STEM CELLS AND DEVELOPMENT

Volume 18, Number 10, 2009

© Mary Ann Liebert, Inc.
DOI: 10.1089/scd.2008.0223

Isolation and Differentiation of Chicken Mesenchymal Stem

Cells From Bone Marrow

Mahesh Khatri,1,* Timothy D. O’Brien,2 and Jagdev M. Sharma1,†

Mesenchymal stem cells (MSCs) are multipotent progenitor cells found in bone marrow that have the capac-
ity of differentiating into bone, cartilage, fat, muscle, and other tissues. Chicken MSCs were isolated from 1- to
14-day-old chickens. Microscopically, the cultured cells showed morphology resembling fibroblasts and divided
actively. Chicken MSCs expressed the transcription factors PouV, Sox2, and Nanog, which have been shown to be
critical for stem cell self-renewal and pluripotency. The multilineage differentiation potential of chicken MSCs
was revealed by their ability to undergo adipogenic, osteogenic, and chondrogenic differentiation. Like mam-
malian MSCs, chicken MSCs also had immunoregulatory activity and inhibited in vitro mitogenic response of
T cells. The inhibition of mitogenic response of T cells correlated with the production of nitric oxide (NO) in
cultures containing MSCs and T cells. Our data show for the first time that MSCs can be isolated from postnatal
chicken bone marrow and these cells are capable of in vitro multiplication and multilineage differentiation, thus
making them a suitable model in the field of stem cell research.

Introduction
teristics indicate that MSCs can be used as powerful tools in

M esenchymal stem cells (MSCs) were first isolated from

bone marrow as precursors for fibroblasts or stromal
cells. MSCs, also known as plastic-adherent marrow cells or
bone marrow stromal cells, have potential to differentiate
into cells with mesenchymal, mesodermal, neuroectodermal,
or endodermal lineage [1]. MSCs have been isolated from sev-
eral species, including human [2], mouse [3], rat [4], dog [5],
baboon, pig, sheep, goat, rabbit [6], and cat [7]. MSCs have
been isolated from embryonic chicks [8,9]; however, this is
the first report of isolation of MSCs from postnatal chickens.
MSCs constitute a small population (~0.001–0.01% nucle-
ated cells) of adult human bone marrow cells. MSCs have
been isolated from several tissues including adipose tissue,
skeletal muscle, synovium, spleen, thymus, blood, lung,
fetal blood, and amniotic fluid [10]. These cells have the
ability to produce cytokines and growth factors that support
and regulate haematopoiesis [11,12]. Several studies using a
variety of animal models have shown that MSCs may have a
role in the repair and regeneration of infarcted myocardium,
damaged bone, tendon, and cartilage [13–16]. These charac-
reconstructive medicine. Pluripotent stem cells are an attrac-
tive tool for tissue engineering and regenerative medicine.
MSCs isolated from humans as well as from other mam-
malian species have immunoregulatory function and inhibit
inflammation and immunological responses both in vitro
and in vivo. MSCs suppress T-cell proliferation probably via
mechanisms that are independent of major histocompati-
bility complex (MHC). Several soluble factors such as trans-
forming growth factor-β (TGF-β), hepatocyte growth factor,
indoleamine 2,3-dioxygenase (IDO), nitric oxide (NO), and
prostaglandin E2 (PGE2) have been reported to mediate
T-cell suppression by MSCs [10]. MSCs improve the outcome
of allogeneic transplantation by promoting hematopoietic
engraftment [17] and also reduce graft-versus-host disease
[18,19]. In vivo infusion of MSCs improved the course of
chronic autoimmune encephalomyelitis in multiple sclerosis
and other neurodegenerative disorders [20].
Chicken is the first farm animal with a completely se-
quenced genome. Because of its in ovo embryonic develop-
ment rather than in utero, chicken is an important model for

1
Department of Veterinary and Biomedical Sciences and 2Department of Veterinary Population Medicine, College of Veterinary
Medicine, University of Minnesota, Saint Paul, Minnesota.
*Current affiliation: Department of Food Animal Health Research Program, Ohio Agricultural Research and Development Center,
Ohio State University, Wooster, Ohio.
†
Current affiliation: The Biodesign Institute, Arizona State University, Tempe, Arizona.

1485
1486
embryology and development studies. Chicken serves as a
model organism for the study of viruses and cancer. Rous
sarcoma virus, the first tumor virus, and oncogene (src) were
identified in the chicken. The chicken immune system pro-
vided the first indication of the distinctions between T and B
cells, with the B-cell nomenclature based on the avian bursa
of Fabricius [21]. Thus, chicken is an important model system
for studies of evolution, embryology, immunology, oncology,
cell biology, virology, and gene regulation.
In the present study, we have, for the first time, isolated
and characterized MSCs from hatched specific pathogen-free
chickens. Chicken MSCs may be useful as a model system
for studies on development, physiology, and disease.
Materials and Methods
Isolation and expansion of MSCs
Femur bones were obtained from 1- to 14-day-old spe-
cific pathogen-free chickens. MSCs were isolated by previ-
ously described methods [2,22]. In brief, the tip of each bone
was removed and the marrow was harvested by inserting
a syringe needle into one end of the bone and flushing
with Dulbecco’s modified Eagle’s medium (DMEM; Gibco,
Carlsbad, CA). The bone marrow cells were filtered through
a 70-μm nylon mesh filter (BD, Falcon, San Jose, CA) and
mononuclear cells were obtained by density gradient centri-
fugation over Ficoll-Hypaque (gradient density 1.090). Cells
(1–5 × 105/cm2) were plated in 25-cm2 cell culture flasks
in DMEM containing 10% fetal bovine serum (FBS; Atlas
Biological, CO), 2 mm l-glutamine (Gibco, USA), and 1% an-
tibiotic solution (Sigma, St. Louis, MO). Cultures were incu-
bated at 37°C in a humidified atmosphere containing 95%
air and 5% CO2. The nonadherent cells were removed after
72 h of culture. When primary cultures became nearly con-
fluent, the cells were detached with 0.025% trypsin contain-
ing 0.02% EDTA and used for future experiments.
Colony-forming unit-fi broblast (CFU-F) assay
The colony-forming potential of MSCs was tested by plat-
ing 100 or 1,000 cells in a 60-mm2 cell culture dish. After 7–8
days of incubation at 37°C, the cells were fixed and stained
with 1% crystal violet in methanol for 30 min. All visible col-
onies greater than 3 mm were counted [22].
Proliferation of MSCs
The proliferation rate of chicken MSCs was determined
by cell count. For cell count: a total of 1 × 104 cells were plated
in a 24-well plate and a total of three replicas were prepared
for each observation. At intervals, the cells were trypsinized
and a total cell count was determined by Trypan blue dye
exclusion method.
Differentiation assays
Adipogenic differentiation. Adipogenic differentiation was
assayed by the method of Pittenger et al. [2]. In brief, ~104 cells/
well in 24-well plates were cultured in expansion media until
the cells reached 70%–80% confluence. Adipogenic differen-
tiation was induced by culturing confluent MSCs cultures in
DMEM supplemented with 10% FBS, 1 μM dexamethasone,
10 μg/mL insulin, 0.2 mM indomethacin for 21 days. The
KHATRI, O’BRIEN, AND SHARMA
media was completely replaced every 3–4 days. Adipogenic
potential was assessed by Oil Red O staining. The cells were
washed with PBS and fixed with 10% formalin for 30 min at
room temperature. Then the cells were incubated with fil-
tered 0.3% Oil Red O (Sigma-Aldrich, St. Louis, MO) in 60%
isopropanol for 30 min. After three washes in PBS, the cells
were photographed.
Osteogenic differentiation. Osteogenic differentiation was
assayed by the method of Pittenger et al. [2]. In brief, MSCs
were seeded in 24-well plates at a density of ~104 cells/well
and cultured in expansion media until the cells reached 90%–
100% confluence. Osteogenic differentiation was induced by
culturing the cells for 21 days in medium consisting of 100 nM
dexamethasone, 10 mM β-glycerophosphate (Sigma-Aldrich,
St. Louis, MO), 0.05 mM l-ascorbic acid-2-phosphate (Sigma-
Aldrich), and 10% FBS in DMEM. Fresh media was fed to cul-
tures every 3–4 days. Osteogenesis as indicated by calcium
deposition was evaluated by von Kossa staining. The cells
were washed with PBS, fixed with 10% formalin for 30 min at
room temperature, washed three times with distilled water,
and incubated in 5% silver nitrate (Sigma-Aldrich) for 45 min.
The cells were washed three times with distilled water and
incubated with sodium thiophosphate (5%) (Sigma-Aldrich)
for 2 min. Finally, the cells were washed three times with dis-
tilled water and photographed.
Chondrogenic differentiation. Chondrogenic differen-
tiation was assayed by the method of Pittenger et al. [2]
with minor modifications. The chondrogenic induction
of chicken MSCs was examined using high-density pellet
cultures (2 × 105 cells/pellet, 500 × g for 5 min) in DMEM
medium supplemented with 50 mM ascorbic acid, 0.5 mg/
mL insulin (Sigma). Recombinant human transforming
growth factor-β1 (Invitrogen, Carlsbad, CA) was added to
the pellet cultures at a final concentration of 10 ng/mL. The
medium was replaced every 2–3 days for 21 days. Sulfated
glycosaminoglycans were detected by 1% Alcian blue stain-
ing. The pellet was washed with PBS, fixed with 10% for-
malin for 30 min at room temperature, washed three times
with distilled water, and incubated in 1% Alcian blue (pH 1)
(Sigma-Aldrich) overnight. The cell pellet was washed three
times with distilled water and photographed.
RNA extraction and RT-PCR
RT-PCR was performed to examine the expression of
transcription factors and to confirm gene expression indic-
ative of cell differentiation [2,23]. RNA was isolated using
the TRIzol total RNA isolation reagent (Life Technologies,
Rockville, MD). The extracted RNA (1 μg) was reverse tran-
scribed by adding 5 mM of random hexamer oligonucle-
otides (Life Technologies), 200 units of SuperScript reverse
transcriptase (Life Technologies), 0.5 mM deoxyribonu-
cleotide triphosphates (dNTP) (Life Technologies), and 10
mM dithiothreitol (Life Technologies). The cDNA was then
amplified by PCR using primer sequences shown in Table 1.
After PCR, 10 μL of the reaction mixture was subjected to
electrophoresis on a 1.5% agarose gel, and the PCR products
were visualized by ethidium bromide staining.
T-cell proliferation assay
Splenocytes were prepared by centrifugation over
Ficoll-Hypaque gradients [24]. The cells were suspended in
CHICKEN MESENCHYMAL STEM CELLS FROM BONE MARROW 1487

Table 1. PCR Primer Sequences

PCR Accession
Gene Primers sequence (5′–3′) product (bp) no.

β-Actin Forward: CATCACCATTGGCAATGAGAGG 353 L08165

Reverse: GCAAGCAGGAGTACGATGAATC
CD44 Forward: GGTTTTATAGTGGGGCATATTGTTATCCC 700 AF153205
Reverse: TTAACCGCGATGCACACGGC
CD90 Forward: GGTCTACATGTGCGAGCTGA 471 NM 204381
Reverse: AAAGCTAAGGGGTGGGAGAA
CD45 Forward: CACTGGGAATCGAGAGGAAA 574 NM 204417
Reverse: CTGGTCTGGATGGCACTTTT
CD105 Forward: ACGGATGACACCATGGAAAT 704 AY702002
Reverse: ATGAGGAAGGCTCCAAAGGT
PouV Forward: AAATGTGTGAAGCCCAGTCC 401 DQ867024
Reverse: TTGTGGAAAGGTGGCATGTA
Sox2 Forward: TCCGGCGGTAATAATAGCAG 312 U12532
Reverse: TTGCTGATCTCCGAGTTGTG
Nanog Forward: CAGCAGACCTCTCCTTGACC 371 DQ867025
Reverse: CCAGATACGCAGCTTGATGA
PPAR-γ Forward: TACATAAAGTCCTTCCCGCTGACC 401 AF163811
Reverse: TCCAGTGCGTTGAACTTCACAGC
aP2 Forward: GAGTTTGATGAGACCACAGCAGA 312 AF432507
Reverse: ATAACAGTCTCTTTGCCATCCCA
Osteopontin Forward: TGCCAGGAAGCTCATTGAGGATG 371 M59182
Reverse: GCGTCTACATTTACAAACACACGTC
Collagen II Forward: GCAGAGACCATCAACGGCGGT 333 AY046949.1
Reverse: CAGGCGCGAGGTCTTCTGCGA

triplicate in 100 µL RPMI 1,640 medium supplemented with Statistical analysis

5% FBS (Sigma), 2 mM l-glutamine (Invitrogen, Carlsbad,
CA), 0.1 mg/mL streptomycin, and 100 U/mL penicillin G
(Invitrogen) in 96-well plate in the presence or absence of
MSCs. The cultures were stimulated or unstimulated with
mitogen (ConA, Phorbol 12-myristate 13-acetate (PMA), and
ionomycin) and incubated for 48 h at 37°C. The cells were
pulsed with [3H] thymidine during the last 5 h of incubation.
Lymphoproliferation was measured as counts per minute by
a Matrix 9600 beta counter (Packard Instrument Co., Meriden,
CT). All experiments were performed in triplicates.
ConA was purchased from Sigma (St. Louis, MO). Con A
was used at 5 μg/mL. PMA and ionomycin were from Sigma
and were used at concentrations of 50 ng/mL and 1 μg/mL,
respectively.
Measurement of NO production
NO production was determined by measurement of
nitrite in the medium as described earlier [25]. In brief, 50
μL of the spent medium from the cultures mentioned in the
T-cell proliferation assay was mixed with an equal volume
of 1:1 mixture of 1% sulfanilamide in water and 0.1% N-1-
naphthylethylenediamine dihydrochloride in 5% phospho-
ric acid. The absorbance was then read at 570 nm. Sodium
nitrite dissolved in the culture medium was used to con-
struct the standard curve. NO concentration was measured
in micromolars (μM). All experiments were performed in
triplicates.
Statistical analysis was performed by analysis of vari-
ance (ANOVA) followed by comparison of individual means
by Tukey’s test. P < 0.05 was considered to be statistically
significant.
Results
Cell culture
We isolated chicken MSCs from the bone marrow based
on their characteristic property of attachment to a plastic
surface. MSCs showed a fibroblast-like morphology. The ini-
tial adherent spindle-shaped cells appeared as individual
cells on the third day of culture. Within 2 weeks, the cells
reached 70%–80% confluency (Fig. 1A). To confirm that the
isolated cells had MSCs characteristics, we examined their
differentiation capacity and immune-modulating capabili-
ties as shown below.
CFU assay
MSCs isolated from humans and other animal species
have the ability to self-renew and propagate. The CFU assay
was used to assess the proliferation and colony-forming
potential of chicken MSCs. Chicken MSCs formed 30 ± 8
and 65 ± 10 colonies when plated at 100 and 1,000 cells per
60-mm culture dish, respectively (Fig. 1B).
1488
A B
C D
MSCs Cont.
30
* gene expression was detected up to passage 8. Total RNA
Cells (10×e4)
25
* CD45
20
15
10
5 CD105
0
1 2 3 4 5 6
Days
FIG. 1. Morphology, colony formation, and proliferation
potential of chicken mesenchymal stem cells (MSCs). (A)
Morphology of in vitro-expanded chicken MSCs obtained
from bone marrow. Culture-expanded chicken MSCs dem-
onstrate the spindle-shaped fibroblastic morphology. (B)
Colony-forming assay. A single cell can be expanded to
generate clones and form colonies (CFU) that are shown by
crystal violet staining. (C) Proliferation potential of MSCs.
MSCs were seeded in a 24-well plate and their proliferation
was measured over 6-day period by counting the viable cells
by Trypan blue dye. *Significantly different from Day 1; P <
0.05. (D) Phenotype of chicken MSCs. Reverse transcription-
polymerase chain reaction was performed using total RNA
extracted from passage 8 cells with specific primers, which
are shown in Table 1. The left column shows the results with
total RNA from MSCs. Total RNA prepared from normal
chicken spleen cells was used as a control (right column).
The proliferation potential of MSCs is shown in Figure
1C. These cells are continuously in culture for >8 months.
These data indicate that chicken MSCs are capable of self-
renewal and have high proliferation property.
To examine the phenotype of chicken MSCs, we per-
formed RT-PCR using specific primers for various mark-
ers (Table 1; Fig. 1D). The cells showed positive reactions
for CD44, CD90 (Thy-1), and CD105 (Endoglin), but did not
express CD45 indicating that these cells originated from
mesenchymal lineage cells.
Expression of PouV, Sox2, and Nanog transcription
factors in chicken MSCs
Several transcription factors are known to regulate the
development and differentiation of MSCs. In mammals,
MSCs pluripotency is under the control of transcription fac-
tors that include Oct4 [26], Nanog [27], Sox2 [28], and FoxD3
[29]. Oct4, the octomer-binding transcription factor 4, is an
important binding transcription factor present in undiffer-
entiated embryonic and adult stem cells with a high prolifer-
ative capacity. We detected transcription factors, PouV, Sox2,
and Nanog, in chicken MSCs but not in skin fibroblasts. PouV
is a chicken homolog of mammalian Oct4 and like Oct4 has
KHATRI, O’BRIEN, AND SHARMA
SF P2 P8
PouV
Sox2
Nanog
β-Actin
FIG. 2. Transcription factor expression in chicken mesen-
chymal stem cells (MSCs). Total cellular RNA was extracted
from MSCs and subjected to RT-PCR by using specific prim-
CD44 ers to PouV, Sox2, Nanog, or β-actin. PouV, Sox2, and Nanog
prepared from chicken skin fibroblasts (SF) was used as a
CD90 negative control.
β-Actin
been shown to regulate the pluripotency and self-renewal
of chicken embryonic stem cells [30]. As shown in Figure 2,
like mammalian MSCs [23,31], PouV, Nanog, and Sox2 gene
transcripts were expressed in chicken MSCs for as long as
eight passages in vitro (highest passage level tested).
Differentiation of chicken MSCs
To examine the multipotentiality of chicken MSCs, the
cells were cultured in the media specific for the induction of
adipocytes and osteocytes.
For the generation of adipocytes, 70%–80% confluent
cultures were incubated with adipocytes induction media.
After 21 days of incubation, differentiation of MSCs into
adipocytes was determined by staining with Oil Red O.
Differentiated cells contained multiple lipid vacuoles (Fig. 3A
and B). The accumulation of lipid vacuoles in the cells was
first detected between 48 and 72 h after the addition of adipo-
genic medium. The expression of adipogenic-specific genes,
aP2 and PPAR-γ, was induced in the adipocytes, thereby
confirming the adipogenic differentiation of MSCs (Fig. 3E).
Following incubation of MSCs in osteogenic media,
tightly packed colonies forming nodule-like structures were
observed. Deposition of calcium in these cells was dem-
onstrated by staining with von Kossa stain (Fig. 3C). The
osteocyte-specific gene, osteopontin was also up-regulated
in differentiated cells (Fig. 3F).
After 14 days of culture, MSCs exposed to TGF-β1 formed
a compact and homogeneous pellet structure, showing an
increased cellular density. Alcian blue staining revealed a
homogeneous deposition of proteoglycan within the whole
section of the pellet culture (Fig. 3D). The differentiated cells
showed gene expression of collagen II (Fig. 3G).
Characteristics of T-cell suppression by MSCs
MSCs isolated from humans, mice, and other animal spe-
cies suppress T-cell proliferation. Likewise, chicken MSCs
also inhibited ConA-induced T-cell proliferation (Fig. 4A).
We next induced T-cell proliferation using a combination
of PMA and ionomycin. PMA and ionomycin induce the dif-
ferentiation and expansion of immune cells by activating
the protein kinase C and inducing Ca2+ influx, respectively,
bypassing the TCR signaling. PMA and ionomycin-induced
proliferation was also suppressed by MSCs (Fig. 4B), suggest-
ing that MSCs can modulate signals downstream of protein
CHICKEN MESENCHYMAL STEM CELLS FROM BONE MARROW 1489

A B

C D

E F G
Induction Media Induction Media Induction Media
– + – + – +
PPAR-γ Osteopontin Collagen II

β-Actin β-Actin
aP2

β-Actin

FIG. 3. Multilineage differentiation of chicken mesenchymal stem cells (MSCs) in vitro. (A and B) Adipocyte differentia-
tion. Chicken MSCs were cultured in adipogenic medium. Representative photomicrographs of chicken MSCs are shown
(bright field; A) and stained with the Oil Red O dye. Accumulation of lipids into intracellular vesicles (B). (C) Osteocyte dif-
ferentiation. MSCs were cultured in osteogenic medium. Calcium deposition and mineralization were shown in monolayers
using von Kossa staining. (D) Chondrogenic differentiation. Micromass cultures of chicken MSCs cultured in the presence
of 10 ng/mL TGF-β1 showed a homogenous Alcian blue staining of proteoglycans. (E–G) RT-PCR showing the up-regulation
of the lineage-specific genes in adipogenic-, osteogenic-, and chondrogenic-differentiated cells, respectively. aP2, PPAR-γ,
osteopontin, and collagen II gene expression was induced in differentiated cells.

kinase C and Ca2+ influx and the T-cell receptor complex is
not a target for the suppression.
T-cell suppression and NO
The exact mechanism of MSCs-induced immunosup-
pression is yet to be defined, but several chemokines and
molecules of interest have been identified. NO produced by
macrophages has been reported to suppress T-cell prolifer-
ation. In a recent study, Sato et al. [32] showed that murine
MSCs T cells co-culture produce NO. This prompted us to
examine the production of NO in the chicken MSCs spleno-
cytes co-culture system. Co-culture of chicken MSCs with
T cells induced a significant (P < 0.05) and dose-dependent
production of NO (Fig. 5). NO production was not significant
when MSCs were co-cultured with T cells in the absence of
ConA or by ConA-treated MSCs or T cells. High levels of
NO were produced in the co-cultures of T cells and MSCs
and this was accompanied by a strong suppression of T-cell
proliferation.
Discussion
In the present study, we isolated and expanded adherent
cells obtained from chicken bone marrow. The isolated cells
showed features consistent with MSCs. The bone marrow-
derived MSCs expressed transcription factors PouV, Sox2,
and Nanog and differentiated along osteogenic and adipo-
genic lineages when cultured under the appropriate con-
ditions. Also, the bone marrow-derived MSCs inhibited
mitogen-induced proliferation of splenocytes. Therefore, we
conclude that these cells isolated from chicken bone marrow
are MSCs and exhibit features similar to those of mamma-
lian MSCs.
We detected gene expression of PouV in cultured chicken
MSCs at passages 2 and 8. PouV is a chicken homolog of Oct4
in mammals [30]. In mammals, Oct4 is expressed in embry-
onic stem cells where it inhibits tissue-specific genes and
regulates self-renewal and pluripotency [33]. Recent reports
have indicated the expression of Oct4 in MSCs [23,34]. Oct4
interacts with other embryonic regulators, such as Sox2 and
Nanog, which are also involved in the regulation of pluri-
potency and inhibit differentiation [35]. Multilineage differ-
entiation potential of stem cells is strongly correlated with
the expression of Oct4. Oct4 regulates the expression of sev-
eral genes expressed in stem cells, such as fibroblast growth
factor 4 and transcription factors Rex1 and Sox2 [36–39].
Expression of PouV in MSCs, like chicken embryonic stem
cells may be associated with pluripotency and self-renewal
of these cells.
In this study, adipogenic differentiation was induced
with insulin, indomethacin, and dexamethasone, a method
1490
A 30
140
120
% Proliferation
100
80
60
40 *
20
*
0 0
No MSC 1:10 1:5
B FIG. 5. NO production by splenocytes in the presence of
120
100
% Proliferation
80
60
40
20 * three separate experiments. *Significantly different from the
0
No MSC 1:10
FIG. 4. Mesenchymal stem cells (MSCs) suppress T-cell
proliferation induced by ConA (A) and PMA and ionomycin
(B). Splenocytes (2 × 105) were stimulated with ConA (5 μg/
mL) or PMA and ionomycin (50 ng/mL and 1 μg/mL, respec-
tively) in the presence or absence of the indicated number of
MSCs in a 96-well plate for 48 h at 37°C. During the last 5 h
of incubation, the cells were pulsed with 1 µCi per well of 3H
thymidine. Cell-associated radioactivity was harvested and
is shown relative to that in the absence of MSCs. The values
are averages ± SD of triplicate determinations. The data are
representative of three separate experiments. *Significantly
different from the No MSC group, P < 0.05.
routinely used to stimulate the adipogenic differentiation
of stem cells. The exact mechanisms of action are not fully
known yet; it is believed that the insulin/IGF-1, glucocorti-
coids, and cAMP signaling pathways mediate the lipid accu-
mulation in the cells [40]. Differentiation was apparent by
the accumulation of lipid vacuoles within cells, which even-
tually filled the entire cell over a period of time. Cellular dif-
ferentiation was accompanied by the expression of aP2 and
PPAR-γ2. PPAR-γ2 is an adipocyte-specific transcription fac-
tor, induced early during the differentiation of adipocytes
[41]. It plays an important role in adipocytes differentiation
and also stabilizes the metabolic function of differentiated
adipocytes [42]. aP2 is also an adipose tissue-specific gene
and is expressed in the terminal stage of adipocyte differ-
entiation [40].
The osteogenic potential of chicken MSCs was con-
firmed by demonstration of mineralization in the extracel-
lular matrix produced by the differentiated cells, and by the
expression of osteopontin gene. Treatment of MSCs with
osteogenic induction media resulted in transformation of
cells from elongated fibroblastic to shorter cuboidal cells. In
primary culture, differentiated osteoblasts grew as colonies
and formed mineralized nodules, a characteristic of osteo-
genesis in MSCs of humans [43].
KHATRI, O’BRIEN, AND SHARMA
*
25
Nitric Oxide (μM)
20
15
*
10
5
MSC Only No MSC 1:10 1:5
mesenchymal stem cells (MSCs). Splenocytes (2 × 105) were
stimulated with ConA (5 μg/mL) in the presence or absence
of the indicated number of MSCs for 48 h. After the incuba-
tion, the supernatant was harvested and examined for NO
production by Griess assay. The values are averages ± SD
of triplicate determinations. The data are representative of
MSC Only and No MSC group, P < 0.05.
Several mechanisms of T-cell suppression by MSCs have
been proposed including mediation by regulatory T cells,
antigen-presenting cells, and immunosuppressive cytokines
[44–46]. Recently, Sato et al. [32] showed the involvement of
NO in the suppression of T cells by murine MSCs. They
showed that NO suppresses T-cell proliferation by inhib-
iting Stat-5 phosphorylation. We also detected NO from T
cells and MSCs co-cultures and the extent of T-cell suppres-
sion correlated with the amount of NO production, suggest-
ing the important role of NO in immunomodulation. The
physiologic role of NO produced in MSCs T-cell co-culture
system is unknown. Speculatively, NO might be involved in
the mechanisms by which MSCs in bone marrow protect he-
matopoietic stem cells from T-cell-mediated destruction by
inhibiting T-cell proliferation.
In conclusion, we have demonstrated for the first time
that MSCs can be isolated from the bone marrow of hatched
chicken and these cells are capable of in vitro multiplication
and multilineage differentiation, thus making them a suit-
able model in the field of stem cell research.
Author Disclosure Statement
No competing financial interests exist.
References
1. Jiang Y, BN Jahagirdar, RL Reinhardt, RE Schwartz, CD Keene,
XR Ortiz-Gonzalez, MReyes, T Lenvik, T Lund, M Blackstad, J
Du, S Aldrich, A Lisberg, WC Low, DA Largaespada and CM
Verfaillie. (2002). Pluripotency of mesenchymal stem cells de-
rived from adult marrow. Nature 418:41–49.
2. Pittenger MF, AM Mackay, SC Beck, RK Jaiswal, R Douglas, JD
Mosca, MA Moorman, DW Simonetti, S Craig and DR Marshak.
(1999). Multilineage potential of adult human mesenchymal
stem cells. Science 284:143–147.
3. Pereira RF, KW Halford, MD O’Hara, DB Leeper, BP Sokolov,
MD Pollard, O Bagasra and DJ Prockop. (1995). Cultured ad-
herent cells from marrow can serve as long-lasting precursor
cells for bone, cartilage, and lung in irradiated mice. Proc Natl
Acad Sci USA 92:4857–4861.
CHICKEN MESENCHYMAL STEM CELLS FROM BONE MARROW
4. Wakitani S, T Saito and AI Caplan. (1995). Myogenic cells de-
rived from rat bone marrow mesenchymal stem cells exposed
to 5-azacytidine. Muscle Nerve 18:1417–1426.
5. Kadiyala S, RG Young, MA Thiede and SP Bruder. (1997).
Culture expanded canine mesenchymal stem cells pos-
sess osteochondrogenic potential in vivo and in vitro. Cell
Transplant 6:125–134.
6. Mosca JD, JK Hendricks, D Buyaner, J Davis-Sproul, LC Chuang,
MK Majumdar, R Chopra, F Barry, M Murphy, MA Thiede,
U Junker, RJ Rigg, SP Forestell, E Bohnlein, R Storb and BM
Sandmaier. (2000). Mesenchymal stem cells as vehicles for gene
delivery. Clin Orthop Relat Res 379:S71–S90.
7. Martin DR, NR Cox, TL Hathcock, GP Niemeyer and HJ Baker.
(2002). Isolation and characterization of multipotential mes-
enchymal stem cells from feline bone marrow. Exp Hematol
30:879–886.
8. Young HE, EM Ceballos, JC Smith, ML Mancini, RP Wright,
BL Ragan, I Bushell and PA Lucas. (1993). Pluripotent mesen-
chymal stem cells reside within avian connective tissue ma-
trices. In Vitro Cell Dev Biol Anim 29:723–736.
9. Young HE, ML Mancini, RP Wright, JC Smith, AC Black, CR
Reagan Jr. and PA Lucas. (1995). Mesenchymal stem cells re-
side within the connective tissues of many organs. Dev Dyn
202:137–144.
10. Iyer SS and M Rojas. (2008). Anti-inflammatory effects of mes-
enchymal stem cells: novel concept for future therapies. Expert
Opin Biol Ther 8:569–581.
11. Haynesworth SE, MA Baber and AI Caplan. (1996). Cytokine ex-
pression by human marrow-derived mesenchymal progenitor
cells in vitro: effects of dexamethasone and IL-1 alpha. J Cell
Physiol 166:585–592.
12. Majumdar MK, MA Thiede, JD Mosca, M Moorman and SL
Gerson. (1998). Phenotypic and functional comparison of cul-
tures of marrow-derived mesenchymal stem cells (MSCs) and
stromal cells. J Cell Physiol 176:57–66.
13. Awad HA, GP Boivin, MR Dressler, FN Smith, RG Young and
DL Butler. (2003). Repair of patellar tendon injuries using a cell–
collagen composite. J Orthop Res 21:420–431.
14. Noel D, F Djouad and C Jorgense. (2002). Regenerative medicine
through mesenchymal stem cells for bone and cartilage repair.
Curr Opin Investig Drugs 3:1000–1004.
15. Pelttari K, E Steck and W Richter. (2008). The use of mesen-
chymal stem cells for chondrogenesis. Injury 39:S58–S65.
16. Pittenger MF and BJ Martin. (2004). Mesenchymal stem cells
and their potential as cardiac therapeutics. Circ Res 95:9–20.
17. Koc ON, SL Gerson, BW Cooper, SM Dyhouse, SE Haynesworth,
AI Caplan and HM Lazarus. (2000). Rapid hematopoietic re-
covery after coinfusion of autologous-blood stem cells and cul-
ture-expanded marrow mesenchymal stem cells in advanced
breast cancer patients receiving high-dose chemotherapy. J Clin
Oncol 18:307–316.
18. Le Blanc K, I Rasmusson, B Sundberg, C Gotherstrom, M
Hassan, M Uzunel and O Ringden. (2004). Treatment of severe
acute graft-versus-host disease with third party haploidentical
mesenchymal stem cells. Lancet 363:1439–1441.
19. Le Blanc K and O Ringden. (2006). Mesenchymal stem cells:
properties and role in clinical bone marrow transplantation.
Curr Opin Immunol 18:586–591.
20. Kassis I, N Grigoriadis, B Gowda-Kurkalli, R Mizrachi-Kol,
T Ben-Hur, S Slavin, O Abramsky and D Karussis. (2008).
Neuroprotection and immunomodulation with mesenchymal
stem cells in chronic experimental autoimmune encephalomy-
elitis. Arch Neurol 65:753–761.
21. Cooper MD, DA Raymond, RD Peterson, MA South and RA
Good. (1966). The functions of the thymus system and the bursa
system in the chicken. J Exp Med 123:75–102.
22. Nadri S, M Soleimani, RH Hosseni, M Massumi, A Atashi and
R Izadpanah. (2007). An efficient method for isolation of murine
bone marrow mesenchymal stem cells. Int J Dev Biol 51:723–729.
1491
23. Izadpanah R, T Joswig, F Tsien, J Dufour, JC Kirijan and BA
Bunnell. (2005). Characterization of multipotent mesenchymal
stem cells from the bone marrow of rhesus macaques. Stem
Cells Dev 14:440–451.
24. Kim IJ, SK You, H Kim, HY Yeh and JM Sharma. (2000).
Characteristics of bursal T lymphocytes induced by infectious
bursal disease virus. J Virol 74:8884–8892.
25. Pertile TL, JM Sharma and MM Walser. (1995). Reovirus infec-
tion in chickens primes splenic adherent macrophages to pro-
duce nitric oxide in response to T cell-produced factors. Cell
Immunol 164:207–216.
26. Nichols J, B Zevnik, K Anastassiadis, H Niwa, D Klewe-
Nebenius, I Chambers, H Scholer and A Smith. (1998). Formation
of pluripotent stem cells in the mammalian embryo depends on
the POU transcription factor Oct4. Cell 95:379–391.
27. Chambers I, D Colby, M Robertson, J Nichols, S Lee, S Tweedie
and A Smith. (2003). Functional expression cloning of Nanog,
a pluripotency sustaining factor in embryonic stem cells. Cell
113:643–655.
28. Avilion AA, SK Nicolis, LH Pevny, L Perez, N Vivian and R
Lovell-Badge. (2003). Multipotent cell lineages in early mouse
development depend on SOX2 function. Genes Dev 17:126–140.
29. Hanna LA, RK Foreman, IA Tarasenko, DS Kessler and PA
Labosky. (2002). Requirement for Foxd3 in maintaining pluripo-
tent cells of the early mouse embryo. Genes Dev 16:2650–2661.
30. Lavial F, H Acloque, F Bertocchini, DJ Macleod, S Boast, E
Bachelard, G Montillet, S Thenot, HM Sang, CD Stern, J Samarut
and B Pain. (2007). The Oct4 homologue PouV and Nanog regu-
late pluripotency in chicken embryonic stem cells. Development
134:3549–3563.
31. Zhao M, SA Amiel, S Ajami, J Jiang, M Rela, N Heaton and GC
Huang. (2008). Amelioration of streptozotocin-induced diabetes
in mice with cells derived from human marrow stromal cells.
PLoS ONE 3:e2666.
32. Sato K, K Ozaki, I Oh, A Meguro, K Hatanaka, T Nagai, K Muroi
and K Ozawa. (2007). Nitric oxide plays a critical role in sup-
pression of T-cell proliferation by mesenchymal stem cells.
Blood 109:228–234.
33. Pan GJ, ZY Chang, HR Scholer and D Pei. (2002). Stem cell pluri-
potency and transcription factor Oct4. Cell Res 12:321–329.
34. Greco SJ, K Liu and P Rameshwar. (2007). Functional similari-
ties among genes regulated by OCT4 in human mesenchymal
and embryonic stem cells. Stem Cells 25:3143–3154.
35. Boiani M and HR Scholer. (2005). Regulatory networks in embryo-
derived pluripotent stem cells. Nat Rev Mol Cell Biol 6:872–884.
36. Ben-Shushan E, JR Thompson, LJ Gudas and Y Bergman. (1998).
Rex-1, a gene encoding a transcription factor expressed in the
early embryo, is regulated via Oct-3/4 and Oct-6 binding to an
octamer site and a novel protein, Rox-1, binding to an adjacent
site. Mol Cell Biol 18:1866–1878.
37. Botquin V, H Hess, G Fuhrmann, C Anastassiadis, MK Gross, G
Vriend and HR Scholer. (1998). New POU dimer configuration
mediates antagonistic control of an osteopontin preimplanta-
tion enhancer by Oct-4 and Sox-2. Genes Dev 12:2073–2090.
38. Niwa H, J Miyazaki and AG Smith. (2000). Quantitative expres-
sion of Oct-3/4 defines differentiation, dedifferentiation or self-
renewal of ES cells. Nat Genet 24:372–376.
39. Yuan H, N Corbi, C Basilico and L Dailey. (1995). Developmental-
specific activity of the FGF-4 enhancer requires the synergistic
action of Sox2 and Oct-3. Genes Dev 9:2635–2645.
40. Gregoire FM, CM Smas and Sul HS. (1998). Understanding adi-
pocyte differentiation. Physiol Rev 78:783–809.
41. Rosen ED, P Sarraf, AE Troy, G Bradwin, K Moore, DS Milstone,
BM Spiegelman and RM Mortensen. (1999). PPAR gamma is re-
quired for the differentiation of adipose tissue in vivo and in
vitro. Mol Cell 4:611–617.
42. Lazar MA. (2002). Becoming fat. Genes Dev 16:1–5.
43. Bruder SP, N Jaiswal and SE Haynesworth. (1997). Growth
kinetics, self-renewal, and the osteogenic potential of purified
1492 KHATRI, O’BRIEN, AND SHARMA

human mesenchymal stem cells during extensive subculti- Address correspondence to:
vation and following cryopreservation. J Cell Biochem 64: Dr. Mahesh Khatri
278–294. Department of Veterinary and Biomedical Sciences
44. Aggarwal S and MF Pittenger. (2005). Human mesenchymal University of Minnesota
stem cells modulate allogeneic immune cell responses. Blood
256 Vet. Sci. Building
105:1815–1822.
45. Krampera M, S Glennie, J Dyson, D Scott, R Laylor, E Simpson
1971 Commonwealth Avenue
and F Dazzi. (2003). Bone marrow mesenchymal stem cells in- St. Paul, MN 55108
hibit the response of naive and memory antigen-specific T cells
to their cognate peptide. Blood 101:3722–3729. E-mail: khatr001@umn.edu
46. Rasmusson I, O Ringden, B Sundberg and K Le Blanc. (2003).
Mesenchymal stem cells inhibit the formation of cytotoxic T Received for publication August 6, 2008
lymphocytes, but not activated cytotoxic T lymphocytes or nat- Accepted after revision April 21, 2009
ural killer cells. Transplantation 76:1208–1213. Prepublished on Liebert Instant Online April 21, 2009