Beruflich Dokumente
Kultur Dokumente
12/7/2010
Introduction
positions in the genome in which two or more different bases occur with a
1200 bases and are useful as genetic markers since they tend to be
across intra and extracellular spaces. As a result of the study, the ABCC11
SNP was determined to be the first of its kind responsible for a phenotype.
This experiment showed that the ABCC11 gene is responsible for the
found in a few individuals of Northeast Asian decent. Cells with the A allele
showed a lower excretory activity for cGMP than those with allele G which
lead to decreased export of fatty acid chains aprocrine excretions of the ear
student’s genotypes for this known SNP and use the information obtained
from extracted DNA to determine whether they had wet or dry earwax.
Shawne Thorsen
12/7/2010
Methods
To begin the experiment, DNA was extracted from buccal cells following the
experiment began at step B and followed the guidelines all the way through
the 5th instruction for step C. The same PCR cycling conditions were used and
Reagent Volume
Water, PCR grade 4 microliters
REDExtract-N-Amp PCR reaction mix 10 microliters
Forward primer 1 microliter
Reverse primer 1 microliter
Tissue extract 4 microliters
Total volume: 20 microliters
To serve as positive control, GAPDH, a well-established “housekeeping gene”
laboratory methods and conducting this experiment without error. These PCR
reactions were removed from the thermal cycler and frozen until the next lab
session.
Students were instructed to make two 1.5% agarose gels for the entire class
12/7/2010
Tris Buffer solution in a 250ml Erlenmeyer flask. The flask was then gently
covered (not sealed) with plastic wrap, and placed in the microwave at 50%
power for 2 minutes, or until the powder was fully suspended in the liquid.
Ethidium bromide was necessary to visualize the products on the gel, so one
drop was added to the agarose solution while swirling to cool the liquid. Once
warm to the touch, the liquid was poured into a well and two 8-comb wells
10 microliters of both the ABCC11 and GAPDH reactions were added into
If product was seen in both gels (at ~700bp for GAPDH and ~350 for
The same cycling parameters were followed as listed in the SIGMA PCR kit
protocol. The reactions were placed in the freezer until the next lab session
12/7/2010
One 1.5% agarose gel was prepared for the entire class following the
their ABCC11 reactions onto the gel. Students were instructed to use the
microliter PCR cleanup was performed following the Qiaquick protocol. The
To prepare the sequencing reactions, it was determined from the gel that
reverse
outlined by the CEQ DTCS-Quick Start Kit, with minor changes made to
12/7/2010
Series Genetic Analysis System manual. Two .5mL tubes were labeled with
the group number and sample ID (forward or reverse). Finger vortexing was
performed between steps C and D but great care was taken to keep the
samples on ice. In step H, SLS mixture was added to the samples and they
were vortexed briefly every 5 minutes for a total of 15 minutes. The samples
were spun to the bottom using a desktop centrifuge, then pipetted in their
entirety onto the sequencing reaction plate. One drop of mineral oil was
added on top of the samples to prevent them from drying. Each group noted
the location of their forward and reverse reactions so there would be minimal
Results
Shawne Thorsen
12/7/2010
GAPDH
1 2 3 4 5 6 7 8 1 2 3 4
5 6 7 8
12/7/2010
previous grade.
101-
9F.E03_10111709J
0 E 470 7 7 No
101-
9R.F03_10111709J
12/7/2010
TTCAAGGCTTCACCGCCTTTGGGAAGAAGAAGTCTCAAGGCGAGGGATTGAAAAAGCTTCA
GTGCTTCTGGTGATGCTGAGGTTCCAGAGAACAAGGTTGATTTTCGATGCACTTCTGGGCA
TCTGCTTCTGCATTGCCAGTGTACTCGGGCCAGTAAGTGGCAGACTTGGTGAGGTTTGGG
GGACTCTAGGCTTCAGAGGTTTAGCGATGGAACTGCGGGCATGTTCAAGTCCATGCCAGG
AGTTAGAGATGCATTTGTCTTTCAGTTGCTGTCTAGAAAATGAAGACCTTTTGAGGACAGTA
GAGCATGGT
Discussion:
The isolation of DNA from buccal cell swabs was successful in providing
known in the BLAST database. After isolation, a PCR reaction was set up and
run with the genes of interest: ABCC11 and GAPDH. Figure 1 shows the
analysis of both ABCC11 and GAPDH after being run on agarose gel through
allowed for the determination of banding sizes for both genes. The ABCC11
amplicon was the expected size at 350 bp, and GAPDH was found to be the
12/7/2010
mix another PCR reaction with the DNA isolated from individual samples.
Figure 2 demonstrates the results obtained after running the gel. This gel
was used to check the amlpicon size versus semi-log graph paper to
pairs. Also, by observing the intensity of the banding pattern, students were
able to determine the relative concentration of DNA in their sample. This 1.5
the final ABCC11 PCR products. The bands in the 100bp ladder were
compared to the amplicons on the gel. The intensity of the amplicons was
about that of the 400bp standard in the ladder. Since these reactions were
DNA to add to the sequencing reactions. After the reaction was completed, a
trim report was obtained. Data Set 1 summarizes the report: the forward
Sequencher algorithm, thus only the reverse ABCC11 primer sequence (Data
Set 2) was used. The BLAST (Basic Local Alignment Search Tool) program
was used to compare and contrast the similarities between the group’s
12/7/2010
nucleotide (A or G) was present at the known SNP position in the locus. The
ABCC11 primer sequence contained 313 bases, with 312 appearing in the
actual alignment output. This demonstrated that 99% was identical to the
base (A or G) was in the group’s sample. The SNP base identity was C, the
12/7/2010
References:
Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W, Lipman DJ (1997)
2007.
Yoshiura,et. Al. "A SNP in the ABCC11 Gene Is the Determinant of Human
12/7/2010