NEOPLASIA

Mitochondrial DNA mutations in patients with myelodysplastic syndromes

Myung Geun Shin, Sachiko Kajigaya, Barbara C. Levin, and Neal S. Young

We undertook to systematically analyze
the entire mitochondrial genome by gene
amplification and direct sequencing in 10
patients with myelodysplasia; results
were compared with concomitantly stud-
ied 8 healthy volunteers as well as mtDNA
sequences in a standard database. Nucle-
otide changes that were present in our
healthy controls as well as those in pub-
lished databases were counted as poly-
morphisms. Overall, there was no in-
crease in the number of mtDNA genes
harboring polymorphisms or “new” muta-
tions between our patients and healthy
controls, although there were a few more
mtDNA changes resulting in amino acid
changes in myelodysplasia (9 in 8 con-
trols versus 16 in 10 patients). Thirty new
mutations, all nucleotide substitutions,
were found among the 10 patients, distrib-
uted throughout the mitochondrial ge-
nome; 5 mutations resulted in amino acid
changes. None of the mutations in con-
trols produced amino acid changes. We
were not able to confirm previously de-
scribed mutations in sideroblastic ane-
mia or “hot spots” in the cytochrome c
oxidase I and II genes. Our data do not
support a major role for mitochondrial
genomic instability in myelodysplasia,
and they fail to reproduce previous re-
ports of significant or widespread mito-
chondrial mutations in this disease. Mod-
est changes in mutation numbers and
mitochondrial microsatellites may be evi-
dence of increased mutagenesis in
mtDNA, or, more likely, a reflection of
limited clonality among hematopoietic
stem cells in this bone marrow failure
syndrome. (Blood. 2003;101:3118-3125)
© 2003 by The American Society of Hematology

Introduction
The myelodysplastic syndromes (MDSs) are a heterogenous
group of hematologic diseases, characterized by bone marrow
failure and an increased risk of malignant transformation.1
Cytogenetic abnormalities are highly prevalent and correlate
with prognosis and progression to leukemia.2-4 The more
aggressive categories of MDSs, especially disease secondary to
exposure to alkylating drugs, topoisomerase inhibitors, and
radiation, share risk factors with acute leukemia and show
stereotypical chromosome abnormalities.5-7 As in other prema-
lignant conditions, genomic instability has been implicated in
myelodysplasia. However, as with acute myeloid leukemia, the
basis for the genomic instability required to generate the number
of genetic lesions of a fully malignant phenotype has not been
explained. In particular, there is little evidence of defects in
mismatch repair and spindle checkpoint genes or for other
hypothesized mechanisms.1,8 Ras gene mutations are the most
frequent molecular abnormalities present in myelodysplasia,
followed by p15 gene hypermethylation, FLT3 duplication, and
p53 mutation, but these abnormalities are neither uniformly
present nor characteristic of the syndromes.9,10
One clue to a possible basis for genomic instability in myelodys-
plasia may be provided by the constitutional disease called Pearson
syndrome, in which sideroblastic anemia accompanies pancreatic
abnormalities.11,12 In this inherited disorder, a number of deletions
of mtDNA, as well as direct repeats, deletion-dimers, deletion-
multimers, or duplications were observed.12 Additionally, genetic
changes in mtDNA have been hypothesized more widely to play
important roles in senescence, malignancy,13 and autoimmune
disease.14,15 In comparison to the nuclear genome, mtDNA shows
some modification of the universal genetic code,16-18 a paucity of
introns, and lack of histone protection. Past evidence has indicated
that the mtDNA repair capacity of mitochondria is limited, and the
proximity of mtDNA to sites of active oxygen species generation is
suggestive that mtDNA might be more susceptible to mutation than
nuclear DNA. Although the limited repair capacity hypothesis has
been validated experimentally in some experimental systems,19,20
recent data have shown the existence of base excision repair
mechanisms in mammalian mtDNA.21,22
The observation of sideroblastic anemia in Pearson syndrome as
well as the theoretical concerns described earlier led to speculation that
mtDNA abnormalities might be pathophysiologic in human MDS.
Gattermann et al20 initially described abnormalities in the cytochrome c
oxidase (CO) gene in patients with acquired idiopathic sideroblastic
anemia and later in refractory anemia with excess blasts, lacking ringed
sideroblasts.23 Mutations leading to amino acid changes have been
described in a variety of genes and in different MDS subtypes.23 Even
more dramatic data supporting a role for mtDNA mutations in MDS
have recently been published by Reddy et al24; they reported that
mtDNA COI and COII genes contained large numbers of mutations and
evidence of a number of single nucleotide substitutions in a large
proportion of their patients.
Because mtDNA abnormalities might be reflective of an
increased susceptibility to mutagenesis in patients with bone
marrow failure, as well as provide a link to the development of
nuclear genomic instability, cytogenetic abnormalities, and

From the Hematology Branch, National Heart, Lung, and Blood Institute, M.G.S. and S.K. contributed equally to this work.
National Institutes of Health, Bethesda, MD; Biotechnology Division, Chemical
Reprints: Neal S. Young, Bldg 10, Rm 7C103; NIH; 9000 Rockville Pike,
Science and Technology Laboratory, National Institutes of Standards and
Bethesda, MD 20892-1652; e-mail: youngn@nhlbi.nih.gov.
Technology, Gaithersburg, MD.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
Submitted June 20, 2002; accepted November 12, 2002. Prepublished online
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
as Blood First Edition Paper, November 21, 2002; DOI 10.1182/blood-2002-06-
1825. © 2003 by The American Society of Hematology

3118 BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8

BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8 mtDNA MUTATIONS IN MDS 3119

Table 1. Patients and healthy controls marrow findings according to criteria of the French-American-British classifica-
Chromosomal tion system.25
No. Age, y/sex Diagnosis analysis

1 38/F Healthy control ND

mtDNA extraction and amplification
2 37/M Healthy control ND
3 41/F Healthy control ND Total DNA extraction. Mononuclear cells from bone marrow and periph-
4 41/M Healthy control ND eral blood were separated by density gradient centrifugation and washed
5 42/M Healthy control ND twice in phosphate-buffered saline. DNA was extracted using QIAamp
6 48/M Healthy control ND DNA blood mini kit (Qiagen, Valencia, CA). Extracted DNA was resus-
7 42/M Healthy control ND pended in TE buffer (pH 7.5) containing 10 mM Tris (tris(hydroxymethyl)
8 78/M Healthy control ND aminomethane) and 1 mM EDTA (ethylenediaminetetraacetic acid).
9 58/M RARS 46XY Oligonucleotide primers. To directly sequence the entire mtDNA, we
10 77/M RAEB 46XY used 20 primer pairs based on a modification of a published protocol26 to
11 61/M RA 46XY, 11q⫺ obtain 20 partially overlapping segments (Table 2). The COI and COII
12 42/F RA 46XX, t(1:13) genes were amplified using additional 6 and 3 primer pairs, respectively, for
13 56/M RAEB 46XY the confirmation of mutations in these regions. The COI gene at mtDNA
14 62/M RARS 46XY map position 5904 to 7445 was reamplified to produce 6 completely
15 60/M RA 46XY, 20q⫺ overlapping polymerase chain reaction (PCR) fragments to examine the
16 64/M RA 47XY, ⫹8 reported “hot spots,” using the following primers: F5700, 5⬘-TAAGCAC-
17 64/M RAEB 46XY, 20q⫺ CCTAATCAACTGGC-3⬘; R6262, 5⬘-GCCTCCACTATAGCAGATGCG-
18 65/M RARS 46XY 3⬘; F5999, 5⬘-TCTAAGCCTCCTTATTCGAGC-3⬘; R6526, 5⬘-ATAGTGAT-
M indicates male; F, female; ND, not done; RA, refractory anemia; RARS,
GCCAGCAGCTAGG-3⬘; F6242, 5⬘-CGCATCTGCTATAGTGGAGG-3⬘;
refractory anemia with ring sideroblast; and RAEB, refractory anemia with excess R6526, 5⬘-ATAGTGATGCCAGCAGCTAGG-3⬘; F6426, 5⬘-GCCATAAC-
blast. CCAATACCAAACG-3⬘; R7030, 5⬘-TGGGCTACAACGTAGTACGTG-
3⬘; F6744, 5⬘-GGCTTCCTAGGGTTTATCGTG-3⬘; R7255, 5⬘-TTTCATGT-
GGTGTATGCATCG-3⬘; F7075, 5⬘-GAGGCTTCATTCACTGATTTCC-
leukemic transformation, we undertook a systematic determina- 3⬘; and R7792, 5⬘-GGGCAGGATAGTTCAGACGG-3⬘. Similarly, the COII
tion of mtDNA sequence in patients with MDS. Our results do gene at mtDNA map position 7586 to 8269 was reamplified by PCR reaction to
not support a role for abnormalities in mtDNA in these produce 3 completely overlapping fragments: F7215, 5⬘-CGACGTTACTCG-
syndromes, and the minor changes that were found may be GACTACCC-3⬘; R7792, 5⬘-GGGCAGGATAGTTCAGACGG-3⬘; F7645, 5⬘-
explicable as the result of simpler features of the underlying TATCACCTTTCATGATCACGC-3⬘; R8215, 5⬘-GACGATGGGCAT-
pathophysiology of these diseases or naturally occurring muta- GAAACTG-3⬘; F7901, 5⬘-TGAACCTACGAGTACACCGACTAC-3⬘; R8311,
tions in mtDNA. 5⬘-AAGTTAGCTTTACAGTGGGCTCTAG-3⬘.
PCR conditions. The PCR mixture consisted of 50 to 100 ng total
DNA, 0.8 ␮M pair of primers, 0.4 mM of each deoxynucleoside triphos-
phate (dNTP), 2 U Taq DNA polymerase (TaKaRa LA Taq, Shiga, Japan), 5
Patients, materials, and methods ␮L 10 ⫻ buffer, and H2O in a total volume of 50 ␮L, and hybridizations
were performed in a DNA thermal cycler (Perkin-Elmer, Foster City, CA)
Patients and healthy control subjects
with one cycle of 96°C for 1 minute, followed by 36 cycles of 94°C for 30
Patients with MDS and controls are described in Table 1. Blood and bone marrow seconds, 52°C for 50 seconds, 72°C for 1 minute, and, finally, one cycle of
specimens were collected after informed consent was obtained following 72°C for 5 minutes followed by cooling to 4°C. A sample of amplified DNA
protocols approved by the Institutional Review Board of the National Heart, was electrophoresed in 1.5% agarose and stained with ethidium bromide to
Lung, and Blood Institute. MDS was diagnosed by peripheral blood and bone assess the purity and size of the PCR products.

Table 2. Primer sets used to amplify mtDNA

Sets Position Length, bp Forward primer Reverse primer

1 15-921 907 CACCCTATTAACCACTCACG ACTTGGGTTAATCGTGTGACC

2 873-1769 897 GGTTGGTCAATTTCGTGCCAG GCCAGGTTTCAATTTCTATCG
3 1657-2660 1004 CTTGACCGCTCTGAGCTAAAC AGAGACAGCTGAACCCTCGTG
4 2417-3557 1141 CACTGTCAACCCAACACAGG AGAAGAGCGATGGTGAGAGC
5 3441-4728 1288 ACTACAACCCTTCGCTGACG TTATGGTTCATTGTCCGGAGAG
6 4447-5882 1436 TTGGTTATACCCTTCCCGTAC GCTGAGTGAAGCATTGGACTG
7 5700-6526 827 TAAGCACCCTAATCAACTGGC ATAGTGATGCCAGCAGCTAGG
8 6426-7255 830 GCCATAACCCAATACCAAACG TTTCATGTGGTGTATGCATCG
9 7215-8215 1001 CGACGTTACTCGGACTACCC GACGATGGGCATGAAACTG
10 8164-9059 749 CGGTCAATGCTCTGAAATCTGTG GTGGCGCTTCCAATTAGGTG
11 8903-9848 946 CCCACTTCTTACCACAAGGC GAAAGTTGAGCCAATAATGACG
12 9754-10556 803 AGTCTCCCTTCACCATTTCCG GGAGGATATGAGGTGTGAGCG
13 10386-11600 1215 GGATTAGACTGAACCGAATTGG CTGTTTGTCGTAGGCAGATGG
14 11403-12189 787 GACTCCCTAAAGCCCATGTCG AAGCCTCTGTTGTCAGATTCAC
15 11901-12876 976 TGCTAGTAACCACGTTCTGGTG GATATCGCCGATACGGTTG
16 12793-13611 819 TTGCTCATCAGTTGATGATACG TCGAGTGCTATAGGCTTGTC
17 13518-14388 871 CATCATCGAAACCGCAAAC TTAGCGATGGAGGTAGGATTCG
18 14189-15396 1208 ACAAACAATGGTCAACCAGTAAC TTATCGGAATGGGAGGTGATTC
19 15260-16451 1192 AGTCCCACCCTCACACGATTC GCGAGGAGAGTAGCACTCTTG
20 16097-336 809 TACATTACTGCCAGCCACCATG TTAAGTGCTGTGGCCAGAAG
3120 SHIN et al
Sequence analysis
PCR products were purified with the QIA quick PCR purification kit
protocol (Qiagen), and cycle sequencing was performed in a volume of 20
␮L using 8 ␮L BigDye Terminator Ready Reaction Kit (Applied Biosys-
tems, Foster City, CA), 10 pmol forward or reverse primer, and 50 to 100 ng
PCR product. Using a DNA thermal cycler (Perkin-Elmer), cycle sequence
conditions were as follows: 25 cycles of 96°C for 10 seconds, 50°C for 5
seconds, 60°C for 4 minutes, and finally cooling to 4°C. Fluorescent-
labeled DNA was purified by DyeEx column (Qiagen) and then sequenced
by 310 ABI sequencer/genetic analyzer (Applied Biosystems). Forty
oligonucleotide primers derived from Levin et al26 were used in sequencing
the entire mtDNA genome (Figure 1).
Determination of polymorphisms and mutations
Sequence experimentally obtained was compared with the 2001 Revised
Cambridge Reference Sequence27,28 (http://infinity.gen.emory.edu/
mitomap.html) using the Blast2 program29 (http://www.ncbi.nlm.nih.gov/
blast/bl2seq/bl2.htlm) and the database search tool, MitoAnalyzer30 (http://
www.cstl.nist.gov/biotech/strbase/mitoanalyzer.html, 2000) to obtain pre-
liminary evidence for polymorphisms, mutations, and translation of amino
acids. All automated results were manually confirmed. Data from patients
with MDS also were compared with those obtained from concurrently
tested healthy subjects, and we treated nucleotide substitutions found in
both patients and healthy controls as polymorphisms. Thus, polymorphic
sequence variants were identified from both the reported and unpublished
database of polymorphisms in MITOMAP (http://infinity.gen.emory.
edu/mitomap.html) and sequence changes observed in healthy individuals.
When a mtDNA nucleotide change was only observed in patients with
MDS, it was considered a new mutation. New mutations were confirmed by
reamplification of the region using a separate cell specimen for DNA
extraction.
Mitochondrial genomic instability
We determined the mitochondrial genomic instability using 11 mitochondrial
markers: poly (C) tracts (starting bp position at 303, 311, 3566, 12 385, and
BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8
16 184); (CA)n microsatellite, starting bp at 514; poly (A) tract starting at 12 418
bp; deletions.31
Statistical analysis
The Mann-Whitney U test was used to evaluate statistical differences in the
numbers of affected mtDNA genes, newly detected mtDNA mutations, and
amino acid changes between patients and healthy volunteers; P ⬍ .05 was
considered significant.
Results
mtDNA PCR products
The entire 16 569-bp mitochondrial genome was completely
amplified using 20 overlapping 809- to 1288-bp PCR products,
yielding single distinct bands for all 20 primer sets. These PCR
products were then subjected to direct sequencing.
mtDNA nucleotide changes in healthy controls and patients
Among hematologic healthy control subjects, there were 102 mtDNA
sequence variants, which consisted of 75 polymorphisms already listed
in a published polymorphism database (http://infinity.gen.emory.edu/
mitomap.html) and 27 new sequence variations not previously recorded,
including unpublished mtDNA polymorphisms (Table 3). A total of 126
mtDNA nucleotide changes were noted among the 10 patients (Table 4),
30 nucleotide variants (mean ⫽ 3.0) were identified as mutations, and 5
mutations were predicted to produce amino acid change (Table 5; Figure
2). The 102 nucleotide changes (mean ⫽ 12.8) among the 8 healthy
individuals were distributed throughout the mitochondrial genome, and
none of the new sequence variants led to amino acid changes (Table 5).
Hot spot mutations
Mutations of mtDNA at 7264C⬎A and 7289delA (COI gene
region), 7595G⬎C and 7594T⬎G (COII gene region), ranging
Figure 1. Sequencing strategy for total mtDNA. Bars (–) show the 20
amplified mtDNA fragments. Numbers (1-40) indicate sequencing primers
corresponding to the PCR products. The 40 sequence primers26 include 1
(F15), 2 (R921), 3 (F873), 4 (F1234), 5 (F1657), 6 (F2105), 7 (F2972), 8
(R3006), 9 (F3441), 10 (F3931), 11 (F4447), 12 (F4976), 13 (F5318), 14
(F5700), 15 (R6526), 16 (F6426), 17 (R7255), 18 (F7215), 19 (F7645), 20
(F8164), 21 (F8539), 22 (F9309), 23 (R9403), 24 (F9754), 25 (F10127), 26
(F11001), 27 (R11166), 28 (R11927), 29 (F11901), 30 (F12357), 31
(F12793), 32 (F13188), 33 (F13518), 34 (R14388), 35 (R14926), 36
(R15396), 37 (F15260), 38 (R16451), 39 (F16097), and 40 (R336).
Original primer names are shown in parentheses.
BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8 mtDNA MUTATIONS IN MDS 3121

Table 3. Mitochondrial DNA variants in bone marrow specimens Table 3. Mitochondrial DNA variants in bone marrow specimens
of healthy controls of healthy controls (continued)
Affected Amino Affected Amino
No. Age, y/sex Polymorphism Mutation mtDNA gene acid change No. Age, y/sex Polymorphism Mutation mtDNA gene acid change

1 38/F 8602T⬎C ATPase 6 Phe3Leu 13368G⬎A ND5 No

14212T⬎C ND6 No 13965T⬎C ND5 No
16326A⬎G HV1 13966A⬎G ND5 Thr3Ala
16360C⬎T HV1 15607A⬎G CYTB No
2 37/M 4688T⬎C ND2 No 16296C⬎T HV1
7022T⬎C COI No 16324T⬎C HV1
8697G⬎A ATPase 6 No 7 42/M 89T⬎C HV2
9214A⬎G COIII His3Arg 101G⬎A HV2
10463T⬎C tRNA arginine 106G⬎C HV2
11812A⬎G ND4 No 198C⬎T HV2
13368G⬎A ND5 No 235A⬎G HV2
13965T⬎C ND5 No 309C⬎T HV2
14233A⬎G ND6 No 521-522delAC NC
15607A⬎G CYTB No 663A⬎G 12S rRNA
15927G⬎A tRNA threonine 1736A⬎G 16S rRNA
16294C⬎T HV1 4248T⬎C ND1 No
16296C⬎T HV1 4824A⬎G ND2 Thr3Ala
3 41/F 150C⬎T HV2 5460G⬎A ND2 No
723A⬎G 12S rRNA 6734G⬎A COI No
1721C⬎T 16S rRNA 6794A⬎G COI No
3197T⬎C 16S rRNA 7960A⬎G COI No
3861A⬎G ND1 No 8027G⬎A COII Ala3Thr
5836A⬎G tRNA tyrosine 12007G⬎A ND4 No
7768A⬎G COII No 16111C⬎T HV1
10262A⬎G ND3 No 16290C⬎T HV1
13017A⬎G ND5 No 16319G⬎A HV1
13617T⬎C ND5 No 16360C⬎T HV1
13637A⬎G ND5 Glu3Arg 8 78/M 3197T⬎C 16S rRNA
14182T⬎C ND6 No 5495T⬎C ND2 No
16270C⬎T HV1 11467A⬎G ND4 No
4 41/M 150C⬎T HV2 12372G⬎A ND5 No
7669C⬎T COII No 13617T⬎C ND5 No
5 42/M 1018G⬎A 12S rRNA 15218A⬎G CYTB Thr3Ala
2416T⬎C 16S rRNA 16142C⬎T HV1
2789C⬎T 16S rRNA 16210A⬎G HV1
3594C⬎T ND1 No 16256C⬎T HV1
4104A⬎G ND1 No 16270C⬎T HV1
5022A⬎C ND2 Thr3Pro 16399A⬎G NC
6663A⬎G COI Ile3Val
A indicates adenine; C, cytosine; G, guanine; T, thymine; Ala, alanine; Arg,
7175T⬎C COI No
arginine; Glu, glutamic acid; His, histidine; Ile, isoleucine; Leu, leucine; Phe,
7256C⬎T COI No phenylalanine; Pro, proline; Thr, threonine; Val, valine; ATPase, ATP synthase; CO,
7274C⬎T COI No cytochrome c oxidase; CYTB, cytochrome b; HV, hypervariable segment; NC,
7771A⬎G COII No noncoding region; and ND, NADH dehydrogenase.
8155G⬎A COII No
8026G⬎A COII No
from 15% to 40% have been recently reported in MDS.24 In the
9221A⬎G COIII No
current study, 8 known polymorphisms were detected in the COI
10115T⬎C ND3 No
10799C⬎T ND4 No
and COII gene among our patients (Table 4).
11944T⬎C ND4 No
Statistical comparisons
12693A⬎G ND5 No
13650C⬎T ND5 No Compared with the 2001 Revised Cambridge Reference Sequence
13803A⬎G ND5 No and with sequences from healthy subjects and patients, we
14566A⬎G ND6 No
excluded nucleotide changes found in both healthy controls and
15884G⬎A HV1
patients. Although there was a small increase in the number of
16390G⬎A NC
6 48/M 215A⬎G HV2
amino acid changes predicted to result from polymorphisms and
520C⬎CAC NC mutations in the MDS group (mean ⫽ 1.6) compared with healthy
1888G⬎A 16S rRNA individuals (mean ⫽ 1.1), this difference was not statistically
2141T⬎C 16S rRNA significant (Table 6). There was no difference in the number of
8697G⬎A ATPase 6 No affected mtDNA genes in patients with MDS and healthy individu-
9117T⬎C ATPase 6 No als (Table 5). For mutations alone, only those from patients showed
10463T⬎C tRNA arginine amino acid changes (mean ⫽ 0.5) (Table 5).
11719G⬎A ND4 No We used homopolymeric tracts and deletions reported for the
12741C⬎T ND5 No
detection of mitochondrial genomic instability in human tumors.
3122 SHIN et al BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8

Table 4. Mitochondrial DNA aberrations (nucleotide changes) Table 4. Mitochondrial DNA aberrations (nucleotide changes)
in bone marrow specimens of patients with MDS in bone marrow specimens of patients with MDS (continued)
Age, y/ Affected Amino acid Age, y/ Affected Amino acid
No. sex Polymorphism Mutation mtDNA gene change No. sex Polymorphism Mutation mtDNA gene change

9 58/M 204T⬎C HV2 16129G⬎A HV1

4715A⬎G ND2 No 16148C⬎T HV1
10256T⬎C ND3 No 16294C⬎T HV1
16147C⬎T HV1 16374A⬎C HV1
10 77/M 182C⬎T HV2 16391G⬎A NC
2015G⬎A 16S rRNA 14 62/M 215A⬎G HV2
3096T⬎C 16S rRNA 295A⬎G HV2
5585G⬎A NC 319T⬎C HV2
11206C⬎T ND4 No 489T⬎C 12S rRNA
11 61/M 189A⬎G HV2 1095T⬎C 12S rRNA
200A⬎G HV2 1850T⬎C 16S rRNA
1822T⬎C 16S rRNA 7789G⬎A COII No
4218T⬎C ND1 No 10499A⬎G ND4L No
5528T⬎C tRNA tryptophan 11377G⬎A ND4 No
5601C⬎T tRNA alanine 13708G⬎A ND5 Ala3Thr
7819C⬎A COII No 13722A⬎G ND5 No
8410C⬎T ATPase 8 No 14133A⬎G ND5 No
8527A⬎G ATPase 6 Met3Val 15257G⬎A CYTB Asp3Asn
8932C⬎T ATPase 6 Pro3Ser 16145G⬎A HV1
9540T⬎C COIII No 16231T⬎C HV1
9950T⬎C COIII No 16261C⬎T HV1
10070C⬎T ND3 No 15 60/M 7337G⬎A COI No
11440G⬎A ND4 No 12136T⬎C ND4 No
14769A⬎G CYTB Asn3Ser 14529C⬎G ND6 Gly3Arg
15514T⬎C CYTB No 15355G⬎A CYTB No
16129G⬎A HV1 15758A⬎G CYTB Ile3Val
16209T⬎C HV1 16259C⬎T HV1
16292C⬎T HV1 16311T⬎C HV1
16295C⬎T HV1 16 62/M 504T⬎C NC
16311C⬎T HV1 7337G⬎A COI No
12 42/F 153A⬎G HV2 8697G⬎A ATPase 6 No
235A⬎G HV2 9899T⬎C COIII No
663A⬎G 12S rRNA 10463T⬎C tRNA arginine
1736A⬎G 16S rRNA 12633C⬎A ND5 No
4248T⬎C ND1 No 13368G⬎A ND5 No
4541G⬎A ND2 No 14905G⬎A CYTB No
4824A⬎G ND2 Thr3Ala 15607A⬎G CYTB No
7830G⬎A COII Arg3His 15928G⬎A tRNA threonine
7867C⬎T COII No 16163A⬎G HV1
8027G⬎A COII Ala3Thr 16178T⬎C HV1
8794C⬎T ATPase 6 His3Tyr 16186C⬎T HV1
12007G⬎A ND4 No 16189T⬎C HV1
16111C⬎T HV1 16256C⬎T HV1
16209T⬎C HV1 17 64/M 3197T⬎C 16S rRNA
16290C⬎T HV1 5153A⬎G ND2 No
16319G⬎A HV1 9477G⬎A COIII Val3Ile
16362T⬎C HV1 9667A⬎G COIII Asp3Ser
13 56/M 199T⬎C HV2 11467A⬎G ND4 No
204T⬎C HV2 13617T⬎C ND5 No
250T⬎C HV2 14793A⬎G CYTB His3Arg
568C⬎CC NC 15218A⬎G CYTB Thr3Ala
574A⬎C NC 16256C⬎T HV1
1719G⬎A 16S rRNA 16270C⬎T HV1
4529A⬎T ND2 No 16362T⬎C HV1
5074T⬎C ND2 Ile3Thr 16399A⬎G NC
8251G⬎A COII No 16428G⬎A NC
10034T⬎C tRNA glycine 18 65/M 4580G⬎A ND2 No
10238T⬎C ND3 No 12408T⬎C ND5 No
12408T⬎A ND5 No 14260A⬎G ND6 No
12501G⬎A ND5 No 14767T⬎C CYTB No
14233A⬎G ND6 No 15904C⬎T tRNA threonine
15043G⬎A CYTB No 16298T⬎C HV1
15244A⬎G CYTB No
Asn indicates Asparagine; Asp, aspartic acid; Gly, glycine; Met, methionine; Ser,
15924A⬎G tRNA threonine
serine; and Tyr, tyrosine.
BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8 mtDNA MUTATIONS IN MDS 3123

Table 5. The number and distribution of newly detected mtDNA mutations in bone marrow of patients with MDS and healthy controls
Patients with MDS Healthy controls
mtDNA
gene 9 10 11 12 13 14 15 16 17 18 No. M 1 2 3 4 5 6 7 8 No. M

NC 0 00 00 5 0.5 00 0 3 0.4
12S rRNA 0 1 0.1 0 1 0.1
16S rRNA 00 0 3 0.3 0 00 0 4 0.5
ND1 0 1 0.1 0 1 0.1
ND2 0 † 0 3 0.3 0 0 2 0.3
tRNA 0 1 0.1 0 1 0.2
COI 0 0.0 0 0 0 2 0.3
COII † 1 0.1 0 2 0.3
COIII 0 0.0 0 1 0.1
ATPase 8 0 1 0.1 0 0.0
ATPase 6 † 1 0.1 0 1 0.1
COIII 0 0.0 0 0.0
ND3 0 0 2 0.2 0 0.0
ND4L 0 0.0 0 0.0
ND4 0 0 0 3 0.3 0 1 0.1
ND5 0 0 0 3 0.3 0 0 000 00 7 0.9
ND6 † 0 2 0.2 0 1 0.1
CYTB †0 0 3 0.3 0 0.0
Total 1 4 8 2 4 2 2 3 1 3 30 3.0 0 3 6 0 9 4 3 2 27 3.4

NC indicates noncoding region including hypervariable segments; M, mean; †, amino acid change; and 0, no amino acid change.

Among the 11 markers, abnormalities were observed in 3 poly (C)s,
starting at bp 303, 311, and 16 184, respectively. Although there
was a statistical significance difference between MDS group
(n ⫽ 18, mean ⫽ 1.8) and control group (n ⫽ 8, mean ⫽ 1.0), too
few samples were analyzed to exclude the possibility that the C
stretch abnormalities had segregated randomly because of their
relative frequency in normal populations (see “Discussion”).
Discussion
To date, more than 100 point mutations and more than 200 deletions and
rearrangements in mtDNA have been associated with disease, and new
mutations are being described every year.15 Ironically, the database of
“normal” mtDNA sequences is relatively limited. The classic Cam-
bridge Reference Sequence, based on a consensus analysis of a placenta,
the HeLa cell line, and some information from the bovine sequence, has
been corrected based on a reanalysis of the original placenta.27 Although
other sequences have been reported in the literature and to computerized
databases, the origin of the tissues tested has often been from individuals
suspected of harboring pathologic mutations or their family members.
Even the distinction between polymorphisms, which are common, and
new mutations, is poorly demarcated. For these reasons, in the current
study we also undertook to determine the sequence of bone marrow
mtDNA from a comparable number of age-matched healthy volunteers.
In the current work, we found a large number of polymorphisms
as well as apparent new mutations in both patients and controls,
with no statistical difference overall between these 2 populations of
individuals. For the patients with MDS, there was a modest number
of “new” (not present in http://www.gen.emory.edu/mitomap.html)
mutations that resulted in predicted amino acid changes in the gene
product; among the 10 patients, 5 mutations producing nonsynony-
mous alterations were found in nicotinamide adenine dinucleotide
dehydrogenase (ND)2, COII, adenosine triphosphatase (ATPase) 6,
ND6, and cytochrome b (CYTB). No patient showed more than a
single such amino acid change, and most of the patients with MDS,
therefore, were not distinguishable from healthy individuals. We
did not observe small deletions. Large deletions, in particular the
common 4.9-kb deletion between the ATPase8 and ND5 genes32,33
and other large deletions that characterize Pearson syndrome, or
deletions observed in some other constitutional mtDNA diseases
would need additional experiments to confirm.
Our results differ and in some respects fail to confirm data from
other laboratories that have addressed the role of mtDNA in
myelodysplasia. Gattermann et al20 and Gattermann23 used tempera-
ture-gradient gel electrophoresis to identify duplexes of amplified
mtDNA products and then directly sequenced the implicated
region. Looking first at acquired idiopathic sideroblastic anemia,
because of its similarity to Pearson syndrome and the obvious
mitochondrial involvement, they first reported mutations producing

Figure 2. Sequence chromatogram of PCR-amplified

mtDNA COII gene from healthy control 6 (A), patient
12 (B). This 7830G⬎A mutation led to amino acid change
from Arg to His.
3124 SHIN et al BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8

Table 6. Amino acid changes among polymorphism and mutation

Patients with MDS Healthy controls
mtDNA
gene 9 10 11 12 13 14 15 16 17 18 No. M 1 2 3 4 5 6 7 8 No. M

ND1 0 0.0 0 0
ND2 † † 2 0.2 † † 2 0.3
COI 0 0.0 † 1 0.1
COII †† 2 0.2 † 1 0.1
ATPase 8 0 0.0 0 0
ATPase 6 †† † 3 0.3 † 1 0.1
COIII †† 2 0.2 † 1 0.1
ND3 0 0.3 0 0
ND4L 0 0.0 0 0
ND4 0 0.0 0 0
ND5 † 1 0.1 † † 2 0.3
ND6 † 1 0.1 0 0
CYTB † † † †† 5 0.5 † 1 0.1
Total 0 0 3 4 1 2 2 0 4 0 16 1.6 1 1 1 0 2 1 2 1 9 1.1

NC indicates noncoding region including hypervariable segments; M, mean; †, amino acid change; and 0, no amino acid change.

amino acid sequence changes, mainly in the CYTB and COI
genes.20,23 Subsequently, these investigations were expanded to
other MDS categories and revealed mutations in CYTB in refrac-
tory anemia with excess blasts as well as in early leukemia. In total,
new mutations have been reported in 10 sideroblastic anemia cases
and 7 other MDSs.23 Comparison of these data with our own is not
entirely straightforward, partly because the German investigators
did not globally query mtDNA in their cases, the number of
negative cases is not described, nor were healthy controls included.
The putatively pathogenic mutations that they describe are not
present in published databases and were not found among our
healthy controls. However, in the 3 patients with sideroblastic
anemia whom we studied, none showed mutations producing
amino acid changes. We cannot exclude that examination of larger
numbers or more selected patients with clinical subtypes of
sideroblastic anemia might not reveal mutational events, but our
data do not support a general abnormality in mtDNA sequence in
this syndrome. Reddy et al24 also reported major abnormalities in
mtDNA sequence in myelodysplasia, including apparent hot spots:
16 of the 20 MDS cases showed mtDNA mutations, 4 in COI only,
3 in COII only, and 9 in both genes (only portions of these genes
were sequenced in this study). The COI changes included deletions,
insertions, and substitution mutations; COI mutations were most
frequently seen as 7264C⬎A (25%) and 7289delA (15%), and
COII gene mutations were most frequently seen at 7594T⬎G
(30%) and 7595G⬎C (40%). Even more remarkable, all the
substitutional mutations led to amino acid changes or generation of
a termination codon. These results are in striking contrast to our
own limited number of new mutations, of which none were found
at the putative hot spots described by Reddy et al.24 One possible
explanation for this discrepancy is misalignment of the sequences
obtained from the affected patients with 2001 Revised Cambridge
Reference Sequence, which differs from GenBank No. NC 001807
that Reddy et al24 used to design their primers. A 1-bp shift in the
sequence comparison using a Blast2 program (http://www.ncbi.n-
lm.nih.gov/blast/bl2seq/bl2.htlm) would produce such an unex-
pected result. This plausible explanation would also account for
failure to observe the mutations in peripheral blood cells and their
higher frequency in more mature marrow cells, for which there is
no proposed biologic mechanism.
In addition to the few new mutations, we also noted a modest
increase in homopolymeric poly (C) tracts; differences in these
tracts have been associated with mitochondrial genomic instability
analogous to microsatellites in nuclear genomic instability. Indeed,
microsatellite instability has been described in 2 of 26 patients with
MDS.34 However, in the mitochondrial forensic community, these
regions are referred to as the C-stretch regions; a notable example
occurs when a T at 16189 becomes a C, producing a 10C-stretch.
Within the population databases, there are a significant number of
individuals that have this substitution; for example, the Federal
Bureau of Investigation (FBI) database indicates that about 9.8% of
Caucasians and 12.6% of African Americans have this C-stretch
(http://www.fbi.gov/hq/lab/fsc/backissu/april2002/miller1.htm).
Therefore, because our numbers are small, this is probably not a
significant difference (T. Parsons, Armed Forces DNA Identifica-
tion Laboratory [AFDIL], Armed Forces Institute of Pathology
[AFIP], Department of Defense [DOD], personal communication,
June 2002). While it is tempting to associate both the limited new
mutations seen in a few patients and the abnormal homopolymeric
tracts with the pathophysiology of MDS, we believe that a more
likely and stringent interpretation is that these apparent abnormali-
ties are secondary to the small numbers of stem cell clones
operating to support hematopoiesis in this bone marrow failure
syndrome. Likely both mtDNA mutations (and also, less fre-
quently, nuclear DNA mutations) and differences in homopoly-
meric length are prevalent among hematopoietic stem and progeni-
tor cells and are ordinarily of no physiologic consequences.
Analysis of total DNA results in an averaging of these abnormali-
ties, a biologic regression to the normal mean. Such abnormalities
will be more likely observed when limited numbers of clones are
subjected to testing. Tumors, the ultimate clonal population, appear
to fix mutations that have arisen randomly.35 For mtDNA, point
mutations appear to be abundant in individual cells of normal
tissue, which by unconfirmed mechanisms such as the bottleneck
theory become homoplasmic for these abnormalities.36 Whether, as
is likely, individual clones of cells derived from normal bone
marrow progenitors will demonstrate similar phenomena are
amenable to experimentation.
Acknowledgments
We thank Prof Norbert Gattermann (Department of Hematology,
University of Dusseldorf, Germany) for helpful discussions and his
interest in our work.
BLOOD, 15 APRIL 2003 䡠 VOLUME 101, NUMBER 8
This paper is a contribution of the National Institutes of Health
(NIH) and National Institute of Standards and Technology (NIST)
and is not subject to copyright. Certain commercial equipment,
instruments, materials, or companies are identified in this paper to
References
1. Dansey R. Myelodysplasia. Curr Opin Oncol.
2000;12:13-21.
2. Sole F, Espinet B, Sanz GF, et al. Incidence,
characterization and prognostic significance of
chromosomal abnormalities in 640 patients with
primary myelodysplastic syndromes. Grupo Co-
operativo Espanol de Citogenetica Hematologica.
Br J Haematol. 2000;108:346-356.
3. Pfeilstocker M, Reisner R, Nosslinger T, et al.
Cross-validation of prognostic scores in myelo-
dysplastic syndromes on 386 patients from a
single institution confirms importance of cytoge-
netics. Br J Haematol. 1999;106:455-463.
4. Greenberg P, Cox C, LeBeau MM, et al. Interna-
tional scoring system for evaluating prognosis in
myelodysplastic syndromes. Blood. 1997;89:
2079-2088.
5. Felix CA. Secondary leukemias induced by topo-
isomerase-targeted drugs. Biochim Biophys Acta.
1998;1400:233-255.
6. Pedersen-Bjergaard J, Andersen MK, Chris-
tiansen DH. Therapy-related acute myeloid leuke-
mia and myelodysplasia after high-dose chemo-
therapy and autologous stem cell transplantation.
Blood. 2000;95:3273-3279.
7. Levine EG, Bloomfield CD. Leukemias and my-
elodysplastic syndromes secondary to drug, ra-
diation, and environmental exposure. Semin On-
col. 1992;19:47-84.
8. Olipitz W, Hopfinger G, Aguiar RC, et al. Defec-
tive DNA-mismatch repair: a potential mediator of
leukemogenic susceptibility in therapy-related
myelodysplasia and leukemia. Genes Chromo-
somes Cancer. 2002;34:243-248.
9. Fenaux P. Chromosome and molecular abnor-
malities in myelodysplastic syndromes. Int J He-
matol. 2001;73:429-437.
10. Willman CL. Molecular genetic features of myelo-
dysplastic syndromes (MDS). Leukemia. 1998;
12(suppl 1):S2-S6.
11. Rotig A, Colonna M, Bonnefont JP, et al. Mito-
chondrial DNA deletion in Pearson’s marrow/pan-
creas syndrome. Lancet. 1989;1:902-903.
12. Rotig A, Bourgeron T, Chretien D, Rustin P, Mun-
nich A. Spectrum of mitochondrial DNA rear-
rangements in the Pearson marrow-pancreas
syndrome. Hum Mol Genet. 1995;4:1327-1330.
specify the experimental procedure. Such identification does not
imply recommendation or endorsement by NIH and NIST, nor does
it imply that the materials or equipment identified are the best
available for this purpose.
13. Polyak K, Li Y, Zhu H, et al. Somatic mutations of
the mitochondrial genome in human colorectal
tumours. Nat Genet. 1998;20:291-293.
14. Chinnery PF, Turnbull DM. Mitochondrial DNA
mutations in the pathogenesis of human disease.
Mol Med Today. 2000;6:425-432.
15. Naviaux RK. Mitochondrial DNA disorders. Eur
J Pediatr. 2000;159(suppl 3):S219-S226.
16. Anderson S, Bankier AT, Barrell BG, et al. Se-
quence and organization of the human mitochon-
drial genome. Nature. 1981;290:457-465.
17. Taanman JW. The mitochondrial genome: struc-
ture, transcription, translation and replication.
Biochim Biophys Acta. 1999;1410:103-123.
18. Barrell BG, Anderson S, Bankier AT, et al. Differ-
ent pattern of codon recognition by mammalian
mitochondrial tRNAs. Proc Natl Acad Sci U S A.
1980;77:3164-3166.
19. Richter C, Park JW, Ames BN. Normal oxidative
damage to mitochondrial and nuclear DNA is ex-
tensive. Proc Natl Acad Sci U S A. 1988;85:6465-
6467.
20. Gattermann N, Retzlaff S, Wang YL, et al. Het-
eroplasmic point mutations of mitochondrial DNA
affecting subunit I of cytochrome c oxidase in two
patients with acquired idiopathic sideroblastic
anemia. Blood. 1997;90:4961-4972.
21. Bohr VA, Stevnsner T, de Souza-Pinto NC. Mito-
chondrial DNA repair of oxidative damage in
mammalian cells. Gene. 2002;286:127-134.
22. Chen D, Cao G, Hastings T, et al. Age-dependent
decline of DNA repair activity for oxidative lesions
in rat brain mitochondria. J Neurochem. 2002;81:
1273-1284.
23. Gattermann N. From sideroblastic anemia to the
role of mitochondrial DNA mutations in myelodys-
plastic syndromes. Leuk Res. 2000;24:141-151.
24. Reddy PL, Shetty VT, Dutt D, et al. Increased in-
cidence of mitochondrial cytochrome c-oxidase
gene mutations in patients with myelodysplastic
syndromes. Br J Haematol. 2002;116:564-575.
25. Bennett JM, Catovsky D, Daniel MT, et al. Pro-
posals for the classification of the myelodysplas-
tic syndromes. Br J Haematol. 1982;51:189-199.
26. Levin BC, Cheng H, Reeder DJ. A human mito-
chondrial DNA standard reference material for
mtDNA MUTATIONS IN MDS 3125
quality control in forensic identification, medical
diagnosis, and mutation detection. Genomics.
1999;55:135-146.
27. Andrews RM, Kubacka I, Chinnery PF, Lightowl-
ers RN, Turnbull DM, Howell N. Reanalysis and
revision of the Cambridge reference sequence for
human mitochondrial DNA. Nat Genet. 1999;23:
147.
28. Kogelnik AM, Lott MT, Brown MD, Navathe SB,
Wallace DC. MITOMAP: a human mitochondrial
genome database—1998 update. Nucleic Acids
Res. 1998;26:112-115.
29. Tatusova TA, Madden TL. BLAST 2 Sequences, a
new tool for comparing protein and nucleotide
sequences. FEMS Microbiol Lett. 1999;174:247-
250.
30. Lee MS, Levin BC. MitoAnalyzer, a computer pro-
gram and interactive web site to determine the
effects of single nucleotide polymorphisms and
mutations in human mitochondrial DNA. Mito-
chondrion. 2002;1:321-326.
31. Bianchi NO, Bianchi MS, Richard SM. Mitochon-
drial genome instability in human cancers. Mutat
Res. 2001;488:9-23.
32. Pearson HA, Lobel JS, Kocoshis SA, et al. A new
syndrome of refractory sideroblastic anemia with
vacuolization of marrow precursors and exocrine
pancreatic dysfunction. J Pediatr. 1979;95:976-
984.
33. Yanagihara I, Inui K, Yanagihara K, et al. Fluores-
cence in situ hybridization analysis of peripheral
blood cells in Pearson marrow-pancreas syn-
drome. J Pediatr. 2001;139:452-455.
34. Maeck L, Haase D, Schoch C, Hiddemann W,
Alves F. Genetic instability in myelodysplastic
syndrome: detection of microsatellite instability
and loss of heterozygosity in bone marrow
samples with karyotype alterations. Br J Haema-
tol. 2000;109:842-846.
35. Wang TL, Rago C, Silliman N, et al. Prevalence
of somatic alterations in the colorectal cancer cell
genome. Proc Natl Acad Sci U S A. 2002;99:
3076-3080.
36. Nekhaeva E, Bodyak ND, Kraytsberg Y, et al.
Clonally expanded mtDNA point mutations are
abundant in individual cells of human tissues.
Proc Natl Acad Sci U S A. 2002;99:5521-5526.