RESEARCH ARTICLE

Extracellular release of a heterologous phytase from roots of

transgenic plants: does manipulation of rhizosphere biochemistry
impact microbial community structure?
Timothy S. George1, Alan E. Richardson2, Sumei S. Li3, Peter J. Gregory1 & Tim J. Daniell1
1
SCRI, Invergowrie, Dundee, UK; 2CSIRO Plant Industry, Canberra, ACT, Australia; and 3ISSCAS, Nanjing, China

Correspondence: Timothy S. George, SCRI, Abstract

Invergowrie, Dundee, DD2 5DA, UK. Tel.:
144 1382 562 731; fax: 144 1382 562 426;
e-mail: tim.george@scri.ac.uk
Received 12 February 2009; revised 14 July
2009; accepted 27 July 2009.
Final version published online 10 September
2009.
DOI:10.1111/j.1574-6941.2009.00762.x
Editor: Kornelia Smalla
Keywords
inositol phosphate; mycorrhizae; phytase;
phosphate; rhizosphere; transgenic plants.
MICROBIOLOGY ECOLOGY
To maintain the sustainability of agriculture, it is imperative that the reliance of
crops on inorganic phosphorus (P) fertilizers is reduced. One approach is to
improve the ability of crop plants to acquire P from organic sources. Transgenic
plants that produce microbial phytases have been suggested as a possible means to
achieve this goal. However, neither the impact of heterologous expression of
phytase on the ecology of microorganisms in the rhizosphere nor the impact of
rhizosphere microorganisms on the efficacy of phytases in the rhizosphere of
transgenic plants has been tested. In this paper, we demonstrate that the presence
of rhizosphere microorganisms reduced the dependence of plants on extracellular
secretion of phytase from roots when grown in a P-deficient soil. Despite this, the
expression of phytase in transgenic plants had little or no impact on the microbial
community structure as compared with control plant lines, whereas soil treat-
ments, such as the addition of inorganic P, had large effects. The results
demonstrate that soil microorganisms are explicitly involved in the availability of

P to plants and that the microbial community in the rhizosphere appears to be

resistant to the impacts of single-gene changes in plants designed to alter
rhizosphere biochemistry and nutrient cycling.

soil environments, where transgenic T. subterraneum

Introduction
Organic phosphorus (P) tends to accumulate in soils
predominantly as derivatives of inositol phosphates (pri-
marily as phytate or myo-inositol hexakisphosphate) (An-
derson, 1980; Turner et al., 2002). In order to provide plants
access to P present in soil as phytate, transgenic plants
(Arabidopsis thaliana, Nicotiana tabacum L., Trifolium sub-
terraneum L. and Solanum tuberosum L.) that express
phytase genes from soil microorganisms (Aspergillus sp.,
Bacillus sp.) have been developed and characterized (Ri-
chardson et al., 2001; Mudge et al., 2003; Zimmermann
et al., 2003; George et al., 2004, 2005a; Lung et al., 2005).
These plants exude heterologous phytase into the rhizo-
sphere and, when grown in controlled environments (e.g.
sterile and nonsorbing media such as agar), can accumulate
significantly more P than control lines when supplied solely
with phytate (Richardson et al., 2001; Mudge et al., 2003;
George et al., 2004, 2005a). However, the benefit of exuding
phytase from roots has been shown to be compromised in
showed only small (up to 20%) and inconsistent increases
in P accumulation (George et al., 2004). Transgenic
N. tabacum showed a more consistent improvement in
P accumulation (up to 50%), but only in soils that were
amended with phytate to increase its availability (George
et al., 2005a). Possible reasons for the relatively poor
capacity of transgenic plants to acquire P from phytate in
soil include low availability of substrate for mineralization
by phytase, inhibitory effects of the soil environment on the
activity of phytase exuded to the rhizosphere and, as
investigated in this paper, the presence of microorganisms
(phytase exuding or otherwise), which may compensate for
the lack of phytase exuded by wild-type plants.
Soil microorganisms are involved in many soil functions
(Dunfield & Germida, 2001; Devare et al., 2004) including
the cycling of nutrients, particularly N and P (Oehl et al.,
2001; George et al., 2006; Bünemann et al., 2008). Their
presence in some cases (i.e. mycorrhizal fungi) is critical in
order for plants to survive under extremely P-deficient

FEMS Microbiol Ecol 70 (2009) 433–445 

c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
434
conditions (Smith & Read, 1997). More specifically, soil
microorganisms are considered to be critical to the mobili-
zation and cycling of P within the rhizosphere (Jakobsen
et al., 2005). For this and other reasons, the impact of
transgenic plants on the presence of individual species of
microorganisms, or the biodiversity and functionality of the
soil microbial biomass itself, has been of some interest
(Bruinsma et al., 2003). However, the results have been
mixed, with some studies showing small effects of transgenic
plants on specific components of the microbial community
(Siciliano et al., 1998; Dunfield & Germida, 2001; Gyamfi
et al., 2002; Bruinsma et al., 2003; Sessitsch et al., 2003;
Castaldini et al., 2005; Hénault et al., 2006), while others
have demonstrated no impact at all (Heuer & Smalla, 1999;
Heuer et al., 2002; Brusetti et al., 2004; Devare et al., 2004;
Fang et al., 2005; Griffiths et al., 2006, 2007a, b; Philippot
et al., 2006; Lupwayi et al., 2007). Moreover, a number of
recent studies have suggested that differences between
transgenic plants lie within the range of natural variation
that occurs either between genotypes or due to shifts in
agronomic practice (Griffiths et al., 2006, 2007a, b). Most of
these studies, however, have focused on the impact of plants
that have been genetically modified to produce herbicide
tolerance or resistance to insect pests or plant pathogens
(Kowalchuk et al., 2003; Liu et al., 2005; Ikeda et al., 2006;
Griffiths et al., 2007b) and not those that directly alter
rhizosphere biochemistry, such as transgenic plants that
exude phytase.
In this paper, we investigate the impact of rhizosphere
microorganisms on the P nutrition of plants and whether
direct manipulation of rhizosphere biochemistry through
genetic engineering had any impact on microbial commu-
nity structure. Transgenic tobacco plants that express and
release extracellular microbial phytases from their roots were
used and compared with both a transgenic control line and
wild-type plants. The efficacy of the expression of phytase in
relation to the P nutrition of plants was examined in relation
to the structure of the bacterial community both within the
rhizosphere and associated with the root (surface and
endophytic bacteria), and on arbuscular mycorrhizal (AM)
fungi associated with the roots.
Materials and methods
Transformation of N. tabacum
Nicotiana tabacum plants (var. W38) were independently
transformed with phytase genes (phyA) from Aspergillus
niger (An) and Peniophora lycii (Pl) using Agrobacterium-
mediated transformation. The fungal phytase genes (phyA)
were expressed independently under the control of either
the CaMV 35S promoter or the A. thaliana phosphate
transporter (AtPt) promoter, with all constructs being

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
T.S. George et al.
modified for extracellular secretion by inclusion of an
extracellular targeting sequence from the carrot extensin
(ex) gene (Richardson et al., 2001; Mudge et al., 2003;
George et al., 2005a). The P. lycii phytase was synthesized
according to the amino acid sequence reported by Lassen
et al. (2001) with codon usage optimized for expression in
tobacco (Geneart, Regensburg, Germany; A.E. Richardson,
unpublished data). Primary transformant calli containing
ex<phyA (T0 generation) were selected on kanamycin
(100 mg mL1) and transformation was verified by Southern
blot (not shown). Vector control plants (pPLEX502;
Schünmann et al., 2003), which had been transformed with
the empty transformation cassette (i.e. plants that have been
through tissue culture, but do not express phytase genes),
were also generated.
Twelve independent lines of both ex<phyA(An) and
vector alone, and 76 independent lines of ex<phyA(Pl) were
initially selected by resistance of T0 plants to kanamycin.
From these, five transformed lines of each construct and one
vector control were selected and transferred to a fertilized
potting mix for collection of T1 generation seed. Trans-
formed ex<phyA and vector control plants for subsequent
experimentation were selected from segregating T1 seedlings
by screening for resistance to kanamycin (100 mg mL1) in
nutrient agar (Richardson et al., 2001) and comparisons
were made with wild-type plants, which had been grown to
the same stage in the absence of kanamycin. Verification of
the transformation of T1 generation material was confirmed
by either a phytase assay of leaf or root tissues or by PCR
using specific primers for either the A. niger or the P. lycii
phyA genes (George et al., 2005a; data not shown).
Soil characterization and amendments
Soil was collected from a Scottish National Heritage nature
reserve at Tentsmuir Point, Fife, UK, and was identified as a
spodosol (USDA Soil Taxonomy). This soil had a low P
sorption capacity and the following soil P characteristics:
Colwell-P 10.8 mg P g1 and total-P 118.4 mg P g1, of which
60% was in organic form. Soils were air-dried, mixed and
passed through a 2-mm sieve and were either left un-
amended (live soil) or amended with various treatments.
Treatments included the addition of inorganic P to levels
sufficient for unlimited plant growth (P-fertilized), steriliza-
tion by g-irradiation (g-irradiated) and sterilized soil re-
inoculated either with a soil wash or with 5% (w/w) live soil.
The latter two treatments were designed to re-establish
complete communities (soil inoculum) or a community
lacking soil fungi including AM fungi (soil wash) (Koide &
Li, 1989). g-Irradiation of soil was performed by exposure to
25 kGy of radiation from a g source (Isotron plc, Swindon,
UK). Reinoculation of g-irradiated soils with both the soil
wash and the live soil was performed by mixing either 50 mL
FEMS Microbiol Ecol 70 (2009) 433–445
Impact of phytase genes on rhizosphere microorganisms
of soil wash solution per kg soil or 5% (w/w) live soil,
respectively, with sterilized soil in a cement mixer for
30 min.
Additions of phosphate were based on the amount of
orthophosphate required to increase plant available P by
10-fold (75 mg P kg1 soil) and was incubated for 28 days
before analysis and plant growth. Incubated soils were
analysed for pH (1 : 5 w/v deionized H2O), anion exchange
resin-extractable P (resin-P or plant available P) (Saggar
et al., 1990), water-extractable Pi and Po (H2O Pi and Po)
and 0.5 M NaHCO3-extractable inorganic P (Olsen-P) (Olsen
& Sommers, 1982; George et al., 2007). The anion exchange
resin method of Saggar et al. (1990) was modified in that
resins were charged with Na2HCO3 and eluted with HCl.
Growth and P uptake by transgenic plants in soil
Five replicate pots containing 450 g (weight at 80% field
capacity) of each soil treatment were sown with five tobacco
seedlings of each plant line separately, which had been
germinated and grown for 7 days on agar containing
100 mg kanamycin L1. Wild-type plants were grown to the
same stage on nutrient agar in the absence of kanamycin.
Because of the impact of these differences in the nursery
conditions on the initial vigour of the transformed plants
and the wild type, it was only possible to compare the plant
growth parameters for transgenic plants against the trans-
genic vector control. Pots were thinned to three plants per
pot after establishment and maintained at 80% field
capacity during growth, by weight. All nutrients except P
were supplied weekly by addition of 5 mL of nutrient
solution [3 mM (NH4)2SO4, 2 mM KNO3, 1 mM MgSO4,
10 mM Ca(NO3)2, 80 mM FeEDTA and micronutrients (B,
Cu, Mn, Zn, Mo and Co)]. Plants were grown in a
randomized design in a glasshouse at 56127 0 N and 03104 0 W
between 14 and 22 1C with an approximate daylight length
of 16 h. Before the plants became pot bound, shoots were
harvested after 28 days of growth and biomass was deter-
mined after oven drying at 65 1C. Shoot materials were
milled and analysed for the total P content after digestion
with a sulphuric acid–hydrogen peroxide mix (Heffernan,
1985).
DNA extraction from roots and soil
For each of the five replicate pots, rhizosphere soil that was
closely adhering to roots after shaking of all plants in each
pot was brushed from plants and collected into a microcen-
trifuge tube before freezing in liquid N2. A composite
subsample of the roots from each plant in each pot was also
collected into a microcentrifuge tube and also frozen in
liquid N2; this sample included microorganisms associated
with the root surface but also any endophytic microorgan-
isms such as AM fungi. Roots were freeze-dried and
FEMS Microbiol Ecol 70 (2009) 433–445
435
pulverized by bead beating with 1-mm stainless-steel beads
(Atlas ball, UK) using a Mixer Mill 301 (Retsch GmbH,
Haan, Germany). Total DNA was then extracted from roots
(root bacteria and AM fungi) using a Nucleospins 96 Plant
DNA extraction kit (Macherey-Nagel, Germany) following
the manufacturer’s procedures. Total DNA was extracted
from the soil (rhizosphere bacteria) according to Deng et al.
(2009). Briefly, soil was extracted with 1 : 2 w/v 0.12 M
Na2HPO4 in a 1% SDS solution on a bead beater with
DEPC-treated glass beads. Following centrifugation (4960 g
for 5 min), the supernatant was added to an equal volume of
phenol : chloroform : IAA (25 : 24 : 1) and mixed. Following
a further centrifugation (4960 g for 1 min), the supernatant
was added to an equal volume of 0.3 M Na acetate in
isopropanol in clean tubes and frozen (  20 1C) overnight.
This was then centrifuged (4960 g for 5 min) to pellet the
DNA, which was then washed with ice-cold 70% ethanol
and centrifuged (4960 g for 5 min). Ethanol was removed
and the pellet was allowed to dry before being resuspended
in 50 mL TE; this solution was cleaned by passing
over polyvinylpolypyrrolidone (Sigma) using Multiscreen
HTS HV plates (Millipore) after the polyvinylpolypyrroli-
done was equilibrated by repeated water addition (100 mL).
DNA extracted from both roots and rhizosphere soil was
used for PCR amplification and community structure
analysis using terminal-restriction fragment length poly-
morphism (T-RFLP). It should be noted that the different
extraction procedures for the rhizosphere and root DNA
could impact the T-RFLP profile observed and comparison
between these two compartments should be made with
caution.
PCR amplification, T-RFLP and sequencing
The small subunit rRNA gene was used to assess the
community structure of AM fungi and root and rhizosphere
bacteria. Following optimization for template quantity, AM
fungal PCR was performed using 2 mL of the DNA extraction
in a 25-mL volume PCR reaction containing Expand High
Fidelity Buffer with 15 mM MgCl2, 100 nM of each of the
dNTPs, 200 nM of each of the primers NS31 and AM1
(Simon et al., 1992; Helgason et al., 1998), 20 mg mL1
bovine serum albumin (BSA) and 0.7 U Expand High
Fidelity enzyme mix (Roche Applied Science, Mannheim,
Germany). NS31 was 5 0 labelled with the fluorophore FAM
and AM1 with VIC (Applied BioSystems, UK). Thermo-
cycling conditions were as follows: 94 1C for 2 min; 10 cycles
of 94 1C for 15 s, 58 1C for 30 s, 72 1C for 45 s; 20 cycles of
94 1C for 15 s, 58 1C for 30 s, 72 1C for 4515 s per cycle; and
72 1C for 7 min.
Following optimization for template quantity, bacterial
PCR was performed using 2 mL of DNA extracted either
from soil or root. This was amplified in a 25-mL volume PCR

c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
436
reaction containing Platinum Taq buffer with 15 mM
MgCl2, 100 nM of each of the dNTPs, 200 nM of each of
the primers 16f27 (AGAGTTTGATCCTGGCTCAG; Amann
et al., 1995) and 1392R (ACGGGCGRTGTGTACA; Black-
wood et al., 2003 modified to include a variable base),
20 mg mL1 BSA and 0.725 U of Platinum Taq DNA poly-
merase (Promega UK), 16f27 was 5 0 labelled with the
fluorophore FAM and 1392R with VIC. Before amplifica-
tion, the bacterial PCR mastermix was digested with HhaI
(40 min at 37 1C) to remove contaminating bacterial
template, with subsequent heat inactivation (10 min at
65 1C) of the endonuclease activity. Thermocycling condi-
tions were as follows: 94 1C for 2 min; 10 cycles of 94 1C for
15 s, 58 1C for 30 s, 72 1C for 45 s; 20 cycles of 94 1C for 15 s,
58 1C for 30 s, 72 1C for 45 s15 s per cycle; and 72 1C for
7 min.
All PCR was performed using a DNA Engine PTC Dyad
thermocycler (MJ Research, Reno). The success of PCR
amplification was assessed by agarose gel electrophoresis.
The PCR product was subjected to restriction enzyme
digestion using AluI for bacterial and independent diges-
tions with HinfI and Hsp92I for AM fungal products. In the
restriction enzyme digestion step, 5 mL of PCR product was
digested with 1 mL of restriction enzyme (0.5 U) at 37 1C for
2 h, followed by a 10-min enzyme denaturation step at
65 1C. The digested PCR product was further diluted 1 : 10
with molecular-grade ultrapure water and 1 mL mixed with
8.95 mL of formamide and 0.05 mL of an internal length
standard (LIZ, Applied Biosystems Inc., Freemont, CA). The
terminal restriction fragments marked with fluorophore
were analysed by electrophoresis using an automated DNA
sequencer (ABI PRISMTM 3730). Blank samples (negative
PCR controls from the second-round PCR and water con-
trols) were also digested and analysed. A postrun analysis
was performed using GENEMAPPER (Applied BioSystems, UK)
to allow peak sizing and generation of a peak area for each
identified peak. Peaks that were attributed to plant DNA
(130 bp peak related to chloroplast DNA) were removed
before analysis. A fixed bin width of 5 bp was used as in the
preliminary analysis as this produced uniform and stable
peak identification. Data were then processed in EXCEL
Table 1. Characteristics of soil used in experimental treatments
Treatment Live P-fertilized
pH (H2O) 5.5 (0.0) 5.3 (0.1)
Resin-Pi (mg g1) 4.3 (0.5) 106.3 (0.9)
Olsen-Pi (mg g1) 10.8 (2.8) 16.6 (0.1)
H2O Pi (mg g1) 0.7 (0.3) 46.5 (7.8)
H2O Po (mg g1) 8.1 (1.2) 43.3 (12.9)
Soil was a spodosol (0–10 cm) collected from Tentsmuir Forest, Fife, UK, which was either left live, fertilized with KH2PO4 (P-fertilized), sterilized by
g-irradiation or sterilized and reinoculated with live soil (5% w/w) (reinoculated) or a bacterial wash. Data represent the mean of five replicates with SEs
in parentheses.

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
T.S. George et al.
(Microsoft Corporation) to yield peak relative abundance,
with subsequent removal of peaks representing o 1% of the
total fluorescence in each sample. Hellinger transformation
was performed to reduce the effect of dominant peaks
(Blackwood, 2006).
Data presentation and statistical analyses
All data are presented as the mean of five replicates and error
bars represent one SE of the mean. Significant differences
were established using general ANOVA and treatment means
compared by LSD (P = 0.05) (GENSTAT v5; Rothamsted Ex-
periment Station, UK). All data were tested for normality
before analysis and, where required, skewed data were
transformed to natural log values before analysis. The
various microbial community assemblages in the various
compartments of the root soil interface were subjected to
principal component analysis (PCA; GENSTAT v9; Rothamsted
Experiment Station), general ANOVA was used to identify
components that were significantly affected by the experi-
mental treatments and relationships between PCs and plant
performance were established using linear regression. The
Shannon–Wiener index was applied to T-RFLP profiles to
establish diversity that incorporates measures of evenness
and richness.
Results
Soil treatments
The soil treatments affected some soil properties important
to the interpretation of subsequent data: pH varied signifi-
cantly (P o 0.001) with soil treatment, being reduced by
0.2 U with P addition and increased by 0.3 U with
g-irradiation and 0.4 U when soils were g-irradiated and
reinoculated with either inoculum (Table 1).
Pools of soil P were also changed by the soil treatments
(Table 1). Resin-P was increased (P o 0.001) by both P
addition (25-fold) and g-irradiation (eightfold), although
reinoculation of g-irradiated soil with either inoculum
reduced resin-P to a level not significantly different from
the live soil. Soil treatments also induced similar changes in
g-Irradiated Reinoculated Bacterial wash LSD (P = 0.05)
5.8 (0.0) 5.9 (0.0) 5.9 (0.0) 0.2
33.6 (3.6) 6.7 (0.2) 9.5 (0.8) 5.4
20.9 (1.4) 14.9 (1.3) 9.2 (0.5) 4.8
20.4 (2.0) 2.7 (0.2) 10.6 (3.9) 12.7
14.5 (4.0) 3.6 (1.2) 7.0 (1.3) 20.6
FEMS Microbiol Ecol 70 (2009) 433–445
Impact of phytase genes on rhizosphere microorganisms 437

Olsen-P, with significantly greater P concentrations in shown). However, it should be noted that this difference
fertilized and sterilized soil, but not in sterilized soils that may be an artefact of the different DNA extraction protocols
were reinoculated. The addition of P to soils led to a large used for rhizosphere and root-associated communities,
increase (P o 0.001) in both the water-extractable Pi (inor- although it has been demonstrated, at least for nematode
ganic phosphate) and Po (organic phosphate), and community structure, that different extraction methods
g-irradiation also increased the water-extractable Pi (29- yield similar community structure analysis using T-RFLP
fold), but not the organic portion of this pool. In reinocu- (Donn et al., 2008). When considered separately, PC1
lated soils, water extractable Pi and Po were again not accounted for 35.5% and 25.2% of the variability for the
significantly different from live soil. rhizosphere and root-associated communities, respectively
(Fig. 2).
Plant growth and P accumulation The rhizosphere populations showed a significantly dif-
ferent and distinct community structure between soil treat-
Shoot growth was significantly (P o 0.001) affected by soil
ments, with the two live soils (live and P-fertilized) being
treatment, whereby plants grown in both the P-fertilized and
more similar to each other than the various g-irradiated
the g-irradiated soils were larger than those in the other soil
treatments in this dimension (Fig. 2a). There were no
treatments, which were not different from each other (data
significant differences between plant lines or any interaction
not shown). Plants grown in live soil were the smallest, being
between plant line and soil treatment. There were also
2.8-fold smaller than in the P-fertilized and the g-irradiated
significant differences between treatments in PC2, which
treatments. Plants grown in reinoculated soils were inter-
accounted for a further 11.0% of the variation. Again, the
mediate, with the bacterial wash and live soil inoculum
soil treatments were all significantly (P o 0.001) different
treatments being 1.8-fold and 1.4-fold larger than plants
from one another, with the exception of the bacterial wash
grown in live soil, respectively. There was also a significant
and live soil treatments. The g-irradiated and P-fertilized
main effect of plant line (P o 0.001) on shoot biomass, with
treatments were also more similar to one another in this
plants that expressed the A. niger phytase generally being
dimension, as were the live soil and both reinoculation
larger than either the P. lycii phytase or the control plants.
treatments. Unlike PC1, there were significant (P o 0.05)
There was no significant interaction between plant lines and
differences between plant treatments in PC2, with the
soil treatments.
unplanted control being different from all the other planted
Unlike shoot biomass, there was no significant main effect
treatments. However, there was no significant difference in
due to plant line on P accumulation. However, there was a
the structure of the rhizosphere community between the
significant main effect (P o 0.001) caused by the soil treat-
transgenic and the control plant lines.
ments so that plants accumulated more P in all treatments
Root-associated bacterial community structure was also
compared with the live soil, and with all treatments being
affected by soil treatment, but to a lesser extent than that
significantly different from one another (Fig. 1). The effect
observed in the rhizosphere (Fig. 2b). Soil treatments caused
of the soil treatments on plant P-accumulation was best
a significant (P o 0.001) main effect in PC1, which ac-
demonstrated by vector control plants, which, when com-
counted for 25.2% of the variation. In particular, the live
pared with P accumulation on live soil, accumulated 5.3-
soil treatment was distinct from all other soil treatments and
fold more P on g-irradiated soils, 4.1-fold more on P-
both the P-fertilized and the g-irradiated treatments were
fertilized soils, 3.2-fold more on bacterial wash and 1.4-fold
distinct from the two reinoculated treatments. There was no
more on live soil inoculum treatments. There was also a
significant main effect of the plant line in PC1, but the
significant interaction (P o 0.001) between plant and soil
interaction between the plant line and the soil treatment was
treatments so that in g-irradiated soil both of the 35S-
significant (P o 0.001). Despite this, there were no consis-
promoted phytase constructs (lines 35SAn and 35SPl)
tent differences between the transgenic lines and the control,
accumulated more P than either the control plants or those
suggesting that any impact of plants was not consistently
promoted with the AtPt promoter (Fig. 1). In all other soil
due to the expression of phytase. The next PC to be related
treatments, there were no significant differences between
to differences in experimental treatments was PC5, which
plant lines.
explained only 5.5% of the variation. There was a significant
(P o 0.05) impact of soil treatment in this dimension, but
Impact on rhizosphere and root-associated
only the live soil and bacterial wash treatments could be
microorganisms
statistically differentiated. There was no significant effect of
The bacterial community structure of the rhizosphere and plant line in this dimension. As with PC1, statistically
the plant root were significantly (P o 0.001) different when significant (P o 0.05) interactions between treatments
analysed by PCA, with PC1 accounting for 66.4% of the showed no consistent differences between controls and
variability when the two datasets were pooled (data not transgenic plants.

FEMS Microbiol Ecol 70 (2009) 433–445 

c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
438 T.S. George et al.

(a) Live (c) γ-Irradiated

LSD P<0.05
LSD P<0.05
3000 *
3000
*

2000
2000
P Accumulation (μg P per plant)

1000 1000

0 0
(b) P-fertilized (d) Bacterial wash
3000 LSD P<0.05

P Accumulation (μg P per plant)

LSD P<0.05
3000

2000 2000

1000
1000

0
0
35SAn AtPTAn 35SPl AtPTPl Vt (e) Reinoculated
Plant treatment 3000 LSD P<0.05

2000

1000

0
35SAn AtPTAn 35SPl AtPTPl Vt
Plant treatment

Fig. 1. P accumulation (mg P per plant) for four independently transformed Nicotiana tabacum lines that express phyA from either Aspergillus niger (An)
or Peniophora lycii (Pl) under the control of either the 35S promoter (35SAn and 35SPl, respectively) or the AtPT1 phosphate transporter (AtPTAn and
AtPTPl, respectively) promoters, compared with a transformed vector control line (Vt). Plants were grown for 28 days in a Spodosol (0–10 cm) collected
from Tentsmuir Forest, Fife, UK, which was either (a) live; (b) fertilized with KH2PO4; (c) sterilized by g-irradiation and sterilized soil reinoculated with (d) a
bacterial wash or (e) live soil (5% w/w). Values represent the mean of five replicates, with SEs of the mean shown as bars. Differences between means
were tested using ANOVA and across all treatments LSD (P o 0.05) is shown as a single bar. Within each panel, significant differences between the
transgenic and control lines are shown as .

The diversity of the dominant members of the rhizo-
sphere and root-associated bacterial populations was as-
sessed by the number of T-RFLP fragments that contributed
to the community analysis (Table 2). It is important to note
that this, however, does not reflect the entire diversity in the
system as rare individual species and groups in the popula-
tion are not counted in this instance (Bent & Forney, 2008).
Across the two sample populations, the bacterial richness of
the dominant members of the population was 48% greater
in the rhizosphere compared with the community associated
with the root. Moreover, within the rhizosphere, the greatest
richness, as measured by this method, occurred in the live
soil, which was significantly richer (P o 0.05) than all other
soil treatments including the fertilized (live) soil (Table 2).
However, no differences were evident between plant lines,
nor were there any significant interactions in either of the
rhizosphere or the root-associated populations. In contrast
to the rhizosphere, the richness of the dominant bacterial


c 2009 Federation of European Microbiological Societies FEMS Microbiol Ecol 70 (2009) 433–445
Published by Blackwell Publishing Ltd. All rights reserved
Impact of phytase genes on rhizosphere microorganisms 439

0.3 Table 2. Effect of soil treatment on bacterial richness, as measured by

(a) Rhizosphere bacteria
0.2 T-RFLP in rhizosphere and root-associated populations
PC2 (11.0%)

0.1 Number of T-RFLP peaks scored

0.0 Treatment Rhizosphere Root associated

–0.1 Live 36.4 (4.1) 21.1 (3.9)

g-Irradiated 32.0 (2.7) 22.0 (2.6)
–0.2
Bacterial wash 30.1 (2.2) 21.3 (2.7)
–0.3 Reinoculated 32.2 (2.6) 22.5 (1.8)
–0.4 –0.2 0.0 0.2 0.4
P-fertilized 30.1 (3.6) 21.9 (1.8)
PC1 (35.5%) LSD (P 4 0.05) 1.7 n.s.
0.2 Data are presented as the mean number of T-RFLP peaks scored (based
(b) Root bacteria
Bacterial wash on a 1% threshold) for each soil treatment pooled across all six plant lines
0.1 Reinoculated
γ-Irradiated (n = 5 for each plant line). Means are shown with one SD in parentheses
PC5 (5.5%)

P-fertilized and, where significant, the LSD is provided (P = 0.05).

0.0 Live soil
35SAn
AtPTAn
–0.1 35SPl of the variation (Fig. 2c). In this dimension, the P-fertilized
AtPTPl
NP treatment was distinct from both the live soil and the
–0.2 Vt g-irradiated soil that received 5% live soil as inoculum.
WT
–0.90 –0.85 –0.80 –0.75 –0.70 –0.65 –0.60 –0.55
Neither the g-irradiated soil nor soil that was reinoculated
PC1 (25.2%) with a bacterial wash had amplifiable AM fungal DNA
associated with their roots. Despite the large effect due to
0.06 (c) AM fungi
soil treatment, there was no impact of plant line or its
interaction with soil treatment. The next PC that was related
0.04
PC5 (1.3%)

to either plant or soil treatment was PC5, which explained

0.02
0.00
–0.02
–0.04
–0.5 –0.4 –0.3 –0.2 –0.1 0.0 0.1 0.2
PC1 (57.9%)
Fig. 2. Mean loadings of PCs derived from (a) rhizosphere bacterial
community structure, (b) root-associated bacterial community structure
and (c) the root AM fungal community. In each case, the first two PCs to
be significantly affected by the plant and soil treatments are plotted
against each other. Values in parenthesis for each component indicate
the amount of total variability represented. Filled stars represent the
mean loading for each soil treatment (n = 35); live (cyan); P-fertilized
(pink); sterilized by g-irradiation (red); and sterilized soil reinoculated with
a bacterial wash (green) or with 5% of live soil (blue). The mean effects
of Nicotiana tabacum lines (n = 5) that express phyA from either
Aspergillus niger (An) or Peniophora lycii (Pl) under the control of either
the 35S constitutive (35SAn and 35SPl, respectively) or the Arabidopsis
thaliana AtPT1 phosphate transporter (AtPTAn and AtPTPl, respectively)
promoters and vector (Vt) and wild-type (WT) control lines along with a
no plant control (NP) are also shown by separate symbols. On each panel,
the bars show the LSD (P = 0.05) for the interaction between plant and
soil treatments in both dimensions.
communities associated with the root was not influenced by
soil treatment (Table 2).
The AM fungal community structure associated with
roots was also significantly affected (P o 0.001) by soil
treatment as indicated by PC1, which accounted for 57.9%
only 1.3% of the variability. In addition to a significant effect
of soil treatment, this component showed a significant
difference (P o 0.05) between plant lines, with both wild-
type and vector control plants being different from all four
transgenic lines.
Given the large effect of soil treatment on microbial
community structure (Fig. 2), the data were reanalysed
within each soil treatment to establish whether there
was a stronger impact of plant line without the over-riding
variation caused by soil treatment. For both the rhizosphere
and the root-associated bacterial communities, however,
there were no instances where transgenic lines collectively
led to a significant and consistent change in the community
structure relative to the two control lines (e.g. Fig. 3
for the rhizosphere communities). However, there were
instances in live soils when PCs, which explained variation
ranging from 5.0% to 27.5% of the data, showed a signifi-
cant difference (P o 0.05) between the controls and the
35SAn line, which is consistent with this construct being
the most responsive in terms of plant growth in sterilized
soil (Fig. 1).
Despite the lack of any strong effect of plant genotype (i.e.
expression of extracellular phytase) on the rhizosphere
microbial community structure, there was an impact of the
presence of plants (Fig. 3). In four of the soil treatments, a
relatively large proportion (7.0–20.2%) of the variability
within soil treatments could be attributed to PCs that
showed a significant difference (P o 0.05) between
unplanted controls and the planted treatments.

FEMS Microbiol Ecol 70 (2009) 433–445 

c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
440 T.S. George et al.

Relationship between rhizosphere community for PC1; Fig. 1) and shoot P accumulation by the plants (Fig. 4).
structure and plant P accumulation However, a major shift in microbial community structure
was not required in order to achieve an increase in shoot P
There was a significant relationship (R2 = 0.75, P o 0.001)
accumulation, as demonstrated by the P-fertilized treat-
between rhizosphere community structure (as determined
ment. Likewise, it was also evident that a large change in
the structure of the microbial community did not necessa-
0.2 rily change the ability of the plant to accumulate P as
Live
demonstrated by the comparison between live soil and
0.1 the various inoculum treatments of sterilized soil. While
g-irradiation caused the largest change in both the commu-
PC1 (20.2%)

nity structure and increase in the availability of P, the soil

0.0
inoculated with a bacterial wash appeared to transform the
microbial community back towards that of the live soil, and
–0.1 reduced the availability of P as measured in both soil extracts
LSD (P<0.05)
(Table 1) and by uptake of P by plants (Fig. 4). Moreover,
–0.2 the sterilized soil that was reinoculated with 5% live soil
shifted the community structure even further toward that of
P-fertilized the live soil and further reduced the availability of soil P for
plant uptake.
LSD (P<0.05)
0.1
PC1 (16.7%)

Discussion
0.0 This study demonstrates that the heterologous expression of
a microbial phytase gene in plants had no detectable impact
on the community structure of microorganisms in the
–0.1
rhizosphere or those associated with the root, given the
known limits of the methodology applied. This was despite
these plant lines previously being shown to have a clear
γ-Irradiated effect on the biochemistry of the rhizosphere (George et al.,
0.15
2005b, 2007). In contrast, soil treatments aimed at perturb-
LSD (P<0.05)
ing the soil microbiology or altering the P status of the soil
0.10
PC3 (10.9%)

had a significant effect on microbial community structure.

0.05 The effects of soil treatment were particularly evident on
mycorrhizal associations with roots and on the structure of
0.00 the bacterial community in rhizosphere soil as compared
with that associated with roots. Furthermore, and despite
–0.05 the lack of impact of the expression of phytase in different
transgenic lines on soil microorganisms, it was apparent that

Bacterial wash
0.10
LSD (P<0.05)
Fig. 3. Mean loadings of PCs derived from rhizosphere bacterial com-
PC4 (7.0%)

0.05
munity structure, which have significant effects due to the plant line.
Shown are Nicotiana tabacum lines that express phyA from either
0.00 Aspergillus niger (An) or Peniophora lycii (Pl) under the control of either
the 35S constitutive (35SAn and 35SPl, respectively) or the Arabidopsis
thaliana AtPT1 phosphate transporter (AtPTAn and AtPTPl, respectively),
–0.05
promoters and vector (Vt) and wild-type (WT) control lines and a no plant
control (NP). Plants were grown in a Spodosol soil that was live
–0.10 (unamended); P-fertilized; and sterilized by g-irradiation and sterilized
35SAn

AtPTAn

35SPl

AtPTPl

NP

Vt

WT

soil that was reinoculated with a bacterial wash. For each soil treatment,
the PC is plotted for each plant line (n = 5; and including the no plant
control), with the bars showing LSD (P = 0.05). Values in parenthesis for
Plant treatment each component indicate the amount of total variability represented.


c 2009 Federation of European Microbiological Societies FEMS Microbiol Ecol 70 (2009) 433–445
Published by Blackwell Publishing Ltd. All rights reserved
Impact of phytase genes on rhizosphere microorganisms
0.6
0.4
0.2
PC1 (35.5%)
0.0
–0.2
Bacterial wash
Reinoculated
–0.4 γ-Irradiated
Live soil
P-fertilized
–0.6
0 1000 2000 3000 4000 5000
Shoot P accumulation (μg P per plant)
Fig. 4. Relationships between shoot P accumulation (mg P per plant) of
plants grown in different soil treatments and the PC1 derived from the
rhizosphere bacterial community structure. Two separate relationships
fitted by an exponential function (y = a1b (1  exp(cx)) are shown along
with R2 values and the significance (P-value) of the relationships as
established by regression analysis. Data points represent individual
observations for all plant lines within soil treatments and include data
from live (unamended) (cyan), P-fertilized (pink) and g-irradiated (red)
soils and sterilized soil that was reinoculated with either a bacterial wash
(green) or 5% live soil (blue).
the presence of microorganisms themselves had an influence
on the efficacy of the expression of phytase in plants on their
growth, and subsequently, the ability to acquire additional
phosphate from soil.
Impact of rhizosphere microorganisms on the
efficacy of heterologous expression of phytase
Plants that constitutively expressed either the A. niger or the
P. lycii phytase accumulated more P than control plants
when grown in g-irradiated soils, but not in any of the live
soil treatments (either unamended or P-fertilized) or in
either of the reinoculation treatments. While not knowing
exactly the effectiveness of the g-irradiation treatment in
‘sterilizing’ the soil, the dose was considered to be sufficient
to eliminate most soil microorganisms (McNamara et al.,
2003), and was effective for the removal of mycorrhizal
fungi. No attempt was made, however, to maintain ‘sterility’
in the soil, which was allowed to recolonize naturally over 28
days of incubation and a subsequent period of 28 days of
plant growth. While it is tempting to suggest that the
presence of mycorrhizal fungi might be responsible for
compensating plants for the inherent lack of phytase expres-
sion in all treatments except for the sterilized soils, this was
not supported by the results (i.e. mycorrhizal fungi were also
absent from the bacterial-wash treatment and no differences
were observed between the various plant lines). This sug-
gests that the presence of some other component of the
FEMS Microbiol Ecol 70 (2009) 433–445
441
microbial biomass, or the general presence of microorgan-
isms themselves in the rhizosphere, renders the expression
of phytase in plants ineffective relative to control lines. This
could be for a number of reasons, which include (1)
microbial decomposition or inactivation of the phytase
when exuded into the rhizosphere, although we have shown
previously that the enzyme can remain active in live soils
(George et al., 2007), (2) that the microbial biomass
indirectly mediates the availability of inositol phosphates
for mineralization by phytase (L’Annunziata, 1975;
Bünemann et al., 2008) and (3) that the presence of
phosphatase and phytase-exuding microorganisms in the
rhizosphere themselves compensates directly for the inabil-
ity of plants to utilize P from inositol phosphates. Indeed, a
wide range of soil fungi and bacteria that exhibit phytase
activity have been reported (Tarafdar & Claassen, 1988; Hill
& Richardson, 2007; Sakurai et al., 2008) and, in some
instances, have been shown to be more prominent in the
rhizosphere (Unno et al., 2005). Other studies have sug-
gested that shifts in rhizosphere microbial community
structure are correlated with a more effective mineralizing
environment (Acosta-Martinez et al., 2003; Marschner et al.,
2006; Renalla et al., 2006). However, this was not evident in
the present study and it is important to note that under
certain conditions of enhanced availability of inositol phos-
phates, plants exuding phytase do have an advantage even in
live soils (George et al., 2005a).
The g-irradiation treatment also had a major effect on the
growth of all plant lines, with both transgenic and control
lines producing larger biomass and accumulating more P
than when grown in the unamended soil. This response may
be due to either a relief of pathogenesis or due to the
increased availability of P. For the former, it was evident
that reduced growth and P accumulation occurred in both
the reinoculation treatments and less growth and P accu-
mulation was evident in the P-fertilized soil, despite the P-
rate being considered to be sufficient for maximum plant
growth. An alternative explanation is that the irradiation
treatment resulted in a large release of P (Table 1), which
occurred presumably with the removal of any microorgan-
isms that may exert a deleterious effect on plant growth. The
lack of growth response of the transgenic lines that had
targeted expression of the phytase (i.e. from the AtPT1
promoter) may have also been affected by the availability of
P in these treatments, as it would be expected that the
expression of the phytase from this promoter would be
suppressed under such conditions (Mudge et al., 2003). The
impact of reinoculation on reduced plant growth might also
be attributed to a rapid immobilization of available P back
into microbial biomass and thus increased competition with
plants for access to this P (Jakobsen et al., 2005). The release
of cell contents other than inorganic P with g-irradiation,
i.e. monoester forms of P such as inositol phosphates

c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
442
(L’Annunziata, 1975; Bünemann et al., 2008) and easily
mineralized compounds (Oehl et al., 2001), is entirely
possible, and might also go some way towards explaining
the response of the phytase-exuding transgenic plants over
the controls.
Impact of the heterologous expression of
phytase in plants on the microbial community
structure in the rhizosphere and that associated
with roots
Despite the apparent interaction of rhizosphere microor-
ganisms and ability of the heterologous phytase to improve
the P nutrition of plants, there was little impact of the
different plant lines on the structure of the bacterial or
AM fungal communities. However, the presence of the
plants did have a major influence on selecting a community
structure that was different between the rhizosphere and
that associated with roots, with the latter showing less
richness of dominant members of the population and being
affected to a lesser extent by soil treatment. Other studies
have similarly shown differing community structure of
bacteria with increasing proximity to plant roots as opposed
to that in the rhizosphere (Brusetti et al., 2004; Crecchio
et al., 2007).
The different plant lines used in the study, though, did
not explain any significant variability in the structure of the
rhizosphere bacterial community, even when soil treatment
was removed as a variable, with the only consistent effect
being the presence or absence of a plant (Fig. 3). The
influence of the presence of a plant compared with an
unplanted control has commonly been observed and is
considered to be a major driver of microbial community
structure in soil and within the rhizosphere (Dunfield &
Germida, 2003; Philippot et al., 2006).
In contrast, soil treatment had large effects on the rhizo-
sphere microbial community structure, with a major com-
ponent of this variability being explained by the effect of
both g-irradiation and P availability. Irradiation of the soil
significantly reduced the richness of the bacterial population
as measured by T-RFLP and, although the change in micro-
bial biomass and the structural basis for this population shift
was not investigated, it was evident that reinoculation of the
sterilized soil shifted the bacterial community structure back
towards that of the unamended soil. This observation was
apparent in both the bacterial wash and addition of 5% fresh
soil treatments, with the latter having a more pronounced
effect (Fig. 4). While this may be a direct consequence of the
reintroduction of specific groups of microorganisms and
their interaction with plant roots, it may also be a result of
interactions of the microbial population with other aspects
of the soil environment.

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
T.S. George et al.
Indeed, there was a relationship between changes in the
community structure of the rhizosphere bacteria and the
availability of P to plants as measured by their P accumula-
tion (Fig. 4). However, whether the community structure
was reacting to the availability of P, or whether the avail-
ability of P was a consequence of the soil treatments only,
remains uncertain. The fact that P availability could be
increased without a significant change in the community
structure, as in the P-fertilized treatment, and with large
differences in community structure occurring between cer-
tain treatments without a major change in the availability of
P, suggests that this relationship is not straightforward.
What is of interest, though, is that despite g-irradiation
releasing less inorganic P than that added in the P-fertilized
treatment (as measured by standard P-extractions; Table 1),
the P released from the biomass appeared to be more
available for plant uptake, which hints at the importance of
the microbial biomass as a source of available P to plants
(Seeling & Zasoski, 1993; Bünemann et al., 2008) and their
important role in the soil P-cycle.
Soil treatment also had a significant effect on the bacterial
community structure associated with roots, although this
was less marked than that observed in the rhizosphere. This
suggests that the plant exerts a strong influence on the
composition of the root-associated bacterial community
structure, which, to a large extent, had an over-riding
influence over the effects due to soil treatment affecting the
more distant rhizosphere. As with the rhizosphere bacterial
community structure, there were no significant main effects
due to the expression of the phytase gene in transgenic
plants. This observation is similar to that of Rasche et al.
(2006), who demonstrated that any impacts of a transgenic
trait on bacterial endophytes were small in comparison with
other variables including plant genotype and soil type.
However, other studies have suggested a significant impact
of heterologous traits on the community structure of both
rhizosphere and root-associated bacteria (Siciliano et al.,
1998; Siciliano & Germida, 1999), despite these transgenic
traits not being targeted to the rhizosphere.
AM fungal community structure was also affected by the
soil treatment where g-irradiation was effective in removing
AM fungi from the soil. Consequently, no amplifiable AM
fungal DNA was present in the roots of plants grown in
either the irradiated soil or the irradiated soil that was
reinoculated with the bacterial wash. Of the other treat-
ments where AM was identified, the AM fungal community
structure in P-fertilized soil was significantly different from
the nonfertilized treatments. This suggests that P availability
not only affects the strength of mycorrhizal symbiosis but
also the community structure. Such a possibility has simi-
larly been demonstrated by others (Frey et al., 2004;
Vogelsang et al., 2006). In addition, plant line changed the
AM fungal community structure such that the control lines
FEMS Microbiol Ecol 70 (2009) 433–445
Impact of phytase genes on rhizosphere microorganisms
had a community structure different from the transgenic
lines. However, this difference only explained 1.3% of the
variability in the data and further resolution showed that
this was only seen in the live soil inoculum treatment. Other
studies have shown a significant impact of a transgenic trait
(e.g. expression of Bt genes in maize) on the AM fungal
infection of roots (Castaldini et al., 2005; O’Callaghan et al.,
2005). However, our data suggest that any impact of the
heterologous expression of phytase on the AM fungal
community structure was only evident following disruption
of the microbial community structure by sterilization of the
soil.
Overall, there was little evidence for any impact of the
transgenic plant lines on the structure of microbial commu-
nities either within the rhizosphere or on the root surface.
While it is not possible to suggest whether this would be the
case in other soils with different community structures, the
weak sorption environment of this spodosol is likely to allow
the greatest impact of the heterologous protein, which has
been shown to be strongly adsorbed in other stronger
sorbing soils (George et al., 2005b, 2007). Other studies
have similarly reported little impact of transgenic plants on
rhizosphere microbial community structure (Heuer & Smal-
la, 1999; Heuer et al., 2002; Brusetti et al., 2004; Devare et al.,
2004; Fang et al., 2005; Griffiths et al., 2006, 2007a, b).
Importantly, there was no major impact on functionally
important microbial groups here, for example AM fungi,
which have been designated as indicators of environmental
perturbation (Bruinsma et al., 2003; Kowalchuk et al., 2003).
This is the first study of the impacts on rhizosphere and
root-associated microbial community structure of the ex-
pression and extracellular release of a heterologous trans-
gene designed to specifically alter the biochemistry and
cycling of nutrients in the rhizosphere. Our data suggest
that while soil microorganisms appear to be involved in the
availability of P to plants, the microbial community in the
rhizosphere appears to be resistant to the impact of single-
gene changes in plants designed to alter root biochemistry
and nutrient cycling in the rhizosphere. In this case, a
transgenic technology aimed at improving the sustainability
of agriculture by altering rhizosphere biochemistry appears
to have little impact with regard to the ecology of the
microbial community and thus the wider ecology of the
agricultural system.
Acknowledgements
This research was supported by the European Commission
under a Marie Curie Outgoing International Fellowship
(T.S.G.) and the contents of the paper reflect the opinion of
the authors and not that of the European Commission. The
research in the paper was also contributed to by the Royal
Society (London) through funding for a China–UK Science
FEMS Microbiol Ecol 70 (2009) 433–445
443
Network between SCRI and ISSCAS (S.S.L.) and by a travel
grant from the Australian Academy of Science, International
Science Linkages Program (A.E.R.). SCRI is supported by a
grant-in-aid from the Scottish Government RERAD. The
authors thank L. Brown for technical assistance.
References
Acosta-Martinez V, Zobeck TM, Gill TE & Kennedy AC (2003)
Enzyme activities and microbial community in semi arid
agricultural soils. Biol Fert Soils 38: 216–227.
Amann RI, Ludwig W & Schleifer KH (1995) Phylogenetic
identification and in-situ detection of individual microbial
cells without cultivation. Microbiol Rev 59: 143–169.
Anderson G (1980) Assessing organic phosphorus in soil. The
Role of Phosphorus in Agriculture (Khasawneh FE, Sample EC &
Kamprath EJ, eds), pp. 411–431. American Society of
Agronomy, St. Louis.
Bent SJ & Forney LJ (2008) The tragedy of the uncommon:
understanding limitations in the analysis of microbial
diversity. ISME J 2: 689–695.
Blackwood CB (2006) Analysing microbial community structure
by means of terminal restriction length polymorphism (T-
RFLP). Molecular Approaches to Soil, Rhizosphere and Plant
Microorganism Analysis (Cooper J & Rao JR, eds), pp. 84–98.
CABI Publishing, Wallingford, Oxfordshire, UK.
Blackwood CB, Marsh T, Kim S-H & Paul EA (2003) Terminal
restriction fragment length polymorphism data analysis for
quantitative comparison of microbial communities. Appl
Environ Microb 69: 926–932.
Bruinsma M, Kowalchuk GA & Van Veen JA (2003) Effects of
genetically modified plants on microbial communities and
processes in soil. Biol Fert Soils 37: 329–337.
Brusetti L, Francia P, Bertolini C et al. (2004) Bacterial
communities associated with the rhizosphere of the transgenic
Bt 176 maize (Zea mays) and its non transgenic counterpart.
Plant Soil 266: 11–21.
Bünemann EK, Smernik RJ, Marschner P & McNeill AM (2008)
Microbial synthesis of organic and condensed forms of
phosphorus in acid and calcareous soils. Soil Biol Biochem 40:
932–946.
Castaldini M, Turrini A, Sbrana C et al. (2005) Impact of Bt corn
on rhizospheric and soil eubacterial communities and on
beneficial mycorrhizal symbiosis in experimental microcosms.
Appl Environ Microb 71: 6719–6729.
Crecchio C, Curci M, Pellegrino A, Ricciuti P, Tursi N &
Ruggierio P (2007) Soil microbial dynamics and genetic
diversity in soil under monoculture wheat grown in different
long-term management systems. Soil Biol Biochem 39:
1391–1400.
Deng H, Zhang B, Yin R, Wang HL, Mitchell SM, Griffiths BS &
Daniell TJ (2009) Long-term effect of re-vegetation on the
microbial community of a severely eroded soil in sub-tropical
China. Plant Soil, DOI: 10.1007/S11104-009-0124-9.

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
444
Devare MH, Jones CM & Thies JE (2004) Effect of Cry3Bb
transgenic corn and tefluthrin on the soil microbial
community: biomass, activity and diversity. J Environ Qual 33:
837–843.
Donn S, Griffiths BS, Neilson R & Daniell TJ (2008) DNA
extraction from soil nematodes for multi-sample community
studies. Appl Soil Ecol 38: 20–26.
Dunfield KE & Germida JJ (2001) Diversity of bacterial
communities in the rhizosphere and root interior of field-
grown genetically modified Brassica napus. FEMS Microbiol
Ecol 38: 1–9.
Dunfield KE & Germida JJ (2003) Seasonal changes in the
rhizosphere microbial communities associated with field-
grown genetically modified canola (Brassica napus). Appl
Environ Microb 69: 7310–7318.
Fang M, Kremer RJ, Motavalli PP & Davis G (2005) Bacterial
diversity in rhizospheres of nontransgenic and transgenic
corn. Appl Environ Microb 71: 4132–4136.
Frey SD, Knorr M, Parrent JL & Simpson RT (2004) Chronic
nitrogen enrichment affects the structure and function of the
soil microbial community in temperate hardwood and pine
forests. Forest Ecol Manag 196: 159–171.
George TS, Richardson AE, Hadobas P & Simpson RJ (2004)
Characterisation of transgenic Trifolium subterraneum L.
which expresses phyA and releases extracellular phytase:
growth and P nutrition in laboratory media and soil. Plant Cell
Environ 27: 1351–1361.
George TS, Richardson AE, Hadobas PA & Simpson RJ (2005a)
Expression of a fungal phytase gene in Nicotiana tabacum
improves phosphorus nutrition in soil grown plants. Plant
Biotechnol J 3: 129–140.
George TS, Richardson AE & Simpson RJ (2005b) Behaviour of
plant-derived extracellular phytase upon addition to soil. Soil
Biol Biochem 37: 977–978.
George TS, Turner BL, Gregory P, Cade-Menun B & Richardson
AE (2006) Depletion of organic phosphorus from oxisols in
relation to phosphatase activities in the rhizosphere. Eur J Soil
Sci 57: 47–57.
George TS, Simpson RJ, Gregory PJ & Richardson AE (2007)
Differential interactions of Aspergillus niger and Peniophora
lycii phytase with soil particles affects the hydrolysis of inositol
phosphates. Soil Biol Biochem 39: 793–803.
George TS, Brown LK, Gregory PJ, Simpson RJ & Richardson AE
(2009) Heterologous expression of microbial phytases in
plants: a potential way to improve the efficiency and
environmental impact of agricultural enterprises which rely on
animal manures for fertilisation. Nature, in press.
Griffiths BS, Caul S, Thompson J, Birch ANE, Scrimegour C,
Cortet J, Foggo A, Hackett CA & Krogh PH (2006) Soil
microbial and faunal community responses to Bt maize and
insecticide in two soils. J Environ Qual 35: 734–741.
Griffiths BS, Caul S, Thompson J, Birch ANE, Cortet J, Andersen
MN & Krogh PH (2007a) Microbial and microfaunal
community structure in cropping systems with genetically
modified plants. Pedobiologia 51: 195–206.

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
T.S. George et al.
Griffiths BS, Heckmann L-H, Caul S, Thompson J, Scrimegour C
& Krogh PH (2007b) Varietal effect of eight paired lines of
transgenic Bt maize and near-isogenic non-Bt maize on soil
microbial and nematode community structure. Plant
Biotechnol J 5: 60–68.
Gyamfi S, Pfeifer U, Stierschneider M & Sessitsch A (2002) Effects
of transgenic glufosinate-tolerant oilseed rape (Brassica napus)
and the associated herbicide application on eubacterial and
Pseudomonas communities in the rhizosphere. FEMS Microb
Ecol 41: 181–190.
Heffernan B (1985) A Handbook of the Methods of Inorganic
Chemical Analysis for Forest Soils, Foliage and Water, pp. 49–51.
CSIRO Division of Forest Research, Canberra, Australia.
Helgason T, Daniell TJ, Husband R, Fitter AH & Young JPW
(1998) Ploughing up the wood-wide web? Nature 394: 431.
Hénault C, English LC, Halpin C, Andreux F & Hopkins DW
(2006) Microbial community structure in soils with
decomposing residues from plants with genetic modifications
to lignin biosynthesis. FEMS Microbiol Lett 263: 68–75.
Heuer H & Smalla K (1999) Bacterial phyllosphere communities
of Solanum tuberosum L. and T4-lysozyme-producing
transgenic variants. FEMS Microbiol Ecol 28: 357–371.
Heuer H, Kroppenstedt RM, Lottmann J, Berg G & Smalla K
(2002) Effects of T4 lysozyme release from transgenic potato
roots on bacterial rhizosphere communities are negligible
relative to natural factors. Appl Environ Microb 68: 1325–1335.
Hill J & Richardson AE (2007) Isolation and assessment of
microorganisms that utilise phytate. Inositol Phosphates:
Linking Agriculture and the Environment (Turner BL,
Richardson AE & Mullaney EJ, eds), pp. 61–77. CABI
Publishing, Oxford, UK.
Ikeda S, Ytow N, Ezura H, Minamisawa K & Fujimura T (2006)
Soil microbial community analysis in the environmental risk
assessment of transgenic plants. Plant Biotechnol 23: 137–151.
Jakobsen I, Leggett ME & Richardson AE (2005) Rhizosphere
microorganisms and plant phosphorus uptake. Phosphorus,
Agriculture and the Environment (Sims JT & Sharpley AN, eds),
pp. 437–494. American Society for Agronomy, Madison.
Koide RT & Li M (1989) Appropriate controls for
vesicular–arbuscular mycorrhiza research. New Phytol 111:
35–44.
Kowalchuk GA, Bruinsma M & van Veen JA (2003) Assessing
responses of soil microorganisms to GM plants. Trends Ecol
Evol 18: 403–410.
L’Annunziata MF (1975) The origin and transformations of the
soil inositol phosphate isomers. Soil Sci Soc Am J 39: 377–379.
Lassen SF, Breinholt J, Ostergaard PR, Brugger R, Bischoff A,
Wyss M & Fuglsang CC (2001) Expression, gene cloning and
characterisation of five novel phytases from four
basidiomycete fungi: Peniophora lycii, Agrocybe pediades, a
Ceripori sp., and Trametes pubescens. Appl Environ Microb 67:
4701–4707.
Liu B, Zeng Q, Yan F, Xu H & Xu C (2005) Effects of transgenic
plants on soil microorganisms. Plant Soil 271: 1–13.
FEMS Microbiol Ecol 70 (2009) 433–445
Impact of phytase genes on rhizosphere microorganisms
Lung S-C, Chan W-L, Yip W, Wang L, Yeung EC & Lim BL (2005)
Secretion of beta-propeller phytase from tobacco and
Arabidopsis roots enhances phosphorus utilisation. Plant Sci
169: 341–349.
Lupwayi NZ, Hanson KG, Harker KN, Clayton GW, Blackshaw
RE, O’Donovan JT, Johnson EN, Gan Y, Irvine RB & Monreal
MA (2007) Soil Microbial biomass, functional diversity and
enzyme activity in glyphosate-resistant wheat–canola
rotations under low-disturbance direct seeding and
conventional tillage. Soil Biol Biochem 39: 1418–1427.
Marschner P, Solaiman Z & Rengel Z (2006) Rhizosphere
properties of Poaceae genotypes under P-limiting conditions.
Plant Soil 283: 11–24.
McNamara NP, Black HIJ, Beresford NA & Parekh NR (2003)
Effects of acute g irradiation on chemical, physical and
biological properties of soils. Appl Soil Ecol 24: 117–132.
Mudge SR, Smith FW & Richardson AE (2003) Root-specific and
phosphate-regulated expression of phytase under the control
of a phosphate transporter promoter enables Arabidopsis to
grow on phytate as a sole phosphorus source. Plant Sci 165:
871–878.
O’Callaghan M, Glare TR, Burgess EPJ & Malone LA (2005)
Effects of plants genetically modified for insect resistance on
nontarget organisms. Annu Rev Entomol 50: 271–292.
Oehl F, Oberson A, Sinaj S & Frossard E (2001) Organic
phosphorus mineralization studies using isotopic dilution
techniques. Soil Sci Soc Am J 65: 780–787.
Olsen SR & Sommers LE (1982) Phosphorus. Methods of Soil
Analysis, Part 2. Chemical and Microbiological Properties (Page
AL, Miller RH & Keeney DR, eds), pp. 403–430. American
Society for Agronomy, Madison.
Philippot L, Kuffner M, Cheneby D, Depret G, Lauguerre G &
Martin-Laurent F (2006) Genetic structure and activity of the
nitrate reducers community in the rhizosphere of different
cultivars of maize. Plant Soil 287: 177–186.
Rasche F, Velvis H, Zachow C, Berg G, van Elsas JD & Sessitsch A
(2006) Impact of transgenic potatoes expressing anti-bacterial
agents on bacterial endophytes is comparable with the effects
of plant genotype, soil type and pathogen infection. J Appl Ecol
43: 555–566.
Renalla G, Landi L, Ascher J, Ceccherini MT, Pietramellara G &
Nannipieri P (2006) Phosphomonoesterase production and
persistence and composition of bacterial communities during
plant material decomposition in soils with different pH values.
Soil Biol Biochem 38: 795–802.
Richardson AE, Hadobas PA & Hayes JE (2001) Extracellular
secretion of Aspergillus phytase from Arabidopsis roots
enables plants to obtain phosphorus from phytate. Plant J 25:
641–649.
FEMS Microbiol Ecol 70 (2009) 433–445
445
Saggar S, Hedley MJ & White RE (1990) A simplified resin
membrane technique for extracting phosphorus from soils.
Fert Res 24: 173–180.
Sakurai M, Wasaki J, Tomizawa Y, Shinanoi T & Osaki M (2008)
Analysis of bacterial communities on alkaline phosphatase
genes in soil supplied with organic matter. Soil Sci Plant Nutr
54: 62–71.
Schünmann PHD, Llewellyn DJ, Surin B, Boevink P, De Feyter RC
& Waterhouse PM (2003) A suite of novel promoters and
terminators for plant biotechnology. Func Plant Biol 30:
443–452.
Seeling B & Zasoski RJ (1993) Microbial effects in maintaining
organic and inorganic solution phosphorus concentrations in
grassland topsoil. Plant Soil 148: 277–284.
Sessitsch A, Kan F-Y & Pfeifer U (2003) Diversity and community
structure of culturable Bacillus spp. Populations in the
rhizospheres of transgenic potatoes expressing the lytic
peptide cecropin B. Appl Soil Ecol 22: 149–158.
Siciliano SD & Germida JJ (1999) Taxonomic diversity of bacteria
associated with the roots of field-grown transgenic Brassica
napus cv. Quest, compared to the non-transgenic B. napus cv
Excel and B. rapa cv. Parkland. FEMS Microbiol Ecol 29:
263–272.
Siciliano SD, Theoret CM, de Freitas JR, Hucl PJ & Germida JJ
(1998) Differences in the microbial communities associated
with the roots of different cultivars of canola and wheat. Can J
Microbiol 44: 844–851.
Simon L, Lalonde M & Bruns TD (1992) Specific amplification of
18S fungal ribosomal genes from VA endomycorrhizal fungi
colonising roots. Appl Environ Microb 58: 291–295.
Smith SE & Read DJ (1997) Mycorrhizal Symbiosis. Academic
Press, San Diego.
Tarafdar JC & Claassen N (1988) Organic phosphorus
compounds as a phosphorus source for higher plants through
the activity of phosphatases produced by plant roots and
microorganisms. Biol Fert Soils 5: 308–312.
Turner BL, Papházy MJ, Haygarth PM & McKelvie ID (2002)
Inositol phosphates in the environment. Philos T R Soc B 357:
449–469.
Unno Y, Okubo K, Wasaki J, Shinano T & Osaki M (2005) Plant
growth promotion abilities and microscale bacterial dynamics
in the rhizosphere of Lupin analysed by phytate utilisation
ability. Environ Microbiol 7: 396–404.
Vogelsang KM, Reynolds HL & Bever JD (2006) Mycorrhizal
fungal identity and richness determine the diversity and
productivity of a tallgrass prairie system. New Phytol 172:
554–562.
Zimmermann P, Zardi G, Lehmann M, Zelder C, Amrhein N,
Frossard E & Bucher M (2003) Engineering the root–soil
interface via targeted expression of a synthetic phytase gene in
trichoblasts. Plant Biotechnol J 1: 353–360.

c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved