Conservation Genet Resour (2009) 1:183–187
DOI 10.1007/s12686-009-9045-4
TECHNICAL NOTE
Characterization of microsatellite loci of Tetragonisca angustula
(Hymenoptera, Apidae, Meliponini)
R. M. Brito Æ F. O. Francisco Æ A. M. T. Domingues-Yamada Æ
P. H. P. Gonçalves Æ F. C. Pioker Æ A. E. E. Soares Æ M. C. Arias
Received: 15 June 2009 / Accepted: 17 June 2009 / Published online: 28 June 2009
Ó Springer Science+Business Media B.V. 2009
Abstract An enriched genomic library was constructed
from Tetragonisca angustula, a stingless bee species
widely distributed in Brazil. The library was screened using
two simple-repeat oligonucleotide probes and 21 micro-
satellite primer pairs were designed flanking a selection of
repeat sequences within positive clones. The polymor-
phism of the microsatellite loci was analyzed by screening
a sample of 19 unrelated T. angustula workers. Fifteen out
of 21 loci were shown to be polymorphic, with observed
heterozygosity estimates ranging from 0.00 to 0.89. The
primers were also successfully used to amplify microsat-
ellite loci from other stingless bee species, Tetragonisca
fiebrigi, Tetragonisca weyrauchi, Lestrimelitta maracaia
and Schwarziana quadripunctata. The results from vari-
ability analyses suggest that the microsatellite loci isolated
from T. angustula will be useful in further population
studies for the species and also for other Meliponini.
Keywords Microsatellites
Tetragonisca angustula

Population genetics
Meliponini
R. M. Brito (&)
F. O. Francisco
A. M.
T. Domingues-Yamada
P. H. P. Gonçalves
M. C. Arias
Departamento de Genética e Biologia Evolutiva, Instituto de
Biociências, Universidade de São Paulo, Rua do Matão,
277, São Paulo, SP 05508-090, Brazil
e-mail: brito_rm@yahoo.com.br
F. C. Pioker
Departamento de Ecologia, Instituto de Biociências,
Universidade de São Paulo, Rua do Matão, travessa 14,
n. 321, São Paulo, SP 05508-900, Brazil
A. E. E. Soares
Departamento de Genética, Faculdade de Medicina de Ribeirão
Preto, Universidade de São Paulo, Av. Bandeirantes,
3900, Ribeirão Preto, SP 14049-900, Brazil
The decline of bee species has been observed worldwide
and has usually been associated with degradation of their
natural habitats, abusive use of pesticides, and direct
human action by mismanagement of apiaries (Klein et al.
2007). This issue has been of major concern (see Ghazoul
2005; Steffan-Dewenter et al. 2005) since in a short time it
may negatively affect the genetic variability of both plants
and bees, and also the economy since several crops depend
on bee pollination (Klein et al. 2007).
Deforestation in the Neotropical Region has been mas-
sive over the last 500 years. Some environments have been
dramatically reduced, such as the Atlantic forest in Brazil
which currently occupies less than 8% of its original area.
For bees in particular, damage to the environmental is a
threat not only by reducing nesting sites but also by iso-
lating populations in forest fragments which may lead to
inbreeding depression. In honeybees low genetic variability
is related to the production of diploid males due to csd
(complementary sex determination) gene homozygosis
(Beye et al. 2003). This locus determines whether a fer-
tilized egg will become a female (heterozygous) or a dip-
loid male (homozygous) (Cook 1993; Beye et al. 2003).
The diploid males are sterile and killed by workers, hence
reducing the effective number (Ne) of the population
(Zayed and Packer 2005). According to Kerr and Ven-
covsky (1982), a similar genetic system is observed in
stingless bees. However, recent data showed no evidence
for the existence of a csd locus in other Hymenopteran
species (Hasselmann et al. 2008). Therefore it is unclear if
low heterozygosis may represent a real risk for Meliponini
bees, the major pollinator group of Angiosperm according
to Michener (2000).
Analysis of population genetics, structuring and migra-
tion dynamics are frequently surveyed through codomi-
nant, generally neutral, nuclear markers such as
123
184
microsatellites (Sunnucks 2000). Few microsatellite prim-
ers are available for stingless bees (tribe Meliponini). To
date only three species have had their genomes screened to
develop microsatellite primers: Melipona bicolor (Peters
et al. 1998), Scaptotrigona postica (Paxton et al. 1999) and
Trigona carbonaria (Green et al. 2001). Those loci have
been successfully employed to access the polymorphism at
intra-specific level. However, despite these primers having
succeeded in some cross-species amplification experiments
(Peters et al. 1998; Paxton et al. 1999), we have found a
very low polymorphism level when they were employed in
a heterologous basis in population surveys of Plebeia
remota, Partamona helleri and Partamona mulata (Fran-
cisco et al. 2006). This low genetic variability may be a
natural consequence of habitat fragmentation, but also, can
be due to technical artifacts by the non-amplification of
some allele (null alleles) caused by primer mispairing at
the heterologous template during the PCR annealing step.
We are particularly interested in measuring the genetic
variability of Tetragonisca angustula, one of the most
popular stingless bees in the Neotropical region. This
species, widely distributed from southern Mexico to
southern Brazil (Camargo and Pedro 2008), is very com-
mon in urban and natural areas and is easily handled by
amateur and professional beekeepers. In the present work
we introduce a set of primers designed from the genome of
Tetragonisca angustula which will enable us in future
population surveys to accurately detect their genetic vari-
ability avoiding then misinterpretations of data due to null
alleles when using heterologous primers.
Total DNA was extracted from a pool of 15 individuals
using a phenol:chlorophorm protocol. The DNA was ana-
lyzed in 0.8% agarose gel and a sharp band (*500 ng/ll) of
high molecular weight was observed under a UV light. The
enriched microsatellite genomic library was constructed
according to Billotte et al. (1999) with some modifications.
Genomic DNA (5 lg) was digested with 50 U of Rsa I and
then linked to 10 lM of Rsa21 (50 CTCTTGCTTACGCGT
GGACTA30 ) and Rsa25 (50 TAGTCCACGCGTAAGCAA
GAGCACA30 ) adaptors. Fragments were selected by (GA)8
and (AGA)5 probes and then cloned into pGemÒ-T (Pro-
mega) vector and transformed into E. coli DH5a lineage.
From a total of 96 selected colonies, 80 were sequenced. The
sequences were aligned using the online software Multi-
Align (Corpet 1988) to verify a possible correspondence of
clones to the same locus. After the analysis of sequence
content for the presence of direct repeats, 21 primer pairs
were designed flanking the repeats using the Primer 3 tool,
available online (http://frodo.wi.mit.edu/primer3/input.htm)
(Table 1).
Nineteen unrelated workers from different Brazilian
regions were screened for the microsatellite loci. Also workers
of Tetragonisca fiebrigi, Tetragonisca weyrauchi,
123
Conservation Genet Resour (2009) 1:183–187
Lestrimelitta maracaia and Schwarziana quadripunctata
were tested for cross-species amplifications. T. angustula
specimens and the other Meliponini species were identified by
Dr João M. F. Camargo, FFCLRP/USP, Ribeirão Preto, Bra-
zil. Template DNA was extracted from the thorax of a single
individual per colony using the Chelex method (Walsh et al.
1991). The optimal annealing temperature of each primer pair
was optimized using a Robocycler Gradient 96 (Stratagene).
Amplifications were carried out in 10 ll reaction volumes
containing 3.6 ll of deionized Milli-Q water; 19 PCR buffer;
0.3 ll of MgCl2 25 mM; 0.2 ll of each primer 10 lM; 2 ll of
betaine 5 M; 2 ll of template DNA and 1 U Taq DNA
polymerase (Fermentas). PCR reactions were performed in an
AmpliGene thermocycler (Applied Biosystems) following
the conditions: 4 min at 94°C, then 35 cycles of 30 s at 94°C,
30 s at specific annealing temperature (Table 1), and 30 s at
72°C, followed by a final elongation step of 5 min at 72°C.
Amplified fragments were electrophoresed in 9% polyacryl-
amide gels and silver stained. Genic diversity, observed het-
erozygosity (HO), expected heterozygosity (HE), number of
alleles and allelic frequencies were estimated using formulas
inserted in Microsoft Excel by the second author (Francisco
2009). Tests for Hardy–Weinberg Equilibrium and Linkage
Disequilibrium were calculated by GENEPOP v4.0 (Rousset
2008).
Fifteen out 21 loci tested were polymorphic (P [ 0.05) in
a population survey comprising individuals from assorted
collection sites covering the geographic distribution of Te-
tragonisca angustula. The average value for allelic diversity
(A = 8.94) was higher than the observed for other Melipo-
nini species such as Melipona bicolor (3.88), Scaptotrigona
postica (5.67) and Trigona carbonaria (3.60) (Peters et al.
1998; Paxton et al. 1999; Green et al. 2001). The levels of
observed heterozygosity were lower than the expected
(Table 1) and significant deviations from the Hardy–Wein-
berg expectations were found in all loci except at Tang48,
Tang60, Tang61, and Tang70. Such results were expected
since we analyzed workers collected from colonies
2,000 km apart in some cases which surely do not represent a
panmictic population. Linkage disequilibrium was detected
(P \ 0.05) between loci Tang03/Tang17, Tang11/Tang57,
Tang11/Tang60, Tang57/Tang68, Tang65/Tang79, and
Tang68/Tang77. The PCR products from cross-species
amplification tests produced fragments of expected sizes for
all species analyzed, nonetheless non PCR product for
Tang57 locus was detected for L. maracaia (Table 2).
These loci can be assessed in studies of natural popu-
lations of T. angustula in order to detect how habitat
degradation is affecting their genetic variability. Also this
primer set will be useful for detection of endogamy,
especially in highly managed small populations from me-
liponaries and will allow us to test Kerr and Vencovsky’s
hypothesis. The present work also will contribute to
 Table 1 Characteristics of 16 microsatellite loci from Tetragonisca angustula
Locus Repeat motif GenBank Primer sequences (50 –30 ) Ta (°C) k Allele size HO HE
accession number range (bp)

Tang03 (AG)11 GQ184627 F: GGAACATTTGTTGAAGGAATTTG 60.0 6 196–210 0.32 0.75*

R: GCCGCATTGGTTTTCTTAAT
Tang11 (GA)22 GQ184612 F: TATTCCTATTCACGCGATGC 53.0 13 158–190 0.58 0.86*
R: AGACGATATGGTGGCATTCA
Tang12 (GA)24 GQ184613 F: CCAGATGCAACCCTTTGACT 53.0 14 176–218 0.68 0.88*
R: AGGCCCATCGAAGACCAT
Tang17 (AG)23 GQ184614 F: GTAATGTGGAACGTCTACG 52.0 10 138–172 0.53 0.84*
R: GATAATCGCGCGAGTGGAG
Tang29 (GA)26 GQ184615 F: CGGTCTTGAAGTGCGGAATA 55.0 11 171–207 0.68 0.90*
Conservation Genet Resour (2009) 1:183–187

R: CAGGAACGCGTAACCAACTT
Tang40 (TCAC)7TCAT(TC)14TGT(TCTTC)3 GQ184616 F: TACGTGACAACTTCCGAATG 52.5 11 110–188 0.42 0.78*
R: CGCCGCTAGTTCCCATATC
Tang48 (CT)13 GQ184617 F: TGACGGATAAAGAGAGGTCGAG 55.0 6 233–243 0.58 0.53
R: CTCTCGGATTCCTTGAGCTT
Tang57 (TC)5TT(TC)2TGTT(TC)18 GQ184618 F: GCCGATTTATGGCAACGATA 60.0 11 138–188 0.58 0.84*
R: TCGAATTTATAGTCTTCCGATTC
Tang60 (AG)27 GQ184619 F: GAGAAAACGATGAATGCCG 60.0 8 110–132 0.63 0.74
R: TGAGAGAAGGCAAGTTGTTGA
Tang61 (TA)5 GQ184620 F: GCTGTCGAATGTCTCTAAACC 55.0 2 110–112 0.05 0.05
R: TAGTCACATGGGCAAGATGC
Tang65 (AG)14 GQ184621 F: TGCTCGTTATAATTGCACCA 55.0 7 171–195 0.68 0.76*
R: CAGCTCAAGCCGTAAAGATG
Tang68 (TC)10 GQ184622 F: TAACGGAGCCGAGGATACAG 60.0 2 220–224 0.00 0.43*
R: CGATGAAATCGTGGATGAAG
Tang70 (AG)10 GQ184623 F: GGTTAGGGCGGTCGACTTAT 55.0 5 200–208 0.63 0.72
R: TGGTTCTCTCCGTTTTCGAC
Tang77 (CT)16CC(CT)3 GQ184624 F: CGTTTGAACGATGAACTGGA 55.0 10 175–225 0.89 0.79*
R: CCTATTTCCGACGCTCTGTC
Tang78 (CT)23 GQ184625 F: CGAATACGATCTGCACTCCTC 55.0 16 208–260 0.74 0.88*
R: ATTCACGACGATACGCCACT
Tang79 (TC)21 GQ184626 F: CTAGGCCGGACGACAGATTC 48.0 11 118–140 0.47 0.85*
R: TGAACTGTCTTCCTATCGTCTG
Flanking primers, optimal annealing temperatures (Ta), number of alleles (k), allele size range, observed (HO) and expected (HE) heterozygosity estimated from 19 unrelated workers. GenBank
accession numbers for cloned sequences are also given
* Denotes significant HWE departure (P \ 0.05)
185

123
186 Conservation Genet Resour (2009) 1:183–187

Table 2 Cross-species
Loci Tetragonisca Tetragonisca Lestrimelitta Schwarziana
amplification tests: (?)
fiebrigi weyrauchi maracaia quadripunctata
successful amplification and (-)
no amplification Tang03 ? ? ? ?
Tang11 ? ? ? ?
Tang12 ? ? ? ?
Tang17 ? ? ? ?
Tang29 ? ? ? ?
Tang40 ? ? ? ?
Tang48 ? ? ? ?
Tang57 ? ? - ?
Tang60 ? ? ? ?
Tang61 ? ? ? ?
Tang65 ? ? ? ?
Tang68 ? ? ? ?
Tang70 ? ? ? ?
Tang77 ? ? ? ?
Tang78 ? ? ? ?
Tang79 ? ? ? ?

molecular population surveys on other Meliponini species
providing a set of new microsatellite primers successfully
tested for Tetragonisca fiebrigi, Tetragonisca weyrauchi,
Lestrimelitta maracaia and Schwarziana quadripunctata.
Acknowledgements We would like to express our gratitude to Susy
Coelho Oliveira for the technical support; Dr João M. F. Camargo for
the identification of specimens; Dr Anete P. de Souza for protocols’
adaptation; Dr. Timothy Schaerf for the English revision; Conselho
Nacional de Desenvolvimento Cientı́fico e Tecnológico for a PhD
scholarship to AMTDY, Coordenação de Aperfeiçoamento de Pessoal
de Nı́vel Superior for a master degree scholarship to PHPG, and
Fundação de Amparo à Pesquisa do Estado de São Paulo for PhD
scholarships to FOF and FCP and for financial support (BIOTA 2004/
15801-0).
References
Beye M, Hasselmann M, Fondrk MK, Page RE Jr, Omholt SW (2003)
The gene csd is the primary signal for sexual development in the
honeybee and encodes an sr-type protein. Cell 114:419–429. doi:
10.1016/S0092-8674(03)00606-8
Billotte N, Lagoda PJR, Risterucci AM, Baurens FC (1999) Microsat-
ellite-enriched libraries: applied methodology for the develop-
ment of SSR markers in tropical crops. Fruits 54:277–288
Camargo JMF, Pedro SRM (2008) Meliponini Lepeletier, 1836. In:
Moure JS, Urban D, Melo GAR (eds) Catalogue of bees
(Hymenoptera, Apoidea) in the Neotropical Region—online
version. Available at http://www.moure.cria.org.br/catalogue.
Accessed 10 May 2009
Cook JM (1993) Sex determination in the Hymenoptera: a review of
models and evidence. Heredity 71:421–435. doi:10.1038/hdy.
1993.157
Corpet F (1988) Multiple sequence alignment with hierarchical
clustering. Nucl Acids Res 16:10881–10890
Francisco FO (2009) FOFpop v.2.0, a pool of Microsoft Excel sheets
to analyze genotypic data. Available at: http://www.ib.usp.br/
*lgea/fofpop. Accessed 15 May 2009
Francisco FO, Brito RM, Arias MC (2006) Alelle number and
heterozygosity for microsatellite loci in different stingless bee
species (Hymenoptera: Apidae, Meliponini). Neotrop Entomol
35:638–643. doi:10.1590/S1519-566X2006000500011
Ghazoul J (2005) Buzziness as usual? Questioning the global
pollination crisis. Trends Ecol Evol 20:367–373. doi:10.1016/
j.tree.2005.04.026
Green CL, Franck P, Oldroyd BP (2001) Characterization of
microsatellite loci for Trigona carbonaria, a stingless bee
endemic to Australia. Mol Ecol Notes 1:89–92. doi:0.1046/
j.1471-8278.2001.00041.x
Hasselmann M, Gempe T, Schiøtt M, Nunes-Silva CG, Otte M, Beye
M (2008) Evidence for the evolutionary nascence of a novel sex
determination pathway in honeybees. Nature 454:519–522. doi:
10.1038/nature07052
Kerr WE, Vencovsky R (1982) Melhoramento genético em abelhas. I.
Efeito do número de colônias sobre o melhoramento. Rev Bras
Genet 5:279–285
Klein A-M, Vaissie BE, Cane JH, Steffan-Dewenter I, Cunningham
SA, Kremen C, Tscharntke T (2007) Importance of pollinators in
changing landscapes for world crops. Proc R Soc B 274:303–
313. doi:10.1098/rspb.2006.3721
Michener CD (2000) The bees of the world. The John Hopkins
University Press, Baltimore
Paxton RJ, WeibSchun N, Quezada-Euán JJG (1999) Characteriza-
tion of dinucleotide microsatellite loci for stingless bees. Mol
Ecol 8:690–692
Peters JM, Queller DC, Imperatriz-Fonseca VL, Strassmann JE
(1998) Microsatellite loci for stingless bees. Mol Ecol 7:783–787
Rousset F (2008) GENEPOP’007: a complete re-implementation of
the GENEPOP software for Windows and Linux. Mol Ecol Res
8:103–106. doi:10.1111/j.1471-8286.2007.01931.x
Steffan-Dewenter I, Potts SG, Packer L (2005) Pollinator diversity
and crop pollination services are at risk. TREE 20:651–652. doi:
10.1016/j.tree.2005.09.004

123
Conservation Genet Resour (2009) 1:183–187 187

Sunnucks P (2000) Efficient genetic markers for population biology.
TREE 15:199–203. doi:10.1016/S0169-5347(00)01825-5
Walsh PS, Metzeger DA, Higuchi R (1991) Chelex 100 as a medium
for simple exraction of DNA for PCR-based typing from forensic
material. Biotech 10:506–513
Zayed A, Packer L (2005) Complementary sex determination
substantially increases extinction proneness of haplodiploid
populations. PNAS 102:10742–10746. doi:10.1073/pnas.05022
7110

123