THE JOURNAL OF BIOLOGICAL CHEMISTRY
4163–4170, 1998
© 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Metabolism of Ferulic Acid to Vanillin
A BACTERIAL GENE OF THE ENOYL-SCoA HYDRATASE/ISOMERASE SUPERFAMILY ENCODES AN ENZYME
FOR THE HYDRATION AND CLEAVAGE OF A HYDROXYCINNAMIC ACID SCoA THIOESTER*
(Received for publication, June 24, 1997, and in revised form, November 20, 1997)
Michael J. Gasson, Yoshie Kitamura‡, W. Russell McLauchlan§, Arjan Narbad, Adrian J. Parr,
E. Lindsay H. Parsons¶, John Payne, Michael J. C. Rhodes§, and Nicholas J. Waltoni
From the Departments of Genetics and Microbiology and §Biochemistry, Institute of Food Research, Norwich Laboratory,
Norwich Research Park, Colney, Norwich NR4 7UA, United Kingdom
A gene encoding a novel enoyl-SCoA hydratase/lyase
enzyme for the hydration and nonoxidative cleavage of
feruloyl-SCoA to vanillin and acetyl-SCoA was isolated
and characterized from a strain of Pseudomonas fluore-
scens. Feruloyl-SCoA is the CoASH thioester of ferulic
acid (4-hydroxy-3-methoxy-trans-cinnamic acid), an
abundant constituent of plant cell walls and a degrada-
tion product of lignin. The gene was isolated by a com-
bination of mutant complementation and biochemical
approaches, and its function was demonstrated by het-
erologous expression in Escherichia coli under the con-
trol of a T7 RNA polymerase promoter. The gene product
is a member of the enoyl-SCoA hydratase/isomerase
superfamily.
Cinnamic acids are biologically important and abundant
molecules; for example, ferulic acid (4-hydroxy-3-methoxy-
trans-cinnamic acid) and 4-coumaric acid (4-hydroxy-trans-cin-
namic acid) together represent up to 1.5% by weight of the cell
walls of grasses (1). They function in the cross-linking of plant
cell walls and are precursors of a variety of antimicrobial com-
pounds, signaling molecules, and phytoalexins that play an
important role in plant defense responses (2). They are precur-
sors of lignin in wood (3) and, by contrast, of simple molecules
such as vanillin (4-hydroxy-3-methoxybenzaldehyde) and sali-
cylic acid (2-hydroxybenzoic acid). Because they are released
during the breakdown of lignin and cell wall material, their
catabolism is essential to the biodegradation of plant wastes.
There is substantial interest in the potential of ferulic acid and
related compounds as feedstocks, for example, for the biotech-
nological production of vanillin, one of the principal flavoring
and aroma compounds in the world (4, 5).
The degradation of these molecules is not well understood. It
was proposed (6) that the chain shortening of cinnamic acids
might occur via a b-oxidation process directly analogous to the
well known b-oxidation pathway of fatty acid oxidation. The
* This work was supported in part by the Biotechnology and Biolog-
ical Sciences Research Council Competitive Strategic Grant to the
Institute of Food Research. The names of authors appear in alphabet-
ical sequence. The costs of publication of this article were defrayed in
part by the payment of page charges. This article must therefore be
hereby marked “advertisement” in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted
to the GenBankTM/EBI Data Bank with accession number(s) Y13067.
‡ Supported by a sabbatical leave grant from the Ministry of Science,
Education and Culture of Japan. Permanent address: School of Phar-
maceutical Sciences, Nagasaki University, Nagasaki 852, Japan.
¶ Present address: Celsis Limited, Cambridge Science Park, Cam-
bridge CB4 4FX, United Kingdom
i To whom correspondence should be addressed. Fax: 44-1603-507-
723; E-mail: nicholas.walton@BBSRC.ac.uk.
This paper is available on line at http://www.jbc.org
Vol. 273, No. 7, Issue of February 13, pp.
Printed in U.S.A.
proposed route for ferulic acid is shown in Fig. 1. Key steps in
this scheme are activation to the CoASH thioester, hydration of
the enoyl-SCoA to the b-hydroxy derivative, b-oxidation to the
b-keto thioester, and thioclastic cleavage to give the corre-
sponding benzoyl-SCoA (vanilloyl-SCoA) together with acetyl-
SCoA. The aldehyde, vanillin, would be formed by reduction of
vanilloyl-SCoA.
Downloaded from www.jbc.org by guest, on September 18, 2010
Although it is known that an overall two-carbon cleavage of
ferulic acid can occur to give vanillin or vanillic acid (4-hy-
droxy-3-methoxybenzoic acid) together with an acetate unit,
the mechanism of such a route, whether in plants or microor-
ganisms, has proved surprisingly elusive, perhaps on account
of the assumed low abundance or instability of reaction inter-
mediates (4). In Pseudomonas acidovorans, for example, the
overall conversion was demonstrated many years ago (7), but
no further investigation of the mechanism was reported
subsequently.
In the work reported here, the close relationship of hydroxy-
cinnamate catabolism to the b-oxidation of fatty acids is fully
confirmed and demonstrated. A gene encoding an enoyl-SCoA
hydratase/lyase enzyme for the conversion of feruloyl-SCoA to
vanillin and acetyl-SCoA was isolated from a Pseudomonas
strain able to utilize ferulic acid as sole carbon source,1 and its
function was confirmed by heterologous expression in Esche-
richia coli. The gene product was shown to be a member of the
enoyl-SCoA hydratase/isomerase superfamily (9, 10) which in-
cludes bacterial, mitochondrial, peroxisomal, and glyoxysomal
enzymes of the fatty acid oxidation pathway, together with
bacterial dihydroxynaphthoate synthases of vitamin K biosyn-
thesis and 4-chlorobenzoyl-SCoA dehalogenases of Pseudomo-
nas sp. The gene encodes no NAD1 binding domain, and the
enzyme does not exhibit b-oxidation activity.
EXPERIMENTAL PROCEDURES
Chemicals and Strains—Chemicals were obtained routinely from
Sigma-Aldrich Chemical Co. Ltd., Gillingham, Dorset, UK or from
BDH-Merck, Poole, Dorset, UK and were of analytical grade. The prep-
aration of CoASH thioesters (feruloyl-SCoA, vanilloyl-SCoA, and 4-hy-
droxy-3-methoxyphenyl-b-hydroxypropionyl coenzyme A thioester
(HMPHP SCoA)2) is described below. Restriction enzymes were rou-
tinely obtained from Promega, Southampton, UK. The isolation of
Pseudomonas fluorescens biovar V, strain AN103 by enrichment using
ferulic acid as sole carbon source is described elsewhere.1
Preparation of Feruloyl-SCoA and Vanilloyl-SCoA—These were pro-
duced from ferulic acid and vanillic acid, respectively, essentially as
described by Semler et al. (11) for piperoyl-SCoA, except that in the case
of feruloyl-SCoA, the N-succinimidyl derivative was not isolated before
1
Narbad, A., and Gasson, M. J. (1998) Microbiology, in press.
2
The abbreviations used are: HMPHP SCoA, 4-hydroxy-3-methoxy-
phenyl-b-hydroxypropionyl coenzyme A thioester; HPLC, high perform-
ance liquid chromatography; kb, kilobase(s); PAGE, polyacrylamide gel
electrophoresis; PCR, polymerase chain reaction; bp, base pair(s).
4163
4164 Cleavage of Hydroxycinnamic Acid SCoA Thioester
FIG. 1. Conversion of ferulic acid to vanillin. The postulated b-oxidative route is shown as a light line. The non-b-oxidative route established
in P. fluorescens biovar V, strain AN103, by the present work is shown as a heavy line.
transesterification with CoASH. Final isolation was by preparative
TLC using cellulose TLC plates (Avicel; 1,000 mm; Analtech, Newark,
DE) developed in n-butanol/acetic acid/H2O (5:2:3, v/v/v) (13) and elu-
tion with 50% MeOH.
Preparation of HMPHP SCoA—HMPHP SCoA was prepared start-
ing from a Reformatsky condensation of vanillin with ethyl bromoac-
etate (12) followed by purification of the resulting ethyl 4-hydroxy-3-
methoxyphenyl-b-hydroxypropionate (ethyl HMPHP) by HPLC,
hydrolysis to the free acid, N-succinimidylation and, finally, exchange
of the N-succinimidyl group with CoASH and isolation of the CoASH
thioester by preparative TLC.
Vanillin (3 g) was mixed with 1.9 ml of ethyl bromoacetate and 2 g of
dry zinc dust in 60 ml of dry 1,4-dioxane. The reaction mixture was
heated to boiling using a heating mantle and refluxed gently for about
1 h. After being allowed to cool, the mixture was acidified with 60 ml of
10% H2SO4 and extracted with 4 3 120 ml of Et2O. The combined Et2O
phases were dried with anhydrous Na2SO4, and unreacted vanillin was
removed by washing with 3 3 100 ml of saturated K2S2O5. The ether
phase was then rotary evaporated under vacuum at about 30 °C to
remove the ether, leaving a liquid residue (about 10 ml). This was then
applied to a preparative C-18 reverse phase HPLC column (Dynamax
60A, 8 mm, 250 3 41 mm; Rainin, Woburn, MA) and eluted at 12 ml
min/min with a gradient of MeOH/H2O, containing 1 mM trifluoroacetic
acid. Solvent A comprised 40% MeOH and 1 mM trifluoroacetic acid.
Solvent B comprised 100% MeOH and 1 mM trifluoroacetic acid. At time
t 5 0 min, the solvent was 20% B, rising linearly to 40% B at 28 min and
100% B at 35 min. Fractions were monitored by absorbance at 280 nm,
and material eluting between 37 and 45 min was collected. The solvent
was removed under vacuum at about 35 °C, and the remaining material
brought to 220 °C overnight. The precipitate that formed was then
filtered off rapidly and freeze-dried to give 300 mg of white substance.
This was identified as ethyl HMPHP by mass spectrometry ([M2] 5
239).
To generate the N-succinimidyl ester, 30 mg of ethyl HMPHP was
first hydrolyzed for 40 min at room temperature in 0.5 ml of 1 M KOH
and the pH adjusted to about 3– 4 with 0.6 ml of 0.5 M oxalic acid. The
solution was extracted successively with Et2O (5 3 about 10 ml) and the
organic phases pooled and evaporated to dryness. N-Hydroxysuccinim-
ide (0.1 mmol; 11.5 mg) was then added in 1.2 ml of dry 1,4-dioxane.
This was followed gradually, with stirring, by 0.1 mmol (20.7 mg) of
dicyclohexylcarbodiimide in 0.6 ml of dry 1,4-dioxane. Subsequent steps
were essentially those described above for trans-feruloyl-SCoA, based
Downloaded from www.jbc.org by guest, on September 18, 2010
on the procedure of Semler et al. (11). Identification was confirmed by
mass spectrometry ([M2] 5 960) and by hydrolysis to the free acid (as
with ethyl HMPHP).
Growth of P. fluorescens Biovar V, Strain AN103—Cells were grown
routinely at 25 °C on minimal medium, with shaking, using vanillic
acid (10 mM) or ferulic acid (10 mM) as the sole carbon source; 50 ml of
medium was used in a 250-ml Erlenmeyer flask. Nutrient medium
(LB-Mod) was prepared as indicated by Narbad and Gasson.1 Growth
was measured routinely by monitoring absorbance at 600 nm.
Preparation and Incubation of Cell-free extracts; Assay of Ferulate:
CoASH Ligase—Cell-free extracts of logarithmic phase cultures (6 –10 h
after inoculation) were prepared by sonication. Cells from about 200 ml
of medium were pelleted by centrifugation and resuspended in 5–10 ml
of extraction buffer (routinely 40 mM KPi, pH 7, containing 10 mM
dithiothreitol). They were then sonicated (MSE Soniprep 150; Fisons
Instruments, Crawley, Sussex, UK) at 4 °C (5 3 20 s; 22 amplitude
microns on full power) and centrifuged (20,000 3 g for 20 min at 4 °C).
For storage, extracts were frozen at 270 °C. In some instances, extracts
were buffer changed using a PD-10 column (Pharmacia, Milton Keynes,
UK) before use. Protein contents of extracts varied between 0.25 and 1.8
mg/ml.
Extracts were incubated routinely at 30 °C and pH 7.5 in a reaction
mixture (1 ml) containing 90 mM Tris-HCl buffer and 2.5 mM MgCl2,
together with (as appropriate) 0.5 mM ferulic acid, 0.2 mM CoASH
(lithium salt), and 2.5 mM ATP. This complete reaction mixture consti-
tuted an assay for ferulate:SCoA ligase, where the initial increase in
absorbance at 345 nm was monitored against a blank reaction mixture
from which CoASH was omitted. A value for e345 of 1.9 3 104 M21 cm21
was used (13). Incubations with HMPHP SCoA (see below for prepara-
tion) were performed similarly, but with the omission of ferulic acid,
CoASH, and ATP.
Assay of Vanillin:NAD1 Oxidoreductase—Vanillin:NAD1 oxi-
doreductase was assayed at 30 °C and pH 7.0 by monitoring the initial
decrease in absorbance at 340 nm against a blank reaction mixture
from which NAD1 had been omitted. Because of the similarity in the
extinction coefficients of vanillin and NADH, regeneration of NADH to
NAD1 was achieved by providing lactate dehydrogenase and pyruvate
in the reaction mixture. Reaction mixtures contained, in a 1-ml volume,
75 mM KPi buffer, pH 7.0, 0.125 mM vanillin, 1.2 mM sodium pyruvate,
1.1 unit of lactate dehydrogenase (rabbit muscle; Boehringer, Lewes,
Sussex, UK), and 0.5 mM NAD1.
Protein Assay—Protein was assayed by the method of Bradford (14)
 Cleavage of Hydroxycinnamic Acid SCoA Thioester
using commercially prepared reagent (Bio-Rad Laboratories, Hemel
Hempstead, Hertfordshire, UK).
Analysis of Metabolites—Metabolites, including the components of
cell-free reaction mixtures, were routinely analyzed and quantitated by
HPLC using a Lichrosorb RP-18 column (20 cm 3 4.6 mm; Capital
HPLC, Broxburn, West Lothian, UK) with a multiphasic gradient.
Solvent A was 20 mM NaOAc, adjusted to pH 6, and solvent B was
MeOH. The flow rate was 1.2 ml/min. The proportion of solvent B rose
linearly from 0% at 0 min to 10% at 15 min and then to 50% at 40 min
and 75% at 45 min, finally decreasing to 0% at 50 min. Detection was
with a Spectra Focus detector (ThermoSeparation Products, Stone,
Staffordshire, UK) which permitted UV analysis of each eluting com-
ponent. Typical approximate retention times were: CoASH, 3 min;
vanillic acid, 7 min; ferulic acid, 19 min; acetyl-SCoA, 22 min; HMPHP
SCoA, 29 min; vanilloyl-SCoA, 31 min; vanillin, 31.5 min; feruloyl-
SCoA, 34 min. Quantitation was based on absorbance measurements at
260 nm, using reference compounds as standards; aromatic CoASH
thioesters (both as substrates and products) were also quantitated
independently by alkaline hydrolysis to the free acids, which were then
measured by HPLC.
Mass Spectrometry—Mass spectra (1-ve and 2-ve ion) were recorded
on a 9/50 mass spectrometer (Kratos Instruments, Manchester, UK)
using xenon fast atom bombardment at a potential of 6 – 8 kV with
glycerol as matrix. Liquid chromatography/mass spectrometry of cell-
free reaction mixtures was performed on a Platform I instrument (Mi-
cromass, Manchester, UK) using positive electrospray ionization and
liquid chromatography conditions adapted from the HPLC conditions
described above; data were processed using Micromass MassLynx
software.
Isolation of Mutants in Ferulate Utilization—A suspension of vanil-
late-grown cells (1 ml; 4 3 109 cells/ml in 0.1 M KPi) was incubated with
0.08 ml of ethyl methane sulfonate in a total of 3 ml of 0.1 M KH2PO4 at
37 °C for 45 min. The cells were then precipitated by centrifugation at
4 °C, washed, resuspended, and inoculated into 50 ml of LB-Mod me-
dium. After overnight incubation at 25 °C, the mutagenized cells were
enriched for mutants in ferulate utilization by treatment with carben-
icillin in minimal medium in the presence of ferulic acid. The cells were
harvested by centrifugation at 4 °C and then washed and resuspended
in 20 ml of minimal medium. A sample (1 ml) was inoculated into
minimal medium (15 ml) and incubated at 25 °C for 1 h; then ferulic
acid (10 mM final concentration) and carbenicillin (2 mg/ml final con-
centration) were added. (A control flask was prepared containing ferulic
acid, but not carbenicillin.) The flask was incubated overnight at 25 °C
for 16 h, monitoring A580 to confirm the effectiveness of the antibiotic.
Penicillinase (10 units) was then added to destroy the carbenicillin,
incubating overnight at 25 °C. The cells were harvested by centrifuga-
tion at 4 °C, washed twice, and resuspended in 5 ml of minimal me-
dium; 1 ml of these resuspended cells was then inoculated into 50 ml of
medium containing 10 mM vanillic acid and incubated at 25 °C for about
24 h. These enriched cells were finally screened by replica plating for
mutants unable to use ferulic acid. The enriched stock was diluted,
plated onto LB-Mod medium, incubated at 25 °C for 2 days, and then
replica plated onto minimal medium containing 10 mM vanillic acid or
10 mM ferulic acid. The plates were incubated at 25 °C for 2–3 days and
screened for colonies able to grow on vanillate but unable to grow on
ferulate.
Preparation of Genomic Library of P. fluorescens, Biovar V, Strain
AN103—A genomic library was prepared in the broad host range cos-
mid cloning vector, pLAFR3 (15). Genomic DNA was isolated from
strain AN103 and partially digested with Sau3AI at 37 °C for 7–10 min.
The DNA was then size fractionated on a NaCl gradient (1.25–5 M). The
fraction containing DNA of 20 – 40 kb was selected and 0.5 mg ligated
into the dephosphorylated BamHI site of pLAFR3. Half of the ligation
mix was packaged into bacteriophage l particles using a Gigapack II XL
kit (Stratagene, Cambridge, UK). The packaged cosmids were trans-
fected into E. coli strain 803 (16). Approximately 10,000 primary trans-
fectants were obtained. The lawn of cells obtained was washed from the
selection plates, and glycerol-containing stocks were prepared for stor-
age at 270 °C.
Complementation of Mutants of P. fluorescens, Biovar V, Strain
AN103 Defective in Ferulate Utilization—The genomic library in cosmid
pLAFR3 was introduced into mutant strains by conjugation using the
helper plasmid, pRK2013 (17). Mutant strains were inoculated into
minimal medium containing 10 mM vanillic acid and incubated at 25 °C
for 2 days. The E. coli strain carrying the helper plasmid (E. coli
803pRK2013) was inoculated into LB-Mod medium (10 ml) and incu-
bated at 37 °C for 6 h. A sample of the AN103 genomic library was
similarly inoculated and incubated. Equal populations of the three
4165
organisms were then combined. The mixture of cells was centrifuged,
resuspended in a minimal volume of the supernatant solution, and
spread over a sterile gridded cellulose nitrate membrane filter (47-mm
diameter, Whatman, Maidstone, Kent, UK) on a moist LB-Mod agar
plate. The suspension was allowed to air dry onto the filter for a few
minutes and then incubated overnight at 25 °C. The bacteria were
washed from the filter, and aliquots (0.1 ml) were applied to selection
plates of minimal medium with 10 mM vanillic acid and 5 mg/ml of
tetracycline. These were incubated at 25 °C for 2 days and the colonies
obtained (.1,000/plate) were replica plated to similar plates containing
ferulic acid in place of vanillic acid. Colonies (two to three/plate) able to
grow on these plates containing ferulic acid were selected and inocu-
lated into fresh minimal medium containing 5 mg/ml tetracycline.
SDS-PAGE of Cell-free Extracts and Electroelution of Protein
Bands—SDS-PAGE, with Coomassie staining, was carried out essen-
tially as described by Schägger and von Jagow (18), using an Atto
AE6450 gel electrophoresis apparatus (supplied by Genetic Research
Instrumentation, Dunmow, Essex, UK). Electroelution of protein bands
from fixed, stained gels was performed using a Bio-Rad model 422
electroeluter according to the manufacturer’s instructions. Eluted pro-
tein was then deposited by centrifugation onto a Pro-Spin membrane
(Applied Biosystems, Foster City, CA) used as directed by the
manufacturer.
NH2-terminal Sequencing—Protein NH2-terminal sequencing was
undertaken under contract by Alta Bioscience, Department of Biochem-
Downloaded from www.jbc.org by guest, on September 18, 2010
istry, University of Birmingham, Birmingham, UK.
Isolation, Digestion, and Probing of Cosmid DNA—Cosmid DNA was
isolated using Qiagen minicolumns (Qiagen, Crawley, West Sussex,
UK) according to the manufacturer’s instructions and was digested
with restriction endonucleases EcoRI and PstI. Fragments were sepa-
rated by agarose gel electrophoresis and Southern blotted to a Hy-
bond-N filter (Amersham International, Aylesbury, Buckinghamshire,
UK) as described elsewhere (19). Probe DNA was linearized, denatured,
and labeled with digoxygenin as described by the kit manufacturer
(Boehringer).
Polymerase Chain Reaction (PCR)—Oligonucleotide primers were
prepared using an ABI 394 Synthesizer (Perkin-Elmer, Warrington,
UK). For PCR, Perkin-Elmer UltmaTM DNA polymerase was used with
a “hot start” according to the manufacturer’s directions; a Hybaid Om-
nigeneTM instrument (Teddington, Middlesex, UK) was used, with the
following thermal cycling conditions: for amplification using the degen-
erate primers based on the NH2-terminal sequence of the 31-kDa pro-
tein (see Fig. 5), there was one cycle of a 2-min denaturation at 95 °C
followed by 25 cycles, each consisting of a 2-min denaturation at 95 °C,
2-min annealing at 50 °C, and 2-min extension at 72 °C, and finally, one
cycle of a 7-min extension at 72 °C. For the amplification of open
reading frame (ORF) A, there was one cycle of a 2-min denaturation at
96 °C followed by five cycles, each consisting of a 2-min denaturation at
96 °C, 2-min annealing at 47 °C, and 2-min extension at 72 °C, then 20
cycles, each consisting of a 2-min denaturation at 96 °C, 2-min anneal-
ing at 60 °C, and 2-min extension at 72 °C, and finally, one cycle of a
5-min extension at 72 °C. The following primers were used for the
amplification of ORF A before cloning in the E. coli expression vector,
pSP72 (Promega): NH2-terminal, 59-TATATAGAATTCAAAACCCA-
GAACAAGA-39, incorporating a synthetic EcoRI site; COOH-terminal,
59-ATATATGGATCCTTCAGCGTTTATACG-39, incorporating a syn-
thetic BamHI site. For amplification of ORF A before cloning in the
vector pRK415 (20), the NH2-terminal primer used was 59-TATATA-
AGCTTGGCCGGTGATTGC-39, incorporating a synthetic HindIII site;
this was homologous to a sequence CGACCTTGGCCGGTGATTGC-
TACGGCCAATATCGCTCGGC running from 21 to 240 bp upstream of
the start of the sequence shown in Fig. 5.
DNA Sequencing—Cosmid restriction fragments for sequencing were
subcloned into the E. coli vector pUC19 (Pharmacia), using strain XLI
(Blue) (Stratagene). Automated fluorescent sequencing by the Sanger
dideoxy termination method (21) was carried out by means of an Ap-
plied Biosystems DNA Sequencer (model 373; Perkin-Elmer) together
with the manufacturer’s Taq DyeDeoxy Terminator Cycle sequencing
kit, used according to the manufacturer’s instructions. A primer walk-
ing strategy was employed.
Sequence Homologies—Homologies of nucleotide sequences and their
translation products with sequences available in the data libraries were
determined using the Wisconsin Package, Version 8, September 1994,
Genetics Computer Group, Madison WI and EGCG Package, Peter Rice,
The Sanger Center, Hinxton, Cambridge, UK.
Nucleotide Sequence Accession and Strain Deposit—The nucleotide
sequence data reported in this paper have been submitted to the EMBL,
GenBankTM, and DDBJ nucleotide sequence data bases under accession
4166 Cleavage of Hydroxycinnamic Acid SCoA Thioester
FIG. 2. Formation of (panel A) feruloyl-SCoA (●), vanillin (E),
and acetyl-SCoA (3) from ferulate and of (panel B) vanillin (E),
acetyl-SCoA (3), and feruloyl-SCoA (●) from HMPHP SCoA (f)
by a cell-free extract of P. fluorescens biovar V, strain AN103.
Cells were grown on 10 mM ferulate as the carbon source; extract was
passed through a PD-10 column (Pharmacia) before use and incubated
(7 mg of protein/reaction mixture) in the presence of (panel A) 0.5 mM
ferulate, 0.2 mM CoASH, 2.5 mM MgCl2, and 2.5 mM ATP or (panel B)
0.4 mM HMPHP SCoA and 2.5 mM MgCl2, for the time periods indi-
cated, as described under “Experimental Procedures.”
number Y13067. P. fluorescens biovar V, strain AN103, has been de-
posited with the National Collection of Industrial and Marine Bacteria,
Aberdeen, UK under accession no. NCIMB 40783 as required under the
Budapest Treaty governing deposits of organisms in connection with
patent applications (8, 22).
RESULTS
Conversion of Ferulate in Cell-free Extracts of P. fluorescens
Biovar V, Strain AN103—It was shown previously1 that the
metabolism of ferulate by extracts of cells of strain AN103
grown in the presence of ferulate required CoASH, ATP, and
Mg21 ions. The reaction products were feruloyl-SCoA and
equimolar quantities of vanillin and acetyl-SCoA (Fig. 2A).
Because there was no requirement for NAD1 and because
vanilloyl-SCoA (0.5 mM) was found not to be converted to van-
illin by these extracts even in the presence of NADH (0.5 mM),
the cleavage reaction appeared to proceed without b-oxidation
(see Fig. 1).
Extracts also converted the hydrated derivative of feruloyl-
SCoA, HMPHP SCoA. This too was converted to vanillin and
acetyl-SCoA in equimolar quantities without a requirement for
NAD1 (Fig. 2B); and in addition it was dehydrated by the
extract to feruloyl-SCoA, demonstrating the reverse of the
enoyl-SCoA hydratase reaction (see Fig. 1). (The feruloyl-SCoA
so formed was assumed to be the trans-isomer, but cis- and
trans-isomers were not distinguished by the HPLC analysis
used.) The reaction was relatively rapid, and greater than 90%
of the substrate was converted to products.
TABLE I
Metabolism of ferulate in cell-free extracts of P. fluorescens biovar V,
strain AN103, and of mutant strains van 1 and van 10
Data were obtained using extracts from cells grown in medium con-
taining 10 mM ferulate plus 10 mM vanillate. Preliminary experiments
showed that the induction of ferulate:CoASH ligase in strain AN103 in
response to 10 mM ferulate in the growth medium was unaffected by the
simultaneous presence of 10 mM vanillate. Extracts were prepared and
assayed for ferulate:CoASH ligase and vanillin:NAD1 oxidoreductase
as described under “Experimental Procedures.” Extracts (about 300 mg
of protein) were also incubated for 4 h in the presence of CoASH, Mg21,
ATP, and NAD1 (see “Experimental Procedures,”) and the production of
vanillate determined.
Enzyme activity
Strain Ferulate:CoASH Vanillin:NAD1 Vanillate formed
ligase oxidoreductase
nanokatals/mg protein nmol/mg protein
AN103 1.7 1.2 807
van 1 0 ;0.05 0
van 10 2.0 1.4 59
Vanillin formation was therefore independent of added
Downloaded from www.jbc.org by guest, on September 18, 2010
NAD1; however, as indicated previously,1 when NAD1 was
provided in the reaction mixture, much of the vanillin was
oxidized to vanillate by the activity of vanillin:NAD1 oxi-
doreductase present in the extracts.
Isolation and Complementation of Mutants in Ferulate Uti-
lization—A classical mutation and complementation strategy
was used to isolate the gene(s) responsible for ferulate cleav-
age. Mutants of P. fluorescens AN103 which were unable to
utilize ferulate as sole carbon source were isolated, and their
defect was then complemented by the introduction of cosmid
clones from a genomic library of the same strain. Chemical
mutagenesis of P. fluorescens AN103 using ethyl methane sul-
fonate was followed with enrichment and screening for mu-
tants unable to grow on ferulate. These mutants all retained
the ability to grow on vanillate and fell into two biochemical
classes distinguished by the activities of ferulate:CoASH ligase
and vanillin:NAD1 oxidoreductase. As shown in Table I, class
I mutants (typified by van 1) had severely reduced activities of
both ferulate:CoASH ligase and vanillin:NAD1 oxidoreductase,
whereas class II mutants (typified by van 10) had wild-type
levels of both enzymes. Despite the presence of these enzyme
activities, cell-free extracts of the class II mutants were im-
paired in the ability to form vanillate from ferulate in the
presence of ATP, Mg21, CoASH, and NAD1. This suggested
that the class II mutants were defective in a structural gene for
vanillin formation from feruloyl-SCoA. The absence of two dis-
tinct enzyme activities in the class I mutants suggested that
they may be defective in a common gene control process.
A class II mutant was used for complementation experi-
ments designed to isolate a wild-type copy of the mutant gene.
A gene library of P. fluorescens AN103 DNA was constructed
using the broad host range cosmid cloning vector pLAFR3 in E.
coli. Cosmid clones were introduced from the E. coli library into
a class II mutant derivative of P. fluorescens AN103 by tripa-
rental mating using an E. coli strain carrying the helper plas-
mid pRK2013. Two cosmids, pFI793 and pFI794, were identi-
fied as complementing the class II mutants.
Identification of a 31-kDa Polypeptide Induced by Ferulate—
The protein profiles of P. fluorescens AN103 following growth
on ferulate and vanillate were compared using SDS-PAGE with
Coomassie Blue staining. As shown in Fig. 3, the ferulate-
grown cells produced a strongly enhanced or additional band
corresponding to a polypeptide of 31 kDa. It was likely that this
polypeptide was an enzyme involved in the conversion of feru-
late to vanillin. Accordingly, the 31-kDa band was excised from
 Cleavage of Hydroxycinnamic Acid SCoA Thioester
the fixed and stained polyacrylamide gel, electroeluted, and
subjected to NH2-terminal sequencing. The following sequence
was determined: Ser-Thr-Tyr-Glu-Gly-Arg-Trp-Lys-Thr-Val-
Lys-Val-Glu-Ile-Gln-Asp-Gly-Ile-Ala-Phe.
Identification and Cloning of the Gene for a Ferulate-induced
Polypeptide—The NH2-terminal sequence of the ferulate-in-
duced 31-kDa polypeptide was used to design degenerate oli-
gonucleotide primers (Fig. 4) which were shown to PCR amplify
a 60-bp sequence of DNA from the equivalent P. fluorescens
AN103 gene. The amplified fragment was used as a probe to
locate this gene on EcoRI/PstI digests of the two cosmids
pFI793 and pFI794. The fragments identified were 6 kb and 4.3
kb, respectively, and the latter smaller fragment was targeted
for subcloning and sequence determination.
Open Reading Frame of the 31-Kb Polypeptide—The se-
quence of part of the 4.3-kb fragment of cosmid pFI794 is
shown in Fig. 5. An open reading frame ORF A (831 bp),
corresponding to the ferulate-induced polypeptide and encod-
ing the NH2 terminus determined previously, commenced at
position 126 and was terminated by a stop codon at position
954; it encoded a polypeptide of 276 amino acids, with a molec-
ular mass of 31.010 kDa, in good agreement with the SDS-
PAGE data (see Fig. 3). A native ribosome binding site (GAGA)
could be identified at 29 bp and inverted repeats at 237 bp,
264 bp, and 283 bp.
A second open reading frame (ORF B) was found to begin at
position 1058 and was terminated by a stop codon beginning at
position 2504 (data not shown). This open reading frame of
1,449 bp encoded a derived polypeptide sequence of 482 amino
acids and was preceded by a native ribosome binding site
FIG. 3. Electrophoretic comparison of crude extracts of P.
fluorescens biovar V, strain AN103, from cells grown on 10 mM
ferulate (F) and 10 mM vanillate (V), respectively, as sole carbon
source. SDS-PAGE followed by Coomassie staining for protein was
carried out as described under “Experimental Procedures.” Marker
proteins were phosphorylase b (97.4 kDa), bovine serum albumin (66.2
kDa), hen egg white ovalbumin (45.5 kDa), bovine carbonic anhydrase
(31.0 kDa), soybean trypsin inhibitor (21.5 kDa), and hen egg white
lysozyme (14.4 kDa).
FIG. 4. Degenerate oligonucleotide primers designed from the NH2-terminal amino acid sequence of the ferulate-induced 31-kDa
polypeptide.
4167
(GAGG) at 28 bp.
Expression of ORF A in E. coli and Demonstration of the
Encoded Enzyme Activity—To determine the function of ORF A
and to assay its gene product, ORF A was amplified by PCR,
cloned into an E. coli expression vector, and then transformed
into E. coli. From the sequence of ORF A, PCR primers (see
“Experimental Procedures”) were designed to amplify the gene
such that it was flanked by restriction endonuclease sites
EcoRI and BamHI. The amplified gene retained its native
ribosome binding site, being initiated at base 229 and ending
6 bp downstream of the stop codon. The amplified fragment
was cloned into the equivalent sites of the E. coli expression
vector pSP72 (under the control of the bacteriophage T7 RNA
polymerase promoter) to produce pFI1039, which was trans-
formed into E. coli JM109(DE3) (Promega). Cells of the E. coli
strain containing the vector pSP72 alone, designated JP1, and
of the strain containing pFI1039, designated JP2, were each
grown in the presence and absence of the inducer, isopropyl-b-
D-thiogalactoside, and then extracted and assayed for activity
with feruloyl-SCoA and HMPHP SCoA, determining the reac-
tion products by HPLC. For comparison, a crude extract of
Downloaded from www.jbc.org by guest, on September 18, 2010
strain AN103 was assayed under the same conditions.
As indicated previously in Fig. 2, extracts of strain AN103
grown in the presence of ferulate were shown to convert both
feruloyl-SCoA and HMPHP SCoA to vanillin and acetyl-SCoA
in equimolar proportions. HMPHP SCoA was in addition dehy-
drated to feruloyl-SCoA. Table II shows that the same reaction
products in strikingly similar ratios were also produced by
extracts of E. coli strain JP2 provided with these substrates.
Activity in E. coli strain JP2 was found to be independent of the
inducer, isopropyl-b-D-thiogalactoside, and indeed the specific
activity in the extract made after induction was slightly lower
than in the extract prepared from uninduced bacteria. (It is
possible that increased protein expression occurred upon in-
duction but resulted in the production of incorrectly folded or
inactive enzyme; this could not be assessed by SDS-PAGE
because of coelectrophoresis of the 31-kDa b-lactamase
polypeptide responsible for ampicillin resistance.) No activity
could be demonstrated in extracts of the unmanipulated E. coli
strain JP1 (data not shown), demonstrating unequivocally that
both the enoyl-SCoA hydratase activity and the subsequent
lyase activity were encoded by ORF A.
Ability of ORF A to Complement Pseudomonas Mutant van
10 —As shown in Table I, class II mutant strains were deduced
to be defective in the conversion of feruloyl-SCoA to vanillin,
because although they showed wild-type activities of ferulate:
CoASH ligase and vanillin:NAD1 oxidoreductase, the overall
conversion of ferulate to vanillate in the presence of the re-
quired cosubstrates (CoASH, ATP, Mg21, and NAD1) was se-
verely impaired. It was therefore predictable that ORF A would
be capable of complementing these strains, restoring their abil-
ity to catabolize ferulate and to utilize this compound as a sole
carbon source. To test this hypothesis, ORF A plus its putative
promoter sequence, TTGACAT (bp 59 – 65 in Fig. 5), was first
PCR amplified and cloned into the tetracycline-resistant vector
pRK415 (20) to give pFI2046. E. coli clones containing this
plasmid were then triparentally mated with the class II mu-
tant, van 10, essentially as described above in relation to
4168 Cleavage of Hydroxycinnamic Acid SCoA Thioester
FIG. 5. Nucleotide sequence of part of the 4.3-kb fragment of
cosmid pFI794, showing ORF A. The enoyl-SCoA hydratase signa-
ture sequence (es), inverted repeat regions (ir), and ribosome binding
site (r) are shown. ORF 2 indicates the start of the open reading frame
ORF2 reported by Priefert et al. (23).
complementation by the cosmid clones pFI793 and pFI794. The
complemented mutant recovered the ability to grow on ferulic
acid as anticipated, and furthermore extracts of the comple-
mented mutant showed wild-type ability to produce vanillate
TABLE II
Expression of feruloyl-SCoA hydratase/lyase in E. coli
Extracts were prepared and activities determined with feruloyl-SCoA
and HMPHP SCoA as substrates (0.28 mM and 0.40 mM, respectively),
using HPLC to determine the reaction products, as described under
“Experimental Procedures.” Reaction mixtures contained about 10 mg of
extract protein. For comparison, the activity with each substrate was
determined for an extract of P. fluorescens biovar V, strain AN103 (13
mg of extract protein).
Feruloyl-SCoA as HMPHP SCoA as substrate
substrate
Organism Acetyl- Acetyl- Feruloyl-
Vanillin Vanillin
SCoA SCoA SCoA
formation formation formation formation formation
nanokatals/mg of protein
E. coli JP2 1.5 1.8 1.5 1.8 3.4
E. coli JP2 (induced) 1.2 1.3 1.3 1.5 3.2
P. fluorescens biovar 4.2 3.3 2.9 2.7 8.3
V, strain AN103
and acetyl-SCoA from ferulate in the presence of CoASH, ATP,
Mg21, and NAD1 (data not shown).
Downloaded from www.jbc.org by guest, on September 18, 2010
DNA Sequence Analysis—ORF A was found to show homol-
ogy to an open reading frame of unknown function, ORF2, of
another Pseudomonas species, designated HR199 (23). The de-
duced translation product of ORF2 was 90% identical with the
corresponding translated sequence of ORF A but was 32 resi-
dues shorter at the NH2 terminus. ORF B, commencing down-
stream of ORF A at position 1058, was homologous with vdh, a
gene downstream of ORF2 and encoding vanillin:NAD1 oxi-
doreductase (23). The deduced amino acid sequences of vdh and
ORF B showed 81% identity (not shown), and ORF B has been
confirmed directly by heterologous expression to encode vanill-
in:NAD1 oxidoreductase.3
The alignment between the deduced amino acid sequence of
ORF A and the translated sequences of five other genes encod-
ing enzymes known to catalyze related reactions of CoASH
thioesters is depicted in Fig. 6. These genes are: the fadB gene
of E. coli, encoding the large a-subunit of the fatty acid oxida-
tion complex (24); the faoA gene of Pseudomonas fragi, encod-
ing the corresponding protein of this organism (25); the menB
gene of E. coli, encoding dihydroxynaphthoate synthase (26);
the gene of Pseudomonas sp. CBS-3 which encodes 4-chloro-
benzoyl-SCoA dehalogenase (27); and mvab, from Pseudomo-
nas mevalonii, which encodes 3-hydroxymethylglutaryl SCoA
lyase (28). Residues conserved in four or more of these se-
quences are shown together with conservative substitutions at
the same positions. Approximately 25–30% sequence identity
was found between ORF A and each of these sequences, with
the exception of the translated sequence of mvab, which was
only about 19% identical.
DISCUSSION
The results presented here characterize the pathway for
cleavage of a hydroxycinnamic acid. It is shown that the hy-
dration and cleavage reactions of the CoASH thioester of ferulic
acid are catalyzed by an enzyme encoded by a single gene of 828
bp. The products of the reaction are vanillin and acetyl-SCoA.
The catalysis of both reactions by a single enzyme was shown
by heterologous expression of the gene in E. coli, with demon-
stration of the formation of vanillin and acetyl-SCoA when
feruloyl-SCoA was supplied to cell-free extracts. The conclu-
sions were further supported by the demonstration of the for-
mation of three reaction products, feruloyl-SCoA, vanillin, and
acetyl-SCoA, when the putative hydrated reaction intermedi-
3
J. Payne, unpublished observations.
 Cleavage of Hydroxycinnamic Acid SCoA Thioester 4169

Downloaded from www.jbc.org by guest, on September 18, 2010

FIG. 6. Sequence alignment of the translated sequences of ORF A and members of the enoyl-SCoA hydratase/isomerase super-
family. Fadb_Ecoli, E. coli fadB gene (to residue 285) (24); Faob_Psefr, P. fragi fao gene (to residue 286) (25); Orfa, ORF A; Menb_Ecoli, E. coli
menB gene (26); 4-Cba-Scoa-Dehal, Pseudomonas sp. CBS-3 gene for 4-chlorobenzoate dehalogenase (27); Pmmvab, P. mevalonii mvab gene (28).
Residues conserved in four or more sequences are shown in reverse type; conservative substitutions are shaded. The translated sequence of ORF2
(23) differs principally from that of ORF A in being 32 residues shorter at the NH2 terminus.

ate, HMPHP SCoA, was supplied. This gene and its encoded
enzyme offer important new possibilities for the biotechnolog-
ical production of vanillin (4, 5, 8, 22).
Recently Priefert et al. (23) described an ORF of unknown
function in Pseudomonas sp. HR199 which exhibits strong ho-
mology with ORF A. This gene, ORF2, is shorter than the P.
fluorescens AN103 ORF A, lacking 32 codons at the 59-end as
well as the putative ribosome binding site and promoter. It
remains to be seen whether the difference in length and the
small number of nonconservative substitutions, most notably
at ORF A residues 166 (Gln to Glu), 184 (Glu to Lys), 190 (Glu
to Gln), and 250 (Thr to Pro), influence or modify enzyme
activity. Pseudomonas sp. HR199 was isolated from soil on the
basis of its ability to metabolize eugenol (29). The route pro-
posed in outline for the metabolism of eugenol to vanillate
envisages coniferyl alcohol, coniferyl aldehyde, ferulate, and
vanillin as successive intermediates (29 –31). Although ferulate
is almost certainly an intermediate in this pathway, the reac-
tion sequence from eugenol to vanillin requires further clarifi-
cation, and the enzyme activities responsible have not been
identified.
It is clear that the proteins encoded by ORF A and ORF2 are
additional members of the superfamily that includes enoyl-
SCoA hydratases of fatty acid b-oxidation, together with a
number of other proteins that catalyze, or are assumed to
catalyze, related reactions of CoASH thioesters (9, 10). A com-
pilation of 33 available sequences belonging to this superfam-
ily, across a strongly conserved a-helical region, has recently
been made (10). The equivalent region of the derived amino
acid sequence of ORF A stretches from Gly114 to Met172; within
this region, the derived sequences of ORF A and ORF2 are
almost identical, differing in only one residue, at Gln166. It is
known from site-directed mutagenesis studies that a conserved
Glu residue functions as a catalytic base in the reactions cat-
alyzed by mitochondrial enoyl-SCoA hydratase and mitochon-
drial D3-cis-D2-trans-enoyl-SCoA isomerase (9, 32, 33) and by
the enoyl-SCoA hydratase activity of the multifunctional fatty
acid oxidation large a-subunit of E. coli (34). This residue
appears conserved in all members of the superfamily with
enoyl-SCoA hydratase or D3-cis-D2-trans-enoyl-SCoA isomer-
ase activity, and it is present in the derived amino acid se-
quences of ORF A and ORF2, at residue 143 and 111, respec-
tively. A second Glu residue functions as a general acid-base
catalyst for the activation of the nucleophilic water required in
the enoyl-SCoA hydratase reaction and appears conserved in
the sequences of proteins that possess enoyl-SCoA hydratase
activity, but it is absent from the sequences of those that do
not, including the mitochondrial D3-cis-D2-trans-enoyl-SCoA
isomerases (10, 35). This residue is not conserved in the trans-
lated sequences of ORF A and ORF2, where it is replaced by a
Ser residue, at positions 123 and 91, respectively. In this re-
spect, therefore, this pair of sequences appears unique among
enoyl-SCoA hydratases. In most other respects, however, the
highly conserved residues characteristic of the superfamily are
present in the translated sequences of ORF A and ORF2; these
include an Asp residue at position 129, a Gly at 140, a Gly at
147, a Pro at 150, a Gly at 151, and a Gly at 163 (numbering of
ORF A). Interestingly, however, residue 160 is Asp, rather than
4170 Cleavage of Hydroxycinnamic Acid SCoA Thioester
the Lys or Arg found in almost all other members of the super- Research) and Jack Woolley (De Montfort University, Leicester, UK) for
family, and residue 169 is a Tyr, whereas in most other se- helpful discussions.
quences this is Glu or Asp and very rarely a nonpolar residue
(10). 1.
Multifunctional fatty acid oxidation proteins of the enoyl- 2.
3.
SCoA hydratase superfamily, including the mitochondrial (36, 4.
37), peroxisomal (38, 39) and plant glyoxysomal (40, 41) mul-
5.
tifunctional proteins, the large a-subunit encoded by the fadB 6.
gene of E. coli (24, 42), and the corresponding protein encoded 7.
by the fao gene of P. fragi (25), all possess L-3-hydroxyacyl 8.
dehydrogenase activity. This is responsible for the b-oxidation 9.
reaction to the corresponding 3-oxo acid. This activity is asso-
10.
ciated not with the NH2-terminal region, where enoyl-SCoA
hydratase activity resides, but with a separate domain, which 11.
includes an NAD1 binding site. This domain and the sequence
12.
motif associated with NAD1 binding are not present in the
shorter sequences of ORF A (276 residues) and ORF2, and
13.
hence this provides additional proof that the pathway in P.
fluorescens biovar V, strain AN103 is non-b-oxidative (see Fig. 14.
15.
1). Further evidence is provided by the close proximity of ORF
A to ORF B, encoding vanillin:NAD1 oxidoreductase and by the 16.
fact that ORF A and ORF B are cotranscribed. 17.
The enzyme encoded by ORF A possesses both feruloyl-SCoA 18.
hydratase and HMPHP SCoA lyase activities. This appears to 19.
be the first enzyme of the superfamily with a lyase activity. The
closest formal analogy is with 3-hydroxy-3-methylglutaryl 20.
SCoA lyase, an enzyme that catalyzes a reverse Claisen ester 21.
condensation to acetoacetate and acetyl-SCoA (43). The gene,
mvab, encoding this enzyme in P. mevalonii has been isolated 22.
(28). As shown in Fig. 6, this shows very little homology to ORF 23.
A and members of the enoyl-SCoA hydratase/isomerase super-
24.
family and appears not to belong to this gene family. It is
therefore not possible to use this sequence to provide indica- 25.
tions of the residues of ORF A which might be associated
26.
particularly with the lyase activity.
The proteins encoded by fadB (44) and fao (25) possess a 27.
3-hydroxyacyl epimerase activity. It remains to be investigated
whether the enoyl-SCoA hydratase/lyase enzyme encoded by 28.
29.
ORF A might also possess such an activity. This would explain 30.
the almost complete utilization of HMPHP SCoA (Fig. 2B), 31.
which was initially surprising since it was assumed that this 32.
33.
intermediate would be a mixture of L- and D-isomers. The
isomeric composition of this substrate has not been deter- 34.
35.
mined, however, and further work is clearly required to inves- 36.
tigate this question.
It is probable that homologous genes and enzymes may be 37.
found elsewhere in the microbial and plant kingdoms. In 38.
plants, both CoASH-dependent and CoASH-independent mech-
anisms have been proposed for the conversion of 4-coumarate 39.
to 4-hydroxybenzoate (45–50); in particular, in extracts of cell 40.
cultures of Lithospermum erythrorhizon, both a non-CoASH- 41.
dependent mechanism via 4-hydroxybenzaldehyde (48) and a
CoASH-dependent, b-oxidative mechanism via 4-hydroxyben- 42.
43.
zoyl-SCoA (50) have been reported recently. The bacterial
mechanism described here is of a third type, CoASH-dependent 44.
45.
yet non-b-oxidative. It will therefore be particularly interesting
to discover whether this mechanism can also be demonstrated 46.
in plants. 47.
48.
Acknowledgments—We thank John Eagles and Fred Mellon for per- 49.
forming the mass spectrometric analyses, Hugh Griffin for designing
degenerate oligonucleotide primers, and Paul Needs (Institute of Food 50.
REFERENCES
Hartley, R. D., and Jones, E. C. (1977) Phytochemistry 16, 1531–1534
Dixon, R. A., and Paiva, N. L. (1995) Plant Cell 7, 1085–1097
Whetten, R., and Sederoff, R. (1995) Plant Cell 7, 1001–1013
Rosazza, J. P. N., Huang, Z., Dostal, L., Volm, T., and Rousseau, B. (1995)
J. Indust. Microbiol. 15, 457– 471
Hagedorn, S., and Kaphammer, B. (1994) Annu. Rev. Microbiol. 48, 773– 800
Zenk, M. H. (1979) Rec. Adv. Phytochem. 12, 139 –176
Toms, A., and Wood, J. M. (1971) Biochemistry 9, 337–343
Narbad, A., Rhodes, M. J. C., Gasson, M. J., and Walton, N. J. (March 22, 1996)
U. K. Patent GB 9606187.4
Müller-Newen, G., Janssen, U., and Stoffel, W. (1995) Eur. J. Biochem. 228,
68 –73
Wu, W.-J., Anderson, V. E., Raleigh, D. P., and Tonge, P. J. (1997)
Biochemistry 36, 2211–2220
Semler, V., Schmidtberg, G., and Gross, G. G. (1987) Z. Naturforsch. 42,
1070 –1074
Shriner, R. L. (1942) in Organic Reactions (Adams, R., Bachmann, W. E.,
Fieser, L. F., Johnson, J. R., and Snyder, H. R., eds) vol. 1, pp. 1–37, John
Wiley and Sons, New York
Zenk, M. H., Ulbrich, B., Brusse, J., and Stöckigt, J. (1980) Anal. Biochem. 101,
182–187
Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254
Staskawicz, B., Dahlbeck, D., Keen, N., and Napoli, C. (1987) J. Bacteriol. 169,
5789 –5794
Wood, W. B. (1966) J. Mol. Biol. 16, 118 –133
Downloaded from www.jbc.org by guest, on September 18, 2010
Figurski, D., and Helinski, D. R. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,
1648 –1652
Schägger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368 –379
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY
Keen, N. T., Tamaki, S., Kobayashi, D., and Trollinger, D. (1988) Gene (Amst.)
70, 191–197
Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A.
74, 5463–5467
Narbad, A., Rhodes, M. J. C., Gasson, M. J., and Walton, N. J. (March 21, 1997)
Patent PCT/GB97/00809
Priefert, H., Rabenhorst, J., and Steinbüchel, A. (1997) J. Bacteriol. 179,
2595–2607
Yang, X.-Y. H., Schulz, H., Elzinga, M., and Yang, S.-Y. (1991) Biochemistry
30, 6788 – 6795
Sato, S., Hayashi, M., Imamura, S., Ozeki, Y., and Kawaguchi, A. (1992)
J. Biochem. (Tokyo) 111, 8 –15
Sharma, V., Suvarna, K., Meganathan, R., and Hudspeth, M. E. S. (1992)
J. Bacteriol. 174, 5057–5062
Babbitt, P. C., Kenyon, G. L., Martin, B. M., Charest, H., Slyvestre, M.,
Scholten, J. D., Chang, K. H., Liang, P. H., and Dunaway-Mariano, D.
(1992) Biochemistry 31, 5594 –5604
Anderson, D. H., and Rodwell, V. W. (1989) J. Bacteriol. 171, 6468 – 6472
Rabenhorst, J. (1996) Appl. Microbiol. Biotechnol. 46, 470 – 474
Tadasa, K. (1977) Agric. Biol. Chem. 41, 925–929
Tadasa, K., and Kayahara, H. (1983) Agric. Biol. Chem. 47, 2639 –2640
Müller-Newen, G., and Stoffel, W. (1993) Biochemistry 32, 11405–11412
D’Ordine, R. L., Bahnson, B. J., Tonge, P. J., and Anderson, V. E. (1994)
Biochemistry 33, 14733–14742
Yang, S.-Y., He, X.-Y., and Schulz, H. (1995) Biochemistry 34, 6441– 6447
He, X.-Y., and Yang, S.-Y. (1997) Biochemistry 36, 11044 –11049
Uchida, Y., Izai, K., Orii, T., and Hashimoto, T. (1992) J. Biol. Chem. 267,
1034 –1041
Kamijo, T., Aoyama, T., Miyazaki, J., and Hashimoto, T. (1993) J. Biol. Chem.
268, 26452–26460
Osumi, T., Ishii, N., Hijikata, M. Kamijo, K., Ozasa, H., Furuta, S., Miyazawa,
S., Kondo, K., Inoue, K., Kagamiyama, H., and Hashimoto, T. (1985) J. Biol.
Chem. 260, 8905– 8910
Palosaari, P. M., and Hiltunen, J. K. (1990) J. Biol. Chem. 265, 2446 –2449
Preisig-Müller, R., Gühnemann-Schäfer, K., and Kindl, H. (1994) J. Biol.
Chem. 269, 20475–20481
Gühnemann-Schäfer, K., Engeland, K., Linder, D., and Kindl, H. (1994) Eur.
J. Biochem. 226, 909 –915
He, X.-Y., and Yang, S.-Y. (1996) Biochemistry 35, 9625–9630
Hruz, P. W., Narasimhan, C., and Miziorko, H. M. (1992) Biochemistry 31,
6842– 6847
Yang, S.-Y., and Elzinga, M. (1993) J. Biol. Chem. 268, 6588 – 6592
Löffelhardt, W., and Kindl, H. (1975) Hoppe-Seyler’s Z. Physiol. Chem. 356,
487– 493
Hagel, P., and Kindl, H. (1975) FEBS Lett. 59, 120 –124
French, C. J., Vance, C. P., and Towers, G. H. N. (1976) Phytochemistry 15,
564 –566
Yazaki, K., Heide, L., and Tabata, M. (1991) Phytochemistry 30, 2233–2236
Schnitzler, J.-P., Madlung, J., Rose, A., and Seitz, H. U. (1992) Planta
(Heidelb.) 188, 594 – 600
Löscher, R., and Heide, L. (1994) Plant Physiol. 106, 271–279