JOURNAL OF CLINICAL MICROBIOLOGY, May 1994, p. 1338-1340 Vol. 32, No.

5
0095-1137/94/$04.00+0
Copyright © 1994, American Society for Microbiology

NOTES
Identification of Bovine and Porcine Rotavirus G Types by PCR
VERA GOUVEA,1* NORMA SANTOS,1 AND MARIA DO CARMO TIMENETSKY1'
Division of Molecular Biological Research and Evaluation, Food and Drug Administration, Washington, D.C. 20204,1
and Virology Laboratoty, Instituto Adolfo Lutz, Sdo Paulo, Brazil2
Received 15 December 1993/Returned for modification 25 January 1994/Accepted 17 February 1994

A new seminested PCR typing assay has been extended to identify the important veterinary rotavirus
serotypes G5, G6, G10, and Gll, as well as the rare human serotype G8. The specificity of the method was
evaluated with 30 standard laboratory strains of the Gl to G6 and G8 to Gll types. Rotavirus strain types G6
and G8, not previously recognized in pigs, were identified in field specimens of porcine origin.

Group A rotaviruses are the leading cause of acute gastro-
enteritis in children and young animals of many species
throughout the world. Development of a safe and efficacious
pediatric vaccine is needed to control severe dehydrating
disease and prevent costly hospitalization (4). Several candi-
dates of live animal rotavirus strains or reassortants containing
the VP7 gene of the major human serotypes in an animal
background virus have been evaluated in clinical trials with
various degrees of success.
The rotavirus genome consists of 11 segments of double-
stranded RNA surrounded by double-shelled capsids. The
outer capsid contains two proteins, VP7 and VP4, that inde-
pendently evoke neutralizing antibodies, although their rela-
tive importance in protective immunity in humans has yet to be
established (4). Classification of rotaviruses is based on the
specificity of the viral VP7 antigen, or G serotype, and its VP4
antigen, or P serotype. To date, 14 G serotypes have been
defined by neutralization assays with hyperimmune sera: 13 in
mammals, including the newly described human G12 and
equine G13 and G14, and one serotype (G7) in birds (1, 4, 20).
Serotypes Gi to G4 have been most frequently associated with
diarrhea in humans and constitute the targets of current
vaccine development, whereas the less common human sero-
types G8 and G9 have been only rarely associated with disease.
Natural infections with those G types, however, have not been
restricted to humans; they have also been recovered from a few
animal host species or, in the case of serotype G3, from a
variety of species (4, 10). Rotavirus serotypes G6 and G10 are
major bovine pathogens that have recently been recovered
from diarrheic children and healthy human neonates (2, 5, 22).
Serotypes G5 and Gll have been prevalent in pigs, although
G5 has also been recovered from horses with acute gastroen-
teritis (1 1).
Determination of rotavirus serotypes has been classically
performed by neutralization assay of cell-adapted strains or
has been performed directly with clinical specimens by enzyme
immunoassay with neutralizing monoclonal antibodies (4, 14).
Recently, molecular methods, such as probe hybridization and
PCR amplification, have been developed to type rotaviruses (7,
16, 17). Genotyping has gained widespread acceptance as an
alternative approach to rotavirus serotyping. It correlates well
*
Corresponding author. Mailing address: 1220 North Pierce St.,
701, Arlington, VA 22209. Phone: (703) 522-8431.
1338
with viral antigenic specificity, uses universal synthetic re-
agents, and allows rapid examination of a large number of
specimens.
We have extended our original PCR typing assay developed
to characterize human rotavirus serotypes (7) to embrace the
veterinary-relevant serotypes G5, G6, G10, and Gll. We
describe here a new and complementary assay that includes an
improved means of identifying the G8 serotype.
Thirty well-characterized, cell-culture-adapted animal and
human rotaviruses of known G serotypes were used to develop
and test the new G typing assay. The following animal rotavi-
ruses were used: G6 bovine strains WC3, NCDV, UK, OK,
C486, and B641; GlO bovine strains B223 and Cr; G5 porcine
strains OSU and EE and G5 equine strain H1; G4 porcine
strains Gottfried and SB1A; G3 equine strains H2 and FI14;
and Gll porcine strain YM. The following human rotaviruses
were used: Gi strains Wa, 0, and M37; G2 strains DS1, RV5,
and SC2; G3 strains P and HCR3; G4 strains Hochi and CC4;
G8 strains 69M and B37; and G9 strains W161 and F45. In
addition, 15 fecal specimens of an unknown G type obtained
from field outbreaks of rotavirus diarrhea in cattle (8 samples)
and in pigs (7 samples) in the United States were tested with
the new PCR typing assay.
Rotavirus double-stranded RNA was extracted and purified
by treatment with guanidinium isothiocyanate, hydroxyapatite,
and cetyltrimethylammonium bromide, as described by Santos
and Gouvea (18), and was used as the template for reverse
transcription and first PCR amplification as previously de-
scribed (7). Primer Beg9 and a degenerate mixture of End9
primers (dEnd9) (8) were used to amplify full-length copies of
the rotavirus VP7 gene under PCR conditions of 30 cycles of
94°C for 1 min, 42°C for 2 min, and 72°C for 1 min. Aliquots of
0.2 RI, or, preferably, 2 [lI of a 1:100 dilution, of the first PCR
product were subjected to the seminested PCR typing assay
with the A pool of primers. This pool consisted of the sense
typing primers FT5, DT6, HT8, ET10, and BT11 specific for
the serotypes G5, G6, G8, G10, and G11, respectively, and the
conserved antisense primer sBeg9, which is a shorter version of
primer Beg9. The sequences of the typing primers, their
positions in the genomic segment, the prototype viruses from
which the sequences were taken, and the expected segment
lengths are displayed in Table 1 and Fig. 1. Amplification was
performed essentially as described previously (7) under the
following PCR conditions: 25 cycles of denaturing at 94°C for
1 min, annealing at 55°C for 2 min, and extension at 72°C for
VOL. 32, 1994
TABLE 1. Oligonucleotide primers that constitute the A pool of
PCR typing primers
Primer Sequence (5'-3') Position G strain
sBeg9 GGCTTTAAAAGAGAGAATTTC 1-21 Wa
FT5 CATGTACTCGTTGTTACGTC 779-760 OSU (G5)
DT6 CTAGTTCCTGTGTAGAATC 499-481 UK (G6)
HT8 CGGTTCCGGATTAGACAC 273-256 B37 (G8)
ETIO TTCAGCCGTTGCGACTTC 714-697 B223 (GIO)
BT11 GTCATCAGCAATCTGAGTTGC 336-316 YM (GIl)
a EMBL-GenBank accession number.
1 min. PCR products (5 [I) were analyzed by electrophoresis
on a 1.2% agarose-ethidium bromide minigel in Tris borate
buffer (7).
Excellent specificity was obtained with the A pool of typing
primers, as shown for the prototype G strains in Fig. 2. Thus,
a single amplicon of the expected size was obtained for each
G5, G6, G8, GIO, or GIl strain; no amplification was obtained
for strains of other G types (Gl to G4 and G9). The serotypes
of the other 20 well-characterized laboratory strains of animal
and human rotavirus of serotypes GI to G6 and G8 to GIl
were correctly identified (or were appropriately not amplified)
by the new method, attesting to its specificity and validity.
Similar results were obtained when each of the newly designed
typing primers that constitute the A pool was used singly with
the generic sBeg9 primer in individual PCR typing assays. The
only exception was primer FT5, which weakly amplified G8
strains 69M and B37. This was not surprising, since oligonu-
cleotide primer FT5 has only three mismatches with the
nucleic acid sequences of G8 strains, which is about the limit of
mismatches tolerated at the chosen annealing temperature of
55°C. In the presence of G8-specific primer HT8, as in the A
pool, however, this cross-amplification is completely elimi-
nated because the shorter segment amplified by HT8 is pref-
erentially formed over the larger segment amplified by FT5.
Selection of the new typing primers was based on our original
strategy devised to identify human G serotypes (7). Thus, each
type-specific primer was derived from a distinct variable region
in the VP7 gene. These variable regions are discrete nucleic
acid sequences characteristic of each G type and presumed to
encode type-specific epitopes on VP7 (4). In fact, all five
variable regions used in the present study have been confirmed
as containing neutralization sites by sequence analysis of
escape mutants selected with neutralizing monoclonal antibod-
ies (3, 12). Nevertheless, intertypic sequence homologies
within variable regions have also been demonstrated, such as
those between G8 and G5 in variable region F (nucleotides 756
Beg 9 HT8 BT11 DT6 ET10 FT5
s Beg 9
337 bpi
780 bp
FIG. 1. Rotavirus mRNA strand of VP7 gene, location of the A
typing primers and expected lengths of amplified segments.
NOTES 1339
N1 1 2 3 4 5 6 8 9 10 11 M
Accession
no.'
K02033
X04613
K00037
J04334
X52650
M23194
FIG. 2. PCR typing assay with the A pool of primers. Lane
numbers correspond to the G types of strains as follows: 1, Wa; 2, DS l;
3, P; 4, Hochi; 5, OSU; 6, UK; 8, B37; 9, W161; 10, B223; and 11, YM.
Lanes M, 100-bp markers with highlighted 600-bp segment.
to 774) and those between G8 and G3 in region E (nucleotides
477 to 505) (9). Sharing of variable regions between types
presented some difficulties in the designing of type-specific
primers and resulted in amplification of G8 strains by the
G3-specific primer aET3 in our original PCR typing assay (7)
and by G5-specific primer FT5, if used singly, in the present
study. We have therefore designed a new G8-specific primer,
HT8, to be included in the A pool of primers to completely
eliminate amplification of G8 strains by FF5 primer in the
present PCR A typing assay and to provide a means of
confirming G8 strains identified by the previous PCR typing
method.
We examined 15 field specimens of bovine and porcine
origins by the PCR A typing assay. All bovine fecal specimens
had rotavirus strains of the conventional bovine types G6 (six
specimens) and GIO (one specimen) or a mixture of both (one
specimen). On the other hand, quite diverse and unusual types
were found in the limited number of porcine fecal specimens.
One was of the common porcine serotype G5, but two were
G6, one was G8, and three remained untypeable. The presence
of G5 and G6 rotaviruses in those specimens was confirmed by
enzyme immunoassay with a panel of monoclonal antibodies
specific for serotypes GI to G6 (14). The G8 sample was
unreactive in the enzyme immunoassay but was recognized by
primers ET3 and FF5 in individual PCR assays, as would be
expected for a G8 rotavirus strain (see above). Cell adaptation
and further analyses of these viruses are under way. Types G6
and G8 have not been previously recognized in pigs. G6, the
most prevalent bovine serotype, has recently been recovered
from two children with gastroenteritis in Italy (5), whereas G8,
a serotype first described in children in Indonesia (13) and
later described in Europe (6), has been recovered from cattle
in Thailand (21), Scotland (19), and the United States (15).
Although a novelty, the finding of type G6 and G8 rotavirus
strains in pigs is not surprising in view of accumulating
evidence for occasional but widespread transmission of group
A rotaviruses from one animal species to another in nature (10,
22). The availability of molecular methods to identify rotavirus
genotypes, such as the one described here, as an alternative to
serotyping had facilitated and should intensify studies on the
occurrence and distribution of individual G types in different
animal populations.
1340 NOTES
We thank Yasutaka Hoshino, Linda Saif, Gerald Woode, H. Fred
Clark, and Enzo Palombo for providing rotavirus strains used in this
study and Harry Greenberg for providing monoclonal antibodies.
N.S. is a recipient of a fellowship from Conselho Nacional do
Desenvolvimento Cientifico e Tecnol6gico (CNPq), Brasilia, Brazil.
REFERENCES
1. Browning, G. F., T. A. Fitzgerald, R. M. Chalmers, and D. R.
Snodgrass. 1991. A novel group A rotavirus G serotype: serolog-
ical and genomic characterization of equine isolate F123. J. Clin.
Microbiol. 29:2043-2046.
2. Dunn, S. J., H. B. Greenberg, R. L. Ward, 0. Nakagomi, J. W.
Burns, P. T. Vo, K. A. Pax, M. Das, K. Gowda, and C. D. Rao.
1993. Serotypic and genotypic characterization of human serotype
10 rotaviruses from asymptomatic neonates. J. Clin. Microbiol.
31:165-169.
3. Dyall-Smith, M. L., I. Lazdins, G. W. Tregear, and I. H. Holmes.
1986. Location of the major antigenic sites involved in rotavirus
serotype-specific neutralization. Proc. Natl. Acad. Sci. USA 83:
3465-3468.
4. Estes, M. K., and J. Cohen. 1989. Rotavirus gene structure and
function. Microbiol. Rev. 53:410-449.
5. Gerna, G., A. Sarasini, M. Parea, S. Arista, P. Miranda, H.
Brussow, Y. Hoshino, and J. Flores. 1992. Isolation and charac-
terization of two distinct human rotavirus strains with G6 speci-
ficity. J. Clin. Microbiol. 30:9-16.
6. Gerna, G., A. Sarasini, L. Zentilin, A. Di Mateo, P. Miranda, M.
Parea, M. Battaglia, and G. Milanesi. 1990. Isolation in Europe of
69M-like (serotype 8) human rotavirus strains with either sub-
group I or II specificity and a long RNA electropherotype. Arch.
Virol. 112:27-40.
7. Gouvea, V., R. I. Glass, P. Woods, K. Taniguchi, H. F. Clark, B.
Forrester, and Z.-Y. Fang. 1990. Polymerase chain reaction am-
plification and typing of rotavirus nucleic acid from stool speci-
mens. J. Clin. Microbiol. 28:276-282.
8. Gouvea, V., C. Ramirez, B. Li, N. Santos, L. Saif, H. F. Clark, and
Y. Hoshino. 1993. Restriction endonuclease analysis of the vp7
genes of human and animal rotaviruses. J. Clin. Microbiol. 31:917-
923.
9. Hum, C. P., M. L. Dyall-Smith, and I. H. Holmes. 1989. The VP7
gene of a new G serotype of human rotavirus (B37) is similar to G3
proteins in the antigenic C region. Virology 170:55-61.
10. Hussein, H. A., A. V. Parwani, B. I. Rosen, A. Lucchelli, and L. J.
Saif. 1993. Detection of rotavirus serotypes Gl, G2, G3, and Gll
in feces of diarrheic calves by using polymerase chain reaction-
derived cDNA probes. J. Clin. Microbiol. 31:2491-2496.
11. Imagawa, H., T. Tanaka, K. Sekiguchi, Y. Fukunaga, T. Anzai, N.
Minamoto, and M. Kamada. 1993. Electropherotypes, serotypes,
J. CLIN. MICROBIOL.
and subgroups of equine rotaviruses isolated in Japan. Arch. Virol.
131:169-176.
12. Kirkwood, C., P. J. Masendyck, and B. S. Coulson. 1993. Charac-
teristics and location of cross-reactive and serotype-specific neu-
tralization sites on VP7 of human G type 9 rotaviruses. Virology
196:79-88.
13. Matsuno, S., A. Hasegawa, A. Mukoyama, and S. Inouye. 1985. A
candidate for a new serotype of human rotavirus. J. Virol. 54:
623-624.
14. Padilla-Noriega, L., C. F. Arias, S. L6pez, F. Puerto, D. R.
Snodgrass, K. Taniguchi, and H. B. Greenberg. 1990. Diversity of
rotavirus serotypes in Mexican infants with gastroenteritis. J. Clin.
Microbiol. 28:1114-1119.
15. Parwani, A. V., H. A. Hussein, B. I. Rosen, A. Lucchelli, L.
Navarro, and L. J. Saif. 1993. Characterization of field strains of
group A bovine rotaviruses by using polymerase chain reaction-
generated G and P type-specific cDNA probes. J. Clin. Microbiol.
31:2010-2015.
16. Parwani, A. V., B. I. Rosen, J. Flores, M. A. McCrae, M. Gorziglia,
and L. J. Saif. 1992. Detection and differentiation of bovine group
A rotavirus serotypes using polymerase chain reaction-generated
probes to the VP7 gene. J. Vet. Diagn. Invest. 4:148-158.
17. Rosen, B. I., L. J. Saif, D. J. Jackwood, and M. Gorziglia. 1990.
Serotypic differentiation of group A rotaviruses with porcine
rotavirus gene 9 probes. J. Clin. Microbiol. 28:2526-2533.
18. Santos, N., and V. Gouvea. 1994. Improved method for purifica-
tion of viral RNA from fecal specimens for rotavirus detection. J.
Virol. Methods 46:11-21.
19. Snodgrass, D. R., T. Fitzgerald, I. Campbell, F. M. M. Scott, G. F.
Browning, D. L. Miller, A. J. Herring, and H. B. Greenberg. 1990.
Rotavirus serotypes 6 and 10 predominate in cattle. J. Clin.
Microbiol. 28:504-507.
20. Taniguchi, K., T. Urasawa, N. Kobayashi, M. Gorziglia, and S.
Urasawa. 1990. Nucleotide sequence of VP4 and VP7 genes of
human rotaviruses with subgroup I specificity and long RNA
pattern: implication for new G serotype specificity. J. Virol.
64:5640-5644.
21. Taniguchi, K., T. Urasawa, Y. Pongsuwanna, M. Choonthanom, C.
Jayavasu, and S. Urasawa. 1991. Molecular and antigenic analyses
of serotype 8 and 10 of bovine rotaviruses in Thailand. J. Gen.
Virol. 72:2929-2937.
22. Urasawa, S., A. Hasegawa, T. Urasawa, K. Taniguchi, F. Waka-
sugi, H. Suzuki, S. Inouye, B. Ponprot, J. Supawadee, S. Supra-
sert, P. Rangsiyanound, S. Tonusin, and Y. Yamazi. 1992. Anti-
genic and genetic analyses of human rotaviruses in Chiang Mai,
Thailand: evidence for a close relationship between human and
animal rotaviruses. J. Infect. Dis. 166:227-234.