Beruflich Dokumente
Kultur Dokumente
ORIGINAL ARTICLE
Cellular and Molecular Biology
ABSTRACT
We established a cancer stem (CS) cell line, U87CS, by means of spheroid culture of U87MG
cells derived from glioblastoma (GBM) in neuronal stem cell medium. U87CS cells presented
positive immunohistochemical staining for multidrug resistance (MDR)1 and CD133, a marker
for a subset of leukemia and GBM CS cells. The gene expression of MDR1 and CD133 on
U87CS cells increased by an average of 8.51 and 47.18 times, respectively, compared to the
levels on U87MG cells by real-time quantitative RT-PCR. U87CS cells possessed stronger
drug-resistance to conventional anti-cancer drugs, such as doxorubicin (Dox), etoposide
(VP-16), carboplastin, and BCNU than U87MG cells. Double immunofluoresence staining
showed co-expression of MDR1 and CD133 on U87CS cells transplanted into nude mice
brains. In addition, we identified the crossreactivity of CD133 and MDR1 in a surgical specimen
of GBM. Our results suggest that CS cells may be resistant to current chemotherapy and
represent a novel target for GBM therapeutics.
901
MATERIALS AND METHODS RT-PCR
Cells, animals, and tumor specimens The expression of mRNA of CD133, multidrug resistance
(MDR)1, multidrug resistance-associated protein (MRP)1, and
U87MG, a cell line of GBM, was obtained from Ameri- MRP2 were determined by RT-PCR. The primers for RT-PCR
can Type Culture Collection (ATCC, Manassas, Massachusetts, were chosen as follows: ATGACAAGCCCATCACAACA (F)
USA) and cultured in DMEM containing 10% heat-inactivated and AGCACTACCCAGAGACCAATG (R) of CD133, CCCAT-
fetal bovine serum (FBS). U87MG cells were cultured in neu- CATTGCAATAGCAGG (F) and TGTTCAAACTTCTGCTC-
ronal stem cell (NSC) medium, serum-free DMEM contain- CTGA (R) of MDR1, ATGTCACGTGGAATACCAGC (F)
ing 10 ng/mL EGF, 10 ng/mL bFGF and 10 ng/mL LIF. and GAAGACTGAACTCCCTTCCT (R) of MRP1, ACAGAG-
U87MG cells became spheroids U87CS cells through long GCTGGTGGCAACC (F) and ACCATTACCTTGTCACT-
term culture in NSC medium. Xenograft brain tumors were GTCCATGA (R) of MRP2, and AACTCCATCATGAAGTG-
produced by transplantation of U87CS cells into nude mice TACG (F) and GATCCACATCTGCTGGAAGG (R) of β-actin
brains. The brain tumors were removed 3 weeks after the gene. RNAs were isolated from the cultured cells using an RNA
transplantation and were sliced for immunochemical study. isolation kit (QIAGEN, Santa Clarita, California, USA) and
All animals were obtained from CLEA Japan, Inc., (Tokyo, were reverse-transcribed with oligo dT primer using the super-
Japan) and maintained in standard conditions according to script II first strand cDNA synthesis kit (Invitrogen, Carlsbad,
the Institutional guidelines. Written informed consent was ob- California, USA). cDNAs were amplified using AmpliTaq Gold
tained from patients prior to tumor specimen collection. The (Applied Biosystems, Foster City, California, USA), according
Ethics Committee of Kochi Medical School approved this to the manufacturer’s instructions, and the products were visu-
study. alized by agarose electrophoresis. For quantification of CD133
mRNA, real-time PCR was performed with initial denaturation
at 94◦ C for 10 min, followed by 45 cycles of 20 sec at 94◦ C,
Immunohistochemistry 20 sec at 57◦ C, 20 sec at 72◦ C and 84◦ C at 20 sec by using the
LightCycler system (Roche, Switzerland) and Quantitect SYBR
Formalin-fixed, paraffin-embedded sections were deparaf-
Green PCR Kit (QIAGEN).
finized in xylene and dehydrated through ethanol baths. The
slides were pretreated with citrate buffer (10 mM citric acid,
pH 6.0) for 10 min at 100◦ C in a microwave. The endogenous
peroxidase activity was blocked by incubating the sections for Drug sensitivity of U87MG and U87CS cells
10 min with 3% H2 O2 in methanol. The sections were pretreated
with a blocking serum for 20 min and then incubated with anti- Doxorubicin (Dox), etoposide (VP-16), 1,3 bis-(2-
CD133 antibody (rabbit polyclonal IgG; 1: 100; Abcam Inc, chloroethyl)-1-nitrosourea (BCNU), and carboplastin were ob-
Cambridge, Massachusetts, USA) or goat anti-human MDR1 tained from Sigma (Sigma Chemical Co., St Louis, Missouri,
antibody, JSB-1(Monosan, the Netherlands) for 60 min. After USA). The sensitivity of U87MG and U87CS cells to ADM,
washing, the slides were incubated for 30 min with biotinylated VP-16, BCNU and carboplastin was tested using 3-(4,5-
goat anti-mouse IgG (Cedarlane, Canada) and then with avidin– dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
biotin–peroxidase complex (Vector Laboratories, Burlingame, assay (11). Briefly, cells in the logarithmic growth phase were
CA, USA). Finally, the peroxidase activity was visualized with seeded in a volume of 100 µL at 2 ×103 cells/well in 96-well
0.02% 3,30-diaminobenzidine and 0.005% H2 O2 . After CD133 plates, and drugs were added to another 10 µL of medium. After
or MDR1staining, the preparations were counterstained with incubation at 37◦ C for 72 h the medium was removed from each
hematoxylin. well, 15 µL MTT solution (2 mg/mL) were added, and the plates
were incubated at 37◦ C for 4 h. The reaction was stopped by the
addition of 100 µL of Isopropanol/HCl, and the absorbance at
540 nm was quantified using a microtiter plate spectrophotome-
Immunofluorescence staining ter. Drug sensitivity was expressed as the cell survival rate; ratio
To examine CD133 protein expression, a marker of can- of the absorbance of a given drug concentration to that of no
cer stem cells, immunofluorescence staining was performed as drug. All drug concentrations were tested in triplicate wells
previously described (4). Briefly, cells growing in pre-coated in each experiment, and five independent experiments were
chamber slides were fixed with 4% paraformaldehyde for 15 performed.
min at room temperature, treated with 10% normal goat serum,
and then stained with anti-CD133 antibody. In addition, JSB-1
was used for immunofluoresence staining of human MDR1 pro-
teins. The primary antibodies were detected with Alexa fluor 568
Statistical analysis
goat anti-rabbit IgG for CD133, and with Alexa fluor 488 goat The data are expressed as mean ±standard deviation (SD).
anti-mouse IgG for MDR1 (1: 250; Molecular Probes, Eugene, Statistical analysis was performed using the unpaired t-test.
Oregon, USA). Statistical significance was considered when p < 0.05.
Figure 1. Morphology and immunohistochemical study of U87MG and U87CS cells. a) Optical microscopic view of U87MG cells. Magnitude: ×
100; b) optical microscopic views of U87CS cells. Magnitude: ×100; Immunofluorescence staining of U87CS cells with c) CD133 and d) DAPI.
Magnitude: ×100.
Figure 3. Drug sensitivity of U87CS and U87MG cells by MTT assay. The perpendicular axis indicates the cell survival rate and the horizontal
axis the drug concentration. The solid lines show U87CS cells and dotted lines show U87MG cells. a) Dox, b) VP-16, c) carboplastin and d)
BCNU were administered for measurement of the cell survival rate (%). * indicates p < 0.05 compared to U87MG cells. Data are representative
of two independent experiments.
Figure 5. Immunohistochemical study of surgical specimens of a GBM patient. a) and b) hematoxylin eosin staining. Magnitude: ×100.
Immunofluoresence staining of surgical specimen of recurrent GBM patient with c) MDR1, d) CD133 e) DAPI and f) merge of MDR1 and CD133.
Magnitude: ×200.