Biology 0200

Homework Week 9
Due before 5 PM on
Friday March 25

1) Finding a Start Codon:

Typed below are the first 30 bases of a mRNA that is 437 bases in length and codes for a polypeptide of
131 amino acids. The initiation codon is found somewhere in these bases. Remembering the fact that the
actual initiation codon must lie in an open reading frame, identify which of several possible methionine
codons is the actual initiation codon.

5' CAUGCCAUGCUAACCAAAUGGCUCCCUAGA -......... - 3'

When you have found it:
• circle the initiation codon.
• use the genetic code table to write down its amino acid sequence.

2) Mutations and their effect on mRNA:

Ursinase is a bacterial enzyme consisting of a single 43,000 molecular weight polypeptide chain 351
amino acids). It is produced by translating a messenger RNA containing 1450 nucleotides. Recently, a
mutant of the URS gene (which codes for this mRNA) has been found that lacks a functional enzyme. The
mutant is the result of a single point mutation in which an Thymidine on the template strand of DNA was
changed to a Adenine. (see page 349 of your textbook, Freeman 3/e, for an excellent description of point
mutations).

Normally, ursine contains lysines (LYS) at positions 110 and 111 in the polypeptide chain. The mutant
produces a truncated polypeptide 110 amino acids in length, ending at a single lysine.

a) Explain, as precisely as you can, why the change from Thymidine to Adenine in the URS gene produces
a truncated polypeptide only 110 amino acids in length. Be specific enough to show the exact position
where the change occurred.

b) A geneticist friend of your has produced another mutation in the same strain of bacteria. This mutation,
called ONYX, also involves a single base change in a gene, although it is clearly not the URS gene. When
the ONYX and URS mutant alleles are both present in the same cell, a fully-functional Ursinase protein is
produced. However, this Ursinase protein now has tyrosine (TYR) in position 111 instead of lysine.

Your friend tells you that this gene (ONYX) codes for an RNA that is only 76 bases long, and is never
translated into a polypeptide! What gene is affected by the ONYX mutation? And why does it reverse the
effect of the URS mutation?

IMPORTANT HINT for (2b): Remember that not all genes code for mRNAs! Have we discussed any
genes in class that code for RNAs just 70 to 80 bases in length? (Yes, we have!) Could mutations in any of
these “other” RNAs affect the way a mRNA is translated? (Yes! Think carefully, and the answer should be
obvious)