Sie sind auf Seite 1von 3

UNIVERSIDAD TÉCNICA DE AMBATO

FACULTAD DE CIENCIA E INGENIERÍA EN ALIMENTOS


CARRERA DE INGENIERÍA BIOQUÍMICA
INGENIERIA GENETICA
DATOS INFORMATIVOS:
Estudiante: Stephanie Viviana Villalva Valencia
Docente: MSc. Fernanda Latorre
Nivel: Octavo “A” Bioquímica
Fecha de Presentación: 05 de junio de 2019
TEMA: Gen FLT3 (Leucemia Mieloide Aguda) (2982 pb)

DNA CODIFICANTE
ATGCCGGCGTTGGCGCGCGACGGCGGCCAGCTGCCGCTGCTCGTTGTTTTTTCTGCAATGATATTTG
GGACTATACAAATCAAGATCTGCCTGTGATCAAGTGTGTTTTAATCAATCATAAGAACAATGATTC
ATCAGTGGGGAAGTCATCATATCCCATGGTATCAGAATCCCCGGAAGACCTCGGGTGTGCGTTGAG
ACCCCAGAGCTCAGGGACAGGTACGAAGCTGCCGCTGTGGAAGTGGATGTATCTGCTTCCATCACA
CTGCAAGTGCTGGTCGACGCCCCAGGGAACATTTCCTGTCTCTGGGTCTTTAAGCACAGCTCCCTGA
ATTGCCAGCCACATTTTGATTTACAAAACAGAGGAGTTGTTTCCATGGTCATTTTGAAAATGACAG
AAACCCAAGCTGGAGAATACCTACTTTTTATTCAGAGTGAAGCTACCAATTACACAATATTGTTTA
CAGTGAGTATAAGAAATACCCTGCTTTACACATTAAGAAGACCTTACTTTAGAAAAATGGAAAACC
AGGACGCCCTGGTCTGCATATCTGAGAGCGTTCCAGAGCCGATCGTGGAATGGGTGCTTTGCGATT
CACAGGGGGAAAGCTGTAAAGAAGAAAGTCCAGCTGTTGTTAAAAAGGAGGAAAAAGTGCTTCAT
GAATTATTTGGGACGGACATAAGGTGCTGTGCCAGAAATGAACTGGGCAGGGAATGCACCAGGCT
GTTCACAATAGATCTAAATCAAACTCCTCAGACCACATTGCCACAATTATTTCTTAAAGTAGGGGA
ACCCTTATGGATAAGGTGCAAAGCTGTTCATGTGAACCATGGATTCGGGCTCACCTGGGAATTAGA
AAACAAAGCACTCGAGGAGGGCAACTACTTTGAGATGAGTACCTATTCAACAAACAGAACTATGA
TACGGATTCTGTTTGCTTTTGTATCATCAGTGGCAAGAAACGACACCGGATACTACACTTGTTCCTC
TTCAAAGCATCCCAGTCAATCAGCTTTGGTTACCATCGTAGAAAAGGGATTTATAAATGCTACCAA
TTCAAGTGAAGATTATGAAATTGACCAATATGAAGAGTTTTGTTTTTCTGTCAGGTTTAAAGCCTAC
CCACAAATCAGATGTACGTGGACCTTCTCTCGAAAATCATTTCCTTGTGAGCAAAAGGGTCTTGAT
AACGGATACAGCATATCCAAGTTTTGCAATCATAAGCACCAGCCAGGAGAATATATATTCCATGCA
GAAAATGATGATGCCCAATTTACCAAAATGTTCACGCTGAATATAAGAAGGAAACCTCAAGTGCTC
GCAGAAGCATCGGCAAGTCAGGCGTCCTGTTTCTCGGATGGATACCCATTACCATCTTGGACCTGG
AAGAAGTGTTCAGACAAGTCTCCCAACTGCACAGAAGAGATCACAGAAGGAGTCTGGAATAGAAA
GGCTAACAGAAAAGTGTTTGGACAGTGGGTGTCGAGCAGTACTCTAAACATGAGTGAAGCCATAA
AAGGGTTCCTGGTCAAGTGCTGTGCATACAATTCCCTTGGCACATCTTGTGAGACGATCCTTTTAAA
CTCTCCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCC
TCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGCAATTTAGGTATGAAAGCCA
GCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATA
TGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGGAAGGTACTAGGATCAGG
TGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGT
TGCCGTCAAAATGCTGAAAGAAAAAGCAGACAGCTCTGAAAGAGAGGCACTCATGTCAGAACTCA
AGATGATGACCCAGCTGGGAAGCCACGAGAATATTGTGAACCTGCTGGGGGCGTGCACACTGTCA
GGACCAATTTACTTGATTTTTGAATACTGTTGCTATGGTGATCTTCTCAACTATCTAAGAAGTAAAA
GAGAAAAATTTCACAGGACTTGGACAGAGATTTTCAAGGAACACAATTTCAGTTTTTACCCCACTT
TCCAATCACATCCAAATTCCAGCATGCCTGGTTCAAGAGAAGTTCAGATACACCCGGACTCGGATC
AAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGAAGATGAAATTGAATATGAAAACCAAAAAA
GGCTGGAAGAAGAGGAGGACTTGAATGTGCTTACATTTGAAGATCTTCTTTGCTTTGCATATCAAG
TTGCCAAAGGAATGGAATTTCTGGAATTTAAGTCGTGTGTTCACAGAGACCTGGCCGCCAGGAACG
TGCTTGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGGCTCGAGATATCATGAGTG
ATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGATGGCCCCCGAAAGCCTGT
TTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTCATATGGAATATTACTGTGGGAAATCTTCTC
ACTTGGTGTGAATCCTTACCCTGGCATTCCGGTTGATGCTAACTTCTACAAACTGATTCAAAATGGA
TTTAAAATGGATCAGCCATTTTATGCTACAGAAGAAATATACATTATAATGCAATCCTGCTGGGCTT
TTGACTCAAGGAAACGGCCATCCTTCCCTAATTTGACTTCGTTTTTAGGATGTCAGCTGGCAGATGC
AGAAGAAGCGATGTATCAGAATGTGGATGGCCGTGTTTCGGAATGTCCTCACACCTACCAAAACAG
GCGACCTTTCAGCAGAGAGATGGATTTGGGGCTACTCTCTCCGCAGGCTCAGGTCGAAGATTCGTA
G

DISEÑO DE PRIMERS
Primer forward
ATGCCGGCGTTGGCGCGCGACGGCG

Primer reverse
CTACGAATCTTCGACCTGAGCCTGC

TEMPERATURA DE ANILLAMIENTO
Tm= (wA+xT)*2 + (yG+zC)*4

Forward
Tm forward = (2A+3T)*2 + (12G+8C)*4 = 90 °C

Reverse
Tm reverse = (5A+6T)*2 + (5G+9C)*4 = 78°C

Relación
Tm = Tm for + Tm rev / 2 = (90 + 78) /2 = 84 °C

KIT COMERCIAL
Platinum ™ II Taq Hot-Start DNA Polymerase
Preparación del Mix
Componentes 20 µL reaction 80 µL reaction (C+, C-,
Templado, otro)
Templado de AND 1 4
10 µM forward primer 0.4 1.6
10 µM reverse primer 0.4 1.6
Agua ultra pura, nuclease free 4.2 16.8
Platinum TMGC Enhancer 4 16
Platinum Taq Hot-Start DNA Polymerase 10 40

Condiciones Térmicas de la PCR


Ciclos Pasos Temperatura Tiempo (s)
(°C)
1 Denaturacion 94 120
Inicial
30 Denaturacion 94 15
30 Anillamiento 84 15
30 Extensión 68 45 …(15/ kb)
1 Extensión Final 4 Infinito
almacenamiento

Número de copias finales


2^30 = 1073741824

Bandas en gel de Agarosa


Lader = DM3100
Control += Citocromo
Control - = Agua Ultra pura
Templado ADN
Base DM310 Citocrom Agu Templad
s 0 o a o
10
kb
9kb
8 kb
7 kb
6 kb
5 kb
4 kb
3 kb
2 kb
1 kb
25 b

Bibliografía:
Thermo Fisher Scientific. Invitrogen User Guide, Platinum ™ II Taq Hot-Start DNA Polymerase
Obtenido de:
https://assets.thermofisher.com/TFSAssets/BID/manuals/MAN0017536_Platinum_II_HS_Green_PCR
_MM_UG.pdf