164 ProNet

Novagen®
PCR Tools
2nd edition
PCR Tools
2nd edition | 2009
Thermostable DNA Polymerases.......... 4

Overview and Enzyme Selection Guide ................................. 4
KOD Hot Start DNA Polymerase ............................................. 6
KOD Hot Start Master Mix........................................................ 8
KOD Xtreme™ Hot Start DNA Polymerase............................... 9
KOD XL DNA Polymerase .......................................................11
KOD DNA Polymerase ............................................................ 12
NovaTaq™ Hot Start DNA Polymerase . ................................ 13
NovaTaq Hot Start Master Mix Kit......................................... 13
NovaTaq DNA Polymerase ..................................................... 14
NovaTaq PCR Master Mix ...................................................... 14
Taq Antibody ........................................................................... 15
10 mM dNTP Mix .................................................................... 15
Direct PCR from Blood.........................16

BloodDirect™ PCR Buffer Kits ................................................ 16
RT-PCR.....................................................18
One Step RT-PCR Master Mix Kit ......................................... 18
First Strand cDNA Synthesis Kit ........................................... 19
Cover and Inside Photography: Chris Bucher Photography,
Dale Chihuly Sculpture located at Indiana University,
Medical Sciences Building, Indiana, United States.
Prices and availability are subject to change. Copyright © 2009 EMD Chemicals Inc., an Mix Kit, and Taq Antibody. These products are manufactured by Toyobo and distributed
affiliate of Merck KGaA, Darmstadt, Germany. All rights reserved. Each product is sold by EMD Chemicals, Inc. Patents related to these products include U.S. Patents 4,965,188,
with a limited warranty which is provided with each purchase. Each product is intended 4,889,818, 5,079,352,5,075,216, 5,407,800, 5,322,770, 5,310,652, 5,436,149, 5,338,671,
to be used for research purposes only. It is not to be used for drug or diagnostic purposes USSN 07/873, 897,USSN 08/384,490, and European Patent 592,035.
nor is it intended for human use. EMD Chemicals products may not be resold, modified
for resale, or used to manufacture commercial products without written approval of EMD KOD Hot Start DNA Polymerase, KOD XL DNA Polymerase, KOD Xtreme™ Hot Start DNA
Chemicals. BacVector®, His•Tag®, HSV•Tag®, Novagen®, Pellet Paint®, Perfectly Blunt®, Polymerase, NovaTaq™ DNA Polymerase, NovaTaq Hot Start DNA Polymerase, One Step RT-
and T7Select® are registered trademarks of EMD Chemicals Inc. in the United States and PCR Master Mix Kit. Use of these products is covered by one of more of the following U.S.
in certain other jurisdictions. AccepTor™, BloodDirect™, Clonables™, CytoBuster™, D- Patents and corresponding patent claims outside the U.S.: 5,079,352, 5,618,711, 5,789,224,
Tube™, GelMelt™, GigaSingles, HT96™, KOD Xtreme™, NovaTaq™, Perfect DNA™, pETBlue™, 6,127,155 and claims outside the U.S. corresponding to U.S. Patent 4,889,818. The
S•Tag™, Singles™, SpinPrep™, Straight A’s™, Tuner™, Veggie™, and Zappers™ are trade- purchase of these products includes a limited, non-transferable immunity from suit under
marks of EMD Chemicals Inc. ABI PRISM®, Big Dye®, and MicroAmp® are registered trade- the foregoing patent claims for using only this amount of product for the purchaser’s own
marks of Applera Corporation. Cy5® is a registered trademark of GE Healthcare. Ex Taq™, internal research. No right under any other patent claim (such as the patented 5’ Nuclease
LA Taq™, and PrimeSTAR® are trademarks of Takara Bio Inc. Herculase®, PfuTurbo®, and Process claims in U.S. Patents 5,210,015 and 5,487,972), no right to perform any patented
PfuUltra® are registered trademarks of Stratagene. Platinum®, Pfx50™, and Quant-iT™ are method, and no right to perform commercial services of any kind, including without limi-
trademarks of Invitrogen Corp. Norit® is a registered trademark of Norit N.V. Phusion™ is a tation reporting the results of purchaser’s activities for a fee or other commercial consid-
trademark of Finnzymes Oy. PicoGreen® and SYBR® are registered trademarks of Molecular eration, is conveyed expressly, by implication, or by estoppel. This product is for research
Probes, Inc. use only. Diagnostic uses under Roche patents require a separate license from Roche.
Further information on purchasing licenses may be obtained by contacting the Director of
Patent & Licensing Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California, 94404.
AccepTor™ Vectors are covered under U.S. Patent 5,856,144 issued to EMD Chemicals Inc.
for a vector, method, and kit for direct cloning of PCR products. Pellet Paint® Co-Precipitant is covered under U.S. Patent 7,144,713 and European Patent
0,853,680 issued to EMD Chemicals Inc. for a method for precipitating nucleic acid with
D-Tube™ Dialyzers are covered under U.S. Patent 7,074,313, European Patent 1,285,257, a visible carrier.
Australian Patent 2001,262,612, Canadian Patent 2,410,322, Indian Patent 201,731, and
Israeli Patent 152,986 assigned to Gene Bio-Application Ltd. pETBlue™ Perfectly Blunt® Cloning Kits are licensed under U.S. Patent 5,693,489. For aca-
demic or non-profit laboratories, a nondistribution agreement accompanies the products.
KOD DNA Polymerase, KOD Hot Start DNA Polymerase, KOD XL DNA Polymerase, KOD Commercial laboratories must obtain a research-use license from Brookhaven Science
Xtreme™ Hot Start DNA Polymerase, KOD Hot Start Master Mix, One Step RT-PCR Master Associates prior to purchase of the products.
Novagen • PCR Tools
RESOURCE GUIDE.........................20
PCR Clean Up and
Nucleic Acid Preparation....................36 Clonables 2X Ligation Premix................................................ 49
SpinPrep™ PCR Clean-Up Kit . ............................................... 36 NovaBlue Competent Cell Formats ....................................... 50
SpinPrep Gel DNA Kit ............................................................ 37 NovaBlue GigaSingles™ Competent Cells ............................ 50
Pellet Paint® Co-Precipitant ................................................... 38 NovaBlue Singles™ Competent Cells . ................................... 51
Pellet Paint NF Co-Precipitant ............................................... 39 NovaBlue T1R Singles Competent Cells ................................ 51
Veggie™ NovaBlue Singles Competent Cells ........................ 52
Molecular Size Markers.......................40 Zappers™ Electrocompetent Cells .......................................... 52
Perfect DNA™ Markers ............................................................ 40 HT96™ NovaBlue Competent Cells ........................................ 53
Perfect DNA Ladders ............................................................... 41 HT96 Isothermal Block ........................................................... 53
PCR Markers . ........................................................................... 41
Molecular Biology Essentials.............54
PCR Cloning............................................42 Molecular Biology Reagents.................................................... 54
Cloning Kits Overview............................................................. 42 Molecular Biology Grade Buffers........................................... 55
AccepTor™ Vector Kits.............................................................. 44 Molecular Biology Enzymes.................................................... 56
Perfectly Blunt® Cloning Kits ................................................ 46 D-Tube™ Dialyzers.................................................................... 58
Clonables™ Ligation/Transformation Kit............................... 49 D-Tube Electroelution Accessory Kit...................................... 59
Resource Guide
Look for these 20 FAQ
icons on the 22 Protocol Comparison

23 Comparing the Speed and Product Yield of 7 High
product pages: Fidelity DNA Polymerases
E
NS ED 27 Reliable and Efficient PCR from Whole Blood and
Indicates that the enzyme Crude Tissue Lysates Using the KOD Xtreme™ Hot
FO
L IC
is licensed for PCR. Start DNA Polymerase System

P C R
30 Reliable and Robust Real-time Amplification Using

dN
TPs
NovaTaq™ Hot Start Master Mix
Indicates that dNTPs
are included. 32 One Step Real-Time Amplification of mRNA Using
IN
C L
D
UDE
the One Step RT-PCR Master Mix Kit
ON THE
35 Detection of Shiga toxin-producing E. coli using
Find more information
multiplex colony-direct PCR with KOD XL DNA
WE
on our website.
B
www.novagen.com
Polymerase
customer.service@merckbio.com 3
technical.service@merckbio.com
Visit our website www.merckbio.com
PCR • Thermostable DNA Polymerases
Overview and Enzyme Selection Guide

Thermostable DNA Polymerases
A complete selection of enzymes and kits for PCR
In the 25 years following the invention of PCR by Dr. Kary KOD Xtreme polymerase provides high accuracy, specificity,
Mullis, PCR has evolved to become an integral laboratory and robust yield.
tool. High quality thermostable polymerases are critical for
consistent performance. We offer a complete selection of Not all applications require high-fidelity, high-performance
high-quality Novagen enzymes and kits for a variety of PCR enzymes, but quality is still important. NovaTaq™ DNA
applications. Polymerase is a high-purity, recombinant enzyme suitable
for any application requiring premium quality Taq DNA
Because low error rate is crucial, we feature ultra high- Polymerase. For increased specificity and convenience with
fidelity KOD DNA Polymerase. This unique proofreading standard PCR, we offer NovaTaq Hot Start DNA Polymerase
enzyme, isolated from the extreme thermophile Thermococcus and the Taq Antibody. NovaTaq Hot Start DNA Polymerase
kodakaraensis KOD1, possesses superior processivity and is a chemically modified form of the enzyme that activates
fidelity. This enables faster, more accurate PCR amplification when heated at 95°C for 10 minutes. The proprietary chemical
than can be achieved with conventional enzymes, including modification utilized for NovaTaq Hot Start results in improved
Pfu DNA Polymerase (Tagaki, 1997). KOD DNA Polymerase is low-copy target amplification, higher specificity, and higher
also available in a hot start version for high specificity and yield. Taq Antibody is available as an alternative means of
increased read length (Mizuguchi, 1999). KOD Hot Start DNA providing hot start capability to NovaTaq DNA Polymerase as
Polymerase has been acknowledged in many peer-reviewed well as any other Taq DNA polymerase. Please refer to the
publications as the ultra high-fidelity enzyme of choice. KOD table on the following page as a guide to select the appropriate
XL DNA Polymerase, a blend of KOD DNA Polymerase and a enzyme for your application.
mutant form of KOD that is deficient in 3´→5´ exonuclease
activity (Nishioka, 2002), is designed for reliable amplification Our commitment to moving your research forward includes
of crude samples, multiplex PCR, and incorporation of providing products that respect intellectual property law. All
derivatized dNTPs. New to the KOD family is KOD Xtreme™ Novagen polymerases are licensed for PCR for research use.
Hot Start DNA Polymerase, a high-fidelity “enzyme of last
resort” for the most challenging targets. KOD Xtreme Hot References:
Takagi, M., et al. 1997 Appl. Environ. Microbiol. 63,4504.
Start DNA Polymerase is optimized for the amplification of Mizuguchi, H., et al. 1999. J. Biochem. (Tokyo) 126, 762.
Nishioka., et al. 2001 J. Biotechnol. 88, 141.
the most difficult targets, including GC-rich and long targets.
Enzyme KOD DNA Polymerase Pfu DNA Polymerase Taq DNA Polymerase
Thermus aquaticus
Species Thermococcus kodakaraensis Pyrococcus furiosus
YT-1
Fidelity†
0.0035 0.0039 0.013
(mutation frequency)
Elongation rate
106-138 25 61
(bases/second)
Processivity
>300 <20 not determined
(nucleotide bases)
† Fidelity was measured by the authors as mutation frequency in PCR products using a sensitive blue/white phenotypic assay with a
5.2-kb lacZ plasmid as template (Takagi 1997).
4 For more information or to place an order, Novagen • PCR Tools

contact your local office (see back cover).
PCR Enzyme Selection Guide

A complete selection of enzymes and kits for PCR
Elongation Rate enzymes offer the highest accuracy of commercially available

Polymerase elongation rate affects not only the total experiment proofreading DNA polymerases.
time but also product yield and success rate. Generally, a faster
enzyme can generate higher yield of full-length products in fewer Difficult Targets
amplification cycles. While many targets can be amplified with little optimization,
certain target sequences (such as GC-rich sequences or long,
Specificity complex targets) remain challenging. These targets may
Inactivating the polymerase at room temperature and restoring require a high-performance enzyme optimized for difficult
activity after initial denaturation can increase amplification amplifications.
specificity. The two most common strategies used to create
heat-activatable forms of DNA polymerase are chemical PCR Cloning
modification (NovaTaq™ Hot Start DNA Polymerase) or We offer PCR cloning kits for amplicons that have 3´-dA
antibody-mediated methods (KOD Hot Start DNA Polymerase, ends (AccepTor™ Vector Kits) and amplicons with blunt ends
KOD Xtreme™ Hot Start DNA Polymerase, and NovaTaq DNA (Perfectly Blunt® Kits). Please refer to the PCR Cloning section
Polymerase plus Taq Antibody). of this brochure (page 40) for more information.
Fidelity Our PCR

Enzymes are
Fidelity is critical when the amplification product will be used
for applications such as direct sequencing or cloning. KOD
Priced Competitively for
your Diverse Research needs
PCR Enzyme Selection Guide

PCR Elongation PCR Success With
Product Rate GC-rich Product Difficult Available as
Enzyme Size (kb) (bases/s) Specificity Fidelity Templates Yield Ends Targets Applications Master Mix Page
KOD DNA Cloning, cDNA
Polymerase
<6 120     blunt  amplification
12
KOD Hot Start DNA Cloning, cDNA

Polymerase
<21 120     blunt  amplification
Y 6
Crude samples,
KOD XL DNA Mixed (blunt multiplex,
Polymerase
<30 120     and 3’-dA)
 incorporation of
11
derivatized dNTPs
KOD Xtreme™ Crude samples,
Hot Start DNA <40 120     blunt  Long targets, difficult 9
Polymerase and GC-rich targets
NovaTaq™ DNA
Polymerase
<5 kb 60     3’-dA  Routine PCR Y 14
NovaTaq Hot Start

DNA <5 kb 60     3’-dA  Hot start routine PCR Y 13
Polymerase
NovaTaq DNA
Polymerase plus <5 kb 60     3’-dA  Hot start routine PCR 14
Taq Antibody
 Satisfactory  Good  Excellent  Best
Novagen • PCR Tools customer.service@merckbio.com 5

NS ED dN
TPs ON THE
E
WE
FO
L IC
B
Page
R
KOD Hot Start DNA Polymerase 20 www.novagen.com
IN
C L
D
P C R UDE /KOD
Heat-activatable form of KOD DNA Polymerase for increased specificity and convenient PCR setup
Features KOD Hot Start DNA Polymerase* is a premixed complex of

• More accurate PCR in a shorter time high-fidelity KOD DNA Polymerase and two monoclonal
• Highest accuracy, yield, and processivity of commercially antibodies that inhibit the DNA polymerase and 3’→5’
available proofreading DNA polymerases
exonuclease activities at ambient temperatures (Mizuguchi
• Amplifies genomic DNA templates up to 12 kb
1999). KOD Hot Start combines the high fidelity, fast
• Amplifies plasmid and lambda DNA templates up to 21 kb
• Eliminates mispriming and primer-dimer formation
extension speed, and outstanding processivity of KOD with
• Convenient ambient-temperature setup compatible with the high specificity of an antibody-mediated hot start. Non-
automation specific amplification is reduced because mispriming events
• Optimal KOD Hot Start Buffer for robust PCR performance during setup and initial temperature increase are avoided.
with a wide range of targets
In addition, primer degradation due to exonuclease activity
Product Size Cat. No. Price during setup at ambient temperature is effectively inhibited.
KOD Hot Start DNA 20 U 71086-5 KOD Hot Start DNA Polymerase generates blunt-ended DNA
Polymerase 200 U 71086-3
o 1000 U 71086-4 products suitable for cloning with the Novagen® Perfectly
Blunt® and LIC Vector Kits. The enzyme is compatible with
Components
200 U or 5 × 200 U KOD Hot Start DNA Polymerase (1.0 U/ml) site-directed mutagenesis protocols.
1.2 ml or 5 × 1.2 ml 10X PCR Buffer for KOD Hot Start Unit definition: One unit is defined as the amount of
DNA Polymerase
1 ml or 5 × 1 ml 25 mM MgSO4 enzyme that will catalyze the incorporation of 10 nmol dNTP
1 ml or 5 × 1 ml dNTP Mix (2 mM each) into acid-insoluble form in 30 min at 75°C, in a reaction
Additional Information Available containing 20 mM Tris-HCl (pH 7.5 at 25°C), 8 mM MgCl2,
KOD Hot Start DNA Polymerase User Protocol TB341
inNovations Nos. 17, 21, 25
7.5 mM DTT, 50 mg/ml BSA,150 µM each of dATP, dCTP,
dGTP, dTTP (a mix of unlabeled and [3H]dTTP), and 150 µg/
ml activated calf thymus DNA.
Source Recombinant Thermococcus kodakara-
ensis KOD1 DNA polymerase expressed References:
Mizuguchi, H., et al. 1999. J. Biochem. (Tokyo) 126, 762.
in E. coli
Kitabayashi, M., et al. 2002. Biosci. Biotechnol. Biochem. 66, 2194.
Concentration 1.0 U/ml Fujii, S., et al. 1999. J. Mol. Biol. 289, 835.
Nicking activity None detected
Amplification efficiency Functional PCR; inhibition of activity at
21˚C verified
* Manufactured by and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan.


KOD Hot Start DNA Polymerase
Continued
Number of
Colonies Percentage of Mutants
DNA
Polymerase Total Mutant Mutation Frequency (%)
KOD Hot Start 51200 51 KOD Hot Start 0.10
PfuUltra 49900 53 PfuUltra 0.11
PfuTurbo 65900 164 PfuTurbo 0.25
Taq 7000 354
Taq 5.1
Mutation Frequency: (Number of mutant 0.0 1.0 2.0 3.0 4.0 5.0 6.0
colonies/Number of total colonies) × 100% Mutation frequency
Mutation frequency comparison: KOD Hot Start, PfuTurbo®, PfuUltra®, and Taq
The fidelity of replication was measured as the mutation frequency in PCR products using a modified rpsL+ fidelity
assay (Kitabayashi 2002, Fujii 1999).
Cycle Profile A Cycle Profile B Cycle Profile C Cycle Profile D

Initial denaturation 98°C 30 s 94°C 2 min 95°C 2 min 95°C 2 min
98°C 10 s 94°C 15 s 95°C 20 s 95°C 20 s
29 cycles 55°C 20 s 52°C 20 s 55°C 20 s 55°C 10 s
72°C 30 s 68°C 60 s 72°C 30 s 70°C 15 s
Final extension 72°C 5 min 68°C 5 min 72°C 3 min N/A
23 cycles 25 cycles
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
KOD yields more product in fewer cycles compared to
Lane Sample other PCR enzymes
M PCR Markers
1 KOD Hot Start DNA Pol. A 919-bp fragment of human glycogen synthase kinase 3α (GSK
2 KOD DNA Pol.
3 Platinum® Pfx DNA Pol.
3α) was amplified by one of 7 enzymes in 4 different cycling
4 Pfx50™ DNA Pol. protocols (only Cycle Profile A is shown here), which encompass the
5 Phusion™ Hot Start DNA Pol.
6 PfuUltra® II Fusion HS DNA Pol. manufacturers’ recommended cycling conditions. PCR samples (5
7 PrimeSTAR® HS DNA Pol. μl) were taken after 23, 25, 27, and 29 cycles and analyzed on 1.4%
agarose/TAE gels. Lanes indicate the enzyme used for the reaction.
Cycling profiles are defined in the table above. (Note: PicoGreen®
assay results indicate a yield increase with PrimeSTAR® HS DNA
Polymerase from cycle 27 to cycle 29; the reduced band intensity is
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
a gel artifact.)
27 cycles 29 cycles For the full article please see the Technical Note on page 23.
(plus final extension)
Product Size (kb)

M 1 2 4 6 8 10 12 15 21 M M 8.4 12.3 kb
Lambda DNA amplification Genomic DNA amplification
The indicated size fragments of lambda DNA were The human myosin heavy chain gene
amplified using appropriate primers and KOD Hot Start (8.4 kb) and human β-globin gene
DNA Polymerase. M: markers. (12.3 kb) were amplified using KOD
Hot Start DNA Polymerase. M: markers.

TPs
NS ED dN
E ON THE
FO
L IC
WE
KOD Hot Start Master Mix

Page
B
20
IN
C L
D
P C R UDE www.novagen.com
/KOD
Premixed 2X KOD Hot Start PCR components for convenience and reproducibility
Features KOD Hot Start Master Mix* is a ready-to-use 2X mixture

• More accurate PCR in a shorter time optimized for convenient high-fidelity PCR. The mix contains
• Highest accuracy, yield, and processivity of commercially KOD Hot Start DNA Polymerase, two monoclonal antibodies,
available proofreading DNA polymerases ultrapure deoxynucleotides, and reaction buffer with MgSO4.
• Amplifies genomic DNA templates up to 12 kb
The Master Mix simplifies PCR set-up, offering time savings,
• Amplifies plasmid and lambda DNA templates up to 21 kb
consistency, and minimal risk of contamination. The mix is
• Eliminates mispriming and primer-dimer formation
• Convenient ambient-temperature setup compatible with ideal for use in high-throughput applications. This master
automation mix quickly and accurately amplifies genomic and phage/
• Optimal KOD Hot Start Buffer for robust PCR performance plasmid DNA targets to 12 kb and 21 kb respectively. Simply
with a wide range of targets
add KOD Hot Start Master Mix to an equal volume of sample
Product Size Cat. No. Price containing DNA template and primers. The final diluted
KOD Hot Start 100 rxn 71842-3 reaction contains 1 U KOD Hot Start DNA Polymerase per
Master Mix 500 rxn 71842-4
50 µl reaction. The smaller size is sufficient for 100 x 50 µl
Components reactions or 250 x 20 µl reactions. The larger size is adequate
2 × 1.25 ml or 10 × 1.25 ml KOD Hot Start Master Mix
for 500 x 50 µl reactions or 1250 x 20 µl reactions.
Additional Information Available
KOD Hot Start Master Mix User Protocol TB506
1 2 3 4 5 6 7 8 9 10
Lane Template – Target - Size
1 PCR Markers
2  DNA – att region - 595 bp
3  DNA – att region - 595 bp
4 PCR Markers
5 cDNA plasmid – GSK 3 CD ORF – 919 bp
6 cDNA plasmid – GSK 3 CD ORF – 919 bp
7 PCR Markers
8 Uncut BacVector® 3000 DNA – Chitinase deletion region – 1.9 kb
9 Uncut BacVector 3000 DNA – Chitinase deletion region – 1.9 kb
10 Perfect DNA™ Markers, 0.5-12 kb
PCR products amplified using KOD Hot Start Master Mix

The indicated DNA fragments were amplified using KOD Hot Start Master Mix in separate 50-µl or 20-µl reactions using
cycling conditions indicated in the user protocol. Samples (5 µl) were analyzed by agarose gel electrophoresis (1.0% TAE) and
stained with ethidium bromide.

E G
E
NS ED dN
TPs
ON THE
R E S O UR C
UI
WE
FO
DE
L IC

TPs
dN
B
KOD Xtreme™ Hot Start DNA Polymerase
R
Page
20 www.novagen.com
IN
C L
D
P C R UDE /KOD
KOD system optimized for difficult targets
Features: The KOD Xtreme™ Hot Start DNA Polymerase* kit is an

• Optimized for the highest PCR success rate, even with the optimized PCR system for the amplification of long or GC-rich
most difficult targets DNA templates. The system includes an ultra high fidelity KOD
• Efficiently amplifies up to 90% GC-content templates DNA polymerase complexed with two monoclonal antibodies to
• 10X higher fidelity than Taq blends permit hot start thermocycling, along with specially formulated
• Amplifies genomic targets up to 24 kb 2X buffer. KOD Xtreme Hot Start DNA Polymerase quickly and
• Amplifies phage/plasmid targets up to 40 kb accurately amplifies genomic and phage/plasmid DNA targets
• Efficiently amplifies DNA from crude samples up to 24 and 40 kb, respectively. It successfully amplifies
• Eliminates mispriming and primer-dimer formation challenging DNA templates with up to 90% GC content.
• Convenient ambient-temperature setup compatible with
automation
Each kit provides 200 U KOD Xtreme Hot Start DNA Polymerase,
Product Size Cat. No. Price an optimized buffer, and dNTPs sufficient for 200 amplification
KOD Xtreme™ 200 U 71975-3 reactions. The polymerase produces blunt-ended DNA products
Hot Start DNA
Polymerase suitable for cloning with the Novagen® Perfectly Blunt® and
LIC Vector Kits.
Components
1 × 200 U KOD Xtreme Hot Start DNA Polymerase
3 × 1.7 ml 2X Xtreme Buffer
2 × 1 ml dNTPs (2 mM each)

KOD Xtreme Hot Start DNA Polymerase User Protocol TB507
inNovations No. 28
Number of Bases Percentage of Mutants

DNA Polymerase Sequenced Mutated Mutation Frequency (%)
KOD Hot Start 145,753 5
KOD Xtreme 144,535 19 3.4 - KOD Hot Start
LA Taq ‡
167,343 218 13.1 - KOD Xtreme™ Hot Start DNA Polymerase
Taq 102,708 145
130.3 - LA Taq polymerase
‡ LA Taq is representative of polymerases mixes which
are a blend of Taq DNA polymerase and a proofreading
enzyme, such as AccuTaq™ LA DNA Polymerase, Advan- 141.2 - Taq polymerase
tage polymerases, Expand PCR systems, and TaKaRa LA
Taq™ polymerase
0 30 60 90 120 150
Mutation Frequency (× 10-5)
See Page 10 for additional data.

KOD Xtreme™ Hot Start DNA Polymerase

Continued
M1 1 2 3 4 5 6 M2
Lane Samples
GC-rich target Amplification
M1 1 kb DNA ladder
The human IGF2R gene[NM_000876] contains a 5’ 1 Product of KOD Xtreme™ Hot Start DNA Polymerase
region that is ~90% GC. The reactions contained 2 Product of Ex Taq™ polymerase
cDNA derived from 50 ng HeLa cell total RNA. PCR 3 Product of LA Taq™ polymerase
cycling parameters for KOD Xtreme were as follows: 4 Product of PrimeSTAR® polymerase with GC Buffer
initial denaturation at 94°C for 2 min; 30 cycles at 5 Product of LA Taq polymerase with GC Buffer 1
98°C for 10 s, 68°C for 9 min. For polymerases from 6 Product of LA Taq polymerase with GC Buffer 2
other manufacturers, optimal cycling parameters as M2 l/HindIII DNA Markers
recommended by each manufacturer were used.
M1 1 2 3 4 5 M2
Lane Samples
Genomic DNA Amplification
M1 1 kb DNA ladder
The indicated targets were amplified from 200 ng 1 1.3 kb b-globin target
human genomic DNA. PCR cycling parameters for 1.3 2 3.6 kb b-globin target
to 8.5 kb targets: initial denaturation at 94°C for 2 3 8.5 kb b-globin target
min; 30 cycles at 98°C for 10 s, 68°C for 1 min/kb. PCR 4 17.5 kb b-globin target
cycling parameters for 17.5 and 25 kb targets: initial 5 24 kb tissue plasminogen activator target
denaturation at 94°C for 2 min; 5 cycles at 98°C for M2 l /HindIII DNA Markers
10 s, 74°C for
1 min/kb; 5 cycles at 98°C for 10 s, 72°C for 1 min/kb;
5 cycles at 98°C for 10 s, 70°C for 1 min/kb; 20 cycles
at 98°C for 10 s, 68°C for 1 min/kb.
11 22 3
3 4
4 5
5 M
M 66 77
Performance of KOD Xtreme Hot Start DNA L ane(s) Samples
Polymerase versus competitors' polymerases M 1 kb ladder
1 Product of PfuTurbo® DNA Polymerase
in amplification of genomic DNA �
2 Product of Advantage 2 polymerase
A 6273 bp region of the GAD67 target was amplified 3 Product of LA Taq Polymerase
from 100 ng chick kidney genomic DNA. PCR cycling 4 Product of Expand Long Template system
parameters for KOD Xtreme were as follows: initial 5 Product of Herculase® polymerase
denaturation at 94°C for 2 min; 35 cycles at 98°C 6, 7 Products of KOD Xtreme
for 10 s, 68°C for 7 min. For polymerases from Hot Start DNA Polymerase
other manufacturers, optimal cycling parameters as
recommended by each manufacturer were used.
These data were provided by a member of the Faculty of Medicine, Kyoto
University.

NS ED dN
TPs ON THE
E
WE
FO
L IC

B
KOD XL DNA Polymerase
Page
R
20 www.novagen.com
IN
C L
D
P C R UDE /KOD
High performance enzyme blend for long and accurate PCR
Features KOD XL DNA Polymerase* is an optimized blend of KOD

• Ideal for amplification of large DNA fragments from DNA Polymerase and a mutant form of KOD that is deficient
purified DNA or crude samples in 3´→5´ exonuclease activity (Nishioka 2002). This enzyme
• Amplifies DNA templates up to 30 kb mixture is designed for reliable amplification of long, complex
• Successfully amplifies GC-rich sequences targets with robust yield and high accuracy. It can also be
• Efficiently incorporates derivatized dNTPs
used for incorporation of derivatized dNTPs in PCR amplicons
Product Size Cat. No. Price (Sawai 2002, Sawai 2001). KOD XL DNA Polymerase generates
KOD XL DNA 250 U 71087-3 a mixture of PCR products with blunt and 3´-dA overhangs,
Polymerase 1250 U 71087-4
suitable for cloning with the Novagen® Perfectly Blunt®,
TP
Components
AccepTor™, and LIC Vector d NKits. s
250 U or 5 × 250 U KOD XL DNA Polymerase (2.5 U/ml)
1.2 ml or 5 × 1.2 ml 10X PCR Buffer for KOD XL DNA Polymerase Unit definition: One unit is defined as the amount of enzyme
1 ml or 5 × 1 ml dNTP Mix (2 mM each) that will catalyze the incorporation of 10 nmol of dNTP into
Additional Information Available acid-insoluble form in 30 min at 75˚C, in a reaction containing
KOD XL DNA Polymerase User Protocol TB342 20 mM Tris-HCl (pH 7.5 at 25˚C), 8 mM MgCl2, 7.5 mM DTT,
inNovations No. 17
50 mg/ml BSA, 150 µM each of dATP, dCTP, dGTP, dTTP
(a mix of unlabeled and [3H]dTTP), and 150 µg/ml activated
Source Recombinant Thermococcus koda- calf thymus DNA.
karaensis KOD1 DNA polymerase
expressed in E. coli (wild type and References:
exonuclease-deficient forms)
Nishioka, M., et al. 2002. J. Biotechnol. 88, 141.
Concentration 2.5 U/ml
Sawai, H., et al. 2002. Bioconjugate Chem. 13, 309.
Endonuclease None detected
Sawai, H., et al. 2001. Chem. Commun. 24, 2604.
Nicking activity None detected
Amplification efficiency Functional PCR
Taq KOD XL
1 2 3 4 5 6 7 8 M 1 2 3 4 5 6 7 8
Lane Sample
1 1-kb PCR fragment
2 2-kb PCR fragment
3 4-kb PCR fragment
4 6-kb PCR fragment
5 8-kb PCR fragment
6 10-kb PCR fragment
Performance comparison
The indicated λ DNA fragments were amplified using 2.5 U Taq DNA Polymerase
or 2.5 U KOD XL DNA Polymerase in a 50-µl reaction. M: markers.

NS ED dN
TPs ON THE
E
WE
FO
L IC
B
Page
R
KOD DNA Polymerase 20 www.novagen.com
IN
C L
D
P C R UDE /KOD
Pure recombinant high fidelity DNA polymerase from Thermococcus kodakaraensis KOD1
Features KOD DNA Polymerase* is a recombinant form of Thermococcus

• More accurate PCR in a shorter time kodakaraensis KOD1 DNA polymerase (Nishioka 2001). KOD is
• Higher fidelity than Pfu DNA polymerase—excellent for a high-fidelity thermostable polymerase that amplifies target
cloning DNA up to 6 kb with superior accuracy and yield (Takagi 1997).
• Greater yield—extension speed is 2X faster than Taq DNA
The 3´→5´ exonuclease-dependent proofreading activity of
polymerase and 5X faster than Pfu DNA polymerase
• Higher processivity—sequential nucleotide polymerization the enzyme results in a lower mutation frequency than any
is 10- to 15-fold greater than Pfu and Tli DNA other commercially available DNA polymerase. The elongation
polymerases rate and processivity are 5 times and 10 to 15 times higher,
• Does not result in truncated amplification products
respectively, than for Pfu DNA polymerase, resulting in highly
Product Size Cat. No. Price accurate products and robust yield in a short reaction time.
KOD DNA Polymerase 250 U 71085-3 The enzyme generates blunt-ended PCR products suitable for
cloning with the Novagen® Perfectly Blunt® and LIC Vector
Components Kits.
250 U KOD DNA Polymerase (2.5 U/ml)
Unit definition: One unit is defined
T P s as the amount of enzyme
1 ml 10X Buffer #1 for KOD DNA Polymerase (pH 8.0) dN
1 ml 10X Buffer #2 for KOD DNA Polymerase (pH 8.8) that will catalyze the incorporation of 10 nmol of dNTP into
1 ml 25 mM MgCl2
acid-insoluble form in 30 min at 75˚C, in a reaction containing
1 ml dNTP Mix (2 mM each)
20 mM Tris-HCl (pH 7.5 at 25˚C), 8 mM MgCl2, 7.5 mM DTT,
Additional Information Available 50 mg/ml BSA, 150 µM each of dATP, dCTP, dGTP, dTTP
KOD DNA Polymerase User Protocol TB320
inNovations No. 25 (a mix of unlabeled and [3H]dTTP) and150 µg/ml activated
calf thymus DNA.
References:
Source Recombinant Thermococcus koda-
karaensis KOD1 Nishioka, M., et al. 2001. J. Biotechnol. 88, 141.
Takagi, M., et al. 1997. Appl. Environ. Microbiol. 63, 4504.
DNA polymerase expressed in E. coli
Concentration 2.5 U/ml
Purity > 90% homogeneous by SDS-PAGE
5' Exonuclease Less than 2% per unit of enzyme M 1 2 3
when incubated 1 h at 74˚C
in a reaction with 5'-labeled l/ScaI bp Lane Sample
digest M Perfect DNA™ Markers, 0.5–12 kbp
12,000 –
10,000 – 1 5.4-kb PCR product (lambda DNA)
Nicking activity None detected 8000 – 2 2.0-kb PCR product (plasmid DNA)
Amplification efficiency Functional PCR 6000 – 3 1.6-kb PCR product (human genomic DNA)
4000 –
3000 –
2000 –
1500 – PCR products amplified using KOD
DNA Polymerase
1000 – DNA fragments from various templates were
amplified using 2.5 U KOD DNA Polymerase
in a 100-µl reaction. Samples were analyzed
500 – by agarose gel electrophoresis (1.2% TAE).

NS ED
E
FO
L IC

NovaTaq™ Hot Start DNA Polymerase
Page
R
20
P C R
Heat-activatable, chemically modified form of recombinant Taq DNA polymerase
Features NovaTaq™ Hot Start DNA Polymerase is a chemically modified

• Higher PCR specificity and yield form of Taq DNA polymerase that is inactive at ambient
• Improved low-copy target amplification temperature. The enzyme provides improved specificity when
• Ambient temperature setup compatible with automation compared to standard Taq DNA polymerase and can minimize
• Target amplification of up to 5 kb the generation of nonspecific amplification products, such
• Ideal for quantitative and high-throughput PCR
as primer-dimers and misprimed products. The enzyme must
applications
be activated by heat treatment (10 min at 95˚C), after which
Product Size Cat. No. Price thermal cycling can proceed. The enzyme generates PCR
NovaTaq™ Hot Start DNA 250 U 71091-3
Polymerase 1,250 U 71091-4 products with 3´-dA overhangs, suitable for cloning with the
Novagen® Perfectly Blunt®, AccepTor™, and LIC Vector Kits.
Components
250 U or 5 × 250 U NovaTaq Hot Start DNA Polymerase Unit definition: one unit is defined as the amount of enzyme
1.5 ml or 5 × 1.5 ml 10X NovaTaq Hot Start Buffer that will catalyze the incorporation of 10 nmol of dNTP into
1.5 ml or 5 × 1.5 ml 25 mM MgCl2
acid-insoluble form in 30 min at 72˚C, in a reaction containing
Additional Information Available 25 mM TAPS (tris-[hydroxymethyl]-methyl-amino-propane-
NovaTaq Hot Start DNA Polymerase TB460
and Kits User Protocol sulfonic acid, sodium salt), pH 9.3 at 25˚C, 50 mM KCl, 2 mM
MgCl2, 1 mM 2-mercaptoethanol, 0.2 mM dATP, dGTP, and
Source Recombinant Thermus aquaticus DNA poly- dTTP, 0.1 µM [α-32P]dCTP, and 12.5 µg activated salmon sperm
merase expressed in E. coli DNA in a volume of 50 µl.
Concentration 5 U/ml bp M 1 2
Lane Sample
Exonuclease None detected M Markers
1 2-kb fragment amplified using NovaTaq Hot Start
Amplification Functional PCR DNA Polymerase
efficiency 2500 – 2 2-kb fragment amplifed using Company A
2000 – chemically modified Taq DNA polymerase
1500 –
1000 –
800 –
600 – Hot Start PCR products
400 – The indicated fragments were amplified
200 – under standard conditions for each enzyme
and analyzed by agarose gel electrophoresis
(1.2% TAE).
dN
TPs NS ED
E
FO
L IC
NovaTaq™ Hot Start Master Mix Kit

Page
R
20
IN
C L
D
UDE
P C R
Premixed 2X “hot start” PCR components for convenience and reproducibility
Product Size Cat. No. Price NovaTaq Hot Start Master Mix provides a ready-to-use 2X
NovaTaq™ Hot Start Master 200 rxn 71676-3 mixture of NovaTaq Hot Start DNA Polymerase, ultrapure
Mix Kit 1000 rxn 71676-4
deoxynucleotides, and reaction buffer with MgCl2. The Master
Components Mix simplifies the set-up for PCR resulting in time savings,
4 × 1.25 ml or 20 × 1.25 ml NovaTaq Hot Start Master Mix
1 × 1.5 ml or 3 × 1.5 ml 25 mM MgCl2
consistency, and minimal risk of contamination. In addition to
3 × 2 ml or 11 × 2 ml PCR Grade Water the Master Mix, the kit includes PCR Grade Water and MgCl2 for
Additional Information Available optimizing Mg2+ concentration. Simply add the NovaTaq Hot
NovaTaq Hot Start DNA Polymerase and Kits User Protocol TB460 Start Master Mix to an equal volume containing DNA template,
primers, and, if desired, additional MgCl2. The final diluted
reaction contains 1.25 U of NovaTaq Hot Start DNA Polymerase
SE per 50 µl. The two NovaTaq Hot Start Master Mix Kit sizes
provide sufficient components for 200 or 1000 standard 50-µl
amplification reactions.

NS ED
E
FO
L IC
NovaTaq™ DNA Polymerase

Page
R
20
P C R
Ultrapure recombinant enzyme for dependable PCR amplification
Product Size Cat. No. Price NovaTaq™ DNA Polymerase is a premium quality
NovaTaq™ DNA Polymerase 100 U 71003-3 recombinant form of Thermus aquaticus DNA polymerase.
500 U 71003-4
2500 U 71003-5 This thermostable enzyme is suitable for a wide range
Components
of PCR applications. To ensure the highest purity and
100 U, 500 U, or 5 × 500 U NovaTaq DNA Polymerase reproducible perfomance, each preparation is extensively
1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 ml 10X NovaTaq Buffer with MgCl2
tested in a variety of quality control assays. NovaTaq DNA
1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 m 10X NovaTaq Buffer without MgCl2
1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 ml 25 mM MgCl2 Polymerase has 5´→3’ exonuclease activity and lacks
3’→5’ exonuclease activity. The enzyme generates PCR products
NovaTaq DNA Polymerase and Kits User Protocol TB309 with 3’-dA overhangs, suitable for cloning with the Novagen®
Perfectly Blunt®, AccepTor™, and LIC Vector Kits. Each kit also
Source Recombinant Thermus aquaticus DNA includes optimized 10X NovaTaq Buffer with 15 mM MgCl2
polymerase expressed in E. coli for routine amplification conditions, plus separate vials of 10X
Concentration 5 U/ml
NovaTaq Buffer without MgCl2 and 25 mM MgCl2 to enable
Purity >95% homogenous by SDS-PAGE
convenient optimization of Mg2+ concentration.
Unit definition: one unit is defined as the amount of enzyme
RNase None detected
Amplification efficiency Functional PCR that will catalyze the incorporation of 10 nmol dNTP into acid-
insoluble form in 30 min at 74˚C, in a reaction containing
25 mM TAPS (tris-[hydroxymethyl]-methyl-amino-propane-
sulfonic acid, sodium salt), pH 9.3 at 25˚C, 50 mM KCl, 2 mM
bp M 1 2 3 4 5 M
MgCl2, 1 mM 2-mercaptoethanol, 0.2 mM dATP, dGTP, and
12,000 – dTTP, 0.1 µM [α-32P]dCTP, and activated salmon sperm DNA.
8000 –
6000 –
4000 –
3000 –
2000 –
1500 –
Lane Sample
M Perfect DNA™ Markers, 0.5–12 kb PCR products amplified using
1000 – NovaTaq DNA Polymerase
1 0.5-kb PCR product
2 1.0-kb PCR product DNA fragments 0.5 to 7.35 kb in size were
3 2.0-kb PCR product amplified using 2.5 U NovaTaq DNA Polymerase in
500 –
4 4.8-kb PCR product separate 100-ml reactions. Products were analyzed
5 7.35-kb PCR product by agarose gel electrophoresis (1.2% TAE).
dN
TPs NS ED
E
FO
L IC
NovaTaq™ PCR Master Mix

Page R
20
IN
C L P C R
D
UDE
Premixed 2X PCR reaction components for convenience and reproducibility
Product Size Cat. No. Price The NovaTaq PCR Master Mix is a ready-to-use 2X mixture
NovaTaq™ PCR 200 rxn 71007-3 of NovaTaq DNA Polymerase, ultrapure deoxynucleotides,
Master Mix
and reaction buffer without MgCl2. The Master Mix simplifies
the assembly of PCRs and offers advantages of time savings,
Components
4 × 1.25 ml 2X NovaTaq PCR Master Mix consistency, and minimal risk of contamination. Simply add
1.5 ml 25 mM MgCl2 Solution the NovaTaq PCR Master Mix to an equal volume containing
3 × 2 ml PCR Grade Water
the required amount of MgCl2, DNA template, and primers,
Additional Information Available and the reaction is ready for thermal cycling. The final diluted
NovaTaq DNA Polymerase and Kits Protocol TB309
reaction contains 2.5 U of NovaTaq DNA Polymerase per 100
ml. Sufficient components are included for 200 standard 50-ml
(or 100 × 100-ml) amplification reactions.


Taq Antibody
Converts unmodified Taq DNA polymerase into a hot start enzyme
Features The Taq Antibody* is a mouse monoclonal antibody that inhibits

Taq DNA polymerase activity at ambient temperatures. When
• Higher PCR specificity and yield
• Improved low-copy target amplification mixed with Taq DNA Polymerase, it provides an antibody-
• Ambient temperature setup compatible mediated hot start that enhances the specificity, sensitivity,
with automation and convenience of PCR. Inhibition is effective during reaction
assembly at ambient temperature, and is completely reversed
Product Size Cat. No. Price
Taq Antibody 100 µl 71088-3 when thermal cycling begins, with no other effect on PCR
conditions. The antibody inhibits both native and recombinant
Components
100 ml Taq Antibody (1 mg/ml) Taq DNA polymerase activities, including NovaTaq™ DNA
1.3 ml 10X PCR Buffer Polymerase.
Taq Antibody User Protocol TB322
One microgram (1 ml) of antibody inhibits > 95% of 5 U of Taq
DNA polymerase at 40˚C. For convenience, simply mix 100 ml
Taq Antibody with 500 U (100 ml) NovaTaq DNA Polymerase,
incubate for 5 minutes at room temperature, and proceed with
PCR. The polymerase:antibody complex can be freshly prepared
for each experiment or stored at –20˚C for later use.
10 mM dNTP Mix
Qualified for enzymatic DNA synthesis
Product Size Cat. No. Price The 10 mM dNTP Mix is a ready-to-use preparation of
10mM dNTP Mix 0.2 ml 71004-3 ultrapure dATP, dCTP, dGTP, and dTTP (monosodium salts) at a
concentration of 10 mM each in sterile deionized water at pH
7.0. The dNTP Mix is free of RNase and DNase and is qualified
for any application that requires pure deoxynucleotides, such
as PCR, cDNA synthesis, and fill-in reactions.

PCR • Direct PCR from Blood
Direct PCR from Blood

BloodDirect™ PCR Buffer Kits
PCR amplification directly from human or mouse blood
Features BloodDirect™ PCR Buffer Kits are novel buffers that

• Enables direct PCR amplification from neutralize DNA polymerase inhibitors present in human or
anticoagulant-treated blood mouse blood. This eliminates all sample pretreatment steps
• Ideal for genotyping and genetic screening experiments, and allows direct PCR amplification from as little as 0.5 µl of
including routine transgenic mouse genotyping
blood treated with any commonly used anticoagulant.
• No DNA extraction required
• Compatible with fresh, stored, and dried blood samples
• Minimizes risk of sample cross-contamination Blood samples and other biological fluids contain a variety
• Requires as little as 0.5 ml human or mouse blood of Taq DNA polymerase inhibitors such as polysaccharides,
proteins, lipids and their conjugates, hemoglobin, and heparin.
BloodDirect™ PCR Buffer Kit, 50 rxn 71342-3
Sequestration of these substances from the DNA template is
Human 250 rxn 71342-4 necessary prior to PCR amplification. BloodDirect PCR buffers
BloodDirect™ PCR Buffer Kit, 50 rxn 71343-3
Mouse 250 rxn 71343-4
neutralize charge-bearing inhibitory substances that might
bind to DNA polymerase or template DNA. This ensures
Components
successful PCR amplification directly from blood.
Cat. No. 71342
200 ml or 1 ml 5X BloodDirect Buffer 1
200 ml or 1 ml 5X BloodDirect Buffer A, Human Each BloodDirect PCR Buffer Kit includes two components:
Cat. No. 71343 5X BloodDirect Buffer 1 and either 5X BloodDirect Buffer A
200 ml or 1 ml 5X BloodDirect Buffer 1
200 ml or 1 ml 5X BloodDirect Buffer B, Mouse
in the human kit or 5X BloodDirect Buffer B in the mouse
kit. These buffers are added to the PCR mixture in place of
10X PCR buffer. Anticoagulant-treated blood sample (1 µl
BloodDirect PCR Buffer Kit User Protocol TB404
inNovations No. 18 per 50-ml mixture, 0.5 ml per 20-ml mixture) is added as the
final component.
BloodDirect Kits can be used in genotyping and genetic

screening experiments with fresh blood samples, with samples
stored at –20°C for up to four years, and with archived dried
blood samples stored on filter paper or specimen collection
cards. BloodDirect PCR Buffer Kit for mouse blood is ideal for
routine transgenic mouse genotyping. The simple protocol
dramatically reduces the risk of cross-contamination and
sample mishandling.
BloodDirect Kits are compatible with commercially available

Taq DNA polymerases, except for chemically-modified hot start
DNA polymerases. To perform hot start PCR with BloodDirect
PCR Buffer Kits, use any antibody-mediated hot start DNA
polymerase, for example, NovaTaq™ DNA Polymerase plus Taq
Antibody.

PCR • Direct PCR from Blood

BloodDirect™ PCR Buffer Kits
Continued
β-globin protein S HLA DPB1 Typical PCR setup and cycling conditions
M 1 2 3 4 N M 1 2 3 4 N M 1 2 3 4 N M
Final Volume
Treatment 50 ml 20 ml
5X BloodDirect Buffer 1 10 ml 4 ml
← 408 bp 5X BloodDirect Buffer A 10 ml 4 ml
← 280 bp (or B)
← 213 bp
dNTP mixture (2.5 mM each) 4 ml 1 ml
5’-primer† 0.5 mM 0.125 mM
3’-primer† 0.5 mM 0.125 mM
Comparison of direct PCR using fresh, dried, and purified DNA samples from human blood Taq DNA polymerase (5 U/ml) 0.25 ml 0.1 ml
PCR amplifications (50 µl) were performed with BloodDirect buffers and NovaTaq™ DNA Polymerase using the PCR-grade water to 50 ml to 20 ml
cycling conditions listed in the table (PCR setup and cycling conditions) with annealing at 55°C. Target
sequences included β-globin, protein S, and HLA DPB1. PCR samples(5 µl) of the total reaction volume was analyzed Anticoagulant-treated blood 1 ml 0.5 ml
by agarose gel electrophoresis (2.5% TAE) and ethidium bromide staining. Lane 1: 1 µl EDTA-treated human blood;
Lane 2: blood dried in PCR tube; Lane 3: blood absorbed on filter paper (4-mm diameter); Lane 4: purified DNA Cycling Conditions
equivalent to 1 µl blood; Lane N: negative control; Lane M: markers.
94˚C, 4.5 min*
94˚C, 30 s
Annealing temperature, 40 cycles
A. Heparinized blood samples 1 min
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 M 72˚C, 1 min
72˚C, 7 min
* Preheating at 80˚ C for 15 min is recommended when fresh
blood (collected on the same day as PCR amplification) is used.
†
Final concentration
← 521 bp
B. Purified DNA samples

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 M
← 521 bp
Screening for transgenic mice by BloodDirect PCR analysis

PCR analysis to detect the lck promoter-human D4-GD1 transgene was performed using BloodDirect buffers and
NovaTaq DNA Polymerase. For heparinized blood samples, the cycling conditions listed in the table above
(Typical PCR setup and cycling conditions) were used with annealing at 55˚C; for purified DNA samples, the
conditions were modified (30 cycles and a 30-s annealing at 55˚C). Panel A shows the results from 1-ml samples
of heparinized blood; Panel B shows the results from 200-800 ng of each DNA purified from the tails of the same
19 mice. A total reaction volume of 5 ml was analyzed by agarose gel electrophoresis (2.5% TAE) and
ethidium bromide staining. Lane M: markers.

PCR • RT - PCR
RT - PCR
One Step RT-PCR Master Mix Kit

Page
20
Convenient one-enzyme, hot start master mix system for RT-PCR
Features and Benefits: The One Step RT-PCR Master Mix Kit* allows rapid, sensitive
• Robust one-step, one-enzyme master mix system for easy analysis of gene expression from tissues and cells. One Step
reaction assembly RT-PCR Master Mix Kit can replace methods for detecting
• Eliminates the risk of cross contamination associated with
and quantifying gene expression such as Northern blots,
two-step RT-PCR protocols
• High-temperature (60°C) for reverse transcription in situ hybridization, dot blots, S nuclease assays and
enhances read-through of RNA secondary structure conventional two step RT-PCR. The kit utilizes recombinant
• Ideal for gene expression studies Thermus thermophilus (rTth) DNA Polymerase, which acts
• Compatible with real-time RT-PCR as both a thermostable RNA‑dependent DNA polymerase
• Optimized buffer conditions and antibody-mediated hot and a DNA‑dependent DNA polymerase. The rTth DNA
start for increased sensitivity
• Rapid enzyme activation step (30 s) avoids damage of
Polymerase is provided in a 2X master mix with an antibody
template RNA for antibody-mediated hot start, optimized buffer, and
ultrapure deoxynucleotides. Antibody-mediated hot start
One Step RT-PCR 50 rxn 71978-3
enhances specificity of both reverse transcription and PCR.
Master Mix Kit The kit enables cDNA synthesis from input RNA followed
by PCR amplification of the cDNA in a single reaction, with
Components no additional hands-on requirement for buffer changes or
2 × 625 ml 2X One Step RT-PCR Master Mix
1 × 200 ml 50 mM Mn(OAc)2 adding reagents. Typically, detection of a specific transcript
1 × 1.1 ml RNase Free Water
1 × 50 ml Primer F (10 pmol/ ml)
requires only 2 hours.
1 × 50 ml Primer R (10 pmol/ ml)
1 × 50 ml Positive Control RNA (5 × 108 copies/ml)
We recommend using either two gene-specific primers or oligo
One Step RT-PCR Master Mix Kit User Protocol TB508 (dT) and one gene-specific 5´-primer with the kit. Although
rTth adds 3´ dA overhangs, it is generally not recommended
for PCR product cloning because the rTth error rate is higher
than standard Taq DNA Polymerase. This kit is ideal for the
rapid screening of gene expression.

PCR • RT - PCR
RT - PCR
First Strand cDNA Synthesis Kit
Reliable preparation of templates for RT-PCR
Product Size Cat. No. Price The First Strand cDNA Synthesis Kit is designed for the
First Strand cDNA 40 rxn 69001-3 preparation of high-quality first strand cDNA from cellular
Synthesis Kit
Oligo(dT) primer 20 µg 69896-3
RNA templates. The kit contains MMLV Reverse Transcriptase
for superior yields of full-length cDNA. Both oligo(dT) and
Components random hexamer primers are included for a choice of general
4000 U MMLV Reverse Transcriptase
200 ml 5X First Strand Buffer
priming strategies and as alternatives to user-supplied specific
100 ml 100 mM DTT primers. A small volume (1-2 ml) of the first strand cDNA
50 ml 10 mM dNTP Mix
reaction can be used in PCR amplification with KOD DNA
20 mg Oligo(dT) Primer
10 mg Random Hexamer Primers Polymerase. Use this kit in conjunction with the Straight A’s™
1.5 ml Nuclease-free Water mRNA Isolation System and appropriate PCR reagents to
100 pmol Positive Control Primer, 3’ AS
100 pmol Positive Control Primer, 5’ S amplify rare coding regions.
AS + RH
AS + dT
RH
AS
dT
M
PCR of first strand cDNA

The positive control RNA was subjected to first strand cDNA synthesis with various
primer combinations followed by addition of the 5'-sense Control Primer (and
antisense Control Primer, where appropriate) and amplification. First strand primers
are indicated. AS: antisense Control Primer, RH: random hexamers, dT: oligo (dT).

E G PCR • Resource Guide
R E S O UR C
UI
DE
FAQ
Thermostable DNA Polymerases Resource Guide
What is the difference between NovaTaq™ and d. KOD Xtreme – 3´ to 5´ exonuclease proofreading activity
e. NovaTaq – lacks 3´ to 5´ exonuclease proofreading activity
KOD polymerases?
f. NovaTaq Hot Start – lacks 3´ to 5´ exonuclease proofreading
NovaTaq DNA Polymerase is a premium quality recombinant
activity
form of Thermus aquaticus DNA polymerase. The enzyme
possesses 5´ to 3´ DNA polymerase activity and lacks 3´ to
5´ exonuclease activity (proofreading). The preparation is What types of ends do the various Novagen
>95% pure and lacks RNase and endonuclease activities. polymerases leave on PCR amplification
NovaTaq DNA Polymerase generates PCR products with 3´- products?
dA overhangs. Generally, proofreading polymerases that possess 3´ to 5´
exonuclease activity will remove the 3´-dA overhangs whereas
KOD is a recombinant form of Thermococcus kodakaraensis non-proofreading polymerases will not.
KOD1 DNA Polymerase. The enzyme's 3´ to 5´ exonuclease- a. KOD – blunt ends
dependent proofreading activity results in an extremely b. KOD Hot Start – blunt ends
low mutation frequency. The extension speed of KOD is 2X c. KOD XL – mixture of blunt ends and 3´-dA overhangs
faster than Taq, enabling shorter reaction times. KOD DNA d. KOD Xtreme – blunt ends
polymerase produces blunt-ended DNA products. e. NovaTaq – 3´-dA overhangs
f. NovaTaq Hot Start – 3´-dA overhangs
Why should I use KOD DNA polymerases?
KOD DNA Polymerase is an ultra high fidelity thermostable What does “hot start” mean and what are the
DNA polymerase and a number of independent studies have advantages?
verified the extreme high fidelity of KOD DNA Polymerase While it is most convenient to set up PCR reactions at
compared to other thermophilic polymerases (Takagi 1997, ambient temperature, this can lead to mispriming events that
Nishioka 2001, Rual 2004, Wu 2006). In addition to a result in non-specific amplification products. In addition, the
low mutation frequency, the fast extension rate and high exonuclease activity possessed by proofreading enzymes, such
processivity of KOD result in higher yields of full-length as KOD, can lead to primer degradation. “Hot start” means
product in fewer reaction cycles. Combined, these make KOD that the polymerase is not active until cycling temperatures
DNA polymerases the PCR enzyme of choice when speed and are increased to activate the polymerase. This eliminates the
fidelity matter. mispriming and primer degradation concerns described above,
Nishioka, M. et al. 2001. J. Biotech. 88, 141. resulting in greater specificity and increased target yield. In
Rual, J-F. et al. 2004. Genome Res. 14, 2128.
Takagi, M. et al. 997 Appl. Environ. Microbiol. 63, 4509.
addition, “hot start” enzymes offer convenience of the room-
Wu, G. et al. 2006. J. Biotechnol. 124, 496. temperature reaction set-up.
Are the Novagen® polymerases “proofreading”? How does the hot start work with Novagen
What type of proofreading mechanism do polymerases?
NovaTaq and KOD polymerases use? KOD Hot Start is a premixed complex of KOD DNA Polymerase
KOD, KOD Hot Start, and KOD Xtreme™ polymerases all and two monoclonal antibodies. The antibodies inhibit
possess 3´ to 5´ exonuclease proofreading activity, making the 3´ to 5´ exonuclease and DNA polymerase activities at
them ideal for applications where fidelity is essential, such as ambient temperatures, providing high template specificity by
PCR from reverse transcription reactions and cloning. KOD XL preventing primer degradation and mispriming during reation
is a mixture of traditional KOD and its exonuclease-deficient set-up.
mutant. NovaTaq polymerase does not have proofreading
activity. NovaTaq Hot Start is a chemically modified form of Taq DNA
a. KOD – 3´ to 5´ exonuclease proofreading activity Polymerase that is inactive at room temperature. The enzyme
b. KOD Hot Start – 3´ to 5´ exonuclease proofreading activity must be activated by heat treatment (10 minutes at 95˚C),
c. KOD XL – mixture of KOD (with exonuclease proofreading after which thermal cycling can proceed.
activity) and its exonuclease-deficient mutant.

PCR • Resource Guide E G
R E S O UR C
UI
DE
FAQ

What is the difference between KOD XL and With other KOD polymerases, the addition of DMSO to
2-10% final concentration may decrease template secondary
KOD Xtreme™ Hot Start DNA Polymerases?
structure and increase yield. Final DMSO concentrations of
KOD XL is designed for accurate and rapid amplification of
less than 5% v/v have no effect on fidelity. The effect of
complex, GC-rich, and long (up to 30 kb) target DNA. KOD
DMSO above 5% v/v on enzyme fidelity has not yet been
XL is an optimized mixture of KOD DNA Polymerase and a
determined.
mutant form of KOD that is deficient in 3´ to 5´ exonuclease
activity, resulting in increased efficiency and better yield of
long targets. KOD XL is the only variation of KOD polymerase Are there any special recommendations for
known to work in reactions for incorporation of modified using KOD with long targets?
dNTPs. In addition to trying one of our polymerases specialized for
long targets (KOD XL or KOD Xtreme), it is often beneficial to
KOD Xtreme™ Hot Start is an optimized PCR system for adjust the final Mg2+ concentration. Adjusting the final MgSO4
the amplification of long or GC-rich DNA templates. The concentration from 1.5 to 2.25 mM in 0.25 mM increments
system includes an ultra high fidelity KOD DNA Polymerase should be tried when suboptimal results are obtained for
complexed with two monoclonal antibodies to permit hot targets over 3000 bp. Also, the addition of DMSO to 2-10%
start thermocycling, along with specially formulated 2X v/v final concentration may reduce secondary structure of
Xtreme buffer. KOD Xtreme quickly and accurately amplifies the template DNA and increase yield. The 2X Xtreme Buffer
genomic and phage/plasmid DNA targets up to 24 and 40 kbp, supplied with KOD Xtreme polymerase has been optimized
respectively. KOD Xtreme successfully amplifies challenging for long targets. The addition of DMSO or other additives is
DNA templates with up to 90% GC content. Relative fidelity generally not needed when using KOD Xtreme polymerase.
is higher than that of KOD XL.
I see smearing of my PCR products after
Can I use KOD DNA polymerases for site- cycling when using KOD. What is causing
directed mutagenesis? this and how can I get rid of it?
KOD DNA polymerases are an ideal choice for site-directed Because KOD has higher processivity and faster reaction
mutagenesis protocols. These polymerases possess ultra- times, it is important to adjust extension times to
high fidelity, providing a reduced chance of unintentional 10-25 s/kb.
changes. This high fidelity combined with high processivity
and fast extension rate, allow for efficient amplification of Smearing can be caused by too long or short extension times.
plasmids over 10 kb with only the desired mutation. Below If the smear is above the target size, extension time can be
are selected citations of KOD Hot Start used for site-directed reduced by 5 s/kb and/or the Mg2+ concentration can be
mutagenesis. reduced in 0.25 mM increments. If the smearing is below the
target size, we would recommend increasing the extension
Deigendesch, N. et al. 2006 Nucleic Acids Res. 34, 5007
time by 5 s/kb and/or increasing the Mg2+ concentration
Konno, A. et al. 2007 Mol. Biol. Evol. 24, 2504.
Liang, J. et al. 2007 Nucleic Acids Res. 35, 2944. in 0.25 mM increments. Smearing can also sometimes be
reduced by reducing the amount of template DNA added to
Are there any special recommendations for the reaction.
using KOD with GC-rich targets?

If not using a hot start enzyme, smearing can be caused by
KOD Xtreme Hot Start DNA Polymerases has been specifically
exonuclease activity during reaction set-up. Reactions should
formulated for difficult targets, including GC-rich targets.
be set up on ice to avoid degredation.
Additions, such as DMSO or other additives, are generally
not needed.

R E S O UR C
UI
DE
Protocol Comparison
KOD Hot Start KOD Xtreme™ Phusion™ PfuUltra® II

Hot Start Hot Start Fusion HS
Company Merck Chemicals Merck Chemicals NEB/Finnzymes Stratagene
Target Size genomic up to 12 kb genomic up to 24 kb genomic up to 7.5 kb genomic up to 19 kb
phage/plasmid phage/plasmid (use 5U/rxn for genomic > 6 kb)
up to 21 kb up to 40 kb vector up to 20 kbp
Fidelity 50-fold higher than Taq 11-fold higher than Taq 52-fold higher than Taq 20-fold higher than Taq
Ends blunt blunt blunt blunt
Other target info For targets up to 90% GC
Enzyme/50 µl rxn 1 U/rxn 1 U/rxn 1 U/rxn 1 µl/rxn
Activate 95˚C for 2 min 94˚C for 2 min 98˚C for 30 s 95˚C for 2 min
Denature 95˚C for 20 s 98˚C for 10 s 98˚C for 30 s 95˚C for 20 s
Anneal Lowest Tm for 10 s Lowest Tm for 30 s Tm + 3 for 30 s Lowest Tm-5 for 20 s
Extend 70˚C for 68˚C for 72˚C for 72˚C for
2 min, 5 sec 5 min 1 min, 15 s 1 min, 15 s
Final Extension time n/a n/a 72˚C for 10 min 72˚C for 3 min
# of cycles 25 30 30 30
Reaction time for a 1 h, 10 min 2 h, 51 min 1 h, 8 min 1 h, 3 min
5 kb target amplified
from plasmid
PfuTurbo® PfuUltra Herculase® Platinum®

Hot Start Hot Start Hot Start Pfx
Company Stratagene Stratagene Stratagene Invitrogen
Target Size genomic up to 19 kb genomic up to 6 kb genomic up to 37 kb up to 12 kb
phage up to 20 kb (use 5 U/rxn for genomic > vector up to 48 kb
6kbp)
vector up to 17 kb
Fidelity 6-fold higher than Taq 18-fold higher than Taq 3-fold higher than Taq 26-fold higher than Taq
Ends blunt blunt mixed blunt
Other target info For GC rich, long, and
challenging targets
Enzyme/50 µl rxn 2.5-5 U/rxn 2.5-5 U/rxn 2.5-5 U/rxn 1-2.5 U/rxn
Activate 95˚C for 2 min 95˚C for 2 min 95˚C for 2 min 94˚C for 2 min
Denature 95˚C for 30 s 98˚C for 30 s 98˚C for 30 s 94˚C for 15 s
Anneal Lowest Tm-5 for 30 s Lowest Tm-5 for 30 s Lowest Tm-5 for 30 s 55˚C for 30 s
Extend 72˚C for 5 min 72˚C for 10 min 10 cycles: 72˚C for 5 min 68˚C for 5 min
20 cycles; 72˚C for 5 min
+ 10 s/cycle
Final Extension time 72˚C for 5 min 72˚C for 10 min 72˚C for 10 min n/a
# of cycles 30 30 30 30
Reaction time for a 3 h, 12 min 3 h, 12 min 3 h, 43 min 2 h, 53 min
5 kb target amplified
from plasmid

R E S O UR C
UI
DE
Technical Notes

Comparing the Speed and Product Yield of 7 High Fidelity
DNA Polymerases
Keith Yaeger and Keith Fourrier - EMD Chemicals - Novagen - Madison, WI
Introduction and two monoclonal antibodies. The Reaction volume

Thermococcus kodakaraensis (strain antibodies inhibit the 3´→5´ exonuclease Reaction volumes of 50, 25, 20, and
KOD1), previously thought to be a and DNA polymerase activities at 10 ml were tested to determine an
Pyrococcus sp., is a hyperthermophilic ambient temperatures (Mizuguchi 1999), optimum volume for consistent PCR
archaea isolated from a solfataric hot providing high template specificity by results (data not shown). Both 50- and
spring on Kodakara Island, Japan preventing primer degradation and 25-ml reactions gave consistent results,
(Atomi 2004). In preliminary studies to mispriming events during reaction set- and the 25-ml volume was used for the
characterize the KOD1 DNA polymerase, up. This report evaluates the speed and remaining experiments.
researchers found that the enzyme product yield of KOD Hot Start DNA
had fidelity comparable to Pfu DNA Polymerase in an optimized reaction Template
polymerase, but with an extension rate buffer and compares the enzyme to A 919-bp fragment of human GSK3a
(referred to as speed) 5 times higher 6 other commercially available high (glycogen synthase kinase 3a) catalytic
and processivity 10 to 15 times higher fidelity thermophilic DNA polymerases. domain ORF, 54% GC-content, in an Open
than the Pfu enzyme (Takagi 1997). Biosystems cDNA plasmid (MHS1010-
When amplifying DNA for cloning, high Materials and Methods 7507851, GeneBank BC027984) was
fidelity DNA polymerases, such as KOD Thermocycler selected as the DNA template.
polymerase, are recommended. If the DNA amplification was performed on
enzyme is also fast and can generate MJ Research PTC-200 thermocyclers Primers/reagents
high yields of full-length product, fewer that had recently been calibrated by the Primers used were HPLC purified:
amplification cycles are required and manufacturer. Reactions were going to (35-mer sense) 5´-GACGACGACAAGA
the probability of obtaining error-free be done in tube strips, always using the TTTCCCAAGAAGTGGCTTACAC-3´ and
clones is greatly increased. same polymerase in the same location (41-mer antisense) 5´-GAGGAGAAGC
on each strip. To ensure no bias due to CCGGTCTTAACATCGCAGTTCATCAAAGA
Since the preliminary KOD DNA the location of the reaction in the strip AG-3´. Bases shown in bold are
Polymerase studies, significant work or in the thermocycler, test reactions homologous to the ORF. Table 1 shows the
has been done to optimize the PCR were performed using KOD Hot Start ion components used for each
buffer and cycling parameters. Another DNA Polymerase, and reaction yields polymerase.
improvement is KOD Hot Start DNA measured. Yields were found to be
Polymerase, which is a premixed comparable for all tube locations and
complex of KOD DNA Polymerase wells tested (data not shown).
Table 1. Reaction components and cycling profile for each DNA polymerase based on manufacturers’ recommendations
[Mg2+] in reaction
Template/
(mM)
[dNTP] [Primer] 25-ml reaction Polymerase*/ Cycling
DNA Polymerase Buffer added in 1X buffer (mM each) (mM each) (ng) 25-ml reaction profile†
KOD Hot Start 1X 1.5 0.2 0.3 5 0.5 U 4
KOD 1X 1.5 0.2 0.3 5 0.5 U 1
Platinum® Pfx 1X 1.0 0.3 0.3 5 0.5 U 2
Pfx50™ 1X in buffer 1.2 0.3 0.3 5 2.5 U 2
Phusion™ Hot Start 1X in buffer 1.5 0.2 0.5 5 0.5 U 1
PfuUltra® II Fusion
1X in buffer 2.0 0.25 0.2 5 0.5 ml (U not given) 3
Hot Start
PrimeSTAR® HS 1X in buffer 1.0 0.2 0.3 5 0.625 U 3
*Manufacturer defined units, used as recommended by manufacturer. † See Table 2 for cycling parameters
Continues on page 24

R E S O UR C
UI
DE
Technical Notes
Table 2. Cycling profiles used Cycling profiles

Cycle Profile 1 Cycle Profile 2 Cycle Profile 3 Cycle Profile 4 All 7 enzymes were tested in 4 different
Initial denaturation 98°C 30 s 94°C 2 min 95°C 2 min 95°C 2 min cycling protocols, which encompass the
98°C 10 s 94°C 15 s 95°C 20 s 95°C 20 s manufacturers’ recommended cycling
29 cycles 55°C 20 s 52°C 20 s 55°C 20 s 55°C 10 s
conditions (Table 2).
72°C 30 s 68°C 60 s 72°C 30 s 70°C 15 s
Final extension 72°C 5 min 68°C 5 min 72°C 3 min N/A
Results and Discussion
Different Cycling Profiles
A. 23 cycles 25 cycles Multiple reaction strips were prepared
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
Lane DNA Polymerase using master mixes for each polymerase.
M PCR Markers After 19, 21, 23, 25, 27, and 29 cycles,
1 KOD Hot Start
2 KOD reaction strips were removed and placed
3 Platinum® Pfx
4 Pfx50™
on ice. Samples (5 ml) from cycles 23,
5 Phusion™ Hot Start 25, 27, and 29 were assayed on 1.4%
6 PfuUltra® II Fusion HS
7 PrimeSTAR® HS agarose/TAE gels containing ethidium
bromide (Figure 1). Yield concentrations
were determined on diluted samples from
19, 21, 23, 25, 27, and 29 cycles using a
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 Quant-iT™ PicoGreen® ds DNA Assay Kit
27 cycles 29 cycles (Invitrogen) and a FLUOstar plate reader
(plus final extension)
(BMG LABTECH).
B. 23 cycles 25 cycles C . 23 cycles 25 cycles
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
New primers and enzyme kits were
obtained and all experiments were repeated
to verify initial results and trends. Results
with the new reagents were comparable to
the initial experiments (data not shown).
Yields generated by each enzyme at 19,
21, 23, 25, 27, and 29 cycles were plotted
for each protocol. Not all enzymes gave
their best yield using the manufacturer’s
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 recommended cycling conditions, so the
27 cycles 29 cycles 27 cycles 29 cycles best yields for each enzyme, from any
(plus final extension) (plus final extension)
cycling protocol, were compared (Figure 2).
D. 23 cycles 25 cycles For cloning purposes, fewer reaction cycles
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
increase the potential for error-free clones.
Figure 1. PCR results from 7 high fidelity
thermophilic DNA polymerases using 4 Cycles 19-25 have been shaded green on
different cycling profiles the graph to emphasize the reaction yields
PCR samples were removed after 23, 25, 27, and 29
cycles and 5 ml were assayed on 1.4% agarose/TAE
gels. Lanes indicate the enzyme used for the reaction.
Cycling profiles are defined in Table 2. (A) cycling
profile 1 (Note: PicoGreen results indicate a yield
increase with PrimeStar HS DNA Pol. from cycle 27
to cycle 29; the reduced band intensity here is a gel
loading artifact), (B) cycling profile 2, (C) cycling
profile 3, (D) cycling profile 4.
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
27 cycles 29 cycles

R E S O UR C
UI
DE
Technical Notes

4.00
from these earlier cycles. KOD Hot Start DNA KOD Hot Start (1)
Polymerase consistently gave high yields in 3.50

KOD (1)
cycles 19-25 for all 4 profiles tested. (data 3.00

Platinum® Pfx (2)
(µg/25-µl reaction)
not shown)
Amplicon yield
2.50
Pfx50™ (2)
2.00 Phusion™ Hot Start (3)
2-Step PCR 1.50 PfuUltra® II Fusion HS (2)
Longer primers (generally ≥23 bases) 1.00 PrimeSTAR® HS (1)
can increase PCR specificity and, due 0.50

to higher annealing temperatures, can
0.00
be used in time-saving 2-step cycling 19 21 23 25 27 29
profiles. KOD Hot Start DNA Polymerase Cycle number
and the other 6 high fidelity enzymes

Figure 2. Best yield for each high fidelity thermophilic enzyme
were tested in a 2-step protocol from any cycling profile
(initial denaturation at 95°C for 2 min, Yields were determined by PicoGreen analysis after 19, 21, 23, 25, 27, and 29 cycles for all 4 cycling
and 29 cycles of 95°C for 20 s, 68°C for profiles (Table 2). The best yield data for each enzyme, from any cycling profile, was graphed. The
cycling profile that gave the best yields is identified in parentheses. The green shaded area highlights
40 s). Figure 3 shows that not all enzymes yields in cycles 19-25, which would be preferable for cloning.
functioned well with this 2-step protocol
(lanes with little or not product). Other
enzymes, including the 2 KOD enzymes, 23 cycles 25 cycles
generated high yields comparable to the M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7
Lane DNA Polymerase
3-step protocols shown in Figure 1. M PCR Markers
KOD application - screening plaques 1 KOD Hot Start
2 KOD
Testing the ability of KOD Hot Start DNA 3 Platinum Pfx
4 Pfx50
Polymerase to amplify a variety of DNA 5 Phusion Hot Start
templates, the enzyme was used in a 2-step 6 PfuUltra II Fusion HS
7 PrimeSTAR HS
cycling profile to screen random clones from
Figure 3. PCR results from 7 high
the T7Select® Human Brain cDNA Library fidelity enzymes using a 2-step
cycling profile
(Cat. No. 70637). Plaques were eluted in 100
PCR samples were removed after 23, 25, 27,
ml TE (10 mM Tris-HCl, 0.1 mM EDTA) and and 29 cycles of a 2-step protocol and 5 ml
M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 were assayed on 1.4% agarose/TAE gels. Lanes
5 ml eluate was used for PCR. Primers were: indicate the enzyme used for
sense primer 5´-ACT TCC AAG CGG ACC 27 cycles 29 cycles the reaction.
AGA TTA TCG C-3´ and antisense primer

5´-AAC CCC TCA AGA CCC GTT TAG
AGG-3´. Reactions were cycled with an
initial denaturation at 95°C for 2 min, and
25 cycles of 95°C for 20 s, 68°C for 25 s.
Of the 50 clones screened, KOD successfully
amplified 49 inserts (Figure 4). Amplicons Continues on page 26
ranged in size from ~250-1800 bp.

R E S O UR C
UI
DE
Technical Notes
KOD DNA polymerase (pol) fidelity independent assays is the consistent high
in PCR has been assayed by different fidelity of KOD DNA pol.
methods. Initial studies by Takagi et al.
(1997) measured the mutation frequency Conclusion
in amplicons after 30 PCR cycles using a A number of independent studies have
plasmid template containing the lacZ gene. verified the extremely high fidelity of KOD
By comparing the number of white and DNA Polymerase. In addition to a low
light blue colonies (mutant) to the total mutation frequency, the fast extension rate
number of colonies (including blue, intact and high processivity of the KOD enzyme
lacZ colonies), they determined mutation result in high yields of full-length product
rates of 2.8% for KOD DNA pol, 3.6% for in fewer reaction cycles. Combined, these
Pfu DNA pol, and 48.0% for Taq DNA pol. attributes have made KOD Hot Start DNA
Using the same blue/white assay method, Polymerase the PCR enzyme of choice for
but with 25 cycles, Nishioka et al. (2001) many routine and high throughput cloning
found mutation frequencies of 0.79% for and structural proteomics studies. ■
KOD DNA pol and 28.1% for Taq DNA pol. References
Atomi, H. et al. 2004. Archaea 1, 263.
Rual et al. (2004) directly sequenced ~70,000
Mizuguchi, H. et al. 1999. J. Biochem. (Tokyo) 126, 762.
bases and determined a misincorporation Nishioka, M. et al. 2001. J. Biotech. 88, 141.
rate of 1 in 35,000 nucleotides for KOD Pienaar, E. et al. 2006. Comp. Biol. Chem. 30, 102.
Rual, J-F. et al. 2004. Genome Res. 14, 2128.
DNA pol compared to 1 in 2,000 nucleotides
Takagi, M. et al. 1997. Appl. Environ. Microbiol. 63, 4509.
for Platinum® Taq DNA Polymerase High Tindall, K.R. and Kunkel, T.A. 1988. Biochemistry 27, 6008.
Fidelity in amplicons generated after 20
cycles of PCR. Discrepancies in mutation
rates can be due to the different assay
methods, as well as to thermal degradation
of DNA at high temperatures, which is not
related to enzyme function (Tindall 1988,
Pienaar 2006). What stands out in these
Lane Sample
M1 Perfect DNA™ Markers, 0.5-12 kbp
M2 PCR Markers
Figure 4. Results from

KOD Hot Start
amplification of T7Select Human
cDNA Library clones
PCR was performed as stated in the text; 5 ml
of each 25-ml reaction were assayed on a 1.4%
agarose/TAE gel. KOD Hot Start successfully
amplified 49 of 50 clones with amplicons
ranging from ~250-1800 bp.

R E S O UR C
UI
DE
Technical Notes
Reliable and Efficient PCR from Whole Blood and Crude Tissue

Lysates Using the KOD Xtreme™ Hot Start DNA Polymerase System
Introduction thermocycling, thereby ensuring high (tomato, tobacco, and rice) under the
Among the persistent challenges of priming specificity and inhibition of same cycling and reaction conditions
existing PCR systems are sample scarcity, primer degradation during setup at with excellent yield. In contrast, the
time and cost efficiency, and the reliable ambient temperature. two competitor high-efficiency Taq-
amplification of problematic targets such proofreading enzyme blends failed to
as GC-rich DNA. The latest addition to our 2. A specifically formulated 2X buffer yield any detectable PCR product from the
PCR system offering, the KOD Xtreme™ Hot which in combination with optimized same tissue lysates, yielding PCR product
Start DNA Polymerase System, addresses reaction conditions, facilitates the only when purified genomic DNA was
these issues, while still maintaining high amplification of GC-rich, long, and used as template. Hence, the KOD Xtreme
accuracy and fast reaction rate. otherwise problematic target DNA Hot Start DNA Polymerase System is an
sequences (Yaeger, 2008), as well as efficient and reliable PCR system that
Currently, efficient and reliable PCR amplification from difficult samples obviates the need for the purification of
systems require the prior purification of such as whole blood or crude tissue target genomic DNA from plant tissues,
target DNA templates from samples of lysates. or the optimization of reaction or cycling
interest. In addition to the burdens of cost conditions for different types of tissue
and time invested in the DNA purification Results lysates, thereby saving time, sample, and
procedures, this approach necessitates a As illustrated in Figure 1A, KOD Xtreme cost of PCR reagents and DNA purification
larger amount of sample material, which polymerase successfully amplified a systems.
in many cases is scarce. Furthermore, the 1.3 kb fragment of the β-globin gene
amplification of GC-rich DNA templates from different sample sizes (1, 2, or 4 Figure 3 illustrates the superior
often requires extensive time consuming µl) of whole blood, with superior yield performance of the KOD Xtreme Hot
optimization. The KOD Xtreme Hot Start and reliability compared with other Start DNA Polymerase System in
DNA Polymerase System exploits the commercial PCR systems. This reliability genotyping PCR using crude mouse tail
inherent high fidelity, fast extension rate, and high yield were maintained with DNA tissue lysates compared to a competitor’s
and processivity of DNA polymerase from templates up to 8.5 kb under the same high-efficiency Taq-proofreading enzyme
Thermococcus kodakaraensis (KOD DNA reaction and cycling conditions, from blends commonly used for this purpose.
polymerase) in a combination that permits only 2 µl of whole blood (Figure 1B), thus The competitor’s PCR systems did not
hot start PCR and the amplification of eliminating the usual need for further amplify the larger transgenic target
difficult DNA targets, and facilitates optimization when targeting larger DNA sequence, and amplified the wild-type
PCR from whole blood or crude tissue sequences or different amounts of starting sequence with mostly moderate to low
lysates. This is all achieved with minimal sample material. efficiency. In contrast, the KOD Xtreme
optimization. The system includes: Hot Start DNA Polymerase system
Figure 2 features the amplification of a efficiently and reliably amplified
1. The ultra high fidelity KOD DNA 1.3 kb fragment of the rbcL gene from homozygous wild-type, homozygous
polymerase in complex with two crude lysates of different plant tissues. The transgenic, as well as heterozygous target
neutralizing monoclonal antibodies KOD Xtreme Hot Start DNA Polymerase genomic DNA with excellent yield.
that inhibit the DNA polymerase and System facilitated the successful
the 3’5’ exonuclease activities at amplification of the target gene fragment
ambient temperature. This complex from crude lysates of two different tissue
allows for antibody-mediated hot start types (leaf and grain) of different plants

R E S O UR C
UI
DE
Technical Notes
Summary
The KOD Xtreme™ Hot Start DNA and templates that are up to 90% GC- technical assistance in providing data and/or
samples. We would also like to acknowledge
Polymerase System has been optimized rich, with much enhanced yields and the EMD Chemicals technical service scientists
to provide the highest success rate even blunt ended DNA products suitable for and others for their assistance in preparing this
cloning. To the end user, such superior note.
with the most challenging DNA targets
and sample types. It is superior for the performance is achieved with minimal
References
amplification of target DNA from whole manipulation and significant cost, time,
Yaeger, K., et al. 2008 inNovations 28, 15.
blood or crude lysates of different types and sample savings.
of tissues. This is in addition to offering
Acknowledgements: We would like to thank
fast reaction rates, high fidelity, and high Akio Sugiyama, Toyobo Co., Ltd and Yuji Arai,
efficiency amplification of long targets National Cardiovascular Center, Japan for their
Figure 1: Performance of the KOD Xtreme Hot Start DNA Polymerase System in Amplification from Whole Blood Samples
Figure 1A Figure 1B
KOD Xtreme PfuTurbo® Ex Taq™ HS LA Taq™ HS Taq KOD Xtreme
M 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3 M M1 1 2 3 M2
A. Reactions (50 µl each) were set up to amplify a 1.3 kb region of the β-globin gene from 1, 2 or 4 µl of untreated
whole blood (lanes numbered 1, 2, and 3, respectively). B. PCR reactions were set up to amplify a 1.3 kb region, a
3.6 kb region, or an 8.5 kb region of the β-globin gene (lanes 1, 2, and 3, respectively) from 2 µl of untreated whole
blood. For both A and B, PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for
2 min; 30 cycles at 98°C for 10 s, 68°C for 1 min/kbp. For polymerases from other manufacturers, optimal cycling
parameters as recommended by each manufacturer were used. M and M1: 1 kbp Ladder; M2: λ/Hind III Marker.
Primers:
<β-globin 1.3 kb>
Primer F: 5’-TTAGGCCTTAGCGGGCTTAGAC-3’
Primer R: 5’-CCAGGATTTTTGATGGGACACG-3’
<β-globin 3.6 kb>

Primer F: 5’-GGTGTTCCCTTGATGTAGCACA-3’
Primer R: 5’-ACATGTATTTGCATGGAAAACAACTC-3’
<β-globin 8.5 kb>

Primer F: 5’-TGATAGGCACTGACTCTCTGTCCCTTGGGCTGTTT-3’
Primer R: 5’-ACATGATTAGCAAAAGGGCCTAGCTTGGACTCAGA-3

R E S O UR C
UI
DE
Technical Notes

Figure 2: Performance of the KOD Xtreme™ Hot Start DNA Polymerase System in Amplification from Crude Lysates of Different Plant Tissues
KOD Xtreme Ex Taq™ HS LA Taq™ HS

1 2 3 4 5 M 1 2 3 4 5 M 1 2 3 4 5
Lane Samples
M 1 kbp Ladder
1 Tomato leaf
2 Tobacco leaf
3 Rice leaf
4 Rice grain
5 Purified rice leaf DNA
Reactions (50 µl each) were set up to amplify a 1.3 kb region of the rbcL gene from each of the indicated crude plant tissue lysates. All tissues (~ 3 x 3
mm piece of leaf or one rice grain) were extracted for 10 minutes at 95°C in 100 mM Tris-HCl (pH 9.5), 1 M KCl, 10 mM EDTA, and 1 ul of each of the
extracts was used in the corresponding amplification reaction. PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for
2 min; 30 cycles at 98°C for 10 s, 68°C for 1.5 min. For polymerases from other manufacturers, optimal cycling parameters as recommended by each
manufacturer were used.
Primers:
F1: 5’-ATGTCACCACAAACAGAGACTAAAGC-3’ (Tomato & Tobacco)
R1: 5’-AAGCAGCAGCTAGTTCCGGGCTCCA-3’ (Tomato & Tobacco)）
F2: 5’-ATGTCACCACAAACAGAAACTAAAGC-3’ (Rice)
R2: 5’-AAGCTGCGGCTAGTTCAGGACTCCA-3’ (Rice)
Figure 3*: Genotyping of Transgenic Mice by PCR from Mouse Tail Tissue Lysates Using KOD Xtreme Hot Start DNA Polymerase System
KOD Xtreme Ex Taq™ HS LA Taq™ HS

1 2 3 M 1 2 3 M 1 2 3
Lane Samples
M 1 kbp Ladder
1 Tg/Tg
2 Tg/W
3 W/W
Reactions (50 µl each) were set up to amplify a 1.5 kbp region or a 3.1 kbp region of the wild-type or transgenic gene, respectively, from the indicated mouse
tail tissue lysates. Tissue fragments (~ 3 mm-long tail piece each) were extracted in 50 mM NaOH for 10 minutes at 95°C, neutralized with one-tenth volume of
1 M Tris-HCl, pH 8.0, spun at 12,000 rpm for 5 min, and 1 µl of each of the clarified extracts was used in the corresponding amplification reaction. PCR cycling
parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 3 min. For polymerases from other
manufacturers, optimal cycling parameters as recommended by each manufacturer were used. Tg: transgenic; W: wild-type.
Primers:
F: 5’-TGGACGTGAGCTTCAGCAC-3’
R: 5’-AGGCCTGACAGTAGCTCAG-3’
* The mouse tail samples were provided by Dr. Yugi Arai, National Cardiovascular Center, Japan.

R E S O UR C
UI
DE
Technical Notes
Reliable and Robust Real-time Amplification Using

NovaTaq™ Hot Start Master Mix
Hope Schultz and Keith Yaeger - EMD Chemicals - Novagen - Madison, WI
Real-time PCR methods are used to Real-time PCR Amplification from cDNA detected using a HEX-labeled probe.
determine the level of specific mRNA or with NovaTaq™ Hot Start Master Mix Figure 1, Panel A shows the amplification
DNA sequences. These real-time methods Real-Time PCR was performed using curves for the real-time PCR and the
may be used in a number of different a linearized plasmid containing the reproducibility of the amplification using
application areas including analyzing glycogen synthase kinase 3 alpha NovaTaq Hot Start Master Mix Kit over
gene expression, genotyping studies, and (GSK3α) cDNA. The stock DNA at 5 × 108 a range of template concentrations. In
pathogen detection. We have demon- copies/µl was 10-fold serially diluted in figure 1, Panel B the cycle threshold (Ct)
strated that NovaTaq™ Hot Start Master TE and reactions were run in triplicate. is plotted against DNA concentration.
Mix can be used in real-time PCR The following parameters were used on This yielded a standard curve with a
amplification of various templates to the Chromo4 Real-Time PCR Detection correlation of 1, showing that NovaTaq
obtain reproducible results and robust System(Bio-Rad): initial denaturation at Hot Start Master Mix gave linear results
amplification of low copy number 95°C for 10 minutes; followed by 94°C for 10 to 109 copies of the plasmid.
genes. In this article, a comparison for 30 seconds, 54°C for 30 seconds, and
of competitors’ PCR mixes indicates 72°C for 10 seconds for 45 cycles. The
NovaTaq Hot Start Master Mix provides primer/probe mix was designed to target
superior amplification and specificity. a 112 bp amplicon of GSK3α. DNA was
Figure 1.
Linearized cDNA plasmid amplified
using NovaTaq Hot Start Master Mix
Panel A Panel B
Real-Time PCR Amplification from Time PCR Detection System was: initial amplification curves (Figure 2, Panel A).
Human Genomic DNA with NovaTaq Hot denaturation at 95°C for 10 minutes; Ct vs. DNA concentration (Figure 2, Panel
Start Master Mix followed by 94°C for 30 seconds, 54°C B) yielded linear results for 0.01 to 100 ng
Human Genomic DNA (Cat No. 69237) for 30 seconds, and 72°C for 10 seconds genomic DNA. Note that 0.001 ng would
was serially diluted 10-fold in TE (10mM for 45 cycles. DNA was detected using correlate to about 0.3 copies of the target
Tris, pH 8 from 50 ng/µl. The primer/ a HEX-labeled probe. All reactions were sequence and one of the three experiments
probe mix was designed to target a 139 performed in triplicate. Amplification was performed in triplicate gave a signal while
bp amplicon of GSK3α. The cycling seen down to a level of approximately 3 the other two were negative.
profile using the Bio-Rad Chromo4 Real- copies per reaction as indicated by the
Panel A. Amplification
curve
Trace color
109 Copies
108 Copies
Figure 2. 107 Copies

106 Copies
105 Copies
104 Copies
Serially diluted human 103 Copies
102 Copies
101 Copies
genomic DNA amplified using
NovaTaq Hot Start Master Mix
Panel A Panel B

R E S O UR C
UI
DE
Technical Notes

Performance of NovaTaq™ Hot Start Polymerase or qPCR mixes from the shown on the right. The melting analysis
Master Mix in quantitative PCR versus indicated manufacturer. DNA was detected (curves shown on the left) was done
competitors' PCR mixes. using SYBR® Green dye. Each reaction with a temperature range of 60°C to
Total RNA was isolated from mouse 3T3 was performed in triplicate. The following 99°C, acquiring at each degree. A single
cells and cDNA was synthesized using parameters were used with a Corbett peak in the melting curve demonstrates
MMLV reverse transcriptase. A 122 bp Rotorgene 6000: initial denaturation at specificity of the reaction. Multiple peaks
region of the mouse β-actin coding 95°C for 10 min; followed by 95°C for 10 indicate that secondary products were
sequence was amplified from 15 ng/µl s, 55°C for 15 s, and 72°C for 20 s for also amplified.
of cDNA using NovaTaq Hot Start DNA 40 cycles. The amplification curves are
Figure 3.
NovaTaq Hot Start DNA Polymerase – Red
Invitrogen – Green
Invitrogen's polymerase shows lower amplification effi-
ciency as indicated by the lower fluorescence intensity.
Figure 4.
Qiagen - Green
NovaTaq Hot Start DNA Polymerase shows superior am-
plification efficiency as indicated by the much higher
fluorescence intensity.
Figure 5.
KAPA Biosystems – Green
KAPA Biosystems polymerase demonstrates poor reaction
specificity as demonstrated by the multiple peaks in the
melting curve.
Figure 6.
Stratagene - Green
NovaTaq Hot Start DNA Polymerase shows superior am-
plification efficiency as indicated by the much higher
fluorescence intensity.
Summary strand cDNA. The data obtained using Mix has a higher amplification efficiency
We have demonstrated that NovaTaq Hot this enzyme premix are reproducible and specificity than several competitors’
Start Master Mix Kit may be used for real- and allows for the analysis of low copy PCR mixes.
time PCR of plasmid, genomic, and first number genes. NovaTaq Hot Start Master

R E S O UR C
UI
DE
Technical Notes
One Step Real-Time Amplification of mRNA Using the
One Step RT-PCR Master Mix Kit

Hope Schultz and Keith Yaeger - EMD Chemicals - Novagen - Madison, WI
Reverse transcription followed by thermophilus (rTth) DNA Polymerase, allowing for a sensitive detection of
polymerase chain reaction (RT-PCR) which functions as both a thermostable RNA. One Step RT-PCR Master Mix
allows amplification and detection of RNA–dependent DNA polymerase and a Kit is compatible with SYBR® Green,
very low amounts of RNA. The technique DNA–dependent DNA polymerase. The providing fluorescent signal to detect
is important for gene expression profiling anti-rTth antibody included in the mix the amplified region and melt analysis to
and RNA virus detection. In addition to enhances the specificity of the reverse confirm homogeneity of product. In this
using purified RNA as a template, RT- transcription by binding the polymerase article, the One Step RT-PCR Master Mix
PCR kits may be used directly with crude and reducing mispriming during Kit was used to amplify mRNA directly
lysates of mammalian cells, a technique reaction assembly. The high optimal from mammalian extracts. Duplex
that can be used to compare mRNA temperature for polymerization by rTth RT-PCR using the same crude extract
levels in different cells. polymerase in reverse transcription demonstrates that the One Step RT-PCR
offers the advantage of increased success Master Mix can be used to analyze two
The Novagen® brand One Step RT- by reducing secondary mRNA structure targets in a single reaction when probes
PCR Master Mix Kit allows for mRNA and the single reaction set up reduces are used as the detection method.
amplification in a single tube because chances of contaminating the samples
it contains recombinant Thermus with exogenous DNA, RNA or nucleases
Real-Time PCR from CytoBuster™ Protein Extraction Reagent RT-PCR reactions that were done in
Crude Lysate (Cat. No. 71009) to lyse cells and 40 units triplicate. The primers used targeted a
To test the ability of the One Step RT-PCR RNase Inhibitor (Cat. No. 556881). An 99 bp amplicon from exon 3 to exon 4 of
Master Mix Kit to amplify mRNA from addition of 50 μl of TE (10 mM Tris, pH cyclophilin B (PPIB, genomic accession
HeLa cell lysates in a real-time reaction 8, 1mM EDTA) + 0.02% Triton X-100 NT_010194.16).
using SYBR Green I for detection. was added to yield a lysate containing
5000 cell equivalents/μl. The lysate PCR was performed Chromo4 Real-
HeLa cells (5X10 cells) were cultured
5 was two-fold serially diluted in TE + Time PCR Detection System (Bio-Rad)
in DMEM, pelleted, and stored at -70°C. 0.02% Triton X-100, and 2 μl of each and SYBR Green I was from Invitrogen.
The cell pellet was treated with 50 μl of dilution was used as template in 50 μl Table 1 contains the cycling parameters.
Table 1
CYCLING STEP Time/temperature
1. Polymerase Activation 30 s at 90°C
2. Reverse Transcription 15 min at 60°C
3. Denaturation 30 s at 94°C
4. Denaturation 1 s at 95°C
5. Annealing 15 s at 50°C
6. Extension 5 s at 72°C
Repeat Steps 4-6 for 40 cycles

R E S O UR C
UI
DE
Technical Notes

We observed excellent yield and reproducibility as shown in the amplification curves (Figure 1, Panel A). The signals titrated
from 10,000 to 10 cells as shown by the standard curve with a correlation of 0.999 (Figure 1 Panel C). The melting curve
(Figure 1, Panel B) shows a single product was amplified.
Figure 1. PPIB mRNA amplified from crude HeLa lysates
Trace colors
10000 Cells
5000 Cells
2500 Cells
1250 Cells
625 Cells
313 Cells
156 Cells
78 Cells
39 Cells
20 Cells
10 Cells
No Template Control
Panel A: Amplification Curve Panel B: Melting Curve
Panel C: Ct vs. Cell Number

R E S O UR C
UI
DE
Technical Notes
Duplex Real-Time PCR with One-Step RT-PCR Master Mix

The template used in the duplex RT- PCR experiment was the same HeLa cell preparation used in the SYBR® Green I experiments
previously described. In the reactions, the primer Set I targeted a 99 bp amplicon spanning from exon 3 to exon 4 of PPIB.
Primer Set II targeted an 112bp amplicon spanning from exon 4 to exon 5 of glycogen synthase kinase 3 alpha (GSK3α, genomic
accession NC_000019). FAM Dye was used to detect PPIB and HEX dye was used to detect GSK3α. Reactions were performed in
triplicate using the Chromo4 Real-Time PCR Detection System (Bio-Rad) with the cycling conditions described in Table 1. The
plate was read after step 5 for these experiments. Figures 2 and 3 shows that PPIB and GSK3α are efficiently amplified in the
same reaction and the signal titrates well from 5000 to 10 cells with a standard curve with a correlation coefficient of 0.997.
Figure 2: PPIB mRNA amplified from crude HeLa cell lysates using the One Step RT-PCR Master Mix Kit and FAM Dye.
Trace color
5000 Cells
2500 Cells
1250 Cells
625 Cells
313 Cells
156 Cells
78 Cells
39 Cells
20 Cells
10 Cells
Panel A: Amplification Curve Panel B: Ct vs. Cell Number
Figure 3: GSK3α mRNA amplified from crude Hela cell lysates using the One Step RT-PCR Master Mix Kit and HEX Dye.
Trace color
5000 Cells
2500 Cells
1250 Cells
625 Cells
313 Cells
156 Cells
78 Cells
39 Cells
20 Cells
10 Cells
Panel A: Amplification Curve Panel B: Ct vs. Cell Number
Summary
Real time reverse transcription PCR is a powerful technique in functional proteomics. The Novagen® One Step RT-PCR Master
Mix Kit provides results that are reproducible and robust.

R E S O UR C
UI
DE
Technical Notes

Detection of Shiga toxin-producing E. coli using multiplex
colony-direct PCR with KOD XL DNA Polymerase
Okitsu, T., Suzuki, R., Yamai, H.
Bacterial Pathology Department, Kanagawa Prefecture Health Research Institute, Japan
Certain strains of E. coli are known to pro- Table 1. STEC PCR setup1 ponents. PCR were performed using the
duce a family of related toxins, referred to Component Concentration following conditions: initial denaturation at
as Shiga toxin 1 (Stx1, encoded by stx1) PCR buffer for KOD XL 1X 94°C for 5 minutes, 30 cycles of 98°C for 15
and Shiga toxin 2 (Stx2, encoded by stx2). dNTP mix 0.2 mM
seconds, 60°C for 5 seconds, and 74°C for
Shiga toxin-producing E. coli (STEC), 30 seconds. After the PCR, one-tenth of the
stx1 primers (stx1-F + stx1-R) 0.2 µM each
represented by serotype O157:H7, has a reaction solution was analyzed by agarose
stx2 primers (stx2-F + stx2-R) 0.2 µM each
strong infectious capacity and pathoge- gel electrophoresis (2% TAE gel, Figure 1).
eaeA primers (eaeA-F + eaeA-R) 0.2 µM each
nicity. In recent years, this bacterium has The results of the multiplex-PCR showed a
been affecting an increasing number of hlyA primers (hlyA-F + hlyA-R) 0.2 µM each clear amplification for each target: 180 bp
victims, resulting in life-threatening ill- IS1203v primers (1203v-F + 0.1 µM each for stx1, 255 bp for stx2, 384 bp for eaeA,
1203v-R)
ness such as hemorrhagic colitis, hemo- 534 bp for hlyA, and 910 bp for IS1203v, in
Bacterial cells approximately 11 STEC strains (Figure 1). Amplification of
lytic-uremic syndrome, and thrombotic 104 cfu
thrombocytopenic purpura (1). The mor- the target genes from the control K-12 strain
KOD XL DNA Polymerase 2.5 U
bidity and mortality associated with STEC was negative. The results clearly demon-
disease highlight the threat these organ- 1
When using KOD XL DNA Polymerase, set up the PCR on ice. strated that this system is effective for STEC
isms pose to public health. For this reason, typing.
there is an increasing demand for fast and upon the original multiplex PCR assay. By using KOD XL DNA Polymerase,
efficient methods for the detection of vir- With our method, a bacterial colony from PCR was completed in less than 1.5 hours,
ulent strains of STEC in fecal samples and a food or fecal culture was used directly a significant time savings compared to the
in meat and dairy products. as the template. In addition, four target nearly 3.5 hours of the original method,
PCR is generally considered the most genes were examined for the presence of and a great advantage when multiple spec-
sensitive means for determining if a food the IS1203v insertion sequence discov- imens require quick processing.
or fecal sample contains STEC. A multi- ered in stx2 genes (3, 4) with IS1203v-
References
plex PCR method developed by Paton and specific primers. To reduce the time need- 1. Karmali, M. A. (1989) Clin. Microbiol. Rev. 2,
Paton (2) enables simultaneous determi- ed for the PCR, Taq DNA polymerase was 15–38.
replaced with the faster KOD XL DNA 2. Paton, A. W. and Paton, J. C. (1998) J. Clin.
nation of stx1, stx2, and correlated genes Microbiol. 36, 598–602.
that encode accessory STEC virulence Polymerase*. Multiplex CD-PCR analysis 3. M., Nishiya, Y., Kawamura, Y., and Shinagawa, K.
factors, such as eaeA and hlyA, in crude for eleven STEC strains and one control (1999) J. Biosci. Bioeng. 87, 93–96.
DNA extracts from primary fecal cul- K-12 strain isolated at Kanagawa Prefec- 4 Okitsu, T., Suzuki, R, and Yamai, S. (2001) Upload
63 (Toyobo Co., Ltd., Japan newsletter).
tures. ture, Japan, between 1996 and 1999 was
In this study, we developed a rapid performed (Figure 1). Table 1 identifies
typing system for STEC that improves the final concentrations of the PCR com-
M 1 2 3 4 5 6 7 8 9 10 11 12 M
Lane Sample
M Markers (100-bp ladder)
1–11 STEC strains
12 K-12 strain
← IS1203
← hlyA Figure 1. STEC identification by CD-PCR
← eaeA Eleven STEC strains and one K-12 strain were
← stx2 used for CD-PCR. Reaction products were
← stx1 analyzed by agarose gel electrophoresis and
stained with ethidium bromide.

PCR • PCR Clean Up and Nucleic Acid Precipitation
PCR Clean Up and Nucleic Acid Precipitation
SpinPrep™ PCR Clean-Up Kit

Rapid purification of PCR products
Product Size Cat. No. Price The SpinPrep™ PCR Clean-Up Kit is designed for rapid
SpinPrep™ PCR 100 rxn 70976-3 purification of PCR-amplified DNA. The 10-minute procedure
Clean-up Kit
involves addition of binding buffer followed by adsorption
Components
82 ml SpinPrep Bind Buffer
of the DNA to a silica membrane in a spin column format.
27 ml SpinPrep Wash Buffer Following a wash step, DNA is eluted in low-salt buffer. This
10 ml SpinPrep Elute Buffer
kit removes DNA polymerases, dNTPs, salts, and primers so
100 SpinPrep Filters
100 Receiver Tubes that they do not interfere with downstream applications such
100 SpinPrep Eluate Receiver Tubes as cloning, sequencing, or labeling. PCR products from 100
Additional Information Available bp to >12 kb can be cleaned up, with standard recoveries of
SpinPrep PCR Clean-Up Kit User Protocol TB290 60–90%.
SpinPrep PCR Clean-Up Kit 1 2 3 4

bp
Column binding capacity: up to 6 mg
PCR sample volume: 100 µl/rxn
2000 –
Typical recovery: 60-90% 1500 –
1000 –
Size range: 100 bp to > 12,000 bp 750 –
500 –
Time required: < 10 min
300 –
150 –
50 –
Primer removal with the

SpinPrep PCR Clean-Up Kit
Lane Sample
1 PCR Markers
2 Crude PCR product
3 Purified PCR product
4 PCR Markers


SpinPrep™ Gel DNA Kit
Rapid, efficient extraction of DNA from agarose gels
Features The SpinPrep™ Gel DNA Kit enables efficient extraction of DNA
• No organic extraction or alcohol precipitation fragments from 150 bp to >12,000 bp in size from agarose gels.
• Total preparation time < 30 minutes The procedure uses GelMelt™ Solution to dissolve the gel slice,
• No low melting point agarose required followed by adsorption of the DNA to a silica membrane in
a spin column format. After a wash step, the purified DNA is
SpinPrep™ Gel DNA Kit 100 rxn 70852-3 eluted in low-salt buffer. Each spin column can bind up to 20
mg DNA. Routine recovery is 50–90%.
Components
5 × 24 ml SpinPrep GelMelt™ Solution
27 ml SpinPrep Wash Buffer
1 2 3 4 5
10 ml SpinPrep Elute Buffer
bp
100 SpinPrep Filters
100 Receiver Tubes Gel analysis and quantification of DNA
100 SpinPrep Eluate Receiver Tubes ← 12,000, 52% fragments isolated with the SpinPrep Gel DNA Kit
← 8000, 50% Known amounts (2 mg) of four DNA fragments of the
indicated sizes were run in separate lanes on a 1%
SpinPrep Gel DNA Kit User Protocol TB274
← 1000, 90% agarose gel. Each band was excised and the DNA
extracted from the gel using the SpinPrep Gel DNA Kit
SpinPrep Gel Kit and standard protocol. Recoveries shown as percentages
← 150, 90% above were determined by absorbance at 260 nm.
Column binding capacity: up to 20 mg
Samples (250 ng) of each recovered band were analyzed
Gel slice mass: 150 mg/rxn by agarose gel electrophoresis. Lane 1 contained a mixture
Typical recovery: 50-90% of the starting DNAs.
1 2 3 4 5
Size range: 150 bp to bp
> 12kb
Time required: < 30 min Gel analysis and quantification of DNA
← 12,000, 52% fragments isolated with the SpinPrep Gel DNA Kit
← 8000, 50% Known amounts (2 mg) of four DNA fragments of the
indicated sizes were run in separate lanes on a 1%
← 1000, 90% agarose gel. Each band was excised and the DNA
extracted from the gel using the SpinPrep Gel DNA Kit
and standard protocol. Recoveries shown as percentages
← 150, 90% above were determined by absorbance at 260 nm.
Samples (250 ng) of each recovered band were analyzed
by agarose gel electrophoresis. Lane 1 contained a mixture
of the starting DNAs.

ON THE
WE
B
Pellet Paint® Co-Precipitant www.novagen.com
/PelletPaint
Rapid, quantitative precipitation of DNA and RNA; excellent for PCR clean-up
Feature Pellet Paint® Co-Precipitant is a visible dye-labeled carrier

• Allows direct visualization and tracking of precipitated formulated specifically for use in alcohol precipitation of
material nucleic acids (McCormick 1995, McCormick 1996). The
2-minute precipitation uses just 2 ml per reaction and requires
Pellet Paint® Co-Precipitant 125 rxn 69049-3 no low-temperature incubations or prolonged centrifugation.
1000 rxn 69049-4
Both RNA and DNA are efficiently precipitated even from
Components dilute solutions (2 ng/ml). The pellet is easily located by
250 ml or 2 ml Pellet Paint Co-Precipitant its vivid pink color and
1 ml or 8 ml 3 M Sodium Acetate pH 5.2
can be easily followed
Pellet Paint Co-Precipitant User Protocol TB146 during washing steps,
inNovations No. 4a, 5, 9, 12, 26 preventing losses during
handling.
Comparison of different carriers Most PCR applications

for precipitation of nucleic acids
benefit from a clean-up
Compatible with Pellet Paint glycogen tRNA step in which primers Pellet Paint pellet (2 ml) under UV and visible
gel electrophoresis —
and other reactants illumination
PCR amplification ? —
are removed and the target DNA is concentrated (Taggart
DNA sequencing —
restriction digestion
1998). Pellet Paint Co-Precipitant is ideal for this cleanup
ligation ? because the procedure is rapid, primers < 50 nt in length
transformation ? are efficiently removed, and the DNA is quantitatively
cDNA synthesis ? recovered. Furthermore, it provides visual confirmation of
kinase reactions — DNA resuspension.
random priming ? —
in vitro transcription ?
Pellet Paint Co-Precipitant is compatible with most molecular
in vitro translation
RNase protection assay ? biology procedures and is free of contaminating nucleic acids
phenol extraction and nucleolytic enzymes. Although it absorbs in the UV
LiCl precipitation — range, accurate spectrophotometric measurements of DNA
bacterial or RNA samples are possible; the absorbance ratio (provided
? ?
electroporation
with each package) can be used as a correction factor when
PEG precipitation ? ?
determining nucleic acid concentration (McCormick 1996).
Recovery of various RNA and DNA Pellet Paint Co-Precipitant is compatible with automated Cy5®
samples with Pellet Paint carrier sequencers. Pellet Paint NF Co-Precipitant is recommended
Sample Incorp. cpm recovered for use with PE Applied Biosystems automated sequencers.
RNA (100 nt, 0.2 ng/ml) 90% References:
RNA (1000 nt, 0.2 ng/ml) 92% McCormick, M. 1995. inNovations 4a, 10.
RNA (10,000 nt, 0.2 ng/ml) 89% McCormick, M. 1996. inNovations 5, 10.
DNA (100-2000 bp, 4 pg/ml) 86% Taggart, E. W., et al. 1998. J. Clin. Microbiol. 36, 3408.
The indicated samples of 32P-labeled RNA and DNA were prepared

using standard protocols for transcription and random priming, Pellet Paint Procedure
respectively. Following the labeling reactions, incorporation was 1. Add 2 ml Pellet Paint or 1 ml Pellet Paint NF Co-Precipitant
determined by DE81 filtration. Known amounts of incorporated plus 0.1 volume 3 M Sodium Acetate to sample and mix briefly.
material (300,000 cpm) were precipitated in the presence of Pellet 2. Add 2 volumes ethanol (or 1 volume isopropanol) and briefly vortex.
Paint. Samples without Pellet Paint Co-Precipitant resulted in a 5- to 3. Incubate at room temperature for 2 min.
50-fold reduction in recovery. 4. Spin sample for 5 min.
5. Discard supernatant. Wash and resuspend pellet.

ON THE
WE

B
Pellet Paint® NF Co-Precipitant www.novagen.com
/PelletPaint
Non-fluorescent visible nucleic acid co-precipitant for automated sequencing applications
Features Pellet Paint® NF Co-Precipitant is a nonfluorescent dye-

• Efficient and rapid precipitation of BigDye® cycle labeled carrier compatible with fluorescent sequencing. It
sequencing products facilitates rapid removal of BigDye Terminators during alcohol
• Efficient removal of dye terminators precipitation of cycle sequencing reaction products. Cycle
• Direct visualization and tracking of precipitated material
sequencing reactions can be precipitated rapidly with 1 ml of
• No effect on sequencing reaction
carrier per reaction and centrifugation times of 10 minutes. The
• Compatible with fluorescent detection applications
easily visualized carrier provides a simple confirmation that
Product Size Cat. No. Price precipitation has occurred.
Pellet Paint® NF Co-Precipitant 125 rxn 70748-3
1000 rxn 70748-4 Sequencing reaction products
are efficiently pelleted and
Components
125 ml or 1 ml Pellet Paint NF Co-Precipitant dye-labeled terminators
1 ml or 8 ml 3 M Sodium Acetate pH 5.2 remain in the supernatant
Additional Information Available during alcohol precipitation
Pellet Paint NF Co-Precipitant User Protocol TB268
using the standard Applied
inNovations No. 10, 26
Biosystems precipitation
protocols. Resuspension of
pelleted sequencing reaction
products in deionized formamide can be confirmed by checking
for dissolution of the carrier. Pellet Paint NF Co-Precipitant is
fully compatible with the ABI PRISM® BigDye Terminator Cycle
Sequencing Ready Reaction. To avoid extra sample handling,
Pellet Paint NF Co-Precipitant can be added directly to the
reaction mix, template DNA, crude PCR samples, or dilution
buffer before the cycle sequencing reaction. Although Pellet
Paint NF absorbs in the UV range, accurate spectrophotometric
measurements of DNA or RNA samples are possible; the
absorbance ratio (provided with each package of Pellet Paint
NF) can be used as a correction factor when determining
nucleic acid concentration. Pellet Paint NF Co-Precipitant has
no detectable effect on the sequencing reaction or sequence
accuracy. Pellet Paint NF Co-Precipitant is a useful substitute
for the original Pellet Paint Co-Precipitant in applications
Cycle sequencing with Pellet Paint NF where fluorescent detection is used.
Pellet Paint NF (2 ml)* was combined with 100 ng plasmid and 1.6 pmol primer in
10 ml BigDye Terminator Cycle Sequencing Reaction performed in 8-well Micro-
Amp® reaction tubes. Following thermal cycling, reaction products were
purified by addition of isopropanol and centrifugation for 10 min at 3000 × g.
Samples were drained by inversion and the plate was spun at low force in an
inverted position. The samples were resuspended in 20 ml Template Suppression
Reagent and run on an ABI PRISM 310 automated sequencer. Sequence data
were identical to those obtained with a control reaction without Pellet Paint NF
(not shown). The read extended beyond 450 bases.
* Note that the standard precipitation reaction uses 1 µl.

PCR • Molecular Size Markers
ON THE
WE
Molecular Size Markers
B
Perfect DNA™ Markers www.novagen.com
/Markers
Convenient, easy-to-remember sizes
Features Perfect DNA™ Markers contain sets of DNA fragments

• Available in three size ranges: with convenient, easy-to-remember sizes for agarose gel
0.05–10 kbp analysis. The markers have uniform band intensities except
0.1–12 kbp for the easily identifiable reference bands, which are useful
0.5–12 kbp for instant band identification. An extra vial of 6X DNA Gel
• Includes 6X Loading Buffer
Loading Buffer is included.
Perfect DNA™ 100 lanes 70087-3 Perfect DNA Markers
Markers, 0.1-12 kbp
Perfect DNA™ 100 lanes 69002-3 0.1–12 kbp 0.5–12 kbp 0.05–10 kbp
kbp kbp kbp
Markers, 0.05-12 kbp 10
– 12 8
6
Perfect DNA™ 100 lanes 70540-3 – 10 – 12 4
–8 – 10
Markers, 0.5-10 kbp –6 –8
3
–6 –2
– 4*
Components – 1.5
Cat. No. 70087 –3 – 4* – 1.4
500 ml Perfect DNA Markers, 0.1–12 kbp –1
–3
in 1X DNA Gel Loading Buffer –2
1 ml 6X DNA Gel Loading Buffer – 1.5
– 0.75
–2
Cat. No. 69002 – 1.5 – 0.5
–1
500 ml Perfect DNA Markers 0.5-12 kbp – 0.4
in 1X DNA Gel Loading Buffer
–1 – 0.3
1 ml 6X DNA Gel Loading Buffer – 0.5*
– 0.4 – 0.2
Cat. No. 70540 – 0.3
1 ml Perfect DNA Markers, 0.05–10 kbp – 0.2 – 0.1
– 0.1 – 0.5
in 1X DNA Gel Loading Buffer – 0.05
1 ml 6X DNA Gel Loading Buffer 1.5% TAE agarose gel* 0.8% TAE agarose gel* 2.0% TAE agarose gel
*higher-intensity reference band

PCR • Molecular Size Markers
ON THE
WE
Molecular Size Markers

B
Perfect DNA™ Ladders www.novagen.com
/Markers
Evenly spaced DNA markers in ready-to-load format
Features The Perfect DNA™ Ladders contain sets of DNA fragments with
• Available in three size ranges: convenient, easy-to-remember sizes for agarose gel analysis.
50–3000 bp The markers have uniform band intensities and cover a wide
100–1000 bp range of DNA sizes. They are supplied in a convenient ready-
500–10,000 bp to-load format containing dye and are ideal for routine use.
• Includes 6X loading buffer
An extra vial of 6X Loading Buffer (for Cat. Nos. 70538-3 and
Product Size Cat. No. Price 70539-3) or 6X DNA Gel Loading Buffer (for Cat. No 70537-3)
Perfect DNA™ 50 bp 100 lanes 70538-3 is included.
Ladder
Perfect DNA™ 100 bp 100 lanes 70539-3 Perfect DNA Ladders
Ladder
Perfect DNA™ 1 kbp 100 lanes 70537-3 50-bp ladder 100-bp ladder 1-kbp ladder
Ladder bp bp kbp
– 3000
Components
– 2000
Cat. No. 70538 – 1000
1 ml Perfect DNA 50 bp Ladder in 1X Loading Buffer – 10
– 900 –8
1 ml 6X Loading Buffer – 800 –6
–5
– 1000 – 700 –4
Cat. No. 70539 – 900 – 600 –3
– 800 – 2.5
500 ml Perfect DNA 100 bp Ladder in 1X Loading Buffer – 700 – 500 –2
1 ml 6X Loading Buffer – 600
– 500 – 400 – 1.5
Cat. No. 70537 – 450
– 400 –1
500 ml Perfect DNA 1kbp Ladder in 1X DNA Gel Loading – 350 – 300
– 300
Buffer – 250
1 ml 6X DNA Gel Loading Buffer – 200 – 200 – 0.5
– 150
– 100
– 100
– 50
2.0% TAE agarose gel 2.0% TAE agarose gel 0.8% TAE agarose gel
ON THE
WE
B
PCR Markers www.novagen.com
/Markers
For accurate sizing of PCR products
Features PCR Markers contain a mixture of eight PCR Markers

• Contains fragments from 50 to 2000 bp defined DNA fragments ranging from 50 bp
• Includes 6X Loading Buffer to 2000 bp at convenient size intervals for

characterizing small DNA products. The – 2000
Product Size Cat. No. Price – 1500
PCR Markers, 50–2000 bp 50 lanes 69278-3
markers are supplied ready-to-use in gel
loading buffer containing two tracking – 1000
Components dyes that do not interfere with UV – 750

250 ml PCR Markers in 1X Loading Buffer
1 ml 6X Loading Buffer illumination of ethidium bromide-stained – 500
bands. A separate vial of 6X Loading
– 300
Buffer is included. Each vial of markers
is enough for 50 lanes on TBE or TAE
– 150
agarose stained with ethidium bromide.
The recommended 5 ml per lane produces – 50
bands of even intensity that are bright,

1.5% TAE agarose gel
sharp, and easy to photograph.

PCR • PCR Cloning
PCR Cloning
Cloning Kits Overview

Efficient, reliable reagents for cloning PCR products
We offer a variety of cloning kits for PCR and DNA overhanging ends are blunt-ended prior to cloning into
fragments. AccepTor™ Vector Kits are designed for cloning the blunt-end, dephosphorylated vector. For demanding
DNA fragments that have a single 3´-dA overhang, typically procedures, GigaSingles™ Cloning Kits contain extremely
generated by non-proofreading, thermostable polymerases. high efficiency NovaBlue Competent Cells. The pSTBlue-1
Perfectly Blunt® Cloning Kits are designed for cloning DNA AccepTor Vector and pSTBlue Perfectly Blunt Vector are
with any type of ends. DNA fragments or PCR products with both available as Giga Cloning Kits.
AccepTor Vector Cloning and Giga Cloning Kit Configurations

pSTBlue-1 AccepTor Vector
Introductory Kits AccepTor Vector Kits AccepTor Vector Giga Cloning Kits
Kit Component 10 rxn 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn
AccepTor Vector 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg
Positive Control Insert 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml
Clonables 2X Ligation
55 ml 2 × 55 ml 4 × 55 ml 2 × 55 ml 4 × 55 ml
Premix
Nuclease-free Water 1.5 ml 1.5 ml 1.5 ml 1.5 ml 1.5 ml
NovaBlue Singles Competent
11 × 50 ml 22 × 50 ml 44 × 50 ml 22 × 50 ml 44 × 50 ml
Cells*
SOC Medium† 2 (or 3) × 2 ml 4 (or 5) × 2 ml 7 (or 9) × 2 ml 4 × 2 ml 7 × 2 ml
Test Plasmid 10 ml 10 ml 10 ml 10 ml 10 ml
* The pETBlue™ AccepTor Vector Kits also contain Tuner™(DE3)pLacl Competent Cells (0.2 ml for 10 rxn, 2 × 0.2 ml for 20 rxn, and 4 × 0.2 ml for
40 rxn). The AccepTor Vector Giga Cloning Kits subsitute NovaBlue GigaSingles for NovaBlue Singles™ Competent Cells.
†
The pETBlue AccepTor Vector Kits contain extra SOC Medium, as indicated in parentheses.
Perfectly Blunt Cloning and Giga Cloning Kit Configurations pSTBlue-1 Perfectly Blunt
Introductory Kits Perfectly Blunt Cloning Kits Blunt Vector Kits Giga Cloning Kits
Kit Component 10 rxn 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn
Blunt Vector 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg
Positive Control Insert 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml
End Conversion Mix 100 ml 100 ml 2 × 100 ml 100 ml 2 × 100 ml 100 ml 2 × 100 ml
T4 DNA Ligase 100 U 100 U 2 × 100 U 100 U 2 × 100 U
Nuclease-free Water 1.5 ml 1.5 ml 1.5 ml 1.5 ml 1.5 ml
NovaBlue Singles™
11 × 50 ml 22 × 50 ml 44 × 50 ml 22 × 50 ml 44 × 50 ml
Competent Cells*
SOC Medium† 2 (or 3) × 2 ml 5 (or 6) × 2 ml 7 (or 9) × 2 ml 4 × 2 ml 7 × 2 ml
Test Plasmid 10 ml 10 ml 10 ml 10 ml 10 ml
* The pETBlue Perfectly Blunt Cloning Kits also contain Tuner(DE3)pLacl Competent Cells. The Perfectly Blunt Giga Cloning Kits subsitute NovaBlue GigaSingles for NovaBlue Singles
Competent Cells.
†
The pETBlue Perfectly Blunt Vector Kits contain extra SOC Medium, as indicated in parentheses.

PCR • PCR Cloning
PCR Cloning
Cloning Kits Overview
Continued
AccepTor™ Vector Kits AccepTor Vector Kit Applications Vector Features

pSTBlue-1 Archiving Opposing SP6/T7 promoters
Subcloning Amp and Kan selection
Procedure time*: Sequencing Dual EcoRI sites flank insert
• 30-minute ligation In vitro transcription
• 8-minute transformation† pETBlue™-1 Protein expression: No fusion tags
T7lac-driven, tightly controlled, Insert provides ATG start codon
Features: high-level expression in E. coli
• Blue/white screening
• > 80% recombinants
Ends required:
• Single 3′- dA overhang
Polymerase compatibility:
• Nonproofreading DNA polymerases
Perfectly Blunt® Cloning Kits
Procedure time*: Perfectly Blunt Cloning Applications Vector Features

pSTBlue-1 Opposing SP6/T7 promoters
• 20-minute end conversion Amp and Kan selection
• 15-minute ligation Archiving Dual EcoRI sites flank insert
• 8-minute transformation† pT7Blue-3 Subcloning T7 promoter
Sequencing Amp or Kan selection
Features: In vitro transcription Dual EcoRI sites flank insert
• Blue/white screening pT7Blue T7 promoter
• > 95% recombinants NdeI/BamHI sites flank insert
• Also compatible with restriction fragments pT7Blue-2 Protein expression: T7 promoter
T7-driven in vitro protein N-terminal S•Tag™ sequence
Ends required: synthesis Optimal Kozak translation initiation
In vitro transcription/translation Xenopus globin 5'-UTR
• Any ends (kit makes blunt ends) Sequencing
Polymerase compatibility: pETBlue-1 T7 promoter
No fusion tag
• Any DNA polymerase Protein expression: Insert provides ATG start codon
pETBlue-2 T7lac-driven, tightly controlled, T7 promoter
high-level expression in E. coli Optional C-terminal HSV•Tag® and
His•Tag® sequences
Vector provides ATG start codon
* All times listed refer to kits using NovaBlue Singles™

Competent Cells. Giga kits, which use NovaBlue
GigaSingles™ Competent Cells, require one hour for
outgrowth.
† Time to plating transformants is with ampicillin
selection. For kanamycin selection, add 30 minutes.

PCR • PCR Cloning
PCR Cloning
AccepTor™ Vector Kits

Rapid, direct cloning with patented UA cloning technology
Features AccepTor™ Vector Cloning Kits are designed to simplify

• Does not require restriction digestion or special primers cloning of PCR products with single 3´-dA nucleotide
• Perform direct ligation of PCR product with vector overhangs, which are generated by non-proofreading
• Compatible with polymerases that leave single 3´-dA thermostable DNA polymerases, such as KOD XL polymerase
overhangs
and native and recombinant Taq polymerases. The linearized
• Blue/white screening with pSTBlue-1 or pETBlue™-1
vectors AccepTor Vector contains single 3´-dU DNA ends that are
• Simple protocol takes as little as 40 min from PCR compatible with direct ligation of these products without
product to plating transformants the need for intermediate reactions. The dU residues are
converted to dT residues in vivo following transformation.
In the AccepTor Vector Kits, vectors are supplied ready-to-
ligate. Simply mix the vector with your PCR product, add
Clonables™ 2X Ligation Premix, and transform into NovaBlue
Singles™ Competent Cells.
Amplify target using AccepTor Vector Kits are available in an introductory

Taq DNA or KOD XL 10-reaction size as well as 20- and 40-reaction configurations.
polymerase.
The linearized AccepTor Vectors are also available separately
without the ligation and transformation components. See
Giga Cloning Kits for information on the pSTBlue-1 AccepTor
Vector Giga Kit with higher-efficiency competent cells.
A
A
LIGATE PCR product
15 min - 2 h AccepTor Vector
2X Ligation Premix
TRANSFORM NovaBlue Singles

8 min Competent Cells
PLATE SOC Medium

0 min incubation (Amp),
30 min incubation (Kan)

PCR • PCR Cloning
PCR Cloning
AccepTor™ Vector Kits
Continued
pSTBlue-1 Kits & DNA Two different vectors, pSTBlue-1 and pETBlue™-1, are
Product Size Cat. No. Price available as AccepTor™ Vector kits. Each is carefully prepared
Introductory pSTBlue-1 10 rxn 70594-3
AccepTor™ Vector Kit and tested for optimal cloning efficiency and provides easy
pSTBlue-1 AccepTor™ Vector 20 rxn 70595-3 visualization of recombinants by blue/white screening using
Kit 40 rxn 70595-4
LacZ a-complementation. The pSTBlue-1 vector is a general
pSTBlue-1 AccepTor™ Vector 20 rxn 71228-3
Giga Kit 40 rxn 71228-4 purpose vector with dual opposed T7 and SP6 promoters, both
pSTBlue-1 AccepTor™ Vector 20 rxn 70596-3 amp and kan resistance cassettes, and an array of flanking
(linearized vector) 40 rxn 70596-4
pSTBlue-1 DNA 20 µg 70199-3 restriction sites. The pETBlue-1 vector is a plasmid specifically
developed to enable high-level T7 RNA polymerase-driven
Components expression of target genes in E. coli, while providing the
See table on page 42 for kit components.
convenience of blue/white screening and high plasmid copy
number. Initial cloning is performed in the non-expression
pETBlue-1 Kits & DNA host NovaBlue, and the recombinant plasmid is transformed
Product Size Cat. No. Price into Tuner™(DE3)pLacI Competent Cells (included in kits) for
Introductory pETBlue™-1 10 rxn 70597-3
AccepTor™ Vector Kit protein expression.
pETBlue™-1 AccepTor™ Vector 20 rxn 70598-3
Kit 40 rxn 70598-4
Primer design for expression of inserts
pETBlue™-1 AccepTor™ Vector 20 rxn 70599-3
(linearized vector) 40 rxn 70599-4 in pETBlue-1 ccep or Vector
pETBlue™-1 DNA 20 µg 70608-3 pETBlue-1 is designed for the expression of unfused proteins from inserts that
have an ATG start codon. The AccepTor cloning site is located just downstream of
Components the T7 gene 10 RBS (ribosome binding site). Amplification of the insert using sense
See table on page 42 for kit components. primers beginning with ATG at the 5’-end will ensure optimal spacing between the
RBS and translation initiation sites for efficient protein synthesis in E. coli. There
are no restrictions on the C-terminal (antisense) primers.
AccepTor Vector Kits User Protocol TB248 Met...
pETBlue System Manual TB249 Sense Primer: 5'-ATGXXX...
Vector Maps and Sequences novagen.com Antisense primer: No restrictions
EcoO109 I
BamH I
EcoR I
Hind III
SnaB I
EcoR I
EcoR I
Sma I
Hinc II
Bst X I
RleA I
Kpn I
Nhe I
Sph I
Apa I
Acc I
Xho I
Avr II
Xba I
Pml I
dU
Sac I
Eag I
Srf I
Mlu I
Not I
Pst I
Sty I
Sal I
dU
T7 dU SP6 dU
la c Z l a cZ tet
lac rrnB terminator
T7
i
or
T7 terminator
f1
ori
gin
pSTBlue-1 pETBlue-1
ori
3851 bp 3476 bp
p
i
Am
Ka Am ig
n p or
f1

PCR • PCR Cloning
PCR Cloning

Efficient cloning of DNA amplified by any polymerase
Features With the Perfectly Blunt® Cloning Kits, DNA with any type
• 7 different vectors available, including pETBlue™ of end can be cloned with high efficiency. DNA products
expression vectors are treated in the end conversion reaction to produce
• No restriction enzymes or special primers required
blunt, phosphorylated ends, which are compatible with the
• Compatible with inserts generated by any DNA
polymerase, regardless of end type generated linearized, dephosphorylated blunt vector.
• Blue/white screening
• Simple protocol takes less than 1 h from PCR product to The Perfectly Blunt Cloning Kits are designed to simplify
plating transformants cloning of DNA generated by PCR using any type of DNA
Primer design for expression of inserts in pT7Blue-2 polymerase. This approach enables the use of high-fidelity
Blunt Vector proofreading enzymes for amplification, which decreases the
pT7Blue-2 is designed for T7 promoter-driven expression in reticulocyte probability of generating mutations in the target sequence.
lysate or lac promoter-driven expression in E. coli of proteins fused In addition, under many conditions blunt cloning is more
with an upstream, cleavable S•Tag™ sequence. The blunt cloning site
(SmaI) is located just downstream from the enterokinase cleavage site efficient than T-cloning, probably because the efficiency
coding sequence. For in-frame cloning of PCR products, the first base of single 3´-dA addition by Taq DNA polymerase varies
of the 5’ (sense) primer is the last base of the CCN proline codon. N can
be any base, however G and A form preferred codons in E. coli. There significantly depending on the sequence context of the DNA
are no restrictions on the design of the C-terminal (antisense) primer. ends, and the number of PCR cycles performed (Novy 1996,
Sense Primer: 5'-NXXX...* Clark 1998, Brownstein 1996, Magnuson, 1996, Hu 1993).
Antisense primer: No restrictions
*where N = any base (completes Pro codon; G or A is recommended) and XXX = With the Perfectly Blunt cloning protocol, you can go
the initial codon of the insert.
from PCR product to plating transformants in less than
Note: For additional information, please refer to User Protocol TB183
one hour with minimal hands-on time. The finished
PCR product is converted to a blunt, phosphorylated
DNA in a 15-minute reaction using premixed reagents.
Following a 5-minute heat inactivation step, the treated
Amplify target using insert is combined with the ready-to-use vector and
any thermostable
DNA polymerase.
pSTBlue-1
EcoO109 I
BamH I
Hind III
SnaB I
EcoR I
EcoR I
Hinc II
Bst X I
RleA I
Kpn I
Nhe I
Sph I
Apa I
Acc I
Xho I
Avr II
Xba I
Pml I
Sac I
Eag I
Mlu I
Not I
Pst I
Sty I
Sal I
T7 SP6
A
pT7Blue-3
EcoO109 I
A
BamH I
Hind III
SnaB I
EcoR I
EcoR I
Hinc II
Bst X I
RleA I
Kpn I
Nhe I
Sph I
Apa I
Acc I
Xho I
Avr II
Xba I
Pml I
Sac I
Eag I
Mlu I
Not I
Pst I
Sty I
Sal I
A A T7
C
CONVERT ENDS PCR Product
End Conversion Mix lac Z
20 min P
i
or
f1
P
o ri
gi n
LIGATE Blunt Vector

15 min Ligase
pSTBlue-1
pT7Blue-3
TRANSFORM NovaBlue Singles
8 min Competent Cells
p
Am
PLATE SOC Medium Ka

n
0 min incubation (Amp),
30 min incubation (Kan)

PCR • PCR Cloning
PCR Cloning
Continued
pSTBlue-1 Kits & DNA

ligated in an optimized 15-minute reaction. An exclusive
8-minute transformation procedure using high efficiency Introductory 10 rxn 70184-3
NovaBlue Singles™ Competent Cells generates recombinant pSTBlue-1 Perfectly
Blunt® Cloning Kit
colonies that are easily visualized by blue/white screening. pSTBlue-1 Perfectly 20 rxn 70191-3
Blunt® Cloning Kit 40 rxn 70191-4
pSTBlue-1 Blunt 20 rxn 70188-3
The Perfectly Blunt® method is not limited to cloning Vector (linearized) 40 rxn 70188-4
PCR products; these kits are also suitable for cloning pSTBlue-1 Perfectly 20 rxn 71229-3
Blunt® Giga Cloning 40 rxn 71229-4
restriction fragments, cDNA, or sheared DNA Kit
using the same protocols. Six different vectors are pSTBlue-1 DNA 20 µg 70199-3
available as Perfectly Blunt Cloning Kits: pETBlue™-1, Components
pETBlue-2, pSTBlue-1, pT7Blue, pT7Blue-2, and pT7Blue-3. Vector See table on page 42 for kit components.
choices include those designed for general cloning, sequencing,

optimal in vitro transcription/translation, and T7-driven protein pT7Blue-3 Kits & DNA
expression in E. coli. Each vector is available in a kit containing Product Size Cat. No. Price
Introductory 10 rxn 70075-3
sufficient reagents for 10, 20, or 40 reactions. pT7Blue-3 Perfectly
Blunt® Cloning Kit
pT7Blue-3 Perfectly 20 rxn 70182-3
“Vector only” kits are also available in 20- and 40-reaction Blunt® Cloning Kit 40 rxn 70182-4
sizes without ligase and competent cells. For highest-efficiency pT7Blue-3 Blunt 20 rxn 70187-3
Vector (linearized) 40 rxn 70187-4
competent cells, use pSTBlue-1 Perfectly Blunt Giga Cloning
pT7Blue-3 DNA 20 µg 70025-3
Kit. (uncut)
Components
References: See table on page 42 for kit components.
Novy, R.E., et al. 1996. inNovations 6, 7.
Clark, J.M. 1988. Nucleic Acids Res. 16, 9677.
Brownstein, J.M., et al. 1996. BioTechniques 20, 1004.
pT7Blue-2 Kits & DNA
Magnuson, V.L., et al. 1996. BioTechniques 21, 700. Product Size Cat. No. Price
Hu, G. 1993. DNA Cell Biol. 12, 763. pT7Blue-2 Perfectly 20 rxn 70190-3
pT7Blue-2 Blunt 20 rxn 70186-3
Vector (linearized) 40 rxn 70186-4
pT7Blue pT7Blue-2 DNA 20 µg 69141-3
Sse8387 I
(uncut)
BamH I
Hind III
EcoR I
Hinc II
Sma I
Nde I
Kpn I
Sph I
Spe I
Acc I
Xba I
Sac I
Ava I
Pst I
Sal I
T7
Components
See table on page 42 for kit components..
pT7Blue-2 enterokinase site
EcoR V
BamH I
Hind III
SnaB I
EcoR I
BseR I
Hinc II
BstX I
PinA I
Msc I
Nco I
Kpn I
Nhe I
Apa I
Acc I
Xho I
Avr II
Xba I
Pml I
Sac I
Eag I
Mlu I
Not I
Pst I
Sal I
T7 globin UTR S•Tag SP6

pT7Blue Kits & DNA
lacZ
Introductory pT7Blue 10 rxn 70183-3
Perfectly Blunt® Cloning
Kit
f1
pT7Blue Perfectly 20 rxn 70189-3

o r ig

in
ori
pT7Blue pT7Blue Blunt Vector 20 rxn 70174-3

pT7Blue-2 (linearized) 40 rxn 70174-4
pT7Blue DNA (uncut) 20 µg 69967-3
Components
A mp See table on page 42 for kit components.

PCR • PCR Cloning
PCR Cloning

Continued
pETBlue-1 Kits & DNA

pETBlue-1
Product
EcoR I
Size Cat. No. Price
Sma I
Srf I
Introductory 10 rxn 70633-3
pETBlue™-1 Perfectly
pETBlue-2
Sse8387 I
Bst1107 I
Blunt® Cloning Kit
Ecl136 II
BamH I
BssH II
Hind III
EcoR I
BsrG I
Nsp V
Sma I
Pvu II
Nco I
Kpn I
Aat II
Xho I
Pml I
Eag I
Pac I
Asc I
Mlu I
Not I
pETBlue™-1 Perfectly 20 rxn 70634-3
Cla I
Pst I
Sal I
HSV•Tag His•Tag
pETBlue™-1 Blunt 20 rxn 70620-3
Vector (linearized) 40 rxn 70620-4 la cZ tet
lac rrnB terminator
pETBlue™-1 DNA 20 µg 70608-3 T7
T7 terminator
Components
See table on page 42 for kit components.
pETBlue-1
ori
pETBlue-2
pETBlue-2 Kits & DNA
Introductory 10 rxn 70635-3 i
n
Am ig
p or
pETBlue™-2 Perfectly f1
Blunt® Cloning Kit
pETBlue™-2 Perfectly 20 rxn 70636-3
pETBlue™-2 Blunt 20 rxn 70621-3
Vector (linearized) 40 rxn 70621-4 Primer design for expression of inserts in pETBlue™-1 and
pETBlue™-2 DNA 20 µg 70609-3 pETBlue-2 Blunt Vectors
(uncut)
pETBlue-1 is designed for the expression pETBlue-2 is designed for the expression
Components of unfused proteins from inserts that have of proteins fused with C-terminal
See table on page 42 for kit components. an ATG start codon. The blunt cloning site HSV•Tag® and His•Tag® sequences to
is located just downstream from the T7 facilitate detection and purification. In
Additional Information Available gene 10 RBS (ribosome binding site). addition, this vector encodes an ATG
Perfectly Blunt Cloning Kits User Protocol TB183 Amplification of the insert using sense start codon 8 base pairs downstream of
pETBlue System Manual TB249 primers beginning with ATG at the 5’- the T7 gene 10 RBS. The blunt cloning
inNovations No. 6, 8 end will ensure optimal spacing between site is located such that the insert will
Vector Maps and Sequences novagen.com the RBS and translation initiation sites specify the fourth amino acid following
for efficient protein synthesis in E. coli. Met-Ala-Ile at the N-terminus of the
There are no restrictions on the design of expressed protein. In order to achieve the
C-terminal (antisense) primer. correct reading frame, the 5’-end of the
insert (and the sense PCR primer) should
Met... begin with the third base of the Ile/Met
Sense Primer: 5'-ATGXXX... codon. To express a target protein fused
Antisense primer: No restrictions with C-terminal HSV•Tag and His•Tag
peptides, the antisense primer should
begin with two bases in any combination
except TA or CA, and specify an antisense
codon beginning with the third base.
MetAlaIle....insert.....Ser
Vector:
ATGGCGATNXXX...........ATCC
TACCGCTA..........YYYNNTAGG
Sense Primer:
5'-NXXX......
If N = G, Met codon is generated
instead of lle.
Antisense primer:
5'-NNYYY.....
If NN = CA or TA, stop codon is
generated in sense strand.

PCR • PCR Cloning
PCR Cloning
Clonables™ Ligation/Transformation Kit
Simple, reproducible ligation and transformation—in as little as 23 minutes
Features The Clonables™ Kit enables convenient, dependable, high-

• Rapid 15-min ligation, 8-min transformation with efficiency ligation and transformation of any compatible
ampicillin selection DNA ends. The kit features a unique, universal Ligation
• Premixed ligation components decrease pipetting steps Premix, containing ligase, buffer, and cofactors, which
and increase reliability
supports ligation of any type of DNA cohesive or blunt ends
• One reaction condition, optimized for cohesive ends,
single base overhangs, and blunt ends in a 15-minute reaction. Ligated DNA is transformed into
• Single-use competent cells eliminate need to aliquot, NovaBlue Singles™ Competent Cells, which use a streamlined
freeze/thaw, or waste partially used vials protocol that takes less than 8 minutes for ampicillin-resistant
• Compatible with PCR buffer, TE, restriction enzyme buffer, plasmids and 38 minutes for other antibiotic-resistant
and End Conversion Mix
plasmids. This kit can be used with a variety of cloning
Product Size Cat. No. Price vectors and is compatible with any type of DNA end, without
Clonables™ Ligation/ 11 rxn 70526-3
Transformation Kit
altering the ends or desired cloning junctions.
Components The Clonables Kit contains sufficient reagents to perform 11

55 ml Clonables 2X Ligation Premix
10 ml Clonables Positive Control ligation and transformation reactions, and includes a control
1.5 ml Nuclease-free Water
11 × 50 ml NovaBlue Singles Competent Cells
vector and insert mix to verify performance.
2 × 2 ml SOC Medium
10 ml Test Plasmid

Clonables Kit User Protocol TB233
inNovations No. 9
Clonables™ 2X Ligation Premix

Single solution for optimal ligation in 15 minutes
Product Size Cat. No. Price The Clonables 2X Ligation Premix is a single solution
Clonables™ 2X 55 µl 70573-3 containing optimized concentrations of the highest quality T4
Ligation Premix 2.5 ml 70573-4
DNA ligase, buffer, stabilizer, and cofactors needed for efficient
Additional Information Available ligation of any type of compatible DNA ends. The premix is
Clonables Kit User Protocol TB233
tested for ligation of compatible 2- to 4-base cohesive DNA
ends as well as blunt ends and single-base overhangs found on
some PCR products. Under most conditions excellent ligation
occurs in only 15 minutes. With T/A or U/A overhangs, more
colonies can be obtained by incubating for up to two hours.
Although maximal efficiencies are obtained using NovaBlue
Singles Competent Cells, this reagent is compatible with
transformation of any type of chemically competent cells.
The high performance, minimal pipetting requirement, and
single-addition format make the premix suitable for high-
throughput applications.
One vial of the 2X Ligation Premix contains enough reagent

for 11 ligation reactions (10-µl scale).

PCR • PCR Cloning
PCR Cloning
NovaBlue Competent Cell Formats

High efficiency and convenient aliquot sizes for reduced cell waste
NovaBlue is a K-12 strain ideally suited as an initial cloning use tubes); HT96™ format (20-ml volume in a 96-well plate);
host due to its high transformation efficiency, blue/white and a standard format (0.2-µl volume sufficient for ten
screening capability (with appropriate plasmids), and recA transformations). For applications in which animal-derived
and endA mutations, which result in high yields of high- products are prohibited, Veggie™ Singles are prepared with
quality plasmid DNA. NovaBlue competent cells come in a animal-free reagents. Please refer to the table at right and the
variety of formats including: Singles™ format (50-ml single- following pages for more information.
NovaBlue
Competent Cells Transformation Efficiency* Reaction Size Application
GigaSingles™ > 1.0 × 109 cfu/mg 50 ml High-efficiency cloning
Singles > 1.5 × 108 cfu/mg 50 ml Routine cloning
Veggie Singles > 1.5 × 108 cfu/mg 50 ml Applications requiring
nonanimal-derived materials
Routine cloning
HT96 > 1.0 × 108 cfu/mg 96 × 20 ml High-throughput cloning
Standard > 1.5 × 108 cfu/mg 20 ml Routine cloning
* Measured as cfu/µg test plasmid
NovaBlue Genotype:
endA1 hsdR17(rK12– mK12+) supE44 thi-1 recA1 gyrA96
relA1 lac F’[proA+B+ lacIqZM15::Tn10] (TetR)
ON THE
WE
NovaBlue GigaSingles™ Competent Cells
B
www.novagen.com
/CompCells
109 efficiency in chemically competent cells
Features NovaBlue GigaSingles™ Competent Cells produce >1 × 109

• Guaranteed efficiency >1 × 109 cfu/µg colonies/µg plasmid DNA for cloning applications requiring
• Ideal for high-efficiency cloning high-efficiency transformations.
• Enables production of high-quality plasmid DNA
• Easy-to-use Singles format
• Prepared using an optimized chemical method

NovaBlue GigaSingles™ 11 rxn 71227-3
Competent Cells 22 rxn 71227-4
Components
11 × 50 ml or 22 × 50 ml Competent Cells
2 × 2 ml or 4 × 2 ml SOC Medium
10 ml Test Plasmid

PCR • PCR Cloning
ON THE
PCR Cloning
WE
NovaBlue Singles™ Competent Cells
B
www.novagen.com
/CompCells
Cost-effective, high-efficiency transformation of E. coli in less than 8 minutes
Features NovaBlue Singles™ Competent Cells, like all Novagen® Singles

• Guaranteed efficiency >1.5 × 108 cfu/µg Competent Cells, are designed for ultimate convenience and
• Provided frozen as single-use tubes in reliability in plasmid transformation. The cells are grown and
11-reaction or 22-reaction kits
made chemically competent using an optimized procedure. Cells
• Reliably high transformation efficiency
are provided in 50-µl
• Enables high-quality plasmid DNA preparation
• Rapid: perform transformation directly in the supplied volumes to eliminate
tube the need to aliquot,
freeze/thaw, or waste
NovaBlue Singles™ Competent Cells 11 rxn 70181-3
partially used vials.
22 rxn 70181-4 This saves time, money,
NovaBlue Competent Cells 0.4 ml 69825-3
1.0 ml 69825-4
and ensures reliable
cell performance. To
Components
Catalog No. 70181
use, simply thaw, add DNA, incubate five minutes on ice,
11 × 50 ml or 22 × 50 ml Singles Competent Cells heat shock for 30 seconds, place on ice for two minutes, add
10 µl Test Plasmid SOC Medium, and plate directly (when selecting for ampicillin
resistance) or after incubation at 37˚C for 30 minutes (when
Catalog No. 69825
2 x 0.2 ml or 5 x 0.2 ml Competent Cells selecting for other antibiotic resistances).
10 µl Test Plasmid
ON THE
WE
NovaBlue T1R Singles™ Competent Cells
B
www.novagen.com
/CompCells
Resistant to T1 and T5 phage
Features The NovaBlue T1R strain has the same features as NovaBlue,
• Guaranteed efficiency >1.5 × 10 cfu/µg
8
with the added benefit of being resistant to T1 and T5 phage.
• Resistant to T1 and T5 phage NovaBlue is a K-12 strain ideally suited as an initial cloning
host because it has high transformation efficiency, blue/white
screening capability (with appropriate plasmids), and mutations
• Prepared using an optimized chemical method
in endA and recA, which result in high yields of high-quality
Product Size Cat. No. Price plasmid DNA.
NovaBlue T1R Singles™ 11 rxn 71318-3 NovaBlue T1R Genotype:
Competent Cells 22 rxn 71318-4 endA1 hsdR17 (rK12– mK12+) supE44 thi-1 recA1 gyrA96 relA1 lac tonA F’[proA+B+
lacIqZM15::Tn10] (TetR)
Components
11 × 50 ml or 22 × 50 ml NovaBlue T1R Singles Competent Cells
10 ml Test Plasmid

PCR • PCR Cloning
DM ON THE
A
WE
PCR Cloning
B
*A nima l- D
Veggie™ NovaBlue Singles™ Competent Cells www.novagen.com
riv
F
e
ed
M a te ria ls
R E E /CompCells
Certified animal-free chemically competent cells
Features Veggie™ NovaBlue Singles™ Competent Cells are appropriate

• Guaranteed efficiency >1.5 × 108 cfu/µg for standard cloning applications when absence of animal-
• Manufactured free of animal-derived media and derived components is essential. NovaBlue is a K-12 strain
components
ideally suited as an initial cloning host due to its high
• Reproducible high-efficiency cloning
transformation efficiency, blue/white screening capability
(with appropriate plasmids), and mutations in recA and endA,
• Prepared using an optimized chemical method which result in excellent yields of high-quality plasmid DNA.
Veggie NovaBlue Singles Competent Cells are supplied with an
animal-free prepared SOC medium.
Veggie™ NovaBlue Singles™ 11 rxn 71251-3
Competent Cells 22 rxn 71251-4
NovaBlue Genotype:
Components endA1 hsdR17(rK12– mK12+) supE44 thi-1 recA1 gyrA96
11 × 50 ml or 22 × 50 ml Veggie NovaBlue Singles Competent Cells relA1 lac F’[proA+B+ lacIqZM15::Tn10] (TetR)
2 × 2 ml or 4 × 2 ml Veggie SOC Medium
10 µl Test Plasmid
ON THE
WE
B
Zappers™ Electrocompetent Cells www.novagen.com
/CompCells
1010 cloning efficiency in phage-resistant strains
Features NovaXG and NovaXGF´ Zappers™ Electrocompetent Cells

• Conveniently packaged combine favorable genotypes with high-transformation
• Guaranteed transformation efficiency of efficiency for the most demanding cloning applications. Both
>1 × 1010 cfu/µg cell types have tonA mutations conferring resistance to T1
• Methylation restriction minus
and T5 phage. NovaXG features deletion of genes involved in
• Recombination and restriction minus
restriction of methylated DNA [(mcrC–mrr)], and recA and
• Resistant to T1 and T5 phage
• Enables blue/white screening by α-complementation with endA mutations, which facilitate excellent yields of high-quality
appropriate plasmids plasmid DNA. The lacZ w fragment is expressed constitutively
from the genome of NovaXG and allows blue/white screening
NovaXG Zappers™ Electrocompetent 10 rxn 71315-3 for recombinants by lacZ α-complementation.
Cells 20 rxn 71315-4
NovaXGF’ Zappers™ 10 rxn 71317-3
Electrocompetent Cells 20 rxn 71317-4
NovaXGF´ cells have the same genotype as NovaXG, but
harbor an F´ episome which confers tetracycline resistance and
Components
5 × 50 ml or 10 × 50 ml NovaXG or XGF' Zappers
allows infection by M13 for single strand DNA production.
Electrocompetent Cells Because the F´ carries the lacIq repressor gene, addition of
10 ml Test Plasmid
IPTG is required for blue/white screening of recombinants. In
NovaXG Genotype:
the absence of IPTG, transcription of insert DNA from the lac
F– mcrA (mcrC-mrr) endA1 recA1 φ80dlacZM15 lacX74
araD139 (ara-leu)7697 galU galK rpsL nupG λ– tonA promoter is kept to a minimum.
NovaXGF’ Genotype:
mcrA (mcrC-mrr) endA1 recA1 f80dlacZM15 Both NovaXG and NovaXGF´ strains are manufactured for
lacX74 araD139 (ara-leu)7697 galU galK rpsL ultra-high transformation efficiency (>1 × 1010 cfu/µg) by
nupG l tonA F’[lacIq Tn10] (TetR)
electroporation. Ultra-high efficiency is especially important
when working with limited amounts of DNA or when
constructing raries. Cells are packaged at two reactions per
tube to minimize waste.

PCR • PCR Cloning
ON THE
PCR Cloning
WE
HT96™ NovaBlue Competent Cells
B
www.novagen.com
/CompCells
High-efficiency competent cells predispensed in a 96-well plate for high-throughput applications
Features HT96™ NovaBlue Competent Cells are designed for high-

• Guaranteed efficiency >1 × 108 cfu/mg throughput transformation. The cells are predispensed in 20-µl
• High-throughput, 96-well format volumes in a sturdy 96-well polypropylene plate compatible
with a variety of thermal cyclers and water baths. Wells are
HT96™ NovaBlue Competent Cells 1 plate 71011-3 individually sealed and have raised rims to prevent cross-
4 plates 71011-4 contamination. Seals can be pierced with standard pipet tips or
Components
1 or 4 plates HT96 NovaBlue Competent Cells
removed for easier access. Strips of caps are also provided for
1 × 14 ml or 4 × 14 ml SOC Medium reliable sealing during manipulation and storage. Groups of
1 × 10 ml or 2 × 10 ml Test Plasmid
1 or 4 pkg 8-Cap Strips 24 wells can be easily split from the plate for processing smaller
1 or 4 Reagent Reservoirs
numbers of samples.
HT96™ Isothermal Block

Efficient thermal transfer to samples in an HT96 plate
Product Size Cat. No. Price The HT96 Isothermal Block is an anodized aluminum, solvent-
HT96™ Isothermal Block 1 ea 71195-3 resistant block specifically designed to hold one HT96 plate
and to provide efficient thermal transfer to samples held
within the 96-well plate. Using an HT96 Isothermal Block for
each temperature, samples can be rapidly transferred between
the low-temperature and heat-shock steps in transformation
protocols. Simply preincubate the anodized aluminum block
at the desired temperature and place the HT96 Competent Cell
plate in the block. The HT96 Isothermal Block is compatible
with most 96-well PCR plates and robotic platforms.

PCR • Molecular Biology Essentials
ON THE
WE
Molecular Biology Essentials
B
Molecular Biology Reagents www.calbiochem.com
/MolecularBiology
Product Size Cat. No. Price Ethidium Bromide Absorber

Agarose, Type I, Molecular Biology 100 g 121853 Safely remove ethidium bromide
Grade 500 g
EDTA, 0.5 M, pH 8.0, Molecular 100 ml 324506 Gray-brown suspension. Developed specifically for the safe
Biology Grade, DEPC-Treated and simple removal of ethidium bromide (EtBr) from aqueous
EDTA, Disodium Salt, Dihydrate, 100 g 324503 staining solutions and running buffers used in nucleic acid
Molecular Biology Grade 1 kg
separation gels. Typical concentrations in these solutions are
Ethidium Bromide 1g 331564 0.5-10 mg/L. EtBr is bound and concentrated by the adsorber
Ethidium Bromide Adsorber 1 ea 331569
column, allowing filtrate removal. Each column normally
binds at least 300 mg of ethidium bromide from TAE or TBE
Formaldehyde, Molecular Biology 250 ml 344198
buffers. Residual capacity is easily visualized because the EtBr
Grade
X-Gal Solution 3 ml 71077-3 appears as a dark red to black band on the column. As long as
this band has not reached the bottom of the column bed, the
Sodium Chloride Tablets 1 ea 567442
(10 tablets) concentration of dye is still below the column capacity.
EC 214-984-6, RTECS SF7950000,
CAS 1239-45-8. Merck Index: 14, 4731
Agarose, Type 1, Molecular Biology Grade
For nucleic acid electrophoresis Formaldehyde, Molecular Biology Grade
CH2O
Suitable for the preparation of gels for nucleic acid
electrophoresis. Gel strength: ≥1200 g/cm2. A solution of 37% by weight of formaldehyde gas in water,
PROTECT FROM MOISTURE. Gelling range (1.5%): 36-39°C. with 10% methanol added to prevent polymerization. Useful
Melting range: 87-89°C. EEO -mr: ≤0.10. Contaminants: as a preservative, stabilizer, and disinfectant.
Sulfate: ≤0.15%; DNase, RNase, protease: none detected. Purity: ≥37% by acidometry. Contaminants: RNases: none
EC 2327318, CAS 9012-36-6. detected. Heavy metals: 0.0002% (as Pb).
RTECS LP8925000, CAS 50-00-0. Merck Index: 14, 4235. R:
EDTA, 0.5M, pH 8.0, Molecular Biology Grade, 23/24/25-34-40-43; S: 26-36/37/39-45-51.
DEPC-Treated
Ethylenediaminetetraacetic Acid Trisodium Salt X-Gal Solution
For blue/white screening
Sterile-filtered solution of 0.5 M EDTA in H2O treated with
diethyl pyrocarbonate (DEPC). Suitable for use in molecular The β-galactosidase substrate X-Gal
biology applications. (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) is a
CAS 150-38-9. chromogenic stain for b-gal activity. It is commonly used
to distinguish between recombinants and nonrecombinants
EDTA, Disodium Salt, Dihydrate, by lacZ α-complementation with appropriate vectors and
Molecular Biology Grade hosts. X-Gal Solution is provided as a convenient 40 mg/ml
Ethylenediaminetetraacetic Acid, 2Na concentrate in DMSO (3 × 1-ml tubes), ready for dilution into
culture medium or appropriate buffers.
A chelating agent used to sequester divalent and trivalent
metal ions. HYGROSCOPIC. Contaminants: DNases, proteases,
Sodium Chloride Tablets (10 Tablets)
RNases: none detected.
Each tablet contains 9 g sodium chloride. Note: 1 each = 10
RTECS AH4410000,
tablets.
CAS 6381-92-6. Merck Index: 14, 3517 R: 22.
RTECS VZ4725000, CAS 7647-14-5.
Ethidium Bromide
Nucleic acid stain
Red to purple solid. PROTECT FROM LIGHT. Fluorescent dye

that produces fluorescent intercalation complexes with DNA.
Suitable for use in gel electrophoresis and DNA isolation
procedures.
Purity: 95% HPLC.
EC 214-984-6, RTECS SF7950000,
CAS 1239-45-8. Merck Index: 14, 4731

ON THE
WE

Molecular Biology Grade Buffers
B
www.calbiochem.com
/MolecularBiology
Product Size Cat. No. Price Tris Buffer, 100 mM, pH 7.4, Molecular Biology
HEPES, Free Acid, Molecular 25 g 391340 Grade
Biology Grade 250 g
Sterile 100 mM solution, pH 7.4. Widely used biological buffer.
Tris Base, Molecular Biology Grade 500 g 648310
2.5 kg Suitable for DNA and RNA applications. Contaminants: DNases,
Tris Buffer, 1.0 M, pH 8.0, 100 ml 648314 RNases: none detected.
Molecular Biology Grade
Tris Buffer, 100 mM, pH 7.4, 100 ml 648315 RTECS TY2900000, CAS 77-86-1. Merck Index: 14, 9772.
Molecular Biology Grade R: 36/38; S: 26.
TAE Buffer, 10X, Molecular Biology 1L 574797
Grade
TAE Buffer, 10X, Molecular Biology Grade
TE Buffer, 100X, Molecular Biology 1l 574793
Grade Tris-Acetate-EDTA Buffer
TBE Buffer, 10X, Molecular Biology 1L 574795 Used in the preparation of agarose gels and as a running
Grade
buffer for nondenaturing nucleic acid electrophoresis. TAE
is recommended over TBE for preparative gels. With a lower
HEPES, Free Acid, Molecular Biology Grade buffering capacity than TBE, recirculation of buffer during
N-2-Hydroxyethylpiperazine-N’-2-ethanesulfonic Acid extended electrophoresis is recommended. Supplied as 10X
A zwitterionic N-substituted aminosulfonic acid buffering solution containing 400 mM Tris acetate, 10 mM EDTA, pH 8.3.
agent suitable for use with proteins, nucleic acids, and cell
culture. pKa 7.48 at 25°C. Useful in the pH 6.8-8.2 range.
TE Buffer, 100X, Molecular Biology Grade
A widely-used buffer for nucleic acids. This concentrated
Maintains buffering capacity at low temperatures. Purity:
formulation is 1M Tris, 100 mM EDTA, pH 8.0.
≥99% by alkalimetric assay. Contaminants: DNase, RNase, and
protease: none detected. Heavy metals: ≤0.0005%. pKa 7.55.
TBE Buffer, 10X, Molecular Biology Grade
RTECS TL6809000, CAS 7365-45-9. Merck Index: 14, 4654. Tris-Borate-EDTA Buffer
Used in the preparation of agarose gels and as a running buffer

Tris Base, Molecular Biology Grade
for nondenaturing nucleic acid electrophoresis. TBE has better
tris(Hydroxymethyl)aminomethane
buffering capacity than TAE, so recirculation of buffer during
Widely used to prepare buffers for nucleic acids. pKa 8.1 at extended electrophoresis is not necessary. TBE is not recommended
25°C. Useful in the pH range of 7.0-9.0. Purity: ≥99% by for preparative gels. The 10X concentrate is 0.89 M Tris, 0.89 M
titration test (perchloric acid titration). Contaminants: RNases, boric acid, 20 mM EDTA, pH 8.3.
DNases, proteases: none detected. Absorbance (260 nm): Contaminants: DNase, RNase, protease: none detected.
≤0.03; (280 nm): 0.02. Heavy metals: ≤0.0005%. pKa 8.30 at
R: 36/37/38; S: 36/37/39
20°C.
RTECS TY2900000, CAS 77-86-1. Merck Index: 14, 9772. R:
36/38; S: 26.
Tris Buffer, 1.0 M, pH 8.0, Molecular Biology

Grade
Sterile 1 M solution. Suitable for DNA and RNA applications.
Contaminants: DNases, RNases: none detected.
RTECS TY2900000, CAS 77-86-1. R: 36/38; S: 26.

ON THE
WE
Molecular Biology Enzymes
B
www.calbiochem.com
/MolecularBiology
Product Size Cat. No. Price DNase I, RNase free and DNase I, ds Qualified
DNase I, RNase free 1000 U 69182-3 For applications in which maintenance of RNA integrity is critical
DNase I, ds Qualified 50 U 69164-3
Phosphatase, Alkaline, Calf 1000 U 524576
RNase-free DNase I digests either single- or double-stranded DNA,
Intestine, Molecular Biology producing a mixture of mono- and oligonucleotides. Purified to be
Grade free of RNase, this preparation is qualified for applications in which
maintenance of RNA integrity is critical. The enzyme selectively
degrades DNA in the presence of RNA and can be used to remove
DNA template following in vitro transcription reactions. This enzyme
is also useful in other applications such as DNase footprinting and
nick translation. For applications requiring the use of DNase I for
random double-stranded cleavage of DNA, use DNase I, ds Qualified.
This is a select list of our Unit definition: One unit will degrade
molecular biology reagents. 1 µg DNA in 10 minutes at 37˚C. The reaction mixture (50 µl)
contains 80 mM HEPES pH 7.5, 10 mM NaCl, 5 mM MgCl2, 10 mM
DTT, 1 µg plasmid DNA, and enzyme.
For a comprehensive listing, see the
Calbiochem catalog or visit Phosphatase, Alkaline, Calf Instestine, Molecular
www.calbiochem.com/molecularbiology Biology Grade
Dephosphorylation of nucleic acids
Calf Intestine Alkaline Phosphatase catalyzes the hydrolysis of

5´-terminal phosphates of DNA, RNA, and deoxy- and ribonucleoside
triphosphates (Moessner 1990). The enzyme will dephosphorylate
vector DNA to prevent “empty vector” religation in cloning
experiments, and remove 5´-phosphate groups in preparation for
labeling with polynucleotide kinase. Specific activity is 2000 U/mg
protein. No contaminating DNase or RNase are detected. Supplied
as a liquid in 25 mM Tris-HCl, 1 mM MgCl2, 100 μM ZnCl2, 50%
glycerol, pH 7.6. pH optimum is 8.0–10.5, pI 5.7. EC 3.1.3.1, CAS
9001-78-9, M.W. 140,000.
Unit definition: One unit is defined as the amount of enzyme that
will hydrolyze 1.0 mmol of pNPP per minute at 37˚C, pH 9.8.
Reference: Moessner, E., et al. 1980. Hoppe-Seylers Z. Physiol. Chem. 361, 543.

ON THE
WE

Molecular Biology Enzymes
B
www.calbiochem.com
/MolecularBiology
Merck Index 13, 8286.Reference: Moessner, E., et al. 1980. Hoppe-Seylers Z.

Physiol. Chem. 361, 543.
Proteinase K Solution, 600 2 ml 71049-3
mAU/ml 10 ml 71049-4
Proteinase K, Lyophilized 100 mg 70663-4 RNase A Solution
500 mg 70663-5 Convenient solution for selective degradation of RNA
RNase A, Protease-Free, Highly 10 KU 556746
Purified, Bovine Pancreas 50 KU RNase A Solution is a convenient alternative to powdered
RNase A Solution 1 ml 70856-3 RNase A. It is a highly purified preparation of bovine pancreatic
T4 DNA Ligase 100 U 69839-3 ribonuclease A suitable for use in selective removal of RNA. It
500 U 69839-4 has been pretreated to remove DNase I and is suitable for RNA
T4 Polynucleotide Kinase 250 U 69248-3
digestion in plasmid purification procedures. Supplied at a
concentration of 10 mg/ml in 10 mM Tris-HCl, 1 mM EDTA, 50%
glycerol, pH 7.5.
Proteinase K T4 DNA Ligase
Efficient removal of proteins from nucleic acid solutions
Qualified for the most stringent cloning conditions
Proteinase K is a highly active 28,904-Da serine protease
T4 DNA Ligase catalyzes the formation of phosphodiester bonds
isolated from the fungus Tritirachium album. The enzyme
between 3´-hydroxyl and 5´-phosphate groups of adjacent DNA
exhibits broad cleavage specificity on native and denatured
and RNA nucleotides in blunt-end or cohesive-end configurations.
proteins and is widely used in the purification of DNA and
The enzyme joins RNA and DNA strands only in duplex molecules
RNA. Its activity is increased in the presence of denaturants
and does not join single-stranded nucleic acids. Novagen® T4
such as SDS (1%) and elevated temperature (50–60˚C). The
DNA Ligase is rigorously tested in a blue-white cloning assay
recommended working concentration is 50–100 µg/ml for
under conditions that maximize exposure of DNA ends to any
protein removal and enzyme inactivation, and up to 2 mg/
contaminating nucleases. The enzyme is qualified for any ligation
ml for tissue treatment. The Proteinase K, Lyophilized powder
or cloning application.
can be prepared as a 20 mg/ml stock solution in water and
stored in aliquots at –20˚C. The enzyme is also available as Unit definition: 4 Weiss units/µl; one Weiss unit is defined as the
a ready-to-use concentrated stock solution (600 mAU/ml) amount of enzyme required to catalyze the exchange of 1 nmole
that is convenient for routine use in most applications. 1 mg 32
P from pyrophosphate into ATP as Norit®-absorbable material
of Proteinase K is the equivalent of 30 mAU (AU = Anson in 20 minutes at 37˚C. 0.01 Weiss unit is the amount of enzyme
unit). Proteinase K products are free of detectable DNase and required to ligate > 95% of 1 µg bacteriophage λ HindIII fragments
RNase. at 16˚C in 20 minutes.
Unit definition: One AU (AU = Anson unit) is defined as

the amount of enzyme that liberates 1.0 mmol (181 mg) of T4 Polynucleotide Kinase
tyrosine from casein per minute at pH 7.5 at 37˚C. Qualified for the most stringent cloning conditions
T4 Polynucleotide Kinase (PNK) catalyzes the transfer of the

Ribonuclease A, Protease-Free γ-phosphate from ATP to the 5´-hydroxyl of single and double
Dephosphorylation of nucleic acids stranded DNA or RNA. This activity makes PNK useful for 5´–end
labeling of DNA or RNA molecules for hybridization probes or
Ribonuclease A, Protease-Free is a chromatographically
labeled primers for sequencing. The enzyme is also useful for
purified, pyrimidine-specific endoribonuclease that acts on
preparing non-radioactive phosphorylated DNA for cloning or PCR
single-stranded RNA. Supplied lyophilized.
primers.
Unit definition: One unit is defined as the amount of enzyme
Novagen PNK has been rigorously tested for contaminating
that will catalyze the hydrolysis of RNA to yield a first-order
exonuclease, endonuclease, and ribonuclease activities. For
velocity constant equal to 1.0 at 25˚C, pH 5.0.
convenience and reliable performance, 10X Kinase Buffer and ATP
solution are provided with the enzyme.
Unit definition: One unit is defined as the amount of enzyme

required to catalyze the transfer of 1 nmol phosphate to the
5´-OH end of an oligonucleotide from [γ-32P]ATP in 30 min. Unit
assay conditions: 40 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM
DTT, 0.1 mM [γ-32P]ATP, and 0.5 mM 5´-OH polynucleotide end
concentration.

D-Tube™ Dialyzers
Dialysis and electroelution from polyacrylamide or agarose gels
Features: The D-Tube™ Dialyzers can be used for dialysis and

• Easy-to-handle dialyzers for buffer exchange and removal electroelution of proteins, RNA, DNA, and oligonucleotides
of detergents and urea from polyacrylamide or agarose gels. The disposable, single-
• One-step procedure that does not require syringes or any use tubes require no syringes, microcentrifuge, or laborious
special equipment
steps to manipulate small sample volumes. The sample is added
• Typical volume recovery of sample in solution >97%
• Free of Protease, RNAse, DNAse, and PCR products and removed using a standard laboratory pipette. Available
• Ideal for electroelution of proteins, protein-DNA with molecular weight cutoffs (MWCO) from 3.5 to 14 kDa, the
complexes, oligonucleotides, DNA, and RNA from D-Tube Dialyzers are designed in three volume capacities: mini
polyacrylamide and agarose gels
(10–250 µl), midi (50–800 µl), and maxi (500–3000 µl). The
Product Size Cat. No. Price membrane is ultra-clean, EDTA-treated regenerated cellulose,
D-Tube™ Dialyzer Mini, MWCO 1 kit 71504-3 sulfur- and heavy metal-free. Each kit contains 10 D-Tube
6-8 kDa b
D-Tube™ Dialyzer Mini, MWCO 1 kit 71505-3
Dialyzers and one floating rack that can hold up to four D-Tube
12-14 kDa b Dialyzers in the exchange buffer.
D-Tube™ Dialyzer Midi, MWCO 1 kit 71506-3
3.5 kDa b
D-Tube™ Dialyzer Midi, MWCO 1 kit 71507-3
6-8 kDa b
D-Tube™ Dialyzer Maxi, MWCO 1 kit 71508-3
3.5 kDa b
6-8 kDa b
12-14 kDa b
Floating Rack, Mini 10 racks 71512-3
Floating Rack, Midi 10 racks 71513-3
Floating Rack, Maxi 10 racks 71514-3
Components
Cat. No. 71504 – 71510
10 D-Tubes
1 Floating Rack

D-Tube Dialyzer Mini, Midi, Maxi and
D-Tube96 User Protocol TB422
inNovations Nos. 21, 27
D-Tube Dialyzer Size Volume MW Cutoff

Mini 10 to 250 µl 6-8 kDa
10 to 250 µl 12-14 kDa
Midi 50 to 800 µl 3.5 kDa
50 to 800 µl 6-8 kDa
Maxi 100 to 3000 µl 3.5 kDa
100 to 3000 µl 6-8 kDa
100 to 3000 µl 12-14 KDa


D-Tube™ Electroelution Accessory Kit
Optimized reagents for protein and nucleic acid precipitation following electroelution
Features: The combination of D-Tube™ Dialyzers and the D-Tube

• Efficient extraction of protein, protein-DNA complexes, Electroelution Accessory Kit provides a unique tool for
oligonucleotides, DNA, and RNA from 1D and 2D extraction of any protein, protein-protein complex, or
polyacrylamide
protein-DNA complex from non-denaturing and denaturing
and agarose gels
• More than 60% protein recovery (SDS) polyacrylamide gels with 60% recovery yield in
• More than 90% recovery of oligonucleotides , RNA, and less than 2 hours. Extracted proteins are compatible with
DNA from 15 nt to 80 kb in size most downstream applications such as MALDI-MS, animal
• Procedure compatible with variety of downstream immunization for antibody production, HPLC, peptide mapping,
applications including MALDI-MS, functional assays, and
HPLC and functional assays. In addition, D-Tube Dialyzers can be
used for oligonucleotides, RNA, and DNA extraction from
Product Size Cat. No. Price both polyacrylamide and agarose gels. Efficient extraction
D-Tube™ Electroelution 1 kit 71511-3
Accessory Kit (> 90%) is achieved for 15-nt oligos and for DNA fragments of
up to 80 kb. The D-Tube Electroelution Accessory Kit provides,
Components
1 ml MS Precipitation Buffer three D-Tube support trays, one for each size D-Tube which
10 ml TCA, 20%
2 × 1 ml 3 M NaAc, pH 5.2
is compatible with most commercially available horizontal
3 Supporting Trays, Mini, Midi, Maxi electrophoresis units and optimized reagents for protein and
nucleic acid precipitation following electroelution.
For any questions on our PCR portfolio,

contact your local sales representative
or Technical Support.

Argentina Hong Kong Pakistan
Merck Quimica Argentina S.A.I.C. Onwon Trading Limited Merck (Private) Limited
Tel: +54 11 4546 8100 Tel: +852 2757 7569 Tel: +92 21 455 9210
Fax: +54 11 4546 7369 Fax: +852 2757 7211 Fax: +92 21 453 5294
E-mail: mveltri@merck.com.ar E-mail: info@onwon.com.hk E-mail: lab@merck.com.pk
www.merck.com.ar www.onwon.com.hk www.merck.com.pk
Australia India Peru

Merck Pty. Limited Merck Specialities Private Limited Merck Peruana S.A.
Tel: +61 3 9728 7600 Tel: +91 22 6660 9184 Tel: +51 1 6187 500
Fax: +61 3 9728 1351 Tel: +91 22 6660 9000 Fax: +51 1 4372 955
E-mail: merck@merck.com.au Fax: +91 22 2495 4590 E-mail: merck.peruana@merck.com.pe
www.merck.com.au Fax: +91 22 2495 0307 www.merck.com.pe
E-mail: life.science@merck.co.in
Brazil www.merck.co.in Philippines
Merck S.A. Merck Inc.
Toll Free: 0800 21 9292 Indonesia Tel: +63 2 815 4067
Tel: +55 11 3346 8500 Pt. Merck Tbk. Tel: +63 2 815 4208
Fax: +55 11 3207 5040 Toll Free: 0800 140 1253 Fax: +63 2 815 4882
E-mail: quimica@merck.com.br Tel: +62 21 841 3889 E-mail: tish.aligada@merck.ph
www.merck.com.br Fax: +62 21 841 5537
E-mail: chemicals@merck.co.id Singapore
Imprint do Brasil Ltda.
Merck Pte. Ltd.
Tel: +55 19 3772 2900
Israel Customer Hotline: +65 6890 6660
Fax: +55 19 3273 5389
Mercury Scientific & Industrial Tel: +65 6890 6660
E-mail: imprint@imprint.com.br
Products Ltd. Fax: +65 6890 6639
www.imprint-corp.com
Tel: +972 3 938 7164 E-mail: chem@merck.sg
Fax: +972 3 938 7174 www.merck.com.sg
Caribbean
E-mail: mercury@mercury-ltd.co.il
Merck, S.A.
www.mercury-ltd.co.il South Africa
See information under Central America
Merck Laboratory Supplies Division
Japan Tel: +27 11 345 9000
Central America
Merck Ltd. National Contact No. 08600 63725
Merck, S.A. Guatemala
Tel: +81 0120 189 390 Fax: +27 11 345 9251
Tel: +50 2 2410 2300
Fax: +81 0120 189 350 E-mail: labsupply@merck.co.za
Fax: +50 2 2250 5193
E-mail: service@merck.co.jp
E-mail: quimicos@merck.com.gt
www.merck.co.jp Taiwan
www.merck.com.gt
Merck Ltd.
Korea Tel: +886 2 2742 2788
Chile
Merck Limited Fax: +886 2 2742 2766
Merck S.A.
Tel: +82 2 2185 3836 E-mail: bioservice@merck.com.tw
Tel: +56 2 3400 000
Tel: +82 2 2185 3840, 3842 www.merckbio.com.tw
Fax: +56 2 3400 399
Fax: +82 2 2185 3870
E-mail: mqch@merck.cl
E-mail: hk.kim@merck.co.kr Thailand
www.merck.cl
www.merck.co.kr Merck Ltd.
Tel: +66 2 667 8333
China
Malaysia Fax: +66 2 667 8338
Merck China
Merck Sdn Bhd E-mail: customercare@merck.co.th
Tech Service: 400 820 8872
Tel: +6 03 7494 3688 www.merck.co.th
Tel: +86 21 3222 4788
Fax: +6 03 7491 0850
Fax: +86 21 6247 9680
Fax: +6 03 7491 0860 Venezuela
E-mail: Bioteam@merck-china.com
E-mail: chemlab@merck-de.com.my Merck S.A.
www.merck-china.com
www.merck.com.my Tel: +58 21 2235 1379
Fax: +58 21 2237 7632
Colombia
Mexico E-mail: mven@merck.com.ve
Merck Colombia S.A.
Control Técnico Y Representaciones www.merck.com.ve
Tel: +57 1 425 4770
Monterrey, Nuevo, León
Fax: +57 1 425 5407
Tel: +52 81 8158 0600 Vietnam
E-mail: mcsa@merck.com.co
Fax: +52 81 8373 2891 Merck Representative Office
www.merck.com.co
E-mail: ctrscientific@infosel.net.mx Tel: +84 8 932 0187
Fax: +84 8 526 0201
Ecuador Mexico City
E-mail: merckvnadmin@hcm.vnn.vn
Merck C.A. Tel: +52 55 5208 5197
Tel: +593 2 298 1677 +52 55 5208 5198 10002722
Fax: +593 2 298 1644 +52 55 5208 8116 PCR Tools 2008 APLA
E-mail: sicmerck@merck.com.ec Fax: +52 55 5203 6229
www.merck.com.ec
New Zealand
Guatemala Merck Limited
Merck S.A. Toll Free: 0800 46 37 25
See information under Central America Tel: +64 06 356 7328
Fax: +64 06 356 7311
E-mail: info@merck.co.nz
www.merck.co.nz

164 ProNet

Hochgeladen von

Dokumentinformationen

Originalbeschreibung:

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

164 ProNet

Hochgeladen von

Copyright:

Verfügbare Formate

Novagen®

Thermostable DNA Polymerases.......... 4

Direct PCR from Blood.........................16

icons on the 22 Protocol Comparison

is licensed for PCR. Start DNA Polymerase System

30 Reliable and Robust Real-time Amplification Using

Overview and Enzyme Selection Guide

A complete selection of enzymes and kits for PCR

4 For more information or to place an order, Novagen • PCR Tools

PCR Enzyme Selection Guide

Thermostable DNA Polymerases

Elongation Rate enzymes offer the highest accuracy of commercially available

Fidelity Our PCR

PCR Enzyme Selection Guide

KOD Hot Start DNA Cloning, cDNA

NovaTaq Hot Start

 Satisfactory  Good  Excellent  Best

Novagen • PCR Tools customer.service@merckbio.com 5

Features KOD Hot Start DNA Polymerase* is a premixed complex of

6 For more information or to place an order, Novagen • PCR Tools

Thermostable DNA Polymerases

Cycle Profile A Cycle Profile B Cycle Profile C Cycle Profile D

Final extension 72°C 5 min 68°C 5 min 72°C 3 min N/A

Product Size (kb)

Lambda DNA amplification Genomic DNA amplification

Novagen • PCR Tools customer.service@merckbio.com 7

KOD Hot Start Master Mix

Features KOD Hot Start Master Mix* is a ready-to-use 2X mixture

PCR products amplified using KOD Hot Start Master Mix

8 For more information or to place an order, Novagen • PCR Tools

Thermostable DNA Polymerases

KOD system optimized for difficult targets

Features: The KOD Xtreme™ Hot Start DNA Polymerase* kit is an

Additional Information Available

Number of Bases Percentage of Mutants

See Page 10 for additional data.

Novagen • PCR Tools customer.service@merckbio.com 9

KOD Xtreme™ Hot Start DNA Polymerase

10 For more information or to place an order, Novagen • PCR Tools

Thermostable DNA Polymerases

High performance enzyme blend for long and accurate PCR

Features KOD XL DNA Polymerase* is an optimized blend of KOD

Novagen • PCR Tools customer.service@merckbio.com 11

Features KOD DNA Polymerase* is a recombinant form of Thermococcus

12 For more information or to place an order, Novagen • PCR Tools

Thermostable DNA Polymerases

Heat-activatable, chemically modified form of recombinant Taq DNA polymerase

Features NovaTaq™ Hot Start DNA Polymerase is a chemically modified

NovaTaq™ Hot Start Master Mix Kit

Premixed 2X “hot start” PCR components for convenience and reproducibility

Novagen • PCR Tools customer.service@merckbio.com 13

NovaTaq™ DNA Polymerase

Ultrapure recombinant enzyme for dependable PCR amplification

NovaTaq™ PCR Master Mix

Premixed 2X PCR reaction components for convenience and reproducibility

14 For more information or to place an order, Novagen • PCR Tools

Thermostable DNA Polymerases

Features The Taq Antibody* is a mouse monoclonal antibody that inhibits

Novagen • PCR Tools customer.service@merckbio.com 15

Direct PCR from Blood

Features BloodDirect™ PCR Buffer Kits are novel buffers that

BloodDirect Kits can be used in genotyping and genetic