Sie sind auf Seite 1von 44

Biochemisches

Praktikum 1

DNA-Analytik

Praktischer Teil
2

Inhaltsverzeichnis

Sicherheitshinweise DNA-Analytik 1
Arbeitshinweise DNA-Analytik 2
Gießen von Agarosegelen 3
Isolierung genomischer DNA 4
Isolierung genomischer DNA aus Gewebe 5
Isolierung genomischer DNA aus Hefe 7
Analyse genomischer DNA 10
Restriktionsspaltung genomischer DNA 11
Auftrennung genomischer DNA im Agarosegel 12
Isolierung von Plasmid DNA 13
Alkalische Lyse 15
Boiling Methode 16
Analyse von DNA im Agarosegel 17
Kontrolle der Plasmid-DNA im Agarosegel 18
Restriktionsspaltung 19
Restriktionsspaltung der Plasmid-DNA 20
Restriktionskartierung - Auftrennung der Plasmidspaltungen im Agarosegel 22
Transformation von Bakterien 23
Polymerase Kettenreaktion - PCR 26
Optimierung von PCR Bedingungen 27
PCR mit genomischer Hefe-DNA 31
DNA-Längenstandard, Plasmidkarten 33
Anzusetzende Puffer 34
Vorhandene Puffer und Stocklösungen 35
Protokoll zum Grundpraktikum – DNA-Analytik 36
Sicherheitshinweise DNA-Analytik

Sicherheitshinweise und Entsorgungsrichtlinien:


Mercaptoethanol

o Der Lyticase-Puffer enthält β-Mercaptoethanol:


Mercaptoethanol ist gesundheitsschädlich und riecht “schlecht“; Arbeiten mit
Mercaptoethanol immer im Abzug durchführen;
Flüssige Abfälle, die Mercaptoethanol enthalten, in Sondermüllbehälter (wässrige Abfälle)
sammeln!
Spitzen/Plastikgefäße, die mit Mercaptoethanol kontaminiert sind, im Abzug in
Abfallbehälter sammeln und vor der Entsorgung mindestens 24h abdampfen lassen!

SYBR Safe
o SYBR Safe ist ein Farbstoff, der sich an DNA quantitativ anlagert. Untersuchungen haben
bisher keine kanzerogenen oder genotoxischen Wirkungen gezeigt. Daher ist SYBR Safe
im Vergleich zu Ethidiumbromid eine deutlich sicherere Methode, um DNA zu färben.
Trotz der getesteten „Ungefährlichkeit“ handhaben wir SYBR Safe wie Ethidiumbromid.
D.h. Jeder Kontakt mit der Haut ist zu vermeiden! Beim Handhaben von SYBR Safe
IMMER Handschuhe tragen;
Alle SYBR Safe-haltigen Fest-Anfälle (Agarosegele, verschmutzte Handschuhe,
Wischtücher…) sind als Sondermüll zu sammeln (SYBR-Safe-Abfall, fest). Während der
Arbeit mit SYBR Safe Verspritzen von Agarose möglichst vermeiden. Agarosetropfen
sofort mit einem saugfähigen Tuch aufnehmen. Beim Eintrocknen bilden Agarosereste
Stäube, die SYBR-Safe enthalten und durch die Luft aufgenommen werden können!
Der Agarosegel Laufpuffer wird in speziellen Kanistern gesammelt.

Mikrowelle
o Bei Arbeiten mit der Mikrowelle Vorschrift genau beachten!
Zum Aufkochen der Agarose nur Weithals-Erlenmeyerkolben verwenden; Kolben maximal
zu 1/3 mit Puffer füllen; zur Vermeidung von Siedeverzügen Rührfisch in den Kolben
geben; Agarose stufenweise erhitzen; um Verbrühungen zu vermeiden Handschuhe
tragen;

UV-Licht
o Im Geldokumentationssystem wird ein UV-Illuminator zum Sichtbarmachen der DNA ver-
wendet. UV-Licht schädigt bei zu langer Exposition Haut und Augen; niemals direkt ins
UV-Licht schauen, Schutzbrillen und Handschuhe tragen. Die Sicherheitseinrichtung des
Iluminators verhindert den direkten Kontakt mit UV-Licht; Sicherheitsfunktionen nutzen
und bei Fehlfunktionen sofort die/den Betreuer/in benachrichtigen!

Alkalische Lyse
o Der Lysispuffer enthält NaOH – ätzend!

1
Arbeitshinweise DNA-Analytik

Arbeitshinweise allgemein:

o während der Arbeit Handschuhe tragen (Schutz der Probe vor Kontamination mit
DNasen)
o für jeden Pipettierschritt frische Spitze verwenden
o Eppis mit Gruppennummer beschriften (Edding)
o Enzyme immer auf Eis lagern
o RNase und Restriktionsenzyme auf Eis lagern!
o Taq-Polymerase und dNTPs auf Eis lagern
o Entsorgungsanweisungen beachten

Arbeitshinweise Mercaptoethanol:

o während der Arbeit Handschuhe tragen


o Arbeiten mit Merctapoethanol nur unter dem Abzug!
o Entsorgungsanweisungen für Mercaptoethanol beachten

Arbeitshinweise SYBR Safe:

o während der Arbeit Nitril - Handschuhe tragen


o Arbeiten mit SYBR Safe nur an den ausgewiesenen Plätzen!
o Entsorgungsanweisungen für SYBR Safe beachten

Arbeitshinweise Bakterien:

- während der Arbeit Handschuhe tragen


- für jeden Pipettierschritt eine frische Spitze verwenden
- Eppis und Platten eindeutig beschriften, Platten auf dem Boden beschriften
- Verschmutzungen mit Bakteriensuspension sofort mit 70 °C Ethanol desinfizieren!

2
Gießen von Agarosegelen

Gießen der Agarosegele für die Auftrennung der DNA-Proben:


- Benötigtes Gelvolumen berechnen
- 1 x TAE Puffer ansetzen (verdünnen aus 50 x TAE)
Setzen Sie 1 L 1 x TAE an; Sie brauchen diesen Puffer auch als Laufpuffer und für
weitere Agarosegele; wenn Ihnen der 1x TAE Puffer ausgeht, neuen verdünnen;
- Agarose abwiegen für eine Endkonzentration von 0,8 bzw. 1,2 % (bezogen auf 100 %
Volumen) und in entsprechend großen Weithals-Erlenmeyerkolben geben;
- Ca. 60 % des benötigten Endvolumen 1 x TAE zugeben, Agarose durch Schwenken
suspendieren; Rührfisch in den Kolben geben (verringert Gefahr des Siedeverzugs)
- 2 x in Mikrowelle aufkochen lassen: Wiederholt nur kurz erwärmen, dann Kolben
entnehmen und schwenken;
Vorsicht: Siedeverzug möglich. Deshalb: Schutzbrille tragen und langsam aufheizen.
- Solange Aufkochen lassen, bis Gellösung klar und frei von ungelösten Partikeln ist –
mindestens 2-mal.
- Gellösung auf den Rührer stellen und unter Rühren mit 1 x TAE auffüllen auf
Endvolumen; Lösung unter Rühren auf ca. 50 °C abkühlen lassen.
- Gel-„Schiffchen“ in Gießstand einsetzen und fixieren (Betreuer fragen)
- Pro 100 ml Gelvolumen 10 µl SYBR Safe Stocklösung zur Gellösung geben, mischen,
Gellösung in die Gel-Schiffchen gießen, Kamm einsetzen;
- Gel ca. 30 min lang aushärten lassen; das Gel muss fest sein, bevor es abgedeckt
wird!
- Zur Lagerung (über Nacht) vorsichtig in Alufolie schlagen (im Gießstand); darauf
achten, dass der Kamm nicht bewegt wir, da sonst die Taschen beschädigt werden;
- Bis zum Gebrauch am nächsten Tag bei Raumtemperatur (RT) lagern;

Für ein kleines Gel werden 50 ml Gel gegossen und ca. 300 ml Laufpuffer benötigt, für ein
großes Gel werden 150 ml Gel gegossen und ca. 1000 ml Laufpuffer benötigt. Der Laufpuffer
kann über Nacht aufgehoben werden, wenn die Elektrophoresekammer über Nacht mit dem
Deckel verschlossen wird.

Entsorgung: Die Gele werden über den Sybr-Safe-Festabfall entsorgt (blaue Tonne neben der
Geldokumentation), die Laufpuffer werden in speziellen Kanistern gesammelt. Mit SYBR-Safe
kontaminierte Pipettenspitzen müssen getrennt gesammelt werden und so wie die Gele
entsorgt werden. Beachten Sie die Sicherheitshinweise zu Sybr-Safe im Skript.

Folgende Agarosegele werden während der DNA-Analytik Woche benötigt:


Analyse Plasmid-DNA:
0,8 % Mini-Gel, ein 8er Kamm, jede Gruppe, Laufstrecke ca. 2/3 Gellänge;
Analyse genomische DNA und Restriktionskartierung Plasmid-DNA:
0,8 % Midi-Gel, ein 20er Kamm, jede Gruppe, Laufstrecke ca. 2/3 Gellänge;
PCR-Optimierung:
1,2 % Midi-Gel, zwei 20er Kämme, pro vier Gruppen ein Gel;
PCR auf genomischer Hefe-DNA:
1,2 % Mini-Gel, zwei 8er Kämme, pro zwei Gruppen ein Gel;

3
Isolierung genomischer DNA
Im Genom (=genomische DNA) eines jeden Organismus sind alle Informationen gespeichert
bzw. kodiert, die notwendig sind um diesen Organismus funktionieren zu lassen. Jede Zelle
enthält mindestens eine Kopie dieser Organismus-spezifischen DNA. Obwohl mittlerweile
viele Genome sequenziert sind und damit theoretisch alle Informationen über ihre DNA in
einer Datenbank vorliegen, ist es sowohl im „normalen Leben“ als auch in der medizinischen,
genetischen, molekularbiologischen oder biochemischen Forschung immer wieder notwendig
genomische DNA zu gewinnen.
Abstammungsnachweise oder forensische Tatort Analysen basieren genauso auf der
Untersuchung genomischer DNA, wie die genaue Charakterisierung von Hefe- oder
Mausmutanten, die im Labor für wissenschaftliche Untersuchungen generiert oder verwendet
werden.

Abhängig vom Organismus und der zu untersuchenden Probe kommen verschiedene


Methoden zum Einsatz, um Zellen zu zerstören und die genomische DNA freizusetzen. So
lassen sich viele Bakterien oder vereinzelte Säugetierzellen schon mit milden Detergenzien
zerstören. Andere Zellen, z.B. Hefen, sind durch eine spezielle Zellwand geschützt, die mit
besonderen Methoden geöffnet werden muss, um die genomische DNA freizusetzen.
In der Zelle befindet sich neben der genomischen DNA eine Vielzahl anderer Stoffe
(Proteine, Lipide, Zucker, Salze usw.), die von der DNA abgetrennt werden müssen, um
weitere Analysen zu ermöglichen.

Im Praktikum werden Sie genomische DNA aus zwei verschiedenen Quellen – Hefezellen
und Säugetiergewebe – mit zwei unterschiedlichen Methoden isolieren:

Die Isolierung der genomischen DNA aus Gewebe erfolgt durch Behandlung mit ProteinaseK
in einem speziellen Lysispuffer und anschließender Fällung der DNA zur Reinigung und
Konzentrierung.
ProteinaseK baut Proteine bis zu den einzelnen Aminosäuren ab. Der Abbau der
Membranproteine führt zur Zerstörung der Zellen und der Freisetzung aller Zellinhaltsstoffe.
Zelluläre Proteine werden von ProteinaseK abgebaut, unlösliche Bestandteile (Haare,
Knochen, Sehnen…) können durch Zentrifugation abgetrennt werden. Zur Abtrennung
löslicher Verunreinigungen (Aminosäuren, Salze, Zucker…) wird die DNA mit Alkohol
präzipitiert und anschließend in einem geringeren Volumen Puffer wieder gelöst. So wird
zusätzlich eine Konzentrierung der DNA erreicht.

Hefezellen besitzen eine zweischichtige Zellwand, die aus speziellen Proteinen, langkettigen
Zuckern und Chitin aufgebaut ist. Diese Zellwand kann weder durch Detergenzien noch
durch ProteinaseK abgebaut werden.
Um Hefezellen zu zerstören muss zunächst mit einem speziellen Enzym, Lyticase, die
kovalente Verknüpfung der Zellwandkomponenten abgebaut werden. Um Verunreinigungen,
die mit der Lyticase eingebracht werden, entfernen zu können, erfolgt die enzymatische
Behandlung in einem Sorbitolpuffer, der zellwandlose Hefen (= Spheroplasten) osmotisch
stabilisiert und ihr Zerplatzen im wässrigen Puffer verhindert. Nach dem Waschen werden
die Spheroplasten in einem wässrigen Puffer resuspendiert und durch Zugabe von SDS
lysiert. DNA gebundene und zelluläre Proteine werden durch Inkubation bei 70 °C
denaturiert. Durch K+-Ionen (Zugabe von Kaliumacetat) werden die denaturierten Proteine
zusammen mit Dodecylsulfat ausgefällt und können durch Zentrifugation abgetrennt werden.
Durch Präzipitation der DNA mit Alkohol werden lösliche Verunreinigungen abgetrennt und
die DNA konzentriert. Bitte auch Theorieteil zur DNA-Analytik lesen!

4
Isolierung genomischer DNA aus Gewebe, Tag 1

Materialien:
- ca. 30 mg Gewebe
- Gewebe-Lysispuffer
- ProteinaseK Lösung 20 mg/ml
- sterile Eppendorf Tubes 1,5 ml (Eppi)
- Isopropanol
- 70 % Ethanol p.A.
- TE 10/1
- Pipetten
- Pipettenspitzen (weiß, gelb, blau)
- Schüttel-Heizblock 55 °C
- Schüttel-Heizblock 42 °C
- Tisch-Zentrifuge
- 3M Na-Acetat

Versuchsdurchführung:
♦ 500 µl Gewebe-Lysispuffer zur Gewebeprobe pipettieren
(1000 µl Pipette, blaue Spitzen)
♦ 2,5 µl ProteinaseK, 20 mg/ml, zugeben, mischen durch schwenken
(10 µl Pipette, weiße Spitzen)
♦ inkubieren bei 55 °C über Nacht im Schüttelheizblock bei mittlerer Schüttelfrequenz

Achtung:
Die DNA-Proben für den Versuch „Optimierung von PCR-Bedingungen“ – Pferdefleisch und
unbekannte Probe – werden identisch zum Versuch „DNA-Isolierung aus Gewebe“ behandelt und
hier mit bearbeitet.
Jede Gruppe setzt damit 3 Proben zur ProteinaseK Behandlung an:
- Gewebe
- Pferdefleisch
- Unbekannte Probe

5
Isolierung genomischer DNA aus Gewebe, Tag 2

♦ Eppi zentrifugieren 14.000 rpm, 20 min in der Eppendorf-Tischzentrifuge;


Zentrifuge mit mehreren Gruppen gemeinsam nutzen; Eppis tariert stellen, falls notwendig,
Tara Eppi verwenden
♦ Überstand vorsichtig in frisches Eppi überführen
(1000 µl Pipette, blaue Spitze), bei der Probeentnahme auf ein mögliches Pellet achten;
dieses nicht mit der Pipettenspitze berühren und aufwirbeln (Pellet ist eventuell „lose“)
♦ 500 µl Isopropanol zum Überstand zugeben, mischen:
Isopropanol langsam an der Eppi Wand einlaufen lassen;
dies führt zu einem Überschichten der wässrigen DNA-
Lösung mit dem Alkohol; an der Phasengrenze fällt die
genomische DNA sichtbar aus; Phasen vorsichtig, aber
gründlich durch schwenken mischen ⇒ DNA “knäult“.
♦ zentrifugieren 14.000 rpm, 15 min Tischzentrifuge
Zentrifuge mit mehreren Gruppen gemeinsam nutzen; Eppis
tariert stellen, falls notwendig, Tara Eppi verwenden
♦ Überstand vorsichtig abnehmen und verwerfen, Pellet nicht mit der Spitze
berühren, langsam abpipettieren, das Pellet sollte sich nicht von der Eppi
Wand lösen;

♦ 1 ml 70 % Ethanol zugeben (Waschschritt), zentrifugieren 14.000 rpm, 10


min, Tischzentrifuge (siehe oben)
♦ Überstand abnehmen und verwerfen (siehe oben), Eppi in Zentrifuge, 10
sec „Quick run“
♦ restlichen Ethanol mit Pipette abnehmen (je nach Menge 10 oder 100 µl
Pipette und weiße oder gelbe Spitze)
♦ DNA Pellet sofort in 250 µl TE 10/1 lösen
TE zu DNA Pellet geben, im Heizblock bei 42 °C unter leichtem Schütteln inkubieren; nach
ca. 30 min. Lösung vorsichtig auf und ab pipettieren, darauf achten, dass ein eventuell noch
nicht gelöstes Pellet nicht in der Spitze kleben bleibt und dadurch verloren geht.
♦ sobald sich die DNA vollständig gelöst hat 25 µl 3 M Na-acetat zugeben, mischen, 250 µl
Isopropanol zugeben, mischen ⇒ >DNA fällt aus; (diese zweite Fällung dient der
zusätzlichen Reinigung – Abtrennen von Salzen)
♦ zentrifugieren 14.000 rpm, 15 min Tischzentrifuge
(siehe oben)
♦ Überstand vorsichtig abnehmen und verwerfen (siehe oben)
♦ 200 µl 70 % Ethanol zugeben, zentrifugieren 14.000 rpm, 10 min, Tischzentrifuge
(siehe oben)
♦ Überstand abnehmen und verwerfen (siehe oben), Eppi in Zentrifuge, 10 sec „Quick run“
♦ restlichen Ethanol mit Pipette abnehmen (je nach Menge 10 oder 100 µl Pipette und weiße
oder gelbe Spitze)
♦ DNA Pellet an Luft trocken (Eppi offen ca. 5 min stehen lassen)
♦ DNA lösen in 50 µl TE 10/1
TE auf das DNA-Pellet pipettieren, ca. 30 – 60 min inkubieren bei 42 °C; wenn sich die DNA
gelöst hat, mehrmals vorsichtig auf und ab pipettieren und bei Raumtemperatur oder im
Kühlschrank lagern;

6
Isolierung genomischer DNA aus Hefe, Tag 1
Materialien:

- Hefe Zellpellet
- Lyticase-Puffer = Y1
- Spheroplasten-Waschpuffer = Y2
- Lyticase Lösung 10 U/µl
- TE 50/100
- 10 % SDS
- 5 M Kaliumacetat
- Isopropanol
- 70 % Ethanol
- TE 10/1
- Pipetten
- Pipettenspitzen (weiß, gelb, blau)
- Wasserbad 37 °C
- Eisbad
- Tisch-Zentrifugen
- sterile Eppendorf Tubes 1,5 ml
- Heizblock, 70oC und 42oC
- 3 M Na-Acetat

Sicherheitshinweise und Entsorgungshinweise auf Seite 1 beachten! Achtung bei


Arbeiten mit Mercaptoethanol!

Versuchsdurchführung:

♦ Hefe Zellpellet resuspendieren in 500 µl Lyticase-Puffer;


(1000 µl Pipette, blaue Spitzen); zum Resuspendieren Puffer mehrmals auf und ab pi-
pettieren, vortexen (15 sec, Maximum), und Suspension erneut mehrmals auf und ab pi-
pettieren; es soll eine homogene Suspension vorliegen;
Achtung: Lyticase-Puffer enthält Mercaptoethanol – giftig! Im Abzug arbeiten!
♦ 10 µl Lyticase Lösung, 10 U/µl zugeben
(10 µl Pipette, weiße Spitzen); Suspension zum mischen kurz vortexen;
♦ Inkubieren bei 37 °C, 45 min,
im Wasserbad, Suspension ca. alle 10 min vorsichtig mischen
♦ zentrifugieren 5.000 rpm, 5 min in der Tischzentrifuge
Zentrifuge mit mehreren Gruppen gemeinsam nutzen; Eppis tariert stellen, falls notwendig,
Tara Eppi verwenden
♦ Überstand sehr vorsichtig abnehmen, Pellet ist eventuell sehr lose
(1000 µl Pipette, blaue Spitzen), mit der Spitze nicht ans Pellet kommen; Überstand in
Sondermüll, Spitzen in Abfallbehälter im Abzug;
♦ Pellet vorsichtig resuspendieren in 1 ml Spheroplasten-Waschpuffer.
Dieser Schritt dient zum Entfernen des restlichen Mercaptoethanols und Verunreinigungen in
der Lyticasepräparation.
Puffer zugeben und Eppi vorsichtig schwenken; nicht vortexen, nicht oder nur sehr vorsichtig
auf und ab pipettieren; Suspension muss nicht vollständig homogen sein;
zu kräftiges Mischen kann zur Zerstörung der sehr empfindlichen Hefe Spheroplasten führen
(Zellen sind nur noch von einer Zellmembran geschützt) ⇒ geringere Ausbeute an
genomischer DNA

7
Isolierung genomischer DNA aus Hefe, Tag 1

♦ zentrifugieren 5.000 rpm, 5 min in der Tischzentrifuge


♦ Überstand sehr vorsichtig abnehmen
(siehe oben, Überstand in Sondermüll!)
♦ Waschschritt mit Spheroplasten-Waschpuffer wiederholen
(500 µl Puffer zugeben, vorsichtig resuspendieren, zentrifugieren)
♦ Überstand vorsichtig abnehmen
(Überstand in Sondermüll)
♦ Pellet resuspendieren in 500 µl TE 50/100
(1000 µl Pipette, blaue Spitzen), zum resuspendieren auf und ab pipettieren, eventuell
vorsichtig vortexen; Spheroplasten müssen vollständig resuspendiert sein;
♦ 50 µl 10 % SDS zugeben, mischen, inkubieren bei 70 °C, 30 min
(100 µl Pipette, gelbe Spitzen),
♦ 250 µl 5 M K-acetat zugeben, mischen, vorsichtig mischen, nicht vortexen, inkubieren auf
Eis, 15 min
(1000 µl Pipette, blaue Spitzen);
♦ zentrifugieren 14.000 rpm, 20 min Tischzentrifuge
♦ Überstand überführen in frisches Eppi, 700 µl Isopropanol zugeben, mischen
(1000 µl Pipette, blaue Spitzen),
♦ zentrifugieren 14.000 rpm, 10 min, Tischzentrifuge
♦ Überstand abnehmen und verwerfen, 200 µl 70 % EtOH zugeben
♦ zentrifugieren 14.000 rpm, 5 min, Tischzentrifuge
♦ Überstand abnehmen und verwerfen, Eppi in Zentrifuge, 10 sec „Quick run“
♦ Restflüssigkeit abnehmen
♦ DNA Pellet sofort in 500 µl TE 10/1 lösen
TE zu DNA Pellet geben, im Heizblock bei 42 °C unter leichtem Schütteln inkubieren;

8
Isolierung genomischer DNA aus Hefe, Tag 2

♦ nach ca. 30 min oder am nächsten Tag Lösung vorsichtig auf und ab pipettieren, darauf
achten, dass ein noch nicht gelöstes Pellet nicht in der Spitze kleben bleibt und dadurch
verloren geht.
♦ sobald sich die DNA vollständig gelöst hat 50 µl 3 M Na-Acetat zugeben, mischen, 500 µl
Isopropanol zugeben, mischen ⇒ >DNA fällt aus; (diese zweite Fällung dient der
zusätzlichen Reinigung – Abtrennen von Salzen)
♦ zentrifugieren 14.000 rpm, 15 min Tischzentrifuge
♦ Überstand vorsichtig abnehmen und verwerfen (siehe oben)
♦ 200 µl 70 % Ethanol zugeben, zentrifugieren 14.000 rpm, 10 min, Tischzentrifuge
♦ Überstand abnehmen und verwerfen (siehe oben), Eppi in Zentrifuge, 10 sec „Quick run“
♦ restlichen Ethanol mit Pipette abnehmen (je nach Menge 10 oder 100 µl Pipette und weiße
oder gelbe Spitze)
♦ DNA Pellet an Luft trocken (Eppi offen ca. 5 min stehen lassen)
♦ DNA lösen in 50 µl TE 10/1
TE auf das DNA-Pellet pipettieren, ca. 30 – 60 min inkubieren bei 42 °C; wenn sich die DNA
gelöst hat, mehrmals vorsichtig auf und ab pipettieren und bei Raumtemperatur oder im
Kühlschrank lagern;

9
Analyse genomischer DNA
Die Analyse von Nukleinsäuren (DNA und RNA) erfolgt in der Regel durch Auftrennung in
Agarosegelen und gleichzeitiger Anfärbung der DNA mit einem Fluoreszenzfarbstoff. (Kurze
Nukleinsäuren bis ca. 250 Basen können auch in Polyacrylamidgelen aufgetrennt werden).
Nukleinsäuren besitzen eine gleich bleibende Ladungsdichte, d.h. das Verhältnis von
Molekulargewicht zur Ladung ist konstant. Die unterschiedliche Wanderungsgeschwindigkeit im
elektrischen Feld in einer (Agarose-) Gelmatrix beruht auf der Größen-abhängigen Interaktion
der Nukleinsäuremoleküle mit der Gelmatrix. Große Moleküle interagieren stärker und wandern
daher langsamer.
Die Wandergeschwindigkeit ist daher nicht nur von der Größe der Nukleinsäuren, sondern auch
von der Gelmatrix selber abhängig. Je enger vernetzt die Gelmatrix, Agarose, ist, umso
langsamer bewegen sich die Nukleinsäuren. Für große Nukleinsäuren werden daher niedrig
prozentige (0,6 – 0,8%) Agarosegele verwendet, für kürzere Nukleinsäuren höher prozentige
(1,0 – 4,0%).
Das Anfärben der DNA im Agarosegel erfolgt im Praktikum mit SYBR Safe, einem DNA
interagierenden Cyanin-Farbstoff, der sich an die DNA anlagert. Der Farbstoff wird in die
Gelmatrix mit eingegossen. Wenn sich die DNA durch die Agarose bewegt, bindet SYBR Safe
an die DNA. Auf einem UV-Schirm kann dann die DNA über die Fluoreszenz des Farbstoff-
DNA-Komplexes sichtbar gemacht werden.
Für die Größenbestimmung der untersuchten DNA-Fragmente wird auf jedem Gel ein käuflicher
DNA Größenstandard mit aufgetragen und aufgetrennt. Der Vergleich der Laufstrecke der zu
untersuchenden DNA-Fragmente mit diesem Größenstandard erlaubt dann eine
Längenabschätzung. Da die Größenstandards verschiedene DNA-Fragmente in einer
definierten Konzentration enthalten, kann der Vergleich der Fluoreszenzintensität von
Markerbanden mit zu analysierender DNA-Bande auch zu einer groben Mengenabschätzung
verwendet werden.
Bei der Isolierung genomischer DNA wird nicht nur die DNA freigesetzt, sondern auch die in den
Zellen vorhandene RNA. Die im Praktikum verwendeten Methoden können nicht zwischen DNA
und RNA unterscheiden. Deshalb wird mit der DNA auch RNA gefällt. Abhängig vom Zelltyp
kann so viel RNA mit der DNA isoliert werden, dass weitere Analysen durch die RNA gestört
werden. Durch die Behandlung der gereinigten genomischen DNA mit RNase wird die RNA
abgebaut und stört dann weder bei der Analyse im Agarosegel noch bei weiteren
enzymatischen Behandlung der DNA.
Für weiterführende Arbeiten mit (genomischer) DNA ist es oft sinnvoll und notwendig diese in
kleinere, definierte Fragmente zu „zerschneiden“. Hierfür werden Restriktionsendonukleasen (=
Restriktionsenzyme) verwendet. Restriktionsenzyme binden sequenzspezifisch an
doppelsträngige DNA und spalten den DNA-Doppelstrang an spezifischen Stellen. Die Binde-
und Spaltungsstellen der gängigen Restriktionsenzyme sind vier bis acht Basenpaare lang und
meist palindromisch. Wie häufig eine Restriktionsstelle statistisch innerhalb eines DNA-
Fragments vorkommt hängt von der Länge der Erkennungssequenz ab. Die vier Basenpaar
lange Erkennungsstelle von HaeIII sollte daher viel häufiger in genomischer DNA auftreten als
die sechs Basenpaar lange Erkennungssequenz von EcoRI. Bei der Spaltung der beiden
genomischen DNAs mit HaeIII sollten daher statistisch kleinere Fragmente entstehen, als mit
EcoRI.
Bitte auch Theorieteil zur DNA-Analytik lesen!

10
Restriktionsspaltung genomischer DNA, Tag 2

Materialien:
- genomische Gewebe- und Hefe-DNA aus Versuch 1.) und 2.)
- Restriktionsendonuklease EcoRI
- Restriktionsendonuklease HaeIII
- EcoRI 10 x Reaktionspuffer (10 x Eco, schwarz beschriftet)
- 10 x Reaktionspuffer R, (10 x R, rot beschriftet)
- H2Obidest (autoklaviert)
- RNaseA 10 mg/ml
- Pipetten
- Spitzen (weiß, gelb)
- Eppendorf Tubes 1,5 ml, steril
- Agarose
- 50 x TAE
- SYBR Safe Lösung
- Agarosegel – Kammern, Kämme
- DNA-Längenstandard GeneRulerTM, 1 kb DNA Ladder
- 5 x DNA Auftragspuffer
- Wasserbad 37 °C
- Eisbad
- Geldokumentationssystem

Sicherheitshinweise und Entsorgungshinweise auf Seite 1 beachten! Achtung bei


Arbeiten mit SYBR Safe!
Versuchsdurchführung:
RNase Behandlung und Restriktionsspaltung:

Genomische RNase 10 x Eco EcoRI 10 x R HaeIII H 2O


(Restriktions- (Restriktions-
DNA A (10 x Puffer)
enzym)
(10 x Puffer)
enzym)
(autoklaviert)

Gewebe 10 µl --- --- --- --- --- 2 µl


Gewebe 10 µl 2 µl --- --- --- --- ---
Hefe 10 µl --- --- --- --- --- 2 µl
Hefe 10 µl 2 µl --- --- --- --- ---

Gewebe 10 µl 3 µl 3 µl 3 µl --- --- 11 µl


Gewebe 10 µl 3 µl --- --- 3 µl 3 µl 11 µl
Hefe 10 µl 3 µl 3 µl 3 µl --- --- 11 µl
Hefe 10 µl 3 µl --- --- 3 µl 3 µl 11 µl

♦ DNA vorlegen, Puffer, RNaseA, Restriktionsenzym und H2Obidest pipettieren, Eppis kurz
anzentrifugieren, dann den Spaltungsansatz durch mehrmaliges auf und ab pipettieren mi-
schen;
♦ Spaltungsansatz inkubieren bei 37 °C über Nacht, am Mittwoch einfrieren auf –20 °C;
♦ Achtung: Sie benötigen noch einige µl Hefe-DNA für die PCR Reaktion

11
Auftrennung genomischer DNA im Agarosegel, Tag 4

Agarosegelelektrophorese
♦ 0,8 % Agarosegel gießen (Tag 3, siehe Vorschrift Seite 3)
Vorbereiten der Apparatur:
- Elektrophoreseapparatur, Gelträger, Kamm und Gelgießstand gründlich mit Wasser und
Spülmittel reinigen (Nitril - Handschuhe tragen);
- Mit deionisiertem Wasser (VE-Wasser) nachspülen und trocknen lassen (oder mit
Küchentuch nachtrocknen
- Gel entsprechend Vorschrift auf Seite 3 herstellen und verpacken
- Alufolie und Kamm vorsichtig entfernen, Schiffchen aus dem Gießstand nehmen;
- Eventuell ausgelaufenes oder verspritztes Gel aufnehmen und in SYBR Safe-Abfall fest
geben.
- Gelschiffchen in die Kammer einsetzen – Laufrichtung der DNA beachten!
- Puffer vorsichtig in die Gelkammer einfüllen; der Puffer soll ca. 2-3 mm über dem
Agarosegel stehen;

♦ Gelauftrag:

Proben- Proben- Auftrags- E ND -


Tasche Probe H2Obidest
menge volumen puffer 5 x volumen

1 Längenstandard 1000 ng 10µl --


2 Gewebe-DNA, - RNase 5 µl 2 µl 3 µl 10 µl
3 Gewebe-DNA, + RNase 5 µl 2 µl 3 µl 10 µl
4 Hefe-DNA, - RNase 5 µl 2µl 3 µl 10 µl
5 Hefe-DNA, + RNase 5 µl 2 µl 3 µl 10 µl
6 Gewebe-DNA/EcoRI 20 µl 5 µl 25 µl
7 Gewebe-DNA/HaeIII 20 µl 5 µl 25 µl
8 Hefe-DNA/EcoRI 20 µl 5 µl 25 µl
9 Hefe-DNA/HaeIII 20 µl 5 µl 25 µl

Konzentration Längenstandard: 100 ng/µl


♦ Proben mit 100 µl Pipette/gelben Spitzen vorsichtig in die Geltaschen füllen, Deckel aufset-
zen; (Achtung! Proben aus Versuch Plasmidspaltung werden ebenfalls auf dieses Gel
aufgetragen!)
♦ Elektrophorese erfolgt bei 60 – 80 V für ca. 30 min., dann mit 100 – 120 V bis der blaue
Farbstoff etwas weiter als zur Mitte des Gels gewandert ist;
♦ Am Ende der Elektrophorese Strom abstellen, Gel mit Träger aus der Kammer nehmen und
in Tragschale mit saugfähigem Papier legen (Nitril - Handschuhe!)
♦ Gelbild am Dokumentationssystem erstellen
♦ Gelkammer, Gelträger und Kämme nach Gebrauch sofort mit reichlich Wasser reinigen;

12
Isolierung von Plasmid-DNA

Plasmide sind kleine, zirkuläre DNA-Moleküle, die in einigen Mikroorganismen (Bakterien,


Hefen) natürlich vorkommen. Sie sind nicht Bestandteil der genomischen DNA (extra-
chromosomal). Um stabil in einer Bakterienkultur erhalten zu bleiben, müssen Plasmide zwei
genetische Grundelemente enthalten: Einen Replikationsursprung (origin), der vom bakteriellen
Replikationapparat erkannt wird und das Plasmid vervielfältigt und ein Gen, das den Bakterien
einen Wachstumsvorteil gegenüber plasmidlosen Bakterien vermittelt.
- Für die Manipulation von DNA bieten Plasmide einige wichtige Vorteile, die sie zu einem
unverzichtbaren Bestandteil aller Labors, die mit DNA arbeiten, gemacht haben:
- Plasmide vereinen auf einer minimalen DNA-Sequenz alle Faktoren (Replikationsursprung,
Markergen), die notwendig sind, um sie stabil in Bakterienzellen zu vermehren.
- Plasmide können in großer Menge (µg – mg) getrennt von der genomischen DNA aus
Bakterien isoliert werden.
- Plasmide lassen sich hoch effizient in speziell präparierte Bakterien einführen
(transfomieren).
- Durch (heute) einfache Verfahren können Plasmide modifiziert und dadurch den
Bedürfnissen des Nutzers angepasst werden. (Einführen verschiedener Markergene, speziell
Antibiotika-Resistenzgene, Einführen von Restriktionsschnittstellen => Klonierungsvektoren,
Einführung von Promotoren => Expressionsvektoren,…)
Die Isolierung von Plasmid-DNA aus Bakterien ist im Vergleich zur Isolierung von genomischer
DNA aus Hefe oder Gewebe schnell, einfach und sehr effizient. Im Praktikum werden zwei weit
verbreitete Methoden vorgestellt:
Auf der Isolierung von Plasmid-DNA durch alkalische Lyse basieren die meisten heute
kommerziell erwerbbaren „Kits“ zur Plasmidisolierung. Die Bakterienzellen werden in einer
Pufferlösung, die auch EDTA zur Komplexierung zweiwertiger Kationen enthält, resuspendiert.
Die Zugabe eines NaOH und SDS haltigen Puffers führt zur Denaturierung aller Proteine (und
damit zur Lyse der Zellen) und der DNA (sowohl genomische DNA als auch Plasmid-DNA). Die
Zugabe von Kaliumacetat neutralisiert die Lösung. Die DNA beginnt wieder zu renaturieren,
wobei dieser Prozess bei den kleinen Plasmiden deutlich schneller geht, als bei genomischer
DNA. Da die beiden Einzelstränge eines Plasmid aufgrund der zirkulären Natur miteinander
verlinkt bleiben, finden sich die komplementären Stränge auch schnell wieder. Die Zugabe von
K+-Ionen fällt außerdem das Dodecylsulfat zusammen mit den Proteinen aus. Die genomische
Bakterien DNA wird dabei mit ausgefällt, da sie einerseits kovalent an Membranproteine
gebunden ist und außerdem von denaturierten Proteinen bedeckt ist, die sie bei der Fällung
mitreißen. Das Kalium-dodecylsulfat-Protein-genomische DNA Präzipitat wird durch
Zentrifugation abgetrennt. Die renaturierte Plasmid-DNA befindet sich im wässrigen Überstand
und kann daraus mit Alkohol zur weiteren Reinigung und Konzentrierung ausgefällt werden.
Einhalten der Inkubationszeiten und ein vorsichtiges Mischen (nicht kräftig Schütteln, nicht
vortexen) sind wichtig um ein Freisetzen der genomischen DNA zu verhindern. Wird diese
durch zu langes Einwirken der NaOH von den gebundenen Membranproteinen gelöst oder
mechanisch (heftiges Schütteln) geschert, geht sie ganz oder teilweise in Lösung und kann
dann nicht mehr von der Plasmid-DNA abgetrennt werden.

Bei der Isolierung von Plasmid-DNA nach der Boiling Methode werden die Bakterienzellen
durch ein Enzym (Lysozym) zusammen mit einem milden Detergenz aufgeschlossen. Proteine
werden durch kurzzeitiges Erhitzen im kochenden Wasserbad denaturiert. Das für die Zelllyse
verwendete Detergenz ist nicht stark genug, um die denaturierten Proteine in Lösung zu halten.

13
Isolierung von Plasmid-DNA

Sie fallen zusammen mit Zelltrümmern aus. Auch hier reißen die denaturierten Proteine die
genomische DNA mit. Durch Zentrifugation können daher Zelltrümmer, denaturierte Proteine
und genomische DNA abgetrennt werden. Wie bei der alkalischen Lyse ist das Einhalten der
Inkubationszeiten äußerst wichtig, da bei zu kurzen Zeiten die Zellen nicht lysieren und die
Proteine nicht denaturieren und bei zu langen Zeiten die genomische DNA freigesetzt wird und
in Lösung geht.

Bitte auch Theorieteil zur DNA-Analytik lesen!

Es werden 4 verschiedene Bakterienkulturen ausgegeben (beschriftet mit 9, 12, 16 oder 26),


die jeweils ein unterschiedliches Plasmid tragen.
Pro Gruppe wird ein Plasmid auf zwei verschiedene Methoden isoliert. Sie entnehmen dafür 2 x
5 ml Bakterienkultur aus einem Erlenmeyerkolben (vor der Entnahme Kultur aufschütteln),
überführen sie in je ein Plastikröhrchen und zentrifugieren die Röhrchen in der
Eppendorfzentrifuge bei 4000 rpm für 5 min. Der Überstand wird abgegossen und die
Bakterienpellets auf Eis gelagert.
Notieren Sie sich die Nummer Ihrer Bakterienkultur!
Falls die Bakterien nicht als Übernachtkultur, sondern als fertiges Zellpellet ausgegeben
werden, achten Sie darauf, dass Ihre beiden Bakterienpellets die gleiche Nummer tragen! Die
Entnahme aus dem Erlenmeyerkolben, die Zentrifugation und das Abgießen des Überstandes
entfallen dann natürlich.

14
Isolierung von Plasmid-DNA, Tag 2
Isolierung von Plasmid-DNA durch alkalische Lyse:
Materialien:
- Bakterienpellet aus 5 ml Kultur
- Resuspensionspuffer =P1
- Lysispuffer =P2
- Neutralisationspuffer =P3
- Isopropanol
- 70 % Ethanol p.A.
- TE 10/1, steril (autoklaviert)
- RNaseA Lösung 10 mg/ml
- 15 ml Rundbodenröhrchen
- Glaspipetten
- Pipettierhilfe
- sterile Eppendorf Tubes 1,5 ml (Eppi)
- Pipetten
- Pipettenspitzen (weiß, gelb, blau)
- Eisbad
- Tisch-Zentrifugen
- Eppendorf-Zentrifuge für 15ml Röhrchen

Versuchsdurchführung:
♦ Bakterienpellet mit 300 µl Resuspensionspuffer aufnehmen;
1000 µl Pipette, blaue Spitze; Zellpellet resuspendieren durch auf und ab pipettieren; der
Resuspensionspuffer enthält keine RNaseA, daher keine Inkubation nach Resuspendierung;
♦ Bakteriensuspension überführen in 1,5 ml Eppi;
♦ 300 µl Lysispuffer zugeben, vorsichtig mischen bis Suspension klar wird
(nicht schütteln, nicht vortexen! Mischen durch auf den Kopf drehen)
♦ 3 – 5 min inkubieren bei RT;
♦ 300 µl Neutralisationspuffer zugeben (zwischen der Zugabe von Lysis- und Neutralisations-
puffer sollen nicht mehr als 5 min vergehen), vorsichtig, aber vollständig mischen (nicht
schütteln, nicht vortexen), inkubieren auf Eis für 5 min
♦ Zentrifugieren bei 14.000 rpm, 10 min in der Tisch-Zentrifuge;
Zentrifuge mit mehreren Gruppen gemeinsam nutzen; Eppis tariert stellen,
♦ Klaren Überstand überführen in frisches 1,5 ml Eppi, 600 µl Isopropanol zugeben, gründlich
mischen
♦ Zentrifugieren bei 14.000 rpm, 20 min in Tischzentrifuge, Eppis tariert stellen,
♦ Überstand abnehmen und verwerfen;
(vorsichtig abgießen oder mit 1000 µl Pipette abnehmen)
♦ 200 µl 70 % Ethanol zugeben, zentrifugieren 5 min/14.000 rpm in Tischzentrifuge
♦ Überstand abnehmen und verwerfen;
(100 µl Pipette, gelbe Spitze),
♦ Eppi kurz „anzentrifugieren“ (in Tischzentrifuge, 10 sec Quick run)
♦ restliche Flüssigkeit abnehmen;
♦ DNA Pellet 5 min an Luft trocknen (Eppi offen stehen lassen)
♦ DNA Pellet lösen in 45 µl TE 10/1, 5 µl RNase A, 10 mg/ml zugeben

15
Isolierung von Plasmid-DNA, Tag 2
Isolierung von Plasmid-DNA nach der Boiling Methode:
Materialien:
- Bakterienpellet aus 5 ml Kultur
- Puffer STET
- Lysozym Lösung, 10 mg/ml
- Isopropanol
- 70 % Ethanol (p.A.)
- TE 10/1, steril (autoklaviert)
- RNaseA Lösung, 10 mg/ml
- 15 ml Rundbodenröhrchen
- Glaspipetten
- sterile Eppendorf Tubes 1,5 ml (Eppi)
- Pipetten
- Pipettenspitzen (weiß, gelb, blau)
- Wasserbad 100 °C
- Tisch-Zentrifugen
- sterile Zahnstocher/Impfnadeln
- Eisbad
- Eppendorf-Zentrifuge für 15ml Röhrchen

Versuchsdurchführung
♦ Bakterienpellet mit 350 µl Puffer STET resuspendieren;
1000 µl Pipette, blaue Spitze; Zellpellet resuspendieren durch auf und ab pipettieren; vor-
sichtig pipettieren, nicht vortexen, Puffer enthält Triton X-100 und schäumt; Puffer STET
enthält keine RNaseA, es ist kein Inkubationsschritt nach dem Resuspendieren notwendig;
♦ Bakteriensuspension überführen in 1,5 ml Eppi;
♦ 25 µl Lysozym Lösung, 10 mg/ml zugeben, vortexen 3 sec;
♦ Eppi sofort in 100 °C Wasserbad stellen, inkubieren für 40 sec
♦ Eppi zentrifugieren 14.000 rpm, 10 min, Tisch-Zentrifuge;
Zentrifuge mit mehreren Gruppen gemeinsam nutzen; Eppis tariert stellen, falls notwendig,
Tara Eppi verwenden
♦ Bakterienpellet mit sterilem Zahnstocher (Impfnadel, gelbe Spitze) entfernen;
♦ 420 µl Isopropanol zugeben, mischen;
♦ zentrifugieren bei 14.000 rpm, 20 min, Tisch-Zentrifuge
♦ Überstand abnehmen und verwerfen;
(vorsichtig abgießen oder mit 1000 µl Pipette, blauer Spitze abnehmen)
♦ 200 µl 70 % Ethanol zugeben, zentrifugieren 5 min/14.000 rpm, Tisch-Zentrifuge;
♦ Überstand abnehmen und verwerfen;
(100 µl Pipette, gelbe Spitze), Eppi kurz „anzentrifugieren“ (Tisch-Zentrifuge, 10 sec. Quick
run)
♦ restliche Flüssigkeit abnehmen
♦ DNA Pellet 5 min an Luft trocknen (Eppi offen stehen lassen)
♦ DNA Pellet lösen in 45 µl TE 10/1, 5 µl RNaseA zugeben

16
Analyse von DNA im Agarosegel

Für lineare DNA-Fragmente gibt es bei der Auftrennung im Agarosegel eine lineare
Abhängigkeit von Fragmentlänge (in Basenpaaren) und Laufstrecke. So ist es möglich einen
linearen DNA-Längenstandard mit auf das Gel aufzutragen und durch Vergleich Rückschlüsse
auf die Länge der zu analysierenden DNA zu ziehen.
Für zirkuläre Plasmid-DNA gilt diese einfache Korrelation von Laufstrecke zu Größe nicht. Hier
ist das Laufverhalten stark von der Form der zirkulären DNA abhängig.
Plasmid-DNA liegt in Bakterien in der Regel verdrillt vor. D.h. der DNA-Ring ist zu einer Art
Superhelix gewunden. Diese sogenannte „supercoiled“ Form der Plasmid-DNA ist sehr kompakt
und nimmt weniger Raum ein, als ein lineares DNA Molekül der gleichen Größe. Im Agarosegel
läuft ein „supercoiled“ Plasmid schneller, als man es ausgehend von seiner Größe erwarten
würde.
Ist nur in einem der DNA-Stränge an einer Stelle das DNA Phosphatrückrat gebrochen, kommt
es zu einer Entspannung des verdrillten zirkulären DNA-Moleküls. Dieser entspannte, „relaxed“
DNA-Zirkel ist im Agarosegel sperriger als das „supercoiled“ Molekül und auch sperriger als ein
vergleichbar großes lineares DNA-Molekül. Das „relaxed“ Plasmid läuft daher langsamer als
das „supercoiled“ und lineare Plasmid.
Einzelstrangbrüche im DNA-Rückrat können durch mechanische Belastung oder geringste
Spuren von Nuklease Aktivität eingeführt werden und sind in einer Plasmid Präparation nicht
vermeidbar. Das Verhältnis von „supercoiled“ zu „relaxed“ Form ist ein Maß für die Qualität der
Plasmid Präparation (viel „supercoiled“ = gut).
Das Auftrennen der gereinigten Plasmid-DNA im Agarosegel gibt somit Aufschluss über die
Qualität der DNA.
Durch Auftragen einer Plasmid-DNA mit bekannter Konzentration kann außerdem die
ungefähre Konzentration der eigenen Plasmid-DNA abgeschätzt werden.
Will man die tatsächliche Größe eines Plasmids im Agarosegel abschätzen, muss man es
zunächst mit einem Restriktionsenzym linearisieren.

Bitte auch Theorieteil zur DNA-Analytik lesen!

17
Kontrolle der Plasmid-DNA im Agarosegel, Tag 3
Kontrolle und Mengenabschätzung der isolierten Plasmid-DNA:
Materialien
- Kontroll-DNA
- Plasmid-DNA aus Versuch Seite 15 und 16
- H2Obidest (autoklaviert)
- Pipetten
- Spitzen (weiß, gelb)
- Eppendorf Tubes 1,5 ml, steril
- Agarose
- 50 x TAE
- SYBR Safe Lösung 1 mg/ml (?)
- Agarosegel Kammern, Kämme
- DNA-Längenstandard GeneRulerTM, 1 kb DNA Ladder
- 5 x DNA Auftragspuffer
- Geldokumentationssystem

Sicherheitshinweise und Entsorgungshinweise auf Seite 1 beachten! Achtung bei


Arbeiten mit SYBR Safe!
Versuchsdurchführung:
♦ 0,8 % Agarosegel gießen – siehe Vorschrift Seite 3
♦ Gelauftrag:
Alle Proben werden auf ein Endvolumen von 10 µl eingestellt
Proben- Proben- Auftrags- End-
Tasche Probe H2Obidest
menge volumen puffer 5 x volumen
1 Längenstandard 1000 ng ? --
2 Kontroll-DNA 500 ng ? 2 µl ? 10 µl
3 Plasmid-DNA-AL 2,5 µl 2 µl ? 10 µl
4 Plasmid-DNA-AL 5 µl 2 µl ? 10 µl
5 Plasmid-DNA-B 2,5 µl 2 µl ? 10 µl
6 Plasmid-DNA-B 5 µl 2 µl ? 10 µl
7 Kontroll-DNA 1000 ng 2 µl ? 10 µl

Konzentration DNA Marker: 100 ng/µl


Konzentration Kontroll-DNA: 200 ng/µl
♦ Geltaschen vorsichtig, aber gründlich mit gelber oder blauer Spitze ausspülen
♦ Proben mit 10 µl Pipette/weiße Spitzen vorsichtig in die Geltaschen füllen, Deckel aufsetzen
♦ Elektrophorese erfolgt bei 80 V bis der blaue Farbstoff etwa in die Mitte des Gels gewandert
ist;
♦ Am Ende der Elektrophorese Strom abstellen, Gel mit Träger aus der Kammer nehmen und
in Tragschale mit saugfähigem Papier legen (Nitril - Handschuhe!)
♦ Gelbild am Dokumentationssystem erstellen
♦ Gelkammer, Gelträger und Kämme nach Gebrauch sofort mit reichlich Wasser reinigen;

18
Restriktionsspaltung

Restriktionsenzyme spalten DNA sequenz-spezifisch unter Ausbildung definierter Enden. Die


Verteilung der Restriktionsschnittstellen ist für jedes DNA Fragment charakteristisch (da
Sequenz abhängig). Restriktionsanalysen bzw. Restriktionskartierungen können daher zur
Charakterisierung und Identifizierung von DNA-Fragmenten verwendet werden.
Die Ausbildung definierter Enden ermöglicht es nicht nur große DNA-Moleküle in kleinere
Fragmente zu zerschneiden, sondern auch, bei passenden Enden, DNA-Fragmente in neuer
Anordnung wieder zusammen zufügen. Die im Labor üblicherweise verwendeten
Restriktionsenzyme Typ II haben palindromische Erkennungssequenzen und schneiden
innerhalb dieser Erkennungssequenz symmetrisch. Auf diese Weise werden, je nach Enzym,
„überhängende“ oder „glatte“ Enden erzeugt.
Da Restriktionsenzyme sequenz-spezifisch spalten, sind die Basen an den neu erzeugten
Enden für jedes Restriktionsenzym immer gleich und bekannt.
„Überhängende“ Enden, die vom selben Restriktionsenzym erzeugt wurden, können durch
spezielle Enzyme (Ligasen) wieder zusammengefügt werden. „Überhängende“ Enden, die von
zwei verschiedenen Restriktionsenzymen gebildet wurden, sind nicht kompatibel und lassen
sich nicht miteinander ligieren (von dieser Regel gibt es einige Ausnahmen).
Auf diese Weise kann man z.B. gezielt bestimmte DNA-Fragmente in Plasmide einführen. Ein
mit EcoRI linearisiertes Plasmid hat zwei EcoRI spezifische Enden, die sich mit einem
Fragment, das ebenfalls EcoRI Enden hat, verbinden lassen. So wird das Fragment in das
Plasmid eingefügt. Anschließend kann das Plasmid in Bakterien transformiert und dort vermehrt
werden. Zur Kontrolle, ob das Einfügen des Fragments funktioniert hat, wird das Plasmid wieder
aus Bakterien isoliert und erneut mit EcoRI gespalten. Da durch das Zusammenfügen zweier
EcoRI Enden die EcoRI Erkennungsstelle wieder regeneriert wird, lässt sich anhand der
Spaltprodukte einfach feststellen, ob das Plasmid das Fragment aufgenommen hat oder ob nur
die kompatiblen Plasmidenden zusammengefügt wurden.
„Glatte“ Enden können ebenfalls von Ligasen zusammen gefügt werden. Allerdings können bei
„glatten“ Enden auch durch verschiedene Restriktionsenzyme erzeugte Enden miteinander
ligiert werden. In der Regel wird dabei aber keine Restriktionsschnittstelle regeneriert.

Im Praktikum verwenden Sie eines von vier verschiedenen Plasmiden (die DNA haben Sie im
vorherigen Versuch selber isoliert). Die Plasmid-DNA werden Sie mit verschiedenen
Restriktionsenzymen spalten und anschließend auf einem Agarosegel auftrennen und sichtbar
machen.
Die Spaltungsmuster, das Sie finden, sind spezifisch für ein bestimmtes Plasmid. Durch die
Spaltung mit einzelnen Enzymen und unterschiedlichen Kombinationen aus zwei Enzymen,
können Sie aus den Spaltungsmustern eine Restriktionskarte des Plasmids erstellen, die Ihnen
Auskunft darüber gibt, welche Restriktionsschnittstelle wie oft und in welchen Abstand
zueinander auf Ihrem Plasmid vorkommen.

Bitte auch Theorieteil zur DNA-Analytik lesen!

19
Restriktionsspaltung der Plasmid-DNA, Tag 3
Materialien:
- Plasmid-DNA aus 4.) oder 5.); (qualitativ bessere DNA verwenden)
- H2Obidest, autoklaviert
- verschiedene 10 x Reaktions-Puffer
- verschiedene Restriktionsenzyme
- H2Obidest, autoklaviert
- Eppendorf Tubes, steril, 1,5 ml (Eppi)
- Agarose
- 50 x TAE
- SYBR Safe Lösung
- Pipetten
- Pipettenspitzen (weiß, gelb)
- Wasserbad 37 °C
- Tisch-Zentrifugen
- Agarosegel Kammern, Kämme
- DNA-Längenstandard GeneRulerTM, 1 kb DNA Ladder
- 5 x DNA Auftragspuffer
- Geldokumentationssystem
- Eisbad

Versuchsdurchführung:

♦ allgemeiner Spaltungsansatz:
x µl Plasmid-DNA
1/10 Vol 10 x Puffer (entsprechend Enzym)
y µl Enzym (maximal 1/10 Vol. des Gesamtansatzes)
z µl H2Obidest, autoklaviert (H2O ad Endvolumen)
♦ Spaltungen:
- Setzen Sie jeweils 1000 ng Plasmid-DNA pro Spaltung ein
- Konzentration der Plasmid-DNA entsprechend Ihrer Berechnung
- Plasmid-DNA falls notwendig verdünnen
- Setzen Sie 10 Units Enzym pro Spaltung ein, bei Doppelspaltungen 10 Units für jedes
Enzym
- Konzentration der Enzymlösungen: 10 Units/µl
- Endvolumen der Spaltungsansätze: 20 µl

Enzym 1 Enzym 2 10 x Puffer


EcoRI (schwarz) EcoRI unique (10 x Eco, schwarz)
HinDIII (rot) Fermentas R (10 x R, rot)
NdeI (grün) Fermentas O (10 x O, grün)
EcoRI HinDIII Fermentas R (10 x R, rot)
EcoRI NdeI Fermentas O (10 x O, grün)
HinDIII NdeI Fermentas R (10 x R, rot)

(schwarz, rot, grün = Farbe der Beschriftung auf ausgegebenen Tubes)

20
Restriktionsspaltung der Plasmid-DNA, Tag 3

♦ Eppis für Spaltungen vorbereiten → beschriften, in sinnvoller Reihenfolge in Ständer sor-


tieren
♦ Plasmid-DNA in Eppis vorlegen
(10 µl Pipette, weiße Spitzen)
♦ entsprechenden 10 x Puffer zugeben
(10 µl Pipette, weiße Spitzen)
♦ Enzym(e) zugeben, eventuell Eppis kurz zentrifugieren (quick run) um Enzym am Eppi-
Boden zu sammeln; (10 µl Pipette, weiße Spitzen)
♦ H20bidest autoklaviert zugeben, mischen durch auf und ab pipettieren
(100 µl Pipette, gelbe Spitzen)
♦ Inkubieren bei 37 °C für 2 – 3 h, eventuell auch über Nacht
♦ 0,8 % Agarosegel gießen siehe Vorschrift Seite 3

21
Restriktionskartierung
Auftrennung der Plasmidspaltungen im Agarosegel, Tag 4

♦ Markerproben vorbereiten (siehe Auftragsschema), Auftragspuffer zu DNA-Proben geben


♦ Auftragsschema:

Proben- Proben- Auftrags- End-


Tasche Probe H2Obidest
menge volumen puffer 5 x volumen

1 Längenstandard 1000 ng ? --
2 Plasmid-DNA, ungesp. 500 ng ? 2µl 10 µl
3 EcoRI-Spaltung 20 µl 5 µl 25 µl
4 HinDIII-Spaltung 20 µl 5 µl 25 µl
5 NdeI-Spaltung 20 µl 5 µl 25 µl
6 EcoRI/HinDIII-Spaltung 20 µl 5 µl 25 µl
7 EcoRI/NdeI-Spaltung 20 µl 5 µl 25 µl
8 HinDIII/NdeI-Spaltung 20 µl 5 µl 25 µl

♦ Elektrophorese bei 60 V für 15 – 30 min, dann bei 120 V bis blauer Farbstoff etwas weiter als
die Mitte des Gels gelaufen ist;
♦ Gel dokumentieren

22
Transformation von Bakterien
Unbehandelte Zellen nehmen DNA gar nicht oder nur sehr schlecht auf. Um Zellen zu
transformieren, d.h. DNA in sie einzubringen, muss die Zellmembran zunächst permeabel
gemacht werden.
Es gibt verschiedene Methoden mit denen unterschiedliche Zelltypen transformiert werden
können. Im Praktikum transformieren wir Bakterien, die zuvor durch Behandlung mit einem
Ca2+-Ionen haltigen Puffer kompetent für die Aufnahme von DNA gemacht wurden.
Kompetente Bakterien sind relativ empfindlich. Sie werden direkt nach dem kompetent machen
in kleine Arbeitsportionen aufgeteilt und in flüssigem Stickstoff schockgefroren. Nach dem
Auftauen sollten sie weder heftig gemischt (nicht vortexen) werden, noch zu lange rumstehen.
Besonders wichtig ist es die Zellen vor der Transformation ständig auf Eis gekühlt zu halten.
Beachtet man diese Regeln nicht, verlieren die Zellen sehr schnell ihre Kompetenz und die
Effizienz der DNA Aufnahme und damit die Anzahl der erhaltenen Bakterienkolonien sinkt
drastisch ab.
Für die Transformation werden die Bakterienzellen mit einer definierten Menge Plasmid-DNA
gemischt und auf Eis inkubiert. Es erfolgt dann ein kurzer Hitzeschock bei 42 Grad. Dieser führt
dazu, dass die DNA in die Zelle aufgenommen wird.
Um den Zellen Zeit zur Erholung zu geben, werden sie kurz auf Eis gestellt und dann mit wenig
Medium ohne Selektionsantibiotikum gemischt und bei 37°C inkubiert. Die Inkubation ohne
Selektionsantibiotikum ermöglicht es den Bakterien das Resistenz vermittelnde Protein (kodiert
auf dem transformierten Plasmid) zu expremieren. Bei einigen Antibiotika, die die Translation
irreversibel inhibieren ist dies ein essentieller Schritt. Würde das Resistenzgen nicht vor Zugabe
des Antibiotikums schon in der Zelle vorliegen, könnte es wenn Translationshemmer als
Selektionsmittel verwendet werden, nicht mehr gebildet werden.
Nachdem die Bakterienzellen Zeit hatten sich vom Transformationsstress zu erholen und das
Resistenzgen zu expremieren, wird der Transformationsansatz verdünnt und Aliquots der
Verdünnungen auf Medienplatten, die den Selektionsmarker enthalten ausplattiert.

Bitte auch Theorieteil zur DNA-Analytik lesen!

23
Transformation von Bakterien, Tag 4
Materialien:

- kompetente Bakterien (Stamm Top10F’)


- Plasmid-DNA pGEX oder pET-ACID
- TE 10/1, steril
- LB flüssig Medium
- LBamp/LBkan Platten
- Glasperlen
- sterile Eppendorf Tubes 1,5 ml (Eppi)
- Pipetten
- Pipettenspitzen (weiß, gelb, blau)
- Eisbad
- Wasserbad 42 °C
- Schüttler 37 °C
- 15 ml Rundbodenröhrchen

Versuchsdurchführung:

♦ Verdünnen der Plasmid-DNA auf 10 ng/µl in 10/1 TE;


die Konzentration der ausgegebenen Plasmid-DNA ist auf den Eppis angegeben; bei der
Verdünnung falls nötig in „Schritten“ vorgehen – nicht 1 µl Plasmid-DNA 1000 ng/µl in 99 µl
TE geben, sondern 1 µl Plasmid-DNA 1000 ng/µl zu 9 µl TE ⇒ DNA-Lösung mit 100 ng/µl
Plasmid; von dieser Verdünnung wieder 1 µl zu 9 µl TE geben ⇒ Konzentration DNA-Lösung
10 ng/µl
♦ 50 ng DNA bzw. 5 µl TE vorlegen in je ein Eppi → inkubieren auf Eis für 5 min
(die 5 µl TE dienen als Negativkontrolle)
♦ Bakterien Suspension auftauen auf Eis
nicht schütteln, nicht vortexen
♦ Je 50 µl Bakterien zur DNA bzw. TE geben, mischen durch vorsichtiges pipettieren → in-
kubieren auf Eis für 30 min
♦ Bakteriensuspension in Wasserbad 42 °C stellen → inkubieren für 2 min (Heatshock) → auf
Eis für 5 min
Inkubationszeiten bei 42 °C exakt einhalten, auf keinen Fall länger inkubieren;
♦ 950 µl LB zugeben → mischen → Bakteriensuspensionen (= Trafoansatz TS) inkubieren bei
37 °C im Thermo-Schüttler bei 700 rpm, für 45 min;
♦ Platten vorbereiten: - Beschriften und Glasperlen (ca. 8 – 10 pro Platte) aufbringen, Platten
bis zu Verwendung umgedreht auf dem Deckel liegen lassen)
♦ Plattieren:
In der Tabelle angegebene Verdünnungen ansetzen:
Transformationsansatz vortexen, 100 µl entnehmen und zu 900 µl LB geben = Verdünnung
10-1;
diese 10-1 Verdünnung vortexen, 100 µl entnehmen und zu 900 µl LB geben = Verdünnung
10-2;

24
Transformation von Bakterien, Tag 4

Verdünnungs- Verdünnungs- Plattierungs- Anzahl


faktor ansatz volumen Platten

Plasmid-Trafo:

10-1 100 µl TS + 900 µl LB 100 µl 2

10-2 100 µl 10-1 + 900 µl LB 100 µl 2

Negativkontrolle

0 100 µl 1

♦ Bakteriensuspension/-verdünnung kurz vortexen (5 sec.), 100 µl auf entsprechende Platte


überführen, Deckel schließen, zur Verteilung der Suspension Platte „schütteln“ bis die
Flüssigkeit gleichmäßig verteilt ist.; darauf achten, dass die Kugeln sich über die gesamte
Fläche der Platte bewegen;
♦ Plattiert wird nur auf LBamp-Platten (pGEX-Trafo) oder nur auf LBkan-Platten (pET-ACID-
Trafo)!!
♦ Platten ca. fünf min ruhen lassen, kurz schütteln und Glasperlen in Becherglas abschütten
(Glasperlen im Autoklaviermüll entsorgen).
♦ Platten beim Betreuer abgeben (werden über Nacht bei 37 °C inkubiert)
♦ Auswertung der Transformationseffizienz durch Auszählen der Platten und Eintragen der
Ergebnisse in Tabelle (Moodle).

25
Polymerase Kettenreaktion - PCR
Die Polymerase Kettenreaktion (Polymerase Chain Reaction, PCR) ist eine Methode mit der
DNA-Fragmente schnell und einfach von einer sehr geringen Menge Ausgangsmaterial
ausgehend spezifisch vermehrt werden können.
Dazu kopiert die Methode auf einfache Weise in vitro (im „Reagenzglas“) die Art und Weise
nach der in vivo (in der Zelle) DNA repliziert d.h. vermehrt wird.
Möglich wurde die Methode durch die Entdeckung einer DNA-Polymerase aus einem
thermophilen Organismus (Thermus aquaticus), die Temperaturen von bis zu 100 °C
ausgesetzt werden kann ohne dabei an Funktionalität zu verlieren.
Ausgangspunkt einer PCR Reaktion kann jede DNA aus einer beliebigen Quelle sein. Da DNA-
Polymerasen Primer benötigen, von denen aus sie die Neusynthese des DNA-Stranges
beginnen können, muss die Sequenz des gewünschten DNA-Fragments bekannt sein. Die
Primer müssen komplementär zu den Enden des Zielfragments sein.
Template-DNA, Primer und Taq-Polymerase werden zusammen mit dNTPs in einem speziellen
Puffer gemischt und auf 94 – 98°C erhitzt. Dabei trennt sich die doppelsträngige Template-DNA
in ihre beiden Einzelstränge auf. Beim Abkühlen auf die Annealing Temperatur binden die
Primer an ihre komplementären Stellen an die Einzelstränge. Da die Primer in deutlich höherer
Konzentration im Ansatz vorliegen als die Template-DNA ist dieser Schritt einer
Rehybridisierung der Template-DNA Einzelstränge bevorzugt. Die Taq-Polymerase bindet an
das kurze Primer-Template Doppelstrang DNA Stück. Wird die Temperatur dann auf die
optimale Reaktionstemperatur der Taq-Polymerase (72°C) erhöht beginnt diese mit der
Neusynthese des komplementären Strangs.
Der Zyklus aus Erhitzen zur Trennung der Doppelstrang-DNA, Abkühlen für das Primer-
Annealing und Erwärmen auf 72°C wird in PCR-Maschinen nach vorgegebener
Programmierung 30 – 35 mal wiederholt.
Ob und wie gut das gewünschte DNA-Fragment amplifiziert wird hängt von verschiedenen
Faktoren ab. Neben der Basenzusammensetzung und Länge der Primer, der Länge und
Kopienzahl des Templates beeinflussen auch die Annealing-Temperatur und die
Pufferzusammensetzung die Spezifität und Effizienz einer PCR-Reaktion. Daher müssen PCR-
Reaktionen oftmals optimiert werden.
Im Praktikum werden Sie zwei Parameter variieren, um die optimalen Bedingungen einer PCR-
Reaktion zu finden. Zum einen werden Sie die PCR bei verschiedenen Primer Annealing-
Temperaturen durchführen. Dazu werden wir eine Gradienten-PCR-Maschine verwenden, in
der verschiedene Annealingtemperaturen gleichzeitig getestet werden können.
Außerdem werden Sie die PCR-Reaktion mit zwei verschiedenen Mg2+-Ionen Konzentrationen
durchführen. Mg2+-Ionen schirmen die negativen Ladungen im Phophat-Rückrat der DNA ab
und fördern dadurch die Ausbildung doppelsträngiger DNA.
Sie werden somit testen bei welcher Annealing-Temperatur und welcher Mg2+-Ionen
Konzentration Spezifität und Effizienz der PCR-Reaktion optimal sind.
Als zweites PCR-Experiment werden Sie ein spezifisches Fragment von Ihrer Hefe-DNA, die
Sie selbst isoliert haben, amplifizieren. Hier werden in verschiedenen Kontroll-Ansätzen
einzelne Komponenten der PCR weggelassen, um so Ihre Wichtigkeit zu testen.

Bitte auch Theorieteil zur DNA-Analytik lesen!

26
Optimierung von PCR Bedingungen, Tag 3
Materialien:

- Template DNA
- Primer forward und reverse
- Taq-Polymerase
- dNTPs
- Taq 10 x Puffer
- MgCl2 25 mM
- H2Obidest, autoklaviert
- Pipetten
- Spitzen (weiß, gelb)
- Eppendorf Tubes 0,2 und 1,5 ml
- PCR-Maschine
- Agarose
- 50 x TAE
- SYBR Safe Lösung 10 mg/ml
- Agarosegel Kammern, Kämme
- DNA-Längenstandard Gene RulerTM, 1kb DNA Ladder
- 5 x DNA Auftragspuffer
- Eisbad
- Geldokumentationssystem

Dieses Jahr beschäftigen wir uns mit einem aktuellen Thema aus der Lebensmittelchemie –
dem Nachweis von Pferdefleisch. Dies geschieht per PCR und beruht i.d.R. auf dem Nachweis
von mitochondrialer DNA. Die ausgegebenen Primer können entweder in einer universalen
Kombination eingesetzt werden, in der die DNA aller 3 Spezies (Rind, Pferd und Schwein)
nachgewiesen werden kann, oder in einer spezifischen Kombination bei der nur die DNA von
Pferden zu einer Amplifikation führt (Schema s.u.).
Um eine optimale Sensitivität und Selektivität zu erreichen muss die Temperatur des Primer-
Annealings sowie die Konzentration von Mg2+ optimiert werden. Im Kurs werden wir innerhalb
eines Saales verschiedene Magnesium-Konzentrationen ausprobieren und zwischen den Sälen
die Temperatur des Primer-Annealings variieren.

Bitte bereiten Sie folgende Master-Mixe auf Eis vor:

universal
Primer universal antisense (10 uM) 2 ul
Primer universal sense (10 uM) 2 ul
10 x Puffer 10 ul
dNTP Lösung (10 mM) 2 ul
MgCl2 (25 mM) entsprechend Endkonzentration (1, 2, 3 oder 4 mM)
Wasser zu 94 ul auffüllen
Taq polymerase (5U/ul) 2 ul
Endvolumen 96 ul

Pferd
Primer universal antisense (10 uM) 2 ul
Primer horse spec. sense (10 uM) 2 ul
10 x Puffer 10 ul
dNTP Lösung (10 mM) 2 ul
MgCl2 (25 mM) entsprechend Endkonzentration (1, 2, 3 oder 4 mM)
Wasser zu 94 ul auffüllen
Taq polymerase (5U/ul) 2 ul
Endvolumen 96 ul

27
Optimierung von PCR Bedingungen, Tag 3
Verteilen Sie dann diese Mischungen auf 4 PCR-Tubes pro Master-Mix (je 24 ul). Geben Sie
dann die template-DNA dazu (je 1 ul).

Master-Mix universal:
A: Kontroll-DNA Schwein B: Pferdefleisch C: Probe X D: Wasser (als Kontrolle)

Master-Mix Pferd:
E: Kontroll-DNA Schwein F: Pferdefleisch G: Probe X H: Wasser (als Kontrolle)

Stellen Sie die Tubes in die PCR-Maschine, wir lassen die PCR während des Seminars am
Mittwoch laufen und laden gleich anschließend das Gel.
PCR-Profil:

1: 94°C 3 min
2: 94°C 20 sec
3:56-62°C 20 sec (Temp. je nach Saal anders!)
4: 72°C 20 sec
(Wiederholung Schritt 2-4 35x)
5: 4°C Pause

Tragen Sie je 10 ul der PCR-Ansätze mit je 2,5 µl 5x DNA Auftragspuffer auf ein 1.2% Agarose-
Gel auf, 4 Gruppen zusammen benötigen ein großes Gel mit zwei 20 er Kämmen. Hier sollten
die Magnesium-Endkonzentrationen 1, 2, 3 und 4 mM vertreten sein.

Auftragsschema:

1. Längenstandard
2. Kontroll-DNA Schwein universal = Probe A
3. Kontroll-DNA Schwein Pferde-spez. = Probe E
4. Pferd universal = Probe B
5. Pferd Pferde-spez. = Probe F
6. Probe X universal = Probe C
7. Probe X Pferde-spez. = Probe G
8. H2O universal = Probe D
9. H2O Pferde-spez. = Probe H

28
Optimierung von PCR Bedingungen, Tag 3

Sequenzinformation der Primer und der mitochondrialen DNA:


universal sense primer
5’-gcactgaaaatgcctagatgag-3’
Bos AGGCACTGAAAATGCCTAGATGAGTCTCCCAACTCCATAAACACATAGGTTTGGTCCCAGCCTTCCTGTTAACTCTTAAT 80
Equus AGGCACTGAAAATGCCTAGATGAGTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGTTATTAAT 80
Sus AGGCACTGAAAATGCCTAGATGAGCCTCACAGCTCCATAAACACACAGGTTTGGTCCTGGCCTTTCTATTAATTCTTAAT 80
************************ * ************* *** ******* ***** * *** * *****
...sequence coding for tRNA...................|...sequence coding for ribosomal rRNA...
(955 nt)

horse spec. sense primer


5’-atgccctctaaatcacgtctc-3’
Bos AAACTTACACATGCAAGCATCTACACCCCAGTGAGAATGCCCTCTAGGTTA-----TTAAAACTAAGAGGAGCTGGCATC 155
Equus AGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCTCTAAATCACGTCTCTACGATTAAAAGGAGCAGGTATC 160
Sus AAAATTACACATGCAAGTATCCGCGCCCCGGTGAGAATGCCCTCCAGATCC-----TAAAGATCAAAAGGAGCAGGTATC 155
* * ************* *** * **** ************** * * * * ** ****** ** ***

Bos AAGCACAC-A-CC-CTGTAGCTCACGACGCCTTGCTTAACCACACC-CCACGGGAAACAGCAGTGACAAAAATTAAGCCA 231


Equus AAGCACAC-TAGA-AAGTAGCTCATAACACCTTGCTCAGCCACACCCCCACGGGACACAGCAGTGATAAAAATTAAGCTA 238
Sus AAGCACACCTATAACGGTAGCTCATAACGCCTTGCTCAACCACACCCCCACGGGAAACAGCAGTGATAAAAATTAAGCCA 235
******** ******** ** ******* * ******* ******** ********** *********** *

Bos TAAACGAAAGTTTGACTAAGTTATATTAA-TTAGGGTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAACCCA 310


Equus TGAACGAAAGTTCGACTAAGTCATATTAAATAAGGGTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCA 318
Sus TGAACGAAAGTTTGACTAAGTTATATTAA-TTAGAGTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAACCCA 314
* ********** ******** ******* * ** ********** **********************************
3’-cgccagtatgctaattgggtt-5’
universal antisense primer

Bos AGCTAACAGGAGTACGGCGTAAAACGTGTTAAAGCACC-ATACCA-AATAGGGTTAAATTCTAACTAAGCTGTAAAAAGC 388


Equus AATTAATAAATCTCCGGCGTAAAGCGTGTCAAAGACTA-ATACCAAAATAAAGTTAAAACCCAGTTAAGCCGTAAAAAGC 397
Sus AATTAATAGATCCACGGCGTAAAGAGTGTTTAAGAAAAAAAACCACAATAGAGTTAAATTATAACTAAGCTGTAAAAAGC 394
* *** * ********* **** *** * **** **** ****** * ***** *********

29
Optimierung von PCR Bedingungen, Tag 3

Karte der mitochondrialen DNA (ca. 16000 - 17000 bp)


Zielregion
der PCR

30
PCR mit genomischer Hefe-DNA, Tag 4
Materialien:

- genomische Hefe-DNA, aus Versuch 2.)


- Primer Mre11-for (Mre11-f) und Mre11-rev (Mre11-r) (jeweils 10 nM)
- Taq-Polymerase
- dNTPs 25 mM
- Taq 10 x Puffer
- H2Obidest, autoklaviert
- Pipetten
- Spitzen (weiß, gelb)
- Eppendorf Tubes, 0,2 ml und 1,5 ml, steril
- PCR-Maschine
- Agarose
- 50 x TAE
- SYBR Safe Lösung 10 mg/ml
- Agarosegel Kammern, Kämme
- DNA-Längenstandard Gene RulerTM, 1kb DNA Ladder
- 5 x DNA Auftragspuffer
- Eisbad
- Geldokumentationssystem

Versuchsdurchführung:

♦ PCR-Ansatz:
100 ng genomische Hefe-DNA
1 µl dNTPs, 10 mM
5 µl 25 mM MgCl2
5 µl 10 x Taq Puffer
2 µl Primer Mre11-for (10 pmol/µl)
2 µl Primer Mre11-rev (10 pmol/µl)
1 µl Taq-Polymerase
H20 ad 50 µl
♦ Jede Gruppe pipettiert einen vollständigen PCR-Ansatz mit Ihrer selbst hergestellten Hefe-
DNA und vier Kontrollansätze.
- Kontrollansatz 1: wie PCR-Ansatz aber ohne genomische DNA
- Kontrollansatz 2: wie PCR-Ansatz aber ohne Primer Mre11-for
- Kontrollansatz 3: wie PCR-Ansatz aber ohne Primer Mre11-rev
- Kontrollansatz 4: wie PCR-Ansatz mit Taq-Polymerase und genomischer DNA vom
Kursleiter

Das Volumen der fehlenden Komponente wird durch H2O ersetzt

♦ PCR-Ansätze auf Eis pipettieren


♦ Alle Ansätze in einem Eisbad sammeln, PCR-Maschine anschalten, Programm starten

31
PCR mit genomischer Hefe-DNA, Tag 4
♦ PCR-Programm:
Schritt 1: 98 °C 3 min initiale Denaturierung
Schritt 2: 96 °C 45 sec Denaturierungsschritt im Zyklus
Schritt 3: 56 °C 45 sec Primer Annealing
Schritt 4: 72 °C 45 sec Polymerisation
Schleife von Schritt 4 zu Schritt 2, Anzahl der Zyklen: 34
Schritt 5: 15 °C ohne Zeitlimit
♦ Wenn Blocks 98 °C erreicht haben “Pause“ schalten, PCR-Ansätze in vorgeheizten Block
einsetzen, Deckel schließen, festdrehen, auf continue schalten (= “Hot start“)
♦ 1,2 % Agarosegel gießen Siehe Vorschrift Seite 3
♦ Nach Beendigung der PCR, Eppis rausnehmen → auf Eis
♦ Von jedem PCR-Ansatz 10 µl überführen in frisches 1,5 ml Eppi;
♦ 5 x Auftragspuffer zugeben
Auftragsschema:

Tasche Probe

1 Längenstandard, 500 ng
2 PCR Ansatz
3 Kontrollansatz 1
4 Kontrollansatz 2
5 Kontrollansatz 3
6 Kontrollansatz 4

analoger Auftrag für die anderen Gruppen


♦ Elektrophorese erfolgt bei 80 V bis blauer Farbstoff ca. 1/2 - 2/3 des Gels gelaufen ist;
♦ Am Ende der Elektrophorese Strom abstellen, Gel mit Träger aus der Kammer nehmen
und in Tragschale mit saugfähigem Papier legen (Nitril - Handschuhe!)
♦ Gelbild am Dokumentationssystem erstellen

32
DNA-Längenstandard, Plasmidkarten
DNA Größenstandard

Fermentas #SM0313

33
Anzusetzende Puffer
Biochemisches Praktikum 1 - Grundpraktikum

DNA-Analytik – Anzusetzende Puffer:


Prozentangaben: fest in flüssig = w/v
flüssig in flüssig = v/v

Gewebe-Lysispuffer: 50 ml, 1 x für alle, aliquotiert verteilen Stocklösung/Feststoff


100 mM Tris HCl pH 8,5 1 M Tris HCl, pH 8,5
5 mM EDTA, pH 8,0 0,5 M EDTA, pH 8,0
0,2 % SDS 10 % SDS
200 mM NaCl 5 M NaCl

TE 10/1: 100 ml, 1 x für alle (pro Saal), á 10 ml aliquotiert verteilen


10 mM Tris HCl pH 7,5 1 M Tris HCl, pH 7,5
1 mM EDTA pH 8,0 0,5 M EDTA, pH 8,0

Lyticase-Puffer: aus Spheroplasten-Waschpuffer, jede Gruppe 1 ml


1 M Sorbitol (MW: 182,18) Feststoff
100 mM EDTA, pH 8,0 0,5 M EDTA, pH 8,0
14,3 mM Mercaptoethanol (MW: 78,13; D = 1,12) 100 %
herstellen aus Spheroplasten Waschpuffer, Volumenzunahme durch Mercaptoethanol kann
vernachlässigt werden.

Spheroplasten Waschpuffer 200 ml, 1 x für alle (pro Saal), á 20 ml aliquotiert verteilen
1 M Sorbitol (MW: 182,18) Feststoff
100 mM EDTA, pH 8,0 0,5 M EDTA, pH 8,0

TE 50/100: 100 ml, 1 x für alle (pro Saal), á 10 ml aliquotiert verteilen


50 mM Tris HCl, pH 7,5 1 M Tris HCl, pH 7,5
100 mM EDTA, pH 8,0 0,5 M EDTA, pH 8,0

50 x TAE: 100 ml, jede Gruppe


2 M Tris (MW: 121,14) Feststoff
1 M Essigsäure (MW: 60,05g; D = 1,05) 100 % (Eisessig)
50 mM EDTA (MW: 292,24 g) Feststoff

Resuspensionspuffer: =P1; 100 ml, 1 x für alle, á 10 ml aliquotiert verteilen


50 mM Tris HCl, pH 8,0 1 M Tris HCl, pH 8,0
10 mM EDTA, pH 8,0 0,5 M EDTA, pH 8,0

Lysis-Puffer: =P2; 100 ml, 1 x für alle, á 10 ml aliquotiert verteilen


200 mM NaOH 1 M NaOH
1 % SDS 10 % SDS

Puffer STET: 100 ml, 1 x für alle, á 10 ml aliquotiert verteilen


10 mM Tris HCl, pH 8,0 1 M Tris HCl, pH 8,0
1 mM EDTA, pH 8,0 0,5 M EDTA, pH 8,0
100 mM NaCl 5 M NaCl
5 % Triton X-100 100 % Triton

34
Vorhandene Puffer und Stocklösungen
Vorhandene Puffer:

1 M Tris HCl, pH 7,5


1 M Tris HCl, pH 8,5 Neutralisationspuffer: =P3
1 M Tris HCl, pH 8,0 2,55 M Kaliumacetat, pH 5,0
0,5 M EDTA, pH 8,0
5 M NaCl
Na-Acetat:
10 % SDS
1 M NaOH 3 M Na-acetat, pH, 5,0

ProteinaseK-Lösung 20 mg/ml: Lysozym-Lösung 10 mg/ml:


100 mM Tris HCl pH 8,5 10 mg/ml Lysozym
200 mM NaCl 50 mM Tris HCl, pH 8,0

Lyticase Lösung 10 U/µl: LB flüssig:


1 M Sorbitol 10 g BactoTrypton
100 mM EDTA, pH 8,0 5 g Yeast Extract
10 U/µl Lyticase 5 g NaCl
ad 1000 ml H2Obidest, autoklavieren
5 x Auftragspuffer:
10 mM Tris HCl, pH 8,0 LB Platten:
50 mM EDTA, pH 8,0 10 g Bacto Trypton
10 % Ficoll 5 g Yeast Extract
10 % Glycerin 5 g NaCl
0,01 % Bromphenolblau 1,5 g Bacto Agar
0,01 % Xylencyanol ad 1000 ml H2Obidest, autoklavieren

RNase A, 10 mg/ml: Kanamyzin-Stocklösung:


10 mg/ml RNase A 50 mg/ml Kanamyzin
10 mM Tris HCl, pH 7,5
15 mM NaCl
Ampizillin Stocklösung
5 M Kaliumacetat-Lösung 50 mg/ml Ampizillin
5 M Kaliumacetat

35
Protokoll zur Woche DNA-Analytik

Protokoll zum Grundpraktikum – DNA-Analytik

Protokoll von:

Name:

Vorname:

Matrikelnummer:

und

Name:

Vorname:
Matrikelnummer:

Thema: DNA-Analytik

Zeitraum:

Betreuer/in:

36
Protokoll zur Woche DNA-Analytik

Protokoll zum Grundpraktikum Biochemie – Woche DNA-Analytik


Bitte schreiben sie 1 1/2 zeilig mit Schriftgröße 11 – 12 Punkt!

Schreiben Sie zu folgenden Themen jeweils ca. 1 Seiten „Einleitung“.


Die Einleitung soll kurz auf die theoretischen Inhalte der Versuche eingehen und mit einer
kurzen Zusammenfassung was Sie mit welcher Zielsetzung gemacht haben, enden.
Schreiben Sie nicht wesentlich mehr als 1 ½ Seiten; nach 2 Seiten werden wir aufhören zu lesen und zu
korrigieren
Themen:
1. Isolierung genomischer DNA
2. Isolierung von Plasmid-DNA und Restriktionskartierung
3. Transformation von Plasmid-DNA in Bakterien
4. PCR

1. Isolierung genomischer DNA aus Gewebe und Hefezellen und


Analyse der genomischen DNA – Restriktionsspaltung und
Auftrennung im Agarosegel
Berechnung der Pufferherstellung:

Endkonzentration eingesetzt: ml Stocklösung / g Feststoff:


50 ml Gewebe-Lysispuffer:
100 mM Tris HCl, pH 8,5
5 mM EDTA, pH 8,0
0,2 % SDS
200 mM NaCl

100 ml TE 10/1:
10 mM Tris HCl, pH 7,5
1 mM EDTA, pH 8,0

200 ml Spheroblasten Waschpuffer:


1 M Sorbitol
100 mM EDTA, pH 8,0

1 ml Lyticase-Puffer:
1 M Sorbitol
100 mM EDTA, pH 8,0
14,3 mM β-Mercaptoethanol

100 ml TE 50/100:
50 mM Tris HCl, pH 7,5
100 mM EDTA, pH 8,0

37
Protokoll zur Woche DNA-Analytik

100 ml 50 x TAE:
2 M Tris
1 M Essigsäure
50 mM EDTA

Gel-Dokumentation:

Kleben Sie das Bild Ihres Agarosegels ein und beschriften Sie das Bild EXAKT!

Wenn sie sich unsicher sind, fragen Sie was unter exakter Beschriftung zu verstehen ist!

Versuchsauswertung:

1. Schätzen Sie an Hand des Markers im Agarosegel die Größe Ihrer genomischen DNA.
Erwarten Sie für genomische DNA diese Größe? Wenn ja, Begründung, wenn nein,
woran kann es liegen, dass Ihre genomische DNA nicht das erwartete Laufverhalten
zeigt?
2. Schätzen Sie jeweils die Menge der RNaseA behandelten DNA im Agarosegel im
Vergleich zu den (Mengen-) definierten Markerbanden und berechnen Sie die
Konzentration Ihrer DNAs pro µl und Ihre Gesamtausbeute.
3. Vergleichen Sie die DNA-Präparation aus Gewebe und Hefe. Sehen Sie Unterschiede?
Erwarten Sie Unterschiede?
4. Vergleichen Sie die EcoRI und HaeIII Spaltungen der genomischen DNAs. Sehen Sie
Unterschiede zwischen den Spaltungen? Wenn ja, warum?

Beantworten Sie die Fragen mit wenigen kurzen Sätzen. Zu Frage 1 und 2 werden auch Zahlen
erwartet. Ja und Nein wird nicht als (einzige) Antwort akzeptiert (auch nicht zu Frage 3)

Sollte Ihr Agarosegel, Ihre DNA-Präparation oder Ihre Spaltung nicht auswertbar sein,
verwenden Sie die Musterlösung (online und Anhang) zur Beantwortung der Fragen.

Dokumentieren Sie aber in jedem Fall Ihr Gel (Bild einkleben) und begründen Sie kurz, warum
Sie die Musterlösung für die Auswertung benutzen.

38
Protokoll zur Woche DNA-Analytik

2. Isolierung von Plasmid-DNA, Kontrolle und Mengenabschätzung


der isolierten Plasmid-DNA

Berechnung der Pufferherstellung:

Endkonzentration eingesetzt: ml Stocklösung/ g Feststoff:


100 ml Resuspensionspuffer:
50 mM Tris HCl, pH 8,0
10 mM EDTA, pH 8,0

100 ml Lysispuffer:
200 mM NaOH
1 % SDS

100 ml Puffer STET


10 mM Tris HCl, pH 8,0
1 mM EDTA, pH 8,0
100 mM NaCl
5 % Triton X-100

Gel-Dokumentation:

Kleben Sie das Bild Ihres Agarosegels hier ein und beschriften Sie das Bild EXAKT!

Versuchsauswertung

1. Schätzen Sie für beide Methoden die Plasmid-DNA Ausbeute durch Vergleich mit
bekannten DNA-Mengen im Gel, berechnen Sie die Konzentration der Plasmid-DNA pro
µl und Ihre Gesamtausbeute (für beide Präparationsmethoden durchführen). Geben Sie
eindeutig an welche Kontroll-DNA und welche Plasmid-DNA Sie für die Abschätzung
verwenden.
2. Vergleichen Sie die Ausbeute und Qualität der Plasmid-DNA aus den zwei
verschiedenen Isolierungsmethoden. Welche Methode liefert mehr DNA? Welche
Methode liefert die bessere Qualität an Plasmid-DNA? (Qualitätsmerkmale: Verhältnis
supercoiled zu nicked DNA; Laufverhalten der DNA – scharfe Banden?)
3. Diskutieren Sie die beiden Methoden hinsichtlich Schnelligkeit, Einfachheit, Ausbeute
und Qualität der Plasmid-DNA. Welche Methode würden Sie bevorzugen? Warum?

39
Protokoll zur Woche DNA-Analytik

3. Restriktionskartierung von Plasmid-DNA


Gel-Dokumentation:

Kleben Sie das Bild Ihres Agarosegels hier ein und beschriften Sie das Bild EXAKT!

Versuchsauswertung:

1. Messen Sie die Laufstrecke der einzelnen Markerbanden aus und tragen Sie sie in eine
Tabelle mit den Größen in Basenpaaren ein. Berechnen Sie den dekadischen
Logarithmus der Größe in Basenpaaren und tragen diese Werte ebenfalls in die Tabelle
ein.
2. Tragen Sie die Laufstrecke gegen den dekadischen Logarithmus der Größe in
Basenpaaren in ein Diagramm auf Millimeterpapier ein (alternativ Erstellen einer Excel
Tabelle und Excel Grafik); erstellen Sie eine Eichkurve.
Falls Sie Excel verwenden: Achten Sie darauf, dass die vom Programm erstellte
Ausgleichsgrade „sinnvoll“ ist!
3. Messen Sie die Laufstrecke der einzelnen Banden in Ihren verschiedenen
Restriktionsansätzen aus und bestimmen Sie mit Hilfe der Eichgerade ihre Größe.
(Tabelle erstellen) Achten Sie darauf, dass die aus der Eichgerade abgelesenen
Werte in etwa mit den per Augenschein abgeschätzten Werten übereinstimmen.
(Vergleich mit Markerbanden)
4. Wie groß ist Ihr Plasmid in bp?
5. Welche(r) Ansätze (supercoiled Plasmid, linearisiertes Plasmid, in mehrere Fragmente
gespaltenes Plasmid) eignen sich am besten für die Größenbestimmung und welche(r)
eignen sich nicht? Begründung
6. Erstellen Sie eine ungefähre Restriktionskarte Ihres Plasmids, indem Sie die
Schnittstellen der verwendeten Restriktionsenzyme und ihren ungefähren Abstand (in
bp) zueinander in einen Plasmid-Zirkel eintragen. Erklären/begründen Sie Ihre
Restriktionskarte an Hand der Restriktionsspaltungen. Ein Plasmid-Zirkel mit den
Resriktionsschnittstellen alleine genügt nicht. Sie müssen begründen, warum Sie die
Schnittstellen so angeordnet haben.

Sollte Ihr Agarosegel, Ihre DNA-Präparation oder Ihre Spaltung nicht auswertbar sein,
verwenden Sie die Musterlösung (online) zur Beantwortung der Fragen.

Dokumentieren Sie aber in jedem Fall Ihr Gel (Bild einkleben) und begründen Sie kurz, warum
Sie die Musterlösung für die Auswertung benutzen.

40
Protokoll zur Woche DNA-Analytik

4. Transformation von Bakterien


Versuchsauswertung:

1. Zählen Sie die Kolonien pro Platte und notieren Sie die Werte. Bilden Sie den Mittelwert
für die einzelnen Verdünnungen und für alle Platten.
2. Berechnen Sie die Transformationseffizienz (Transformanden pro µg DNA) und tragen
Sie den Wert in die Tabelle ein.
3. Notieren Sie die Plasmid-Daten und Transformationseffizienzen aller Gruppen und
erfassen Sie die Werte in der Tabelle. Berechnen Sie den Mittelwert aller
Transformationseffizienzen für die beiden Plasmide.
4. Gibt es signifikante Unterschiede in den Transformationseffizienzen bezogen auf die
Gruppen (Vergleich verschiedener Gruppen mit identischem Plasmid).
5. Gibt es signifikante Unterschiede in den Transformationseffizienzen bezogen auf die
Plasmide (Vergleich der Mittelwerte der Transformationseffizienz für die verschiedenen
Plasmide)?
6. Wenn ja, diskutieren Sie mögliche Ursachen.

Auswertungstabelle Bakterien-Transformation:
Plasmid pGEX Plasmid pET-ACID
Transformationseffizienz = Transformationseffizienz =
Gruppe Gruppe
Kolonien pro µg DNA Kolonien pro µg DNA

Mittel- Mittel-
wert wert

41
Protokoll zur Woche DNA-Analytik

5. Polymerase Chain Reaction – PCR


5a) Optimierung von PCR Reaktionen:

Gel-Dokumentation:

Kleben Sie das Bild Ihres Agarosegels hier ein und beschriften Sie das Bild EXAKT!

1: Wie groß sind die beiden amplifizierten Fragmente (Pferd spezifisch und universal)?
2: Vergleichen Sie die Ergebnisse der einzelnen Kurs-Säle (= Annealing-Temperatur) und der
Magnesium-Konzentrationen. Gibt es ein eindeutiges Optimum? Sind systematische
Zusammenhänge erkennbar?

5b) Amplifikation eines DNA Fragments von Hefe-DNA


Gel-Dokumentation:

Kleben Sie das Bild Ihres Agarosegels hier ein und beschriften Sie das Bild EXAKT!

Versuchsauswertung:

1. Bestimmen Sie die Größe des amplifizierten DNA-Fragments


2. Vergleichen Sie die Ergebnisse der verschiedenen Gruppen
Sind die PCR Ansätze identisch/ähnlich?
3. Was sehen Sie in den verschiedenen Kontrollansätzen?
Falls in den Kontrollansätzen Banden zu sehen sind: Worauf sind diese Amplifikate
zurückzuführen?

42