Mollicutes
MW 29 5´-TGC GAG CAT ACT ACT CAG GC-3´

SC3NEST1-L 5´-ACA AAA AGA AGA TAT GGT GTT GG-3´ MmmSC

SC3NEST1-R 5´-ATC AGG TTT ATC CAT TGG TTG G-3´

Durchführung
• mit Handschuhen arbeiten
• Primer vorverdünnen: Stammlösung 100pmol/µl, Verdünnung 1:5 auf 20pmol/µl
mit DEPC-Wasser
• DNA vorverdünnen: entsprechend der photometrischen Messung auf 5ng DNA/µl
einstellen

a) Durchführung mit HotStarTaq Master Mix (Qiagen):


• jeweils 25 µl HotStarTaq Master Mix in PCR-Tubes vorlegen, 20 µl des
vorverdünnten Primerpaares hinzugeben
• Zugabe von jeweils 5 µl DANN
• alle Schritte können bei Raumtemperatur stattfinden, weil die Polymerase bei
dieser nicht aktiv ist

b) Durchführung mit selbst hergestelltem Mastermix mit einfacher Taq-


Polymerase (z. B. Boehringer Mannheim):

FLI 272
Amtliche Methodensammlung Stand: Mai 2013

• Herstellung des Mastermix (Angaben für eine Probe):

10 x Taq-Polymerase-Puffer 5 µl
dNTP - Mix 2 µl
Primer 1 1 µl
Primer 2 1 µl
Taq-Polymerase 0,2 µl
DEPC-Wasser 39,8 µl

• nach Zusammengabe aller Substanzen in jedes Reaktionsgefäß 45 µl Mastermix


und 5 µl DNA-Extrakt der Probe pipettieren
• wurde die DNA nicht gemessen und auf 5 ng/µl eingestellt, werden 49 µl
Mastermix und 1 µl DNA-Extrakt pipettiert

Kontrollen mitführen:
→ als Negativkontrolle wird einem Ansatz statt DNA 5 bzw. 1 µl DEPC-
Wasser zugesetzt
→ als Positivkontrolle dient für das Primersystem 1 (MW28/29) 5 bzw.1 µl
DNA-Extrakt eines Typenstammes von M. bovis (Donetta PG 45) und für
das System 2 (SC3NEST1-L/R) 5 bzw. 1 µl DNA-Extrakt eines
Typenstammes von MmmSC (PG 1)

- vortexen, kurz abzentrifugieren und in den vorprogrammierten Cycler stellen,


Zyklus:

Primersystem 1-MW 28/29 2-SC3NEST1-L/R


Aktivierung der HotStarTaq 15min, 95 °C 15 min, 95 °C
Polymerase
→dieser Schritt entfällt bei b)
3-Schritt-Zyklus:
- Denaturierung: 80 Sek., 94 °C 30 Sek., 94 °C
• Annealing: 80 Sek., 55 °C 30 Sek., 52 °C
• Extension: 150 Sek., 72 °C 30 Sek., 72 °C
Zyklenzahl : 30 35
Finale Extension 5 min, 72 °C -
Amplikon ca. 560 bp ca. 717bp

• Proben anschließend auf Agarose-Gel auftragen

Agarose-Gelelektrophorese

Geräte, Materialien und Reagenzien


Elektrophoresekammer (z. B. Biometra, Biozym)
Stromversorgungsgerät
Mikrowelle
Gel-Auswertesystem ( z. B. Bio Imaging System von Syngene)
Maßkolben (1l)
Erlenmeyerkolben ( 300 ml, 500 ml)
Messzylinder (25 ml, 100 ml)

FLI 273
Amtliche Methodensammlung Stand: Mai 2013

Parafilm
Präzisionspipetten, verschiedene Größen
passende Tips, steril und DNase-frei (PCR-clean), z. B. Eppendorf
Handschuhe (Nitrilhandschuhe → beständig gegenüber Ethidiumbromid)
Agarose (PeqGold Universal Agarose von Peqlab)
10x TBE-Puffer
dest. H 2 O
Ethidiumbromid (Tropfflasche, z. B. Eurobio)
Molekulargewichtsmarker: peqGold Low Range DNA-Leiter, 80 - 1031bp,
gebrauchsfertig
DEPC-H 2 O

Ansetzen der Lösungen


• Herstellung des Laufpuffers (1x TBE-Puffer): 100 ml 10x TBE-Puffer ad
1000 ml dest. Wasser
• Zusammensetzung des Agarose-Gels:

Gelkonzentration 1%
Volumen 50ml 100ml
Agarose 0,5g 1g
dest. Wasser 45ml 90ml
10x TBE-Puffer 5ml 10ml
Ethidiumbromid 1 Tr. 2 Tr.

Durchführung
• Elektrophoresekammer zusammensetzen, passenden Kamm auswählen
• Agarose einwiegen, mit dest. Wasser im Erlenmeyerkolben lösen
• in der Mikrowelle bei 600 W zum Kochen bringen, ca. 30 Sek. kochen
• 10x TBE-Puffer und Ethidiumbromid zugeben, Kolben vorsichtig schwenken
• zügig und luftblasenfrei in die Elektrophoresekammer gießen
• mind. 1 h polymerisieren lassen
• Kamm herausziehen, Laufpuffer in die Elektrophoresekammer füllen, bis der
Puffer ca. 1cm über dem Gel steht
• Proben bzw. Marker wie folgt auf Parafilm mischen und in die Slots
pipettieren:

Marker PCR-Proben
2 µl Probenpuffer 2 µl Probenpuffer
9 µl DEPC-Wasser 10 µl Probe
1 µl Marker
→ 10 µl/Slot auftragen → 10 µl/Slot auftragen

FLI 274
Amtliche Methodensammlung Stand: Mai 2013

• Laufdauer und einzustellende Spannung sind abhängig von Größe und Dicke
des Gels und der Beschaffenheit der Kammer → Hinweise des Herstellers
beachten
• Spannung liegt zwischen 80 und 150 V, die Dauer des Laufes zwischen 30
und 120 min
• Faustregel für einzustellende Spannung: 5 V/cm Elektrodenabstand
• die Bromphenolblau-Front sollte mindestens zur Hälfte des Gels gewandert
sein; bei schlechtem Trennergebnis kann das Gel nochmals in die Kammer
gelegt und die Proben weiter getrennt werden
• um eine gleichmäßige Verteilung des Ethidiumbromids im Gel zu erreichen
(wandert entgegengesetzt zur DNA), kann dem Laufpuffer 0,5 mg/l
Ethidiumbromid zugesetzt werden (für einen gleichmäßigen und klaren
Hintergrund auf dem Gel)
• das Gel wird unter UV-Licht mit Hilfe eines geeigneten Gel-Auswertesystems
analysiert und dokumentiert

Ergebnis und Kontrolle


Im UV-Licht ist bei einer positiven Reaktion eine deutliche Bande bei beiden PCR-
Ansätzen (im System 1 bei ca. 560 bp und bei ca. 717 bp im System 2) zu erkennen.
Bei jedem Probenlauf darf die Negativkontrolle keine Bande und muss die
Positivkontrolle eine deutliche Bande zeigen.

33.3.1.3. Antikörpernachweis durch Komplementbindungsreaktion (KBR)


Die KBR für die Lungenseuche wird in der Regel zuerst von den Landesbehörden
festgelegten staatlichen Untersuchungsämtern durchgeführt werden (Anhang 1). Die
notwendigen Reagenzien (Antigen, positive und negative Kontrollseren) werden vom
nationalen Referenzlabor in Jena für die aufgeführten Untersuchungsämter zur
Verfügung gestellt.
Zur Feststellung des Verdachts eines Lungenseucheausbruchs bzw. zur
Eingrenzung des Kreises verdächtiger Tiere kann die jeweilige hauseigene
Arbeitsvorschrift verwendet werden.

Nachfolgend wird der prinzipielle Ablauf am Beispiel der von der OIE empfohlenen
Mikromethode dargelegt, welche auf das Verfahren nach Campbell und Turner
(1953) zurückgeht.

Geräte/Gebrauchsmaterialien
• Zentrifuge, Wasserbad 37 °C ± 1 °C; Wasserbad 58 °C ± 1 °C;
• Waage; heizbarer Magnetrührer; Kühlschrank 6 °C ± 2 °C; Gefrierschrank -
20 °C ± 3 °C
• Ablesespiegel für Mikrotiterplatten; Bechergläser (30 ml bis 800 ml);
• Messzylinder (50 bis 250 ml); Kulturröhrchen (12ml);
• Zentrifugenröhrchen (12 ml); Ständer für Röhrchen, Klebefolie zum Abkleben
der Mikrotiterplatten, Messpipetten (1, 5 und 10 ml), Kolbenhubpipetten (10 bis
1000 µl), entsprechende Pipettenspitzen, Transferpette 8-Kanal (20 - 100 µl),
Multistepper 8-Kanal 25 - 125 µl, Pipettierhilfe
• Erlenmeyerkolben, Stehkolben, Bechergläser, Mikrotiterplatten (U-Form, 8x12
Cups), feuchte Kammer

FLI 275
Amtliche Methodensammlung Stand: Mai 2013

Reagenzien/Rezepturen

Alseverlösung für Hammelerythrozyten:

Dextrose 18,66 g
NaCl 4,18 g
Natriumcitrat 8,00 g
Aqua bidest. 1000 ml

nach gründlichem Mischen für 20 min in den Dampftopf geben

Veronal-Puffer (Veronal - buffered diluent = VBD):

2000 ml Konzentrat, 5:1


NaCl 83,00 g
5,5 - Diäthylbarbitursäure Natriumsalz 10,19 g
Aqua bidest. 800 ml

• Aqua bidest. zum Kochen bringen und mit beheizbaren Magnetrührer


Substanzen darin lösen
• 34,58 ml 1n HCl über einen Scheidetrichter oder langsam mit einer Pipette
tropfenweise hinzugeben, bei Ausfall von Salzen noch etwas Aqua bidest
zugeben
• tropfenweise 5 ml Stammlösung hinzugeben

Stammlösung:

MgCl 2 x 6 H 2 O 20,3 g
CaCl 2 x 2 H 2 O 4,4 g
in Aqua bidest. 100 ml

• 10 ml der konzentrierten VBD werden 1:5 mit Aqua bidest. verdünnt und auf
einen pH-Wert zwischen 7,3 bis 7,5 überprüft. Sollte der pH-Wert außerhalb
dieser Grenzen liegen, muss ein Neuansatz erfolgen. Die konzentrierte
Lösung wird in 200 ml Portionen abgefüllt und bei -20 °C aufbewahrt, die bei
Bedarf 1:5 verdünnt werden können.

Komplement:
(z. B. Fa. Virion), jede Charge ist vor erstmaligem Gebrauch auszuwerten (siehe dort)

Ambozeptor:
(z. B. Fa. Virion), jede Charge ist vor erstmaligem Gebrauch auszuwerten (siehe
dort). Bei Titerverlust empfiehlt sich eine erneute Auswertung.

Antigene sowie negative und positive Kontrollseren:


werden im nationalen Referenzlabor hergestellt und den Untersuchungsämtern
kostenlos zur Verfügung gestellt

FLI 276
Amtliche Methodensammlung Stand: Mai 2013

Hammelblut:
Hammelblut 37,5 ml
Alseverlösung 62,5 ml

Eine sterilisierte Schraubflasche mit einer Markierung bei 100 ml wird mit
Alseverlösung befüllt und mit Hammelblut direkt aus der Kanüle auf 100 ml aufgefüllt.
Das Blut wird aus der Vena jugularis gewonnen. Um Kontaminationen vorzubeugen,
gibt man 200000 Internat. Einheiten/l Penicillin G hinzu. Das so gewonnene
Hammelblut hält sich bei Kühlschranktemperatur etwa 10 bis 14 Tage. Für den
Einsatz im Hämolytischen System muss es jedoch mindestens 24 h alt sein.
Alternativ kann eine 1%ige Erythrozytensuspension der Firma VIRION/SERION
verwendet werden.

Hämolytisches System (HS):


• Hammelblut in Alseverlösung bei 900 x g für 10 Minuten zentrifugieren
• 3- bis 5x waschen in VBD (bis Überstand wasserklar ist), dazwischen jeweils
10 min zentrifugieren bei 900 x g
• herstellen einer 2%igen Hammelerythrozytensuspension mit VBD
• zum Gebrauch wird diese mit gleichem Volumen der Ambozeptor-
Gebrauchsverdünnung gemischt und 15 min bei 37 °C ± 1 °C stehen gelassen
(Sensibilisierung)
• Bei getrennter Aufbewahrung von Erythrozytensuspension und
Ambozeptorverdünnung können diese bis zu 48 h nach Herstellung verwendet
werden.

Durchführung

Anmerkung:
Alle Reagenzien sind vor der Verwendung auf Raumtemperatur zu erwärmen.

Ampozeptorauswertung
Die Ambozeptorauswertung sollte bei Bedarf durchgeführt werden, zumindest bei
Verwendung einer neuen Charge von Ambozeptor.

Ansatz folgender geometrischer Verdünnungsreihen des Ambozeptors:

Röhrchen 1 2 3 : : : n
Reihe A 1:500 1:1000 1:2000 : : : 1:32000
Reihe B 1:750 1:1500 1:3000 : : : 1:24000

• Ausgangsverdünnung 1:500 (z. B. 0.1 ml Ambozeptor + 49,9 ml VBD) herstellen


• Vorlage von 5 ml VBD für die Reihe A ab Röhrchen 2, für Reihe B ab
Röhrchen 1
• für die Reihe A dem 1. und 2. Röhrchen 5 ml Ambozeptorverdünnung 1:500
zufügen und ab Röhrchen 2 durch fortlaufendes Überpipettieren von jeweils 5
ml die weiteren Verdünnungen anlegen

FLI 277
Amtliche Methodensammlung Stand: Mai 2013

• für Reihe B dem 1. Röhrchen 10 ml Ambozeptorverdünnung 1:500 zufügen


und durch fortlaufendes Überpipettieren von jeweils 5 ml weitere
Verdünnungen anlegen
• beide Titrationsreihen zu einer Verdünnungsreihe zusammenfügen

Ansatzschema der Ambozeptorauswertung

Röhrchen Amb.-Verd. VBD Erythr.-Susp. Kompl. Verd. 1:20


(0,5 ml) (ml) (ml) (ml)
1 1:500 1,0 0,5 0,5
2 1:750 1,0 0,5 0,5
3 1:1000 1,0 0,5 0,5
: : : : :
: : : : :
: : : : :
n 1:32000 1,0 0,5 0,5

• Kontrollen

a) Erythrozytenkontrolle: 0,5 ml Erythrozytensuspension


0,2 ml VBD
b) Komplementkontrolle: 0,5 ml Erythrozytensuspension
0,5 ml Komplement 1:20
1,5 ml VBD
c) Ambozeptorkontrolle: 0,5 ml Erythrozytensuspension
0,5 ml Ambozeptorverdünnung
1,5 ml VBD

• schütteln, Inkubation 30 Minuten bei 37 °C ± 1 °C im Wasserbad

Auswertung
Ermittelt wird die höchste Ambozeptorverdünnung, die noch eine komplette
Hämolyse bewirkt. Sie gilt als Ambozeptoreinheit. Die Gebrauchsverdünnung beträgt
4 Einheiten, also die vierfache Konzentration.

Beispiel: 1 Ambozeptoreinheit = 1:6000


Gebrauchsverdünnung = 1:1500

Die Kontrollen dürfen keine Hämolyse aufweisen.

Komplementauswertung
Die Komplementauswertung dient der Feststellung der Komplementgebrauchsdosis
für den Hauptversuch in Gegenwart der entsprechenden
Antigengebrauchsverdünnung. Zum Vergleich wird eine zweite Reihe angesetzt, bei
der das Antigenvolumen durch VBD ersetzt ist.
Das Komplement wird in 8 Konzentrationsstufen in der Wärmebindung geprüft. In der
folgenden Tabelle ist die Herstellung der 8 Verdünnungsstufen dargestellt:

FLI 278
Amtliche Methodensammlung Stand: Mai 2013

Komplementkonzentration (%)
0,5 1,0 1,5 2,0 2,5 3,0 2,5 4,0
Kompl. 1:10 (ml) 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8
VBD (ml) 1,9 1,8 1,7 1,6 1,5 1,4 1,3 1,2

Die weiteren Arbeitsschritte sind in der folgenden Tabelle dargestellt:

Reihe 1 Reihe 2
Komplement je Verd.-Stufe (ml) 0,5 0,5
Antigenverdünnung (ml) - 0,5
VBD (ml) 1,0 0,5

- schütteln, Wasserbad 60 min bei 37 °C ± 1 °C

HS (ml) 1,0 1,0

-schütteln, Wasserbad 30 min bei 37 °C ± 1 °C

Auswertung
Es wird das Röhrchen mit der niedrigsten Komplementkonzentration bestimmt, das
eine komplette Hämolyse aufweist. Die Gebrauchsverdünnung für den Hauptversuch
ist die folgende höhere Konzentration

Beispiel komplette Hämolyse = 2,0 %


Gebrauchskonzentration = 2,5 %

Hauptversuch

• Kontroll- und Probandenseren in einer Verdünnung von 1:5 im Wasserbad bei


58 °C ± 1 °C inaktivieren (30 bis 50 min)
• Trennlinie zwischen Cup 10 und 11 von A bis H ziehen

In der folgenden Tabelle sind die einzelnen Arbeitsschritte aufgeführt:

Cup
Arbeitsschritte 1 2 3 : : : 10 11 12
1. VBD (µl) - 25 25 : : : 25 - 25
2. Serum (µl) 50 - - : : : - 50 -

3. Titration des Serums von 1 nach 10 und von 11 nach 12 durch Übertragung von
25 µl und verwerfen von 25 µl aus den Cups 10 und 12
Titration der Komplementkontrollen (siehe bei Kontrollen)
beim Titrieren mind. 3 x mischen durch Aufziehen und Abgeben mit der Pipette!

4. VBD - - - : : : - 25 25
5. Antigen (µl) 25 25 25 : : : 25 - -
6. Kompl. (µl) 25 25 25 : : : 25 25 25

FLI 279
Amtliche Methodensammlung Stand: Mai 2013

7. schütteln und abgedeckte Platte 18 bis 24 h bei 5 °C ± 3 °C inkubieren


(Kältebindung), danach die Platte wieder auf Raumtemperatur erwärmen oder für
60 min bei 37 °C ± 1 °C im Wasserbad oder im Brutschrank in einer feuchten
Kammer inkubieren (Wärmebindung)
Achtung: auf dem Antigen ist vermerkt, welche Inkubationsvariante anzuwenden
Ist

8. HS (µl) 50 50 50 : : : 50 50 50

9. Schütteln, abdecken und Inkubation 20 - 30 min bei 37 °C± 1 °C im Wasserbad


oder im Brutschrank in einer feuchten Kammer.

Hinweis: Für die Bestimmung der optimalen Inkubationsdauer muss man die
Hämolyse in den Komplementkontrollen verfolgen. Die Inkubation wird
nur solange fortgesetzt, bis die Cups mit 2 und 1 Komplementeinheiten
100 % Hämolyse zeigen, bei 0,5 und 0,25 Komplementeinheiten darf
keine Hämolyse auftreten.

10. Platte entweder 30 min bis 1 h bei Raumtemperatur stehen lassen oder für 5 min
bei 900 x g abzentrifugieren (Erythrozytensedimentation)
11. Auswertung mit Spiegel

Kontrollsystem und Interpretation der Ergebnisse


Das Ablesen der Reaktionsstärke je Verdünnungsstufe erfolgt nach dem Grad der
Hämolyse und der Größe des Erythrozytensedimentes (Knopfbildung) im Vergleich
zur Kontrolle des Hämolytischen Systems:

100 % Hämolyse = negativ = 0 % Erythrozytensediment


75 % Hämolyse = + = 25 % Erythrozytensediment
50 % Hämolyse = ++ = 50 % Erythrozytensediment
25 % Hämolyse = +++ = 75 % Erythrozytensediment
0 % Hämolyse = ++++ = 100 % Erythrozytensediment

Bei der Durchführung des Hauptversuches sind jeweils folgende Kontrollansätze


mitzuführen:

Kontrolle der antikomplementären Wirkung (Eigenhemmung) jedes Serums


(Serumkontrolle)
Serumverdünnung 25 µl
VBD 25 µl
Komplement 25 µl
HS 50 µl
Soll-Ergebnis 100 % Hämolyse, 0 % Erythrozytensediment

Von Eigenhemmung spricht man bei fehlender Hämolyse (mit Erythrozytensediment).


Bei Auftreten von Eigenhemmung empfiehlt sich folgende Vorbehandlung der
entsprechenden Seren mit Komplement:

FLI 280
Amtliche Methodensammlung Stand: Mai 2013

Serum (unverdünnt) 75 µl
Komplement (unverdünnt) 25 µl
30 min bei 37 °C ± 1 °C im Wasserbad inkubieren
VBD 900 µl
30 min bei 58 °C im Wasserbad inkubieren

Hinweis: nicht bei allen Seren kann durch diese Vorbehandlung Eigenhemmung
vermieden werden. In solchen Fällen muss die Untersuchung mit einem
erneut von diesem Tier gewonnenen Serum wiederholt werden.

Antigenkontrolle (AG)
VBD 25 µl
Antigen 25 µl
Komplement 25 µl
HS 50 µl
Soll-Ergebnis 100 % Hämolyse, 0 % Erythrozytensediment

Komplementkontrolle
Für die Komplementkontrolle werden folgende Konzentrationen verwendet: die
zweifache, die einfache, die 0,5-fache und die 0,25-fache Konzentration der in der
Komplementauswertung ermittelten Konzentration (≙ Komplementeinheiten von 2; 1;
0,5 und 0,25). Die entsprechenden Verdünnungen können auch auf der Platte durch
Überpipettieren von jeweils 25 µl erzeugt werden (siehe 3. Titration des Serums).

VBD 50 µl
Komplementverd. 25 µl
HS 50 µl
Soll-Ergebnis bei Komplementeinheiten von 2 und 1 = 100 % Hämolyse,
0 % Erythrozytensediment
bei 0,5 und 0,25 Komplementeinheiten = 0 % Hämolyse
(100 % Erythrozytensediment)

Kontrolle des Hämolytischen Systems (HS)


VBD 75 µl
HS 50 µl
Soll-Ergebnis 0 % Hämolyse, 100 % Erythrozytensediment

Positives Kontrollserum (pos. KS)


Serumverdünnung 25 µl
Antigen 25 µl
Komplement 25 µl
HS 50 µl
Soll-Ergebnis Der ermittelte Titer muss dem für das positive
Kontrollserum angegebenen Titer entsprechen.

FLI 281
Amtliche Methodensammlung Stand: Mai 2013

Negatives Kontrollserum (neg. KS)


Serumverdünnung 25 µl
Antigen 25 µl
Komplement 25 µl
HS 50 µl
Soll-Ergebnis 100 % Hämolyse, 0 % Erythrozytensediment

Beispiel für Plattenbelegung

Reihe
Spalte 1 2 3 4 5 6 7 8 9 10 11 12

Serum-
Probenverdünnung kontrollen
Proben- 1:5 1:10 1:20 1:40 1:80 1:160 1:320 1:640 1:1280 1:2560 1:5 1:10
bezeichng.
A a
B b
C c
D d
E e
F pos. KS
G neg. KS
H Kontrollen AG AG HS HS 2 1 0,5 0,25
Komplementeinheiten

Laut OIE-Manual ist ein Ergebnis bei 1:10 (++++) als positiv zu betrachten. 1:10+
bis 1:10+++ gelten als fraglich.
Das negative Serum darf in der Verdünnung 1:5 keine Reaktion zeigen.
Das Ergebnis ist umgehend dem zuständigen Veterinäramt zu melden.

Hinweise:
Alternativ können weitere kommerziell verfügbare Reagenzien verwendet werden
(Hammelerythrozyten, VBD).

Das NRL organisiert regelmäßig Ringtests für die KBR. Die durch die Bundesländer
ausgewählten staatlichen Untersuchungsämter (Anhang 1) sind verpflichtet, an
diesen Ringtests teilzunehmen. Das Referenzlabor teilt die Ergebnisse den
teilnehmenden Labors mit und führt eine Wertung durch. Bei unvertretbaren
Abweichungen ist den entsprechenden Landesbehörden darüber Mitteilung zu
machen. Die Ursachen für die entstandenen Abweichungen sind gemeinsam mit dem
Referenzlabor abzuklären und abzustellen. Der KBR-Ringversuch muss
anschließend vom entsprechenden Labor wiederholt werden.

Literatur
OIE Manual of Standards for Diagnostic Tests and Vaccines, 5th Edition (2004)
Campbell, A.D. und Turner A.W. (1953): Studies on contagious bovine
pleuropneumonia of cattle. IV. An improved complement-fixation test. Austral. Vet. J.
29, 154-163
Hotzel, H. und Sachse, K. (1998): Verbesserung und Beschleunigung der
Rinderlungenseuche-Diagnostik durch Direktnachweis des Erregers mittels
Polymerase-Kettenreaktion (PCR). BMTW 111, 268-272

FLI 282
Amtliche Methodensammlung Stand: Mai 2013

Anhang

1. Liste der von den Landes-Veterinärbehörden festgelegten


Untersuchungsämter für die Lungenseuche-KBR

Bundesland Untersuchungsämter
Baden-Württemberg Staatliches Tierärztliches Untersuchungsamt Aulendorf
- Diagnostikzentrum -
Löwenbreitestr. 18/20
88326 Aulendorf

Tel.: (07525) 942-0 Fax: (07525) 942-200


E-Mail: Poststelle@stuaau.bwl.de

Chemisches- und Veterinäruntersuchungsamt Stuttgart


Schaflandstr. 3/3
Sitz Fellbach
70736 Fellbach

Telefon (07 11) 9 57 – 1727 Fax: (0711) 957-1729


E-Mail: Poststelle@CVUAS.BWL.DE

Bayern Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit


- Dienststelle Oberschleißheim
Veterinärstr. 2
85764 Oberschleißheim

Tel.: (089) 31560-1 Fax: (089) 31560-425


E-Mail: poststelle@lgl.bayern.de

Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit


– Dienststelle Erlangen
Eggenreuther Weg 43
91058 Erlangen

Tel.: (09131) 764-0 Fax: (09131) 764-102


E-Mail: poststelle@lgl.bayern.de

Berlin Berliner Betrieb für Zentrale Gesundheitliche Aufgaben,


Institut für Lebensmittel, Arzneimittel und Tierseuchen Berlin (ILAT)
Invalidenstr. 60
10557 Berlin

Tel. 030 / 39784-30 Fax 030 / 39784-380


E-Mail: mail@bbges.de

Brandenburg Landeslabor Brandenburg


Ringstraße 1030
15236 Frankfurt (Oder)
Tel.: (0335) 5217-100 Fax: (0335) 5217-120
E-Mail: poststelle@llb.brandenburg.de

Postanschrift:
Landeslabor Brandenburg, Postfach 1469, 15204 Frankfurt (Oder)

FLI 283
Amtliche Methodensammlung Stand: Mai 2013

Hessen Landesbetrieb Hessisches Landeslabor


Marburger Str. 54
35396 Gießen

Tel.: (0641) 3006-0 Fax: (0641) 3006-99


E-Mail: poststelle@lhl.hessen.de

Mecklenburg- Landesamt für Landwirtschaft, Lebensmittelsicherheit und Fischerei


Vorpommern Mecklenburg-Vorpommern (LALLF M-V)
Thierfelder Str. 18/19
18059 Rostock

Tel.: (0381) 4035-0 Fax: (0381) 4001510


E-Mail: poststelle@lallf.mvnet.de

Postanschrift:
Landesveterinär- und Lebensmitteluntersuchungsamt Mecklenburg-
Vorpommern, Postfach 102064,18003 Rostock

Niedersachsen Niedersächsisches Landesamt für Verbraucherschutz und


Lebensmittelsicherheit (LAVES), Veterinärinstitut Hannover
Eintrachtweg 17
30173 Hannover

Tel.: 05 11/ 2 88 97-0 Fax: 05 11/ 2 88 97-299


E-Mail: poststelle.vi-h@laves.niedersachsen.de

Nordrhein-Westfalen Staatliches Veterinäruntersuchungsamt


Deutscher Ring 100
47798 Krefeld

Tel.: (02151) 849-0 Fax: (02151) 849-110


E-Mail: poststelle@svua-krefeld.nrw.de

Postanschrift:
Staatliches Veterinäruntersuchungsamt, Postfach: 21710
47798 Krefeld

Rheinland-Pfalz Landesuntersuchungsamt Rheinland-Pfalz


Institut für Tierseuchendiagnostik
Blücherstr. 34
56073 Koblenz

Tel.: 0261/9149-599 Fax: 0261/9149-570


E-Mail: poststelle@lua.rlp.de

Saarland Landesamt für Soziales, Gesundheit und Verbraucherschutz


Abteilung Verbraucherschutz, Veterinärmedizin
Hochstr. 67
66115 Saarbrücken

Tel.: (0681) 99780 Fax: (0681) 9978-2299


E-Mail: poststelle@lsgv.saarland.de

FLI 284
Amtliche Methodensammlung Stand: Mai 2013

Sachsen Landesuntersuchungsanstalt für das Gesundheits- und


Veterinärwesen Sachsen (LUA)
Standort Leipzig, Außenstelle Wiederitzsch
Beethovenstraße 25
04107 Leipzig

Tel: (0341) 9788-0 Fax: (0341) 9788-159


E-Mail: poststelle@lua.sms.sachsen.de

Sachsen-Anhalt Landesamt für Verbraucherschutz des Landes Sachsen-Anhalt


Fachbereich 4, Veterinärmedizin
Haferbreiter Weg 132-135
39576 Stendal

Tel.: (03931) 631-0 Fax: (03931) 631-153


E-Mail: poststelle@lav.ms.lsa-net.de

Schleswig-Holstein Landeslabor des Landes Schleswig-Holstein,


Lebensmittel-, Veterinär- und Umweltuntersuchungsamt
Max-Eyth-Str. 5
24537 Neumünster

Tel.: (04321) 904-5 Fax: (04321) 904-619


E-Mail: Info@lvua-sh.de

Thüringen Thüringer Landesamt für Lebensmittelsicherheit und


Verbraucherschutz (TLLV), Abteilung 5 – Veterinäruntersuchung
Standort Bad Langensalza
Tennstedter Str. 9
99947 Bad Langensalza

Tel.: 0361 37743-500 Fax: 0361 37743-050


E-Mail: poststelle@tllv.thueringen.de

2. Medium B-Bouillon
• 2,45 g Heart infusion broth (Difco)
+ 90,0 ml Aqua bidest.
• Autoklavieren 20 min bei 121 °C
• steril filtriert aseptisch hinzugeben:
20,0 ml Pferdeserum
10,0 ml Frischhefeextrakt*, 25%ig
1,2 ml Calf thymus DNA (von Sigma oder Difco), 0,2%ig
1,0 ml Thalliumacetat, 1%ige Lösung
• pH-Wert 7,8 einstellen

FLI 285
Amtliche Methodensammlung Stand: Mai 2013

3. Medium B-Agar
• 3,60 g Heart infusion agar (von Difco)
+ 90,0 ml Aqua bidest.
• Autoklavieren 20 min bei 121 °C
• nach Abkühlung auf 50 °C steril filtriert aseptisch hinzufügen:
20,0 ml Pferdeserum
10,0 ml Frischhefeextrakt*, 25%ig
1,2 ml Calf thymus DNA (von Sigma oder Difco), 0,2%ig
• pH-Wert 7,8 einstellen
*
Frischhefeextrakt:
• 250 g frische Bäckerhefe
+ 1000 ml Aqua bidest.
• Suspension für 15 min kochen
• Zentrifugieren 15 min bei 250 x g
• Sterilfiltrieren
• zu 10 ml-Mengen abfüllen
• Aufbewahrung bei -20 °C (maximal 2 Monate)

FLI 286
Amtliche Methodensammlung Stand: Mai 2013

34. Maul- und Klauenseuche

34.1. Charakterisierung der Infektion


Die Maul- und Klauenseuche (MKS) ist eine hochansteckende Viruserkrankung der
Paarhufer, die zur Bildung von Bläschen (Aphthen) und Erosionen an der
Mundschleimhaut und unbehaarten Teilen der Haut, insbesondere an den Klauen,
führt. Bei Jungtieren kann es zu hohen Verlusten durch Schädigung des
Herzmuskels kommen. Die MKS gehört wegen ihrer dramatischen ökonomischen
Auswirkungen zu den bedeutsamsten Tierseuchen. Es besteht jederzeit das Risiko
einer Einschleppung des Virus nach Europa mit dem Reiseverkehr oder durch die
illegale Einfuhr landwirtschaftlicher Erzeugnisse. Stomatitiden und
Klauenveränderungen kommen bei landwirtschaftlichen Nutztieren recht häufig vor
und ihre Ursachen lassen sich oft nicht eindeutig klären. In manchen Fällen ist
klinisch und pathomorphologisch eine differenzialdiagnostische Abgrenzung zur Maul
und Klauenseuche nicht möglich, was eine labordiagnostische Abklärung zwingend
erforderlich macht.

34.1.1. Erreger
Genus Aphthovirus der Familie Picornaviridae, 7 Serotypen (O, A, C, ASIA, SAT1,
SAT2, SAT3), unterteilt in insgesamt 46 Topotypen.

34.1.2. Klinische Symptomatik


Beim Rind stellt nach meist 2 bis 7 Tagen, selten bis 14 Tagen, Inkubationszeit
Fieber das erste Krankheitszeichen dar. Es hält gewöhnlich 1 bis 3 Tage an, kann
aber aufgrund von Sekundärinfektionen später wieder ansteigen. Als weiteres
Frühsymptom ist gegebenenfalls ein Absinken der Milchleistung zu beobachten. Die
Tiere speicheln, zeigen eine gerötete Mundschleimhaut sowie eine zurückgehende
Futteraufnahme. Dann treten in der Mundhöhle und an den Klauen, unter Umständen
auch am Euter, Aphthen bzw. Vesikel auf. Während die Läsionen im Bereich des
Maules nach der Ruptur meist innerhalb weniger Tage reepithelisieren, dauert die
Heilung an den Klauen länger, teilweise bedingt durch bakterielle
Sekundärinfektionen. Die MKS verläuft bei adulten Tieren im Allgemeinen nicht
tödlich, doch kommen neben den lokalen Veränderungen Milchrückgang, Inappetenz
und Gewichtsverlust vor und die Tiere bleiben oft für lange Zeit leistungsgemindert.
Die klinischen Erscheinungen der MKS sind bei Milchrindern tendenziell stärker
ausgeprägt als bei Mastrindern. Insbesondere bei Kälbern wird eine myokardiale
Form mit potenziell perakut tödlichem Verlauf beschrieben. Bei manchen Epidemien
wurde diese Form auch bei älteren Tieren vermehrt beobachtet (sog. “bösartige
MKS“).

Beim Schaf fallen nach einer Inkubationszeit von meist 2 bis 8 Tagen, gelegentlich
auch zwischen einem Tag und 14 Tagen vorwiegend Lahmheiten aufgrund von
Klauenläsionen auf. Die Veränderungen der Mundschleimhaut sind schwächer
ausgeprägt als beim Rind oder fehlen ganz. Die meist kleinen Schleimhautläsionen
konfluieren nicht. Bei einem Großteil der Schafe können die klinischen
Veränderungen sehr schwach und nur für kurze Zeit ausgeprägt sein. Daher sind bei

FLI 287
Amtliche Methodensammlung Stand: Mai 2013

möglichst vielen Tieren die Gliedmaßen oberhalb des Ballenhorns, am Kronsaum


und im Zwischenklauenspalt zu untersuchen. Zu achten ist auch auf Fieber,
Inappetenz, Aborte und Verluste bei Lämmern (myokardiale Form).

Bei der Ziege verläuft die MKS meist gutartig und ohne Allgemeinstörungen. Es
finden sich schnell rupturierende Aphthen in der Mundschleimhaut, aus denen sich
dann Erosionen entwickeln. Eine Rhinitis kann ebenfalls vorkommen. Die Klauen
sind nur selten mitbetroffen.

Beim Schwein treten nach einer Inkubationszeit von meist 1 bis 3 Tagen, bei
geringer Infektionsdosis von bis zu 11 Tagen Blasen vorwiegend an den
Sohlenballen, im Klauenspalt und am Kronsaum auf. Das Fieber kann in einigen
Fällen 42° C erreichen, liegt aber meist bei 39 bis 40° C und auch Verlaufsformen mit
leichtem Fieber wurden beschrieben. Die Tiere zeigen zunächst oft eine gewisse
Lethargie, dann milde und später häufig sehr deutliche Lahmheitserscheinungen, die
sich durch „klammen Gang“ bis hin zu höchstgradiger Schonung der Gliedmaßen
äußern. Aufgrund der starken Schmerzen bewegen sich die Schweine vielfach nur
noch rutschend auf den Karpal- und Tarsalgelenken. Die Entzündung an Kronsaum
und Sohlenballen kann schließlich zum Verlust des Klauenhorns („Ausschuhen“)
führen. Auf der Rüsselscheibe, in der Mundhöhle sowie an den Zitzen säugender
Sauen können ebenfalls Vesikel auftreten. Häufig sind diese Läsionen zum Zeitpunkt
der Untersuchung nur noch als Schorf erkennbar. Durch die myokardiale Form
werden schwere Verluste bei Saugferkeln ohne Veränderungen an den
Schleimhäuten hervorgerufen. Es können auch nur wenige Tiere eines Bestandes
betroffen sein. Deshalb ist eine intensive Bestandskontrolle erforderlich

34.1.2.1. Wirtsspektrum
• natürlicherweise Klauentiere (Rind, Schaf, Ziege, Büffel, Wildwiederkäuer,
Schwein); u. U. Giraffen, Elefanten und Kamele, selten andere Spezies,
experimentell insbesondere Meerschweinchen und Mäuse
• Mensch nur in seltenen Ausnahmefällen bei starker Exposition; unter
mitteleuropäischen Bedingungen besteht auch im Falle eines Seuchenzuges
keine Gefahr für den Verbraucher.

34.1.3. Differentialdiagnostik
Die wichtigsten viralen Differentialdiagnosen sind vesikuläre Stomatitis (VS),
vesikuläre Schweinekrankheit (SVD), Mucosal Disease (MD), bösartiges
Katarrhalfieber (BKF), Rinderpest, Pest der kleinen Wiederkäuer (PPR), Stomatitis
papulosa, Lippengrind (Orf), Blauzungenkrankheit (BT) und die epizootische
Hämorrhagie (EHD). Bei Schaf („OMAGOD“) und Schwein wurden ätiologisch nicht
näher aufzuklärende und an MKS-Symptome erinnernde Veränderungen
beschrieben. Auch Bakterien, chemische Noxen und mechanische Traumata können
zu Stomatitiden und Klauenveränderungen führen.

34.1.4. Diagnostische Indikation


Differenzialdiagnostische Abklärung klinischer Auffälligkeiten, konkreter Verdacht auf
MKS sowie Export-/Importuntersuchungen

FLI 288
Amtliche Methodensammlung Stand: Mai 2013

34.1.5. Zuständige Untersuchungseinrichtungen


Friedrich-Loeffler-Institut, Insel Riems, Südufer 10, 17493 Greifswald sowie die
Untersuchungseinrichtungen der Länder, nach Festlegung der jeweils zuständigen
Obersten Landesbehörde.
Mit der Verabschiedung der neuen Mindest-Biosicherheitsstandards für MKS-
Laboratorien (Minimum Biorisk Management Standards for Laboratories working with
Foot-and-Mouth Disease Virus, 40th General Session of the European Commission
for the Control of FMD (EUFMD), Rome, 22-23 April 2013) wurden die Bedingungen
klargestellt, unter denen auch Untersuchungseinrichtungen, die nicht als MKS-
Hochsicherheitslabor zugelassen sind, Proben auf Erreger der MKS oder Antikörper
gegen MKSV untersuchen dürfen. Das o.g. EUFMD-Dokument wird, wie schon die
vorherige Fassung von 2009, in der MKS-Richtlinie des Rates 2003/85/EG zitiert
werden und damit Rechtskraft erlangen. Es wurde in englischer Fassung den vor den
Ländern benannten Untersuchungseinrichtungen zugeleitet. Das FLI wird eine
deutsche Übersetzung erstellen.
Der Grundgedanke der neuen Mindest-Biosicherheitsstandards ist, dass von der
zuständigen Behörde benannte Untersuchungseinrichtungen inländische
diagnostische Proben mit Methoden (z.B. PCR, ELISA) untersuchen dürfen, bei
denen infektiöses MKSV weder vermehrt noch als Reagenz oder Positivkontrolle
eingesetzt wird. Sie müssen hierzu bestimmte Auflagen bezüglich der Biosicherheit
erfüllen, die aber in einem Labor der Sicherheitsstufe 2 umsetzbar sind

34.1.6. Rechtsgrundlagen
Verordnung zum Schutz gegen die Maul- und Klauenseuche (MKS-Verordnung) in
der jeweils gültigen Fassung, Verordnung über anzeigepflichtige Tierseuchen in der
jeweils gültigen Fassung, Richtlinie 2003/85/EG

34.2. Untersuchungsmaterial
Der Nachweis von infektiösem MKS-Virus bzw. MKSV-Antigen und virusspezifischer
Nukleinsäure gelingt am sichersten in Aphthenlymphe sowie
Aphthendeckenmaterial frischer Aphthen. Sind keine Aphthen vorhanden, ist
Material am Übergang zum gesunden Gewebe zu entnehmen. Tritt der Verdacht bei
Tieren nach Schlachtung, Tötung oder Verenden auf, können auch Organe
(veränderte Teile von Zunge, Maulschleimhaut, Klauen, Euter, Herz, Pansenpfeiler)
in dicht verschlossenen Behältnissen und gekühlt eingesandt werden. Beim Fehlen
von Aphthen kann versucht werden, MKSV auch aus Speicheltupferproben zu
isolieren. Rachenschleimproben (Probang) sind dann zu nehmen, wenn die
Aphthen bereits abgeheilt sind. Sie dienen der Erkennung klinisch gesunder
Virusträger (Carrier), bei denen das MKSV in der Schleimhaut von Pharynx und
Oesophagus persistiert (beim Rind bis zu 3 Jahren, bei kleinen Wiederkäuern bis zu
9 Monaten). Schafe und Ziegen zeigen vielfach keine typischen MKS-Symptome. Bei
diesen Tieren sind daher auch stets Blutproben und Speicheltupferproben (oder
Probangproben) einzusenden. Blutproben dienen insbesondere dem Nachweis von
Antikörpern. Diese sind im Serum frühestens ab dem 5. bis 7. Tag nachweisbar und
erreichen bei Rindern rasch hohe Titer.

FLI 289
Amtliche Methodensammlung Stand: Mai 2013

Wird der Verdacht aufgrund klinischer Symptome festgestellt, sind mehrere seuchen-
verdächtige Tiere mit frischen Veränderungen zu beproben (Aphthen, Schleimhaut-
fetzen). Blutproben zum Nachweis von Antikörpern sind möglichst von Tieren mit
älteren Veränderungen zu nehmen. Bezüglich der Probenziehung aus symptomlosen
Beständen wird auf die Angaben in der Richtlinie 2003/85/EG und der MKS-
Verordnung sowie auf das Tierseuchenbekämpfungshandbuch (TSBH) verwiesen.
Den dort genannten Stichprobenschlüsseln liegt meist eine 95 % Sicherheit bei der
Erkennung einer 5 % Prävalenz zugrunde. Generell sind Proben möglichst sauber zu
gewinnen und nicht mit Desinfektionsmitteln und Säuren in Kontakt zu bringen. Die
Probenverpackung muss den ADR-Vorschriften entsprechen (UN 3373,
Verpackungsanweisung P650), auf jeden Fall aber flüssigkeitsdicht sein und
äußerlich gut desinfiziert werden (z. B. mit 2 % NaOH). Sie darf außerhalb des
zuständigen Labors nicht mehr geöffnet werden. Die Proben sind telefonisch
anzukündigen: Adresse: Friedrich-Loeffler-Institut, Insel Riems, Südufer 10, 17493,
Tel. 0383517-0. Ein Einsendeformular für MKS-Proben findet sich im
Tierseuchenbekämpfungshandbuch (TSBH). Falls ein solches Formular nicht zur
Verfügung steht, ist im Anschreiben jedoch mindestens anzugeben:

• Wer sendet ein? (Veterinäramt, Bearbeiter; incl. dienstlicher und eventuell


privater Telefon- und Fax-Nummer)
• Was wird eingesandt? (Art des Materials, von welchen Tieren, Anzahl etc.)
• Aus welchem Bestand stammen die Proben?
• Was wurde wann in dem Bestand festgestellt - anamnestischer Kurzbericht.
• Zusätzliche Angaben, soweit möglich:
− Wie groß ist der Bestand? Tierarten?
− Art des Bestandes (Zucht-, Mast-, Händlerbestand etc.)?
• Wurden in den letzten 6 Wochen Klauentiere neu eingestallt, wenn ja, woher
(Ausland)?
• Bemerkungen

34.3. Untersuchungsgang
34.3.1. Erregernachweis
Der Nachweis virusspezifischer Nukleinsäure erfolgt heute mittels RT real-time
PCR und liefert in der Regel noch am gleichen Tag ein Ergebnis. Geeignete Proben
sind Aphthenmaterial, Nasen- und Speicheltupfer, Blut (kein Heparinblut!) und in
Spezialfällen Rachenschleimproben (Probang Samples). Die PCR kann sowohl am
FLI wie in den Untersuchungseinrichtungen der Länder durchgeführt werden. Den
Untersuchungseinrichtungen der Länder wurde das unten stehende PCR-Protokoll
zugleitet. Am FLI existieren noch weitere PCR-Protokolle, die zur Absicherung der
Ergebnisse dienen und in Spezialfällen auch an Untersuchungseinrichtungen der
Länder abgegeben werden können. Durch die Sequenzierung von Produkten
spezieller PCR-Verfahren können epidemiologische Aussagen auf molekularer
Grundlage getroffen werden.

Die Virusisolierung in Zellkultur wird am FLI durchgeführt und dient zur


Bestätigung von PCR-Befunden sowie zur Vorbereitung der Viruscharakterisierung.
Geeignete Proben sind insbesondere Aphthenmaterial, Nasen- und Speicheltupfer,
Probangproben und Blut. Der Zeitbedarf beträgt 1 bis 3 Tage bis zum Auftreten eines

FLI 290
Amtliche Methodensammlung Stand: Mai 2013

zytopathischen Effektes. Dann folgt bei Primärausbrüchen die nähere


Charakterisierung des Isolates um Aussagen über einen möglichen Impfstoff und die
Einschleppungsquelle machen zu können.
Der Antigen-ELISA wird am FLI durchgeführt mit Aphthenmaterial und Zellkultur-
überständen um rasch eine vorläufige Bestimmung des Serotyps zu ermöglichen.
Das Ergebnis liegt in der Regel am gleichen Tag vor.

Real-time RT-PCR zum Genomnachweis von MKSV


qRT-PCR_FMD- IRES-1
Die hier beschriebene FMD-IRES-1-Methode basiert auf der Veröffentlichung von
Oem et al. (2005) J. Vet. Sci. 6(3), 2007-212 und amplifiziert ein 128 bp-Fragment in
der IRES-Region des Maul- und Klauenseuche Virus (MKSV).
Der Assay detektiert sehr sensitiv alle bisher im Nationalen Referenzlabor für MKS
am Friedrich-Loeffler-Institut (FLI) untersuchten Serotypen und Isolate des MKSV.
Unspezifische Reaktionen, etwa mit anderen Erregern, wurden nicht festgestellt.
Der FMD-IRES-Assay ist im vorliegenden Protokoll mit dem „housekeeping gene“
beta-Aktin kombiniert. Der hier angewandte Assay basiert auf der Publikation von
Toussiant et al. (2007) J. Virol. Methods 140, 115–123 und amplifiziert ein 131 bp-
Fragment des beta-Aktin-Gens.

Durchführung:
(1) Die Amplifizierung der Feldproben und der internen Kontrollen (IC) erfolgt als
duplex-RT-PCR in einem Reaktionsansatz.
(2) Die Amplifizierung erfolgt auf Basis des Superscript III One-Step RT-PCR Kits
(#12574-026; Invitrogen) in 25µl Gesamtvolumen.
(3) Als alternativer Kit kann der QuantiTect Probe RT-PCR Kit (#204445; Qiagen)
verwendet werden. Das Temperaturprofil ist entsprechend anzupassen.
(4) Sollte eine andere chemische Basis für die Detektion genutzt werden, muss in
Vergleichsexperimenten die Sensitivität und Spezifität der verwendeten
Reagenzien gezeigt werden.
(5) Als Kontrollen sollten neben der „No Template“ Kontrolle (NTC) und mindestens
einer positive Kontrolle (PC), auch eine geeignete Anzahl von RNA-
Isolierungskontrollen (RIC) mitgeführt werden. Die RNA-Isolierungskontrollen
sollten im optimalen Falle negatives Untersuchungsmaterial in der gleichen Art
wie die Feldproben darstellen (z.B. negatives EDTA-Blut). Dies hat den Vorteil,
dass suboptimale Extraktionen und partielle Inhibierungen von Feldproben durch
den Abgleich der beta-Aktin-Kontrolle von RIC und Feldproben festgestellt
werden können.
(6) Nach Herstellung des Mastermixes werden je 20µl vorgelegt und 5µl Template
zugefügt. Die Amplifizierung erfolgt in einem Gesamtvolumen von 25 µl. Sollte
hiervon abgewichen werden, muss in Vergleichsexperimenten die sensitive
Amplifikation und Detektion gezeigt werden.

Auswertung:
HEX-Kanal:
a) Für alle Feldproben und die RNA-Isolierungskontrollen (RIC) sollte ein Treshold-
Cycle-Wert (Ct-Wert) nachweisbar sein. Sind die Ct-Werte für die genannten
Proben vorhanden, ist von einer erfolgreichen RNA-Isolierung und RT-PCR
auszugehen.

FLI 291
Amtliche Methodensammlung Stand: Mai 2013

b) Ist kein Ct-Wert für die IC feststellbar und gleichzeitig auch keine MKSV-
spezifische Amplifizierung aufgetreten, ist die real-time RT-PCR nicht auswertbar
und somit ist die RNA-Isolierung und/oder die RT-PCR zu wiederholen.
c) Ist auch bei den RIC kein Ct-HEX-Wert feststellbar, muss die Funktionalität des
Primer-Sonden-Mixes zum Nachweis Beta-Aktin überprüft werden.
d) Für die NTC (SDW) und der PC sollte kein Ct-HEX-Wert feststellbar sein.

FAM-Kanal:
a) Für die PC sollte ein Ct-Wert um 33 feststellbar sein. Hiermit wird die Funktion
des MKS-Genom-Detektionssystems sichergestellt. Ist für die PC kein Ct-Wert
feststellbar, ist die RT-PCR mit einem neuen FMD-IRES-Mix1 und/oder einer
neuen PC-FMD zu wiederholen.
b) Für die RIC und die NTC sollte kein Ct-FAM-Wert feststellbar sein.
c) Wenn alle eingesetzten Kontrollen in richtiger Weise reagieren ist eine
Auswertung der Feldproben-Ansätze möglich.
d) Eine differentialdiagnostisch abzuklärende Probe wird dann als MKS-
positiv/verdächtig in der RT-PCR gewertet, wenn ein Ct-FAM-Wert für die
entsprechende Probe festgestellt wird.
e) Bei einem positiven/verdächtigen MKSV real time RT-PCR-Ergebnis in dem
Assay ist eine Wiederholung der real time RT-PCR und / oder eine Verifizierung
des Ergebnisses mit einer anderen RT-PCR basierend auf anderen Primern
angezeigt.

Herstellung Primer-Sonden-Mixe:
FMD-IRES-Mix1-FAM

Menge Name Stock- Sequenz 5´- 3´


Konzentratio
n
20 µl FMD-IRES-1F 100 pmol/µl TGT GTG CAA CCC CAG CAC
20 µl FMD-IRES-1R 100 pmol/µl CGA GTG TCG CRT GTT ACC
2,5 µl FMD-IRES1- 100 pmol/µl FAM- ACA GGC TAA GGA TGC CCT TCA GGT ACC
FAM –BHQ1
157,5 µl TE pH8.0 0,1 x
200,0 µl FMD-IRES-Mix1-FAM

Beta-actin-Mix2-HEX

Stock-
Name Konzentratio Sequenz 5´- 3´
n
5 µl ACT-1005-F 100 pmol/µl CAGCACAATGAAGATCAAGATCATC
5 µl ACT-1135-R 100 pmol/µl CGGACTCATCGTACTCCTGCTT

2,5 µl ACT-1081-HEX 100 pmol/µl HEX- TCG CTG TCC ACC TTC CAG CAG ATG T -
BHQ1
187,5 µl TE pH8.0 0,1 x

FLI 292
Amtliche Methodensammlung Stand: Mai 2013

200,0 µl Beta-actin-Mix2-HEX

FLI 293
Amtliche Methodensammlung Stand: Mai 2013

Protokollblatt für qRT-PCR_FMD-IRES1

Labor -Nr.: Durchführung der real-time RT-PCR:


Datum: Uhrzeit: Durchführender:

Bemerkungen:
Mastermix MKS - Nachweis
Superscript III One-Step-Kit (Invitrogen) FMD-IRES + beta-Aktin
Kit-Charge: 1x
RNase freies Wasser 2,0 µl

2x Reaction Mix 12,5 µl

MgSO 4 (5 mM) 0,5 µl

SS III RT/Platinum Taq-Mix 1,0 µl

FMD-IRES-Mix1-FAM 2,0 µl
Beta-Actin-Mix 2-HEX
2,0 µl

Total Volumen Mastermix: 20,0 µl

RNA-Template: (Feldproben, RIC, PC-FMD, NTC) 5,0 µl


1 2 3 4 5 6 7 8 9 10 11 12

Cycler-Programm: RT 15 min 50°C


# Messung: FAM+HEX Inaktiv./Aktiv. 2 min 94°C
# Sammeln der Fluoreszenzdaten in
Denaturierung 15 sec 94°C
der Annealingphase
Annealing 30 sec 55°C 42 Zyklen
Elongation 30 sec 68°C

34.3.2. Antikörpernachweis
Der Antikörper-ELISA wird mit Serum (falls keines zur Verfügung steht, notfalls er-
satzweise gerinnungsgehemmtem Blut) durchgeführt und benötigt 1 bis 2 Tage. Man
unterscheidet Verfahren zum Nachweis von Antikörpern gegen Strukturproteine
(serotypspezifisch) und gegen Nichtstrukturproteine (NSP) (serotypübergreifend).
Letztere Tests sind auch geeignet, infizierte Tiere in einer geimpften Population zu
erkennen, da die Impfung nur Antikörper gegen Strukturproteine induziert (DIVA-
Konzept).
Im Ausbruchsfall würden Proben in Untersuchungseinrichtungen der Länder mit
kommerziell hergestellten ELISAs zum Nachweis von Antikörpern gegen NSP des

FLI 294
Amtliche Methodensammlung Stand: Mai 2013

MKSV untersucht werden. Die deutschen Länder unterhalten für den Seuchenfall
eine Testkitbank bei der Firma Prionics. (Web-Adresse: http://www.prionics.com).
Diese liefert den PrioCHECK® FMDV NS welcher nach Anleitung des Herstellers
durchzuführen ist. Bei Auftreten positiver Einzeltierreaktionen in Antikörper-ELISAs
mit Proben aus ansonsten unverdächtigen Betrieben sind Nachuntersuchungen,
insbesondere mit dem Virus-Neutralisationstest (NT) erforderlich. Dieser wird nur am
FLI durchgeführt und dauert in der Regel 4 Tage. In bestimmten Fällen kann auch
eine Untersuchung auf Antikörper gegen Strukturproteine des MKSV sinnvoll sein.
Die Untersuchungseinrichtungen der Länder können hierzu, so vorhanden,
kommerzielle Testkits einsetzen. Es ist die Prüfung der Eignung der Testkits für das
aktuelle Ausbruchsvirus durch das FLI abzuwarten. Zurzeit existiert diese Möglichkeit
de facto nur für den Serotyp O. Auch für die anderen Serotypen existieren
spezifische Antikörper-ELISAs (LPBE und SPCE), die aber zurzeit nur am FLI
durchgeführt werden können.
Zugelassene Testkits finden sich auf der Webseite des FLI
(http://www.fli.bund.de/fileadmin/dam_uploads/zulassungsstelle/deutsch/02_d_Zul_M
ittel.pdf).

FLI 295
Amtliche Methodensammlung Stand: Mai 2013

35. Milzbrand

35.1. Charakterisierung der Infektion


35.1.1. Erreger
Bacillus (B.) anthracis ist der Erreger des Milzbrandes, einer meist akut und oft
tödlich verlaufenden Infektionskrankheit mit septikämischem Charakter. Haus- und
Wildwiederkäuer sind hochempfindlich für Milzbrand, Schweine, Fleischfresser und
auch Menschen (eher mäßig) und Vögel (Ausnahme Strauß) gelten als fast resistent.
Die Krankheit ist weltweit verbreitet und kommt am häufigsten in Asien (Naher und
Ferner Osten, Indien), Afrika und Südamerika vor; in Europa sind der mediterrane
Raum und Osteuropa am stärksten betroffen.
Die Ansteckung erfolgt gewöhnlich durch die Aufnahme von Milzbrandsporen mit
dem Futter oder Trinkwasser. Nur in Ausnahmefällen wird die Krankheit von Tier zu
Tier übertragen. Auch eine Ansteckung über Milzbrandsporen enthaltende Stäube
und Aerosole ist möglich.
Der Milzbranderreger bildet Sporen als Dauerformen, die sich über Jahrzehnte im
Erdboden als ansteckungsfähig erhalten können. Milzbrandsporen werden weder
durch Fäulnis noch durch Eintrocknen oder beim Gerben der Häute vernichtet.

35.1.2. Klinische Symptomatik


Milzbrand ist am lebenden Tier selten mit Sicherheit festzustellen.

Beim Rind und Schaf treten meist plötzliche Todesfälle auf. Aus den
Körperöffnungen (Anus, Vulva, Mund, Nase) tritt dunkles, schlecht
gerinnendes Blut. Erst bei der Zerlegung ist ein Verdacht auf Milzbrand
festzustellen. Wenn weitere Tiere mit hohem Fieber, unregelmäßigem Puls,
beschleunigter Atmung und evtl. Kolikerscheinungen erkranken, liegt der
Verdacht auf Milzbrand nahe. Tierärztliche Behandlung ist nur dann Erfolg
versprechend, wenn sie frühzeitig einsetzen kann.

Beim Pferd: plötzlich hochfieberhafte Erkrankung mit Kolik, Schling- und


Atembeschwerden, Atemnot wegen Schwellung im Kehlgangsbereich, auch
scheinbare Besserung und Tod nach mehreren Tagen.

Beim Schwein können Krankheitserscheinungen am lebenden Tier fehlen, in


vereinzelten Fällen sind Atembeschwerden infolge Rachenentzündung sowie
Verfärbung und Schwellung im Bereich des Kehlkopfes (Milzbrandbräune) zu
beobachten. Die größte Zahl der Milzbrandfälle wird erst bei der
Fleischbeschau oder in der Tierkörperbeseitigungsanstalt festgestellt.

35.1.3. Differentialdiagnostik
Pasteurellose, Rauschbrand, Pararauschbrand, Vergiftungen

35.1.4. Diagnostische Indikation


gemäß Milzbrand-Rauschbrand-VO siehe 1.6.

FLI 296
Amtliche Methodensammlung Stand: Mai 2013

35.1.5. Zuständige Untersuchungseinrichtungen


• Zuständige Landesuntersuchungsämter
• Nationales Referenzlabor am FLI, Standort Jena
• Konsiliarlaboratorium für B. anthracis in Umweltproben, Institut für Umwelt-
und Tierhygiene, Universität Stuttgart

35.1.6. Rechtsgrundlagen
• Verordnung zum Schutz gegen den Milzbrand und den Rauschbrand vom 23.
Mai 1991 (BGBl. I S. 1172) in der jeweils geltenden Fassung.
• Manual of Standards for Diagnostic Tests and Vaccines des OIE

35.2. Untersuchungsmaterial
35.2.1. Gewinnung
Zur Untersuchung sollte nur frisch entnommenes Material verwendet werden.

Vom lebenden Tier: Blut aus der Ohrvene (B. anthracis ist nur 16 bis 18 h vor
dem Tod im Blut nachweisbar)

Vom toten Tier: Ganze Kadaver, Sektionsmaterial, aber auch Blutausstriche


und tierische Produkte wie Häute, Haare, Wolle,
Tierkörpermehle

35.2.2. Transport und Lagerung


Während des Transportes und evtl. notwendig werdender kurzzeitiger Lagerung ist
das Material kühl bei +7 °C ± 3 °C aufzubewahren.

• Untersuchungsmaterial vorschriftsmäßig gemäß der entsprechenden


Gefahrgutverordnung Straße (ADR) und Eisenbahn (RID), Luftverkehr (IATA-
DGR), DIN EN 829 in der jeweils geltenden Fassung, in dicht schließenden
Behältnissen verpackt, gekennzeichnet, zusammen mit Vorbericht und
Untersuchungsantrag nach vorheriger telefonischer Absprache schicken.
• Wegen möglicher Gefährdungen während des Transportes sollte Milzbrand-
verdächtiges Untersuchungsgut durch Kurier übermittelt werden.

35.3. Untersuchungsgang
Der Umgang mit potentiell B. anthracis-haltigem Material und Kulturen ist
genehmigungspflichtig und darf nur in einem Labor der Sicherheitsstufe 3
vorgenommen werden und die entsprechenden Maßnahmen für biologische
Sicherheit sind zu beachten.

FLI 297
Amtliche Methodensammlung Stand: Mai 2013

35.3.1. Erregernachweis

35.3.1.1. Mikroskopischer Nachweis


Von veränderten Organen bzw. vom Blut werden Ausstrich- und/oder Ab-
klatschpräparate gefertigt und getrocknet. Die Objektträger sollten nach dem
Lufttrocknen für 1h in 10%iger Formaldehydlösung inaktiviert und fixiert werden.

• Gramfärbung
Die stäbchenförmigen (1,0 bis 1,25 x 5 bis 10 µm), plumpen, zylindrischen Gram-
positiven Milzbranderreger liegen in Organ- und Blutausstrichen einzeln oder in
kurzen Ketten von 2 bis 4 Bazillen vor. Die Enden der einzelnen Zelle sind durch die
Fixierung scharf rechteckig abgegrenzt, in Ketten sieht man gerade oder doppelt
konvexe helle Zwischenräume. Die Längsseiten sind mitunter durch stärkere
Hitzefixierung etwas konkav eingezogen (sog. „Bambusstockform“).
Der Erreger ist etwas Gram-labil, daher sollten die Färbungen innerhalb 24 h nach
Ausstreichen von isolierten Bazillen und Inkubation auf Blutagar erfolgen.

• Kapseldarstellung
Im Tierkörper oder bei Isolierung aus frischem Organmaterial lässt sich eine
deutliche Kapsel erkennen, welche aber nach Kultivierung auf künstlichen
Nährmedien rasch verloren gehen kann oder nur noch schwach ausgebildet wird.
Der Kapselnachweis in Kulturen ist nur möglich, wenn diese auf bikarbonathaltigen
Nährböden unter 5- bis 7%iger CO 2 -Atmosphäre kultiviert wurden.

Differentialdiagnose: Andere Bacillus spp, wie z. B. B. subtilis, B. mesentericus,


B. cereus u. ä., die in den Übersichtsfärbungen B.
anthracis sehr ähnlich sind, lassen sich durch den
Nachweis der Kapselbildung abgrenzen.

35.3.1.2. Kultureller Nachweis


Die kulturelle Anzüchtung gilt als sehr sichere Nachweismethode. Als
Ausgangsmaterial werden o. g. Materialien und Vorbehandlungsarten empfohlen.

Anreicherung
Ist üblich besonders bei der Untersuchung von Futtermitteln, die Tierkörpermehle
enthalten, aber auch bei Häuten, Haaren, Wolle, Oberflächentupfern und
Umweltproben. Beimpfung einer Nährbouillon, die mindestens 18 h bei 37 °C aerob
bebrütet wird. Kontaminiertes Material sollte mit der selektiven Anreicherungsbouillon
für B.-anthracis/ B.-cereus-Sporen angereichert werden.
Schon nach 6 h Schütteln bei 37 °C wird die exponentielle Wachstumsphase erreicht
und man kann auf Selektivnährmedien (s. u.) überimpfen. Zur Sicherheit sollte die
angesetzte Bouillonkultur bis 18 h bei 37 °C weiter bebrütet und danach auf
Selektivnährmedien ausgestrichen werden.
Wird das Untersuchungsmaterial zur Ausschaltung der vegetativen Kontaminanten
für 20 min bei 80 °C erhitzt, kann die angegebene Anreicherungsbouillon für B.
anthracis/ B. cereus auch ohne Hemmstoffe verwendet werden. Dadurch verkürzt
sich die Anreicherungszeit auf 4 h Schütteln bei 37 °C (Reissbrodt, 2004).

FLI 298
Amtliche Methodensammlung Stand: Mai 2013

Direktkultur
Diese erfolgt auf festen Nährmedien wie Blutagar oder den unten angeführten Selek-
tivnährmedien. Hierbei sind stets mehrere Platten zu verwenden. Die Beimpfung
erfolgt direkt oder nach Vorbehandlung und/oder Anreicherung (s. o.). Die Platten
werden mindestens 18 h bei 37 °C aerob bebrütet.
Infolge morphologischer Ähnlichkeiten kommt der Abgrenzung zwischen B. anthracis
und seinen taxonomisch nächsten Verwandten B. cereus, B. thuringiensis und B.
mycoides (B.cereus–Gruppe) besondere praktische Bedeutung zu.
Weiterhin sind differentialdiagnostisch einige Antibiotika bildende Arten von
Interesse, wie z. B. B. polymyxa (Polymyxin B), B. brevis (Tyrothricin), B. subtilis
bzw. B. licheniformis (Bacitracin) von Interesse.
Auch B. megaterium (Erdbazillus) kann im Rahmen der Differentialdiagnostik eine
Rolle spielen.

Nach 18-24stündiger Bebrütung sind Kolonien von B. anthracis mittelgroß bis


groß (etwa 0,5 cm ∅), mattglänzend oder trocken, flach, nicht pigmentiert, mit
flockig-spiraliger Oberfläche und von butterartiger Konsistenz,
„Eischneeeffekt“., auf Blutagar ohne Hämolyse.

Selektive Nährmedien
TMSP- oder Anthrax-Blutagar
Auf diesen semiselektiven Nährböden finden Bacillus spp. eine gute Nährstoffbasis,
um schnell zu charakteristischen großen Kolonien auszuwachsen. Das Wachstum
von B. subtilis und B. megaterium ist vollständig gehemmt. Das Wachstum von
Staphylokokken, von Enterobacteriaceae, Pseudomonas aeruginosa und
Enterokokken ist entweder ebenso vollständig gehemmt oder stark reduziert. Der
Zusatz von Schafblut unterstützt das Wachstum, gleichzeitig ist das Auftreten einer
starken Hämolyse um die Kolonien der anderen Bacillus spp. – wie B. cereus, B.
thuringiensis, B. mycoides, B. licheniformis – ein hervorragendes
Differenzierungsmerkmal zu B. anthracis. B.anthracis-Stämme wachsen als weiße,
große Kolonien (2 bis 6 mm im Durchmesser) mit charakteristischer stumpfer
Oberfläche ohne Hämolyse (Tab. 2).

Chromogene Selektivnährmedien
Zur weiteren Differenzierung der Bacillus spp. wird das beschriebene BCM® B.-
cereus/B.-thuringiensis-Plating-Medium auch als Fertigplatte Cereus-Ident-Agar er-
hältlich, empfohlen. Dieses ursprünglich im Rahmen der B.cereus-/B.thuringiensis-
Diagnostik eingesetzte Nährmedium ermöglicht eine optisch klare
Differentialdiagnostik innerhalb der Bacillus spp. Alle Spezies, welche die
Phosphatidylinositol-Phospholipase C (PI-PLC) enthalten und in der Lage sind, das
chromogene Substrat X-myoinositol-1-phosphat zu spalten, wachsen als türkise
Kolonien (z. B. B. cereus, B. thuringiensis). B. anthracis wächst mit einem
Durchmesser wie B. cereus (ca. 4 mm), aber als stumpfe, weiße Kolonie (Tab. 2).
Eine Gram-positive oder Gram-negative Begleitflora wird dabei weitgehend oder
vollständig gehemmt (Reissbrodt et al., 2004).

35.3.1.3. Phagentest
Der Phagentest wird unter Anwendung des für B. anthracis spezifischen Gamma-
Phagen durchgeführt. Als Ausgangskultur kann einerseits eine 3- bis 4-stündige
Nährbouillonkultur oder eine leicht trübe Suspension des verdächtigen Kolonie-
materials in steriler physiologischer Kochsalzlösung oder auch mit dem
resuspendierten Koloniematerial direkt verwendet werden. Stets sollte als

FLI 299
Amtliche Methodensammlung Stand: Mai 2013

Positivkontrolle ein gut charakterisierter Milzbrandstamm und als Negativkontrolle ein


B.cereus-Stamm bei gleicher Präparationstechnik in die Untersuchung einbezogen
werden.

Durchführung:
Auf Blutagar wird auf der Rückseite der Petrischale mit Schablone eine kreisrunde
Fläche (Ø 2 cm) markiert. Auf dieser Fläche wird das Probenmaterial verteilt. Den
Inhalt einer Öse mit Phagensuspension (Titer ca. 1:10 000) exzentrisch auf diesen
Bereich auslaufen lassen, (Flüssigkulturen müssen vorher erst eintrocknen). Im
günstigen Falle erkennt man schon nach 4-6 Std. zartes Wachstum und das typische
Phagenloch, wenn es sich um B. anthracis handelt.
Der Ansatz wird bei 37°C bebrütet und frühestens nach 5 Stunden und optimal nach
24 Stunden abgelesen.

35.3.1.4. Beweglichkeitstest
Die Prüfung der Beweglichkeit des Bakteriums erfolgt auf halbfestem Agar.
Tetrazoliumsalze sind farblos, werden aber bei Bakteriumwachstum in die Zellen
aufgenommen und zu einem roten Farbstoff (Formazan) reduziert. Die Beweglichkeit
kann damit durch „Ausschwärmen“ der Bakterien auf dem Nährmedium sichtbar
gemacht werden.

Durchführung:
• Koloniematerial (nur wenig!) wird nur mit der Pipettenspitze angetippt und in
die Mitte eines halbfesten TTC-haltigen Nähragars gedrückt
• Platte nicht umdrehen, 24h bebrüten bei 37°C.

Auswertung:

Unbeweglich: B.anthracis Beweglich: B.cereus Alternativ im Röhrchen:


a-unbeimpft,
b,d-beweglich
c-unbeweglich
a b c d

35.3.1.5. Molekularbiologischer Nachweis


Diese sehr spezifische und sensitive Methode steht als konventionelle PCR (OIE,
2008) sowie Realtime-PCR mit TagMan- oder FRET-Sonden zur Verfügung. Der
Nachweis dreier charakteristischer genetischer Marker (Plasmid pX01 kodierend für
protektives Antigen, Plasmid pX02 kodierend für Kapselantigen sowie ein

FLI 300
Amtliche Methodensammlung Stand: Mai 2013

genomischer Marker (z. B. rpoB-Gen oder vrrA-Gen) in verdächtigen Kulturen


bestätigt das Vorhandensein von virulenten B.anthracis-Stämmen.

FLI 301
Amtliche Methodensammlung Stand: Mai 2013

Anhang

1. Mikroskopische Färbemethoden
Abklatsch- oder Ausstrichpräparate sollten aus Sicherheitsgründen mit 10%iger
Formaldehydlösung für mindestens 1h fixiert werden.

1.1. Sporenfärbung nach Wirtz:


• Kochsalzlösung auf OT geben, Untersuchungsgut einmischen, lufttrocknen
• in 10%igem Formaldehyd 30 min-1h fixieren
• lufttrocknen
• Fluten des OT mit 5%iger Malachitgrünlösung
• Erhitzen mit Gasbrenner, 30 sec. kochen (Blasenbildung)
• 45 sec Einwirkzeit
• Auswaschen des Farbüberschusses unter fließendem Wasser 30 Sek.
• Gegenfärben mit 0,5%iger Safraninlösung 30 sec.
• Waschen unter fließendem Wasser
• Trocknen (Fließpapier)

Ergebnis: Sporen = grün, übrige Zellbestandteile = rot

1.2. Kapselfärbung n. Foth (aus klinischem Material)


Da die Kapseln gegenüber äußeren Einflüssen widerstandsfähiger als die
vegetativen Zellen sind, findet man in Kadaver-Ausstrichen bzw.
Abklatschpräparaten oft leere Kapseln.
• Objektträgerausstrich lufttrocknen, aber nicht fixieren (Achtung – Biologisches
Sicherheitsrisiko)
• bedecken mit zwei Tropfen Giemsa-Stammlösung für 1 bis 2 min
• dann 20 Tropfen (= 1 ml) Aqua dest. zusetzen und durch leichtes Schwenken
mit der Giemsa-Lösung mischen, Einwirkungszeit 2 bis 5 min
• abspülen und trocknen

Ergebnis: Bakterienkapsel = rosarot, Bakterienzelle = blauviolett

FLI 302
Amtliche Methodensammlung Stand: Mai 2013

1.3. Kapseldarstellung durch Tusche (aus Kulturmaterial)


Der Kapselnachweis in Kulturen ist nur möglich, wenn diese auf bikarbonathaltigen
Nährböden unter 5- bis 7%iger CO 2 -Atmosphäre kultiviert wurden.
• eine Öse Bakterienmasse von einer Agarplatte Platte in 1ml 10%ige
Formaldehydlösung resuspendieren, 1h stehen lassen
• zentrifugieren 5 min, 13000rpm
• Überstand verwerfen
• ein Tropfen vom Sediment mit einem Tropfen Tusche in einem 1,5ml-Tube
mischen
• davon 1 Tropfen auf einen Objektträger übertagen und mit Deckglas abdecken
• Beurteilung bei 1000-fach Vergr.

Ergebnis: hell leuchtende breite Kapsel um die Bakterienzelle sichtbar.


Abb.1 pathogener, bekapselter B. anthracis -Stamm

Abb. 2: nicht bekapselter Stamm

FLI 303
Amtliche Methodensammlung Stand: Mai 2013

2. Nährmedien

2.1. Anreicherungsbouillon für B.-anthracis/B.-cereus-Sporen


(Reissbrodt, 2002)
Basis
Nutrient Broth (Difco, BD) für 1 l
Tryptone (Difco, BD) 5,0g
NaCl 5,0g
K 2 HPO 4 4,0g
Sterilisation 15 min 121 °C
pH 7,3 ± 0,1
Supplemente (als sterile Lösungen zugeben)
D-Glucose 2,0g
Trimethoprim 0,0032g
Sulfamethoxazol 0,016g
Polymyxin B 0,020g
Cycloheximid 0,200g

2.2. Blutagar
Brucella-Agar (oder andere Blutagarbasis, siehe z. B. die folgende Rezeptur) mit
Zusatz von 5 % defibriniertem Blut von Schafen, Pferden, Rindern oder Kaninchen.
Weiter wird empfohlen:
Bacto-Pepton 10,0 g
Natriumchlorid 5,0 g
Na 2 HPO 4 x 12H 2 O 2,0 g
Fleischextrakt 6,0 g
Aqua dest. ad 1000,0 ml
pH = 7,2 ±0,2

2.3. Anthrax-Blutagar
Caseinpepton 14,0 g
Fleischpepton 4,5 g
Hefeextrakt 4,5 g
NaCl 5,0 g
Agar 16,0 g
Schafblut 50 ml
Trimethoprim 3,2 mg
Sulfamethoxazol 16,0 mg
Polymyxin B 20 mg
Aqua dest. ad 1000,0 ml
pH 7,3 ± 0,2

FLI 304
Amtliche Methodensammlung Stand: Mai 2013

2.4. TMSP-Agar
Standard-Agar 40,0 g
Trimethoprimlactat Salz 13,1 mg
Sulfamethoxazol 20,0 mg
Polymyxin B 30 000 Einheiten
Schafblut 50,0 ml
Aqua dest. ad 1000,0 ml
pH 7,3 ± 0,2

Die Zusätze werden als Sterilfiltrate präpariert und nach Abkühlung des
autoklavierten Agarmediums auf 50 °C zugesetzt. Trimethoprim kann als 100-fache
Stammlösung in Wasser angesetzt und bei -20 °C in Aliquots gelagert werden.
Eine 100-fache Lösung von Sulfamethoxazol kann durch Zusatz von 600 µl 10 %
NaOH zu 100 ml Wasser und Erhitzung der Lösung auf 80 °C hergestellt werden.

2.5. Chromogene B.-cereus-Selektivnährmedien


• BCM® Bacillus-cereus/Bacillus-thuringiensis Plating-Medium (Pulver)
Catalog-Nr. C-0710
• BCM® Bacillus-cereus/Bacillus-thuringiensis-Supplement
Catalog-Nr. C-0712

Zur Herstellung der Platten wird das Basismedium (Pulver) gelöst und autoklaviert,
das chromogene Substrat und die Hemmstoffe werden als sterile Supplementlösung
vor dem Ausgießen zugesetzt.
Das BCM® Bacillus-cereus/Bacillus-thuringiensis-Plating-Medium (Biosynth) steht
leicht variiert als Fertigplatte unter dem Namen Cereus-Ident –Agar (Heipha Art.-Nr.
174e) zur Verfügung.

Cereus-Ident-Agar
Columbia-Agar 42,5 g
Wachstumssupplement 4,0 g
Chromogenes Selektivsupplement 2,45 g
Aqua dest. ad 1000,0 ml
pH 7,3 ± 0,1

2.6. Halbfestes Nährmedium zur Beweglichkeitsprüfung


Tetrazoliumsalze sind farblos, werden aber bei Bakteriumwachstum in die Zellen
aufgenommen und zu einem roten Farbstoff (Formazan) reduziert. Die Beweglichkeit
kann damit durch „Ausschwärmen“ der Bakterien auf dem Nährmedium sichtbar
gemacht werden.

NB I- Bouillon für 1 L
Standard-Agar 2,5 g
lösen, autoklavieren (15 min bei 121 °C)
2,3,5,-triphenyltetrazolium chlorid (steril zusetzen) 0,05 g
Aqua dest. ad 1000,0 ml

FLI 305
Amtliche Methodensammlung Stand: Mai 2013

3. Tierversuch
Ein Tierversuch ist behördlich genehmigungspflichtig. Er wird nur durchgeführt, wenn
durch andere Diagnostik keine eindeutige Abklärung möglich ist.

Durchführung:
In der Regel werden weiße Mäuse benutzt, mitunter auch Meerschweinchen, in
Abhängigkeit vom Probenmaterial nach Tetanus- und Gasbrandprophylaxe. Vom
Probenmaterial werden 0,5 ml subkutan oberhalb der Schwanzwurzel verabreicht.
Das Material wird zuvor ggf. zerkleinert (Mörser), filtriert und kurz erhitzt (10 bis 30
min, 80 °C). Kulturen werden mit physiologischer Kochsalzlösung abgeschwemmt.
Beurteilung:
Beim Vorliegen von Milzbrand zeigen die Tiere zuerst ein sulziges Ödem an der
Injektionsstelle, dann eine Septikämie, durch die der Tod nach 1 bis 3 Tagen eintritt.
Der Erreger kann aus dem Blut reisoliert werden.

4. Realtime-PCRs zum Nachweis von pathogenem Bacillus anthracis

4.1. TaqMan-Sonden PCR


Der Nachweis basiert auf der parallelen Amplifikation spezifischer Sequenzabschnitte
aus drei unterschiedlichen kodierenden Regionen: dem Gen des protektiven
Antigens auf Plasmid pXO1, dem Gen des Kapselantigens auf Plasmid pXO2 sowie
dem Gen der ribosomalen Polymerase B auf dem bakteriellen Chromosom.

Primer Sonde Sequenz (5'-3')


BAPA- S2 CGGATCAAGTATATGGGAATATAGCAA
BAPA- R2 CCGGTTTAGTCGTTTCTAATGGAT
BAPA-TM2 5’-FAM-CTCGAACTGGAGTGAAGTGTTACCGCAAAT BHQ-1-3’

CAP-S2 ACGTATGGTGTTTCAAGATTCATG
CAP-R2 ATTTTCGTCTCATTCTACCTCACC
CAP-TM2 5’-FAM-CCACGGAATTCAAAAATCTCAAATGGCAT-BHQ-1-3’

rpoB-S1 CCACCAACAGTAGAAAATGCC
rpoB-R1 AAATTTCACCAGTTTCTGGATCT
rpoB-TM2 5’FAM-ACTTGTGTCTCGTTTCTTCGATCCAAAGCG-BHQ-1-3’
1 2
Qi et al.,2001; Ellerbroek, H. et al: 2002

Verdächtiges Koloniematerial (in 1ml HPLC-Wasser resuspendieren, erhitzen 110°C,


20 Minuten, filtrieren durch 0,2µm Filter) kann direkt als PCR-Template eingesetzt
werden. DNA - Isolierung (z.B. QIAamp DNA Mini Kit, QIAGEN, Invisorb Spin Tissue
Mini Kit, InVitek;) entsprechend den Hinweisen der Hersteller.

PCR-Ansatz:
12,5 µl Fertig-Reaktionmix (z.B. Taqman Universal Mastermix #4304437, 2x)
7 µl HPLC-Wasser
1,5 µl je Primer (10µM)
0,5 µl Sonde (10µM)
2 µl Template

FLI 306
Amtliche Methodensammlung Stand: Mai 2013

PCR-Bedingungen (MX3000 Stratagene):


Dekontamination 50°C, 2 min; Initiale Denaturierung 95°C, 10 min; 50 Zyklen
Amplifikation: 95°C, 25 sek; 60°C, 1 min.

4.2. FRET-Sonden
Der Nachweis basiert auf der parallelen Amplifikation spezifischer Sequenzabschnitte
aus 3 unterschiedlichen kodierenden Regionen: dem Gen des protektiven Antigens
(pag) auf Plasmid pXO1, dem Gen des Kapselantigens (capC) auf Plasmid pXO2
sowie spezifischer genomischer Sequenzen auf dem sasp-Gen (small acid soluble
spore protein).

Primer Sonde Sequenz (5'-3')


BAPA-S3 CGGATCAAGTATATGGGAATATAGCAA
BAPA-R3 CCGGTTTAGTCGTTTCTAATGGAT
BAPA-FL1 TGCGGTAACACTTCACTCCAGTTCGA
BAPA-LC1 Red 640 CCTGTATCCACCCTCACTCTTCCATTTTC-P
CapS3 ACGTATGGTGTTTCAAGATTCATG
Cap A**2 GATTGCAAATGTTGCACCACTTA
CapC-FL+1 TATTGTTATCCTGTTATGCCATTTGAGATTTTT
CapC-LC1 Red640 AATTCCGTGGTATTGGAGTTATTGTTCC- P
ANT-F+2 GCTAGTTATGGTACAGAGTTTGCGAC
ANT-Amt1 CCATAACTAGCATTTGTGCTTTGAAT
ANT-FL1 CAAGCAAACGCACAATCAGAAGCTAAG
ANT-LC1 Red640 GCGCAAGCTTCTGGTGCTAGC-P
1 2 3
Beyer et al., 2003; Mauch, H. et al 2008; Ellerbroek, H. et al 2002

PCR-Ansatz:
4 µl Fertig-Reaktionmix
(z.B. LighCycler: Lightcycler FastStart DNA Master Plus
Hybprobe, Roche, 5x)
8,6 µl HPLC-Wasser
1 µl je Primer (10µM)
1 µl je Sonde (4 µM)
2 µl Template

PCR-Bedingungen (LightCycler 2.0):


Aktivierung 95°C, 20 min; 45 Zyklen Amplifikation: 95°C, 10 sek; 57°C, 20 sek; 72°C
30 sek; Schmelzkurvenanalyse

FLI 307
Amtliche Methodensammlung Stand: Mai 2013

Literatur
BEYER, W., P. GLÖCKNER, J. OTTO and R. BÖHM (1995): A nested PCR method
for the detection of Bacillus anthracis in environmental samples collected from former
tannery sites. Microbiol. Res., 150, 179-186.
BROWN, E. R. and Cherry, W. B. (1955): Specific identification of Bacillus anthracis
by means of a variant bacteriophage. J. infect. Dis. 96, 34-39.
DEDIÉ, K., BOCKEMÜHL, J., KÜHN, H., VOLKMER, K.-J. und WEINKE, TH. (1993):
Epidemiologie, Pathologie, Klinik, Diagnostik und Bekämpfung. In: Bakterielle
Zoonosen bei Mensch und Tier, Kapitel 12 Milzbrand. Ferdinand Enke Verlag
Stuttgart, S. 181-197.
HALLMANN, L. (1961):Ausgewählte Untersuchungsmethoden für das
bakteriologische und serologische Laboratorium. In: Bakteriologie und Serologie.
Georg Thieme Verlag Stuttgart, 3. Aufl.
REISSBRODT, R, A. RASSBACH, B.BURGHARDT,I. RIENÄCKER, H. MIETKE, J.
SCHLEIF, H. TSCHÄPE, M. LYTE, AND P.H.WILLIAMS (2004): Assessment of a
New Selective Chromogenic Bacillus cereus Group Plating medium and Use of
Enterobacterial Autoinducer of Growth for Cultural Identification of Bacillus Species.
Journal of Clinical Microbiology, 3795- 3798
BEYER, W., BARTLING, C., NEUBAUER, H., Zum Stand der Nachweisverfahren für
Bacillus anthracis in klinischen und Umweltproben. Tierärztliche Umschau 58, 653-
662 (2003)
MAUCH, H. PODBIELSKI, A, HERRMANN, A. KIEHL, E. MIQ 26 Teil I, 2008-
Mikrobiologische-infektiologische Qualitätsstandards. ELSEVIER Urban & Fischer,
München, Jena
ELLERBROEK, H., NATTERMANN, H., ÖZEL, M., BEUTIN, L., APPEL, B., PAULI,
G. Rapid and sensitive identification of pathogenic and apathogenic Bacillus anthracis
by realtime PCR. FEMS Microbiol.Lett, 2002; 214(1): 51-9.
QI, Y., G. PATRA, X. LIANG, L.E. WILLIAMS, S. ROSE, R.J. REDKAR AND V.G. DE
VECCHIO (2001) Utilization of the rpoB Gene as a specific chromosomal marker for
real-time PCR detection of Bacillus anthracis. Appl. Env. Microbiol. 67, 3720-3727.
OIE (2008): Anthrax. In: Manual of Standards for Diagnostic Tests and Vaccines.
Office International des Epizooties, World organisation for animal health. Fifth Edition

FLI 308
Amtliche Methodensammlung Stand: Mai 2013

Tabelle 1: Einige Differenzierungsmerkmale zwischen B. anthracis und anderen Bacillus spp. (nach Dedie et al. 1993, mod.)
spezifische Tests weniger spezifische Tests
Beweglichkei Phagen- Mäusepath Penicillin-
Hämolyse Kolonieform Wachstum in Bouillon
t lysis ogenität empfindlichkeit
keine Hämolyse +
Matt glänzend oder trocken, klar mit feinflockigem +
B. anthracis - (selten späte + (bekapselte
flach, nicht pigmentiert Bodensatz (70%)
Vergrünung) Stämme)
±
+ meist starke b-
B. cereus - (25 bis 80 flach, rauh, rhizoid trüb mit Sediment -
(90 %*) Hämolyse
%*)
±
(positiv:
- - klar, anfangs mit Häutchen,
B. mycoides Pferdeblut; - Oberfläche stumpf -
(meist) (10 %*) das absinkt
variabel:
Schafblut)
±
B. megaterium (meist schwach b-Hämolyse - - rund, glattrandig trüb +
beweglich)
* Zahl in Klammern: Prozentsatz der Stämme mit positiven Reaktionen

Tabelle 2: Wachstum und Koloniemorphologie von Bacillus spp. auf verschiedenen Nährmedien (37 °C, 24 h)
Nährmedien TMSP-Agar Blutagar Anthrax-Blutagar