Sie sind auf Seite 1von 139

CORONA

Wahnsinn hat einen Namen


von

Dr. h.c. Peter Echevers H.

„CORONA – Wahnsinn hat einen Namen“


Erstveröffentlichung 2021
Lektorat: PSE Ltda. Rio de Janeiro
Verlag: LULU Press Enterprises
© Cover-Gestaltung Dr. Peter Echevers H.
© Dr. h.c. Peter Echevers H., Rio de Janeiro
E-Book: ISBN
Paperback: ISBN 979-8-761-56856-3
Hardcover: ISBN 979-8-760-67140-0

„Unter Hinweis auf §§ 5, 15 MarkenG nehmen wir Titelschutz in Anspruch für „CORONA - Wahnsinn hat einen Namen“ in
allen Schreibweisen und Darstellungsformen, als Einzeltitel und für alle Medien.“

PSE Publications Service Echevers Ltda. Ladeira da Colina, 2 Geribá


28950-000 Armação dos Búzios, RJ

Alle Rechte vorbehalten. Nachdruck, auch auszugsweise, verboten. Kein Teil dieses Werkes darf ohne schriftliche Einwilligung
des Autors in irgendeiner Form reproduziert oder unter Verwendung elektronischer Systeme verarbeitet, vervielfältigt oder
verbreitet werden.
Widmung

Dieses Buch möchte ich meinem Schlaraffen-Bruder Ritter Krad heraus widmen.
Index

Widmung
Index
Einleitung
Kapitel 1 – Dr. med. Michael Spitzbart
Kapitel 2 – Existenznachweis des Virus
Kapitel 3 – von David Claudi Siber
Kapitel 4 – Zweifel am PCR-Test
Kapitel 5 – von James Corbett
Kapitel 6 – Fragen zum Pandemiegeschehen
Kapitel 7 – Maskenhysterie greift um sich
Kapitel 8 – Dr. med. Wolfgang Wodarg
Kapitel 9 – Fragen zur WHO
Kapitel 10 – Aktuelle Meldung von PFIZER
Kapitel 11 – Das Weimarer Skandalurteil
Kapitel 12 – Ironie am Rande
Kapitel 13 – Interview mit Prof. Dr. Sucharit Bhakdi

Kapitel 14 – COVID-19 gar keine Frage des Immunsystems Kapitel 15 – WORDING

Kapitel 16 – Joachim Kuhs, Rechtspfleger


Kapitel 17 – Das perfide Geschäft der Impfung
Kapitel 18 – Aktuelles Forschungsergebnis zu den mRNA-Seren
Wenner-Gren-Institute Uni Stockholm

Schlussbemerkung
Über den Autor
Einleitung

Ende 2021 sind fast zwei Jahre vergangen, und die allgemeine Corona-Hysterie hät die gesamte
Menschheit fest in ihren Krallen.
Ich bin der festen Überzeugung, das Leben wird sich nie mehr so normalisieren, wie es vor
dieser Pandemie war. Wenn es denn überhaupt tatsächlich eine Pandemie ist. Die Maßstäbe
ändern sich laufend, man weiß heute nicht mehr, welche Vorschriften morgen gelten werden.
Der Corona-Wahnsinn kann von keinem mehr gestoppt werden, die Krankenhäuser haben
längst einen Weg gefunden, sich an dieser Welle gesundzustoßen. Die Krankenkassen können
davon ein Lied singen. Jeder Verdacht auf eine Erkältung landet im Zweifelsfall auf der
Intensivstation, nötig oder nicht. Lebenswichtige Operationen werden vom Terminplan
gestrichen, dafür hat man jetzt einfach keine Zeit.
Maskenhersteller hatten noch nie so gute Zeiten wie gerade jetzt, da sind es nicht mehr
ausschließlich die Ärzte in den Operationssälen, nein die ganze Welt ist zum Kunden geworden.
Von jetzt auf gleich.
Die Pharma-Mafia zieht ihre alten mRNA Impfprojekte aus der Schublade, die sie zwanzig
Jahre nicht an den Mann bringen konnte und wittert ihre große Chance. Fast 8 Milliarden
Menschen impfen, vielleicht sogar jährlich, da rappelt es schon in den Kassen.
Gnädig hört man auf die Hilferufe der Regierungen und nimmt gerne die angebotenen Gelder
zur schnellen Entwicklung von Impfseren entgegen.
„Bei so einer Schnellentwicklung können wir natürlich nicht für Folgen haften.“
„Ja schon klar, die übernehmen im Zweifelsfalle wir.“ rufen die Staaten und erarbeiten statt
dessen einen seitenlangen Vertrag, den der Impfling vor Verabreichung unterschreiben muss.
Der Staat ist also auch fein raus.
Jetzt müssen nur noch die Medien mitmachen. Wer den
QualitätsJournalismus von heute kennt, weiß, dass hier alles eine Frage des Geldes ist. Aber
daran mangelt es ja nicht, wie man sieht.
Die tägliche Ziehung der Corona-Zahlen wird zur Pflichtübung und Nachrichten, Tagespresse
und der gesamte Blätterwald rauschen entzückt bei diesem Thema.
Eine Maschinerie wurde in Gang gesetzt, die alle Gegenstimmen platt walzt, alle noch so
qualifizierten Ärzte, Professoren, Wissenschaftler, Biologen und Virologen, denen es einfällt,
etwas von sich zu geben, was den Geldfluss, den neuen Corona-Markt, ja man muss sagen, die
Corona-Industrie beeinträchtigen könnten, werden verunglimpft und mundtot gemacht. Nach
verheerenden Medien-Kampagnen hat so mancher renommierte Experte seine Arbeit und seine
gesellschaftliche Stellung verloren, weil er es wagte, Zweifel zu äußern. Zweifel an dem
Mainstreamgeschehen, Zweifel an den täglichen Absonderungen der Politiker, die unisono zu
noch mehr Impfungen und noch mehr sozialer Distanz aufrufen. Unbeachtet, dass die bisherigen
Maßnahmen sich ausnahmslos und durch die Bank als Schuss ins Blaue erwiesen haben.
Es sind ganze Hundertschaften der trinkfesten Journaille damit beschäftigt in gezielten
Kampagnen die Demontage von Personen zu betreiben, die nicht konform mitlaufen, sondern
den gesunden Menschenverstand und womöglich noch ein hochqualifiziertes Fachwissen
einbringen.
Bei den ganzen Maßnahmen, die nicht greifen, kann man nur sagen: „… denn sie wussten nicht,
was sie tun! Schlimmer noch, sie wissen es auch heute noch nicht.“
Da wird nun an einem in Millionen Jahren gewachsenen Immunsystem herumexperimentiert
und die Folgen sind weltweit fatal. Was allerdings Mainstream-Politiker und -Experten
keinesfalls zum Hinterfragen der Maßnahmen oder gar Umdenken veranlassen könnte. Warum
auch! Der Rubel, besser Euro und Dollar rollen schließlich in unvorstellbarer Menge in die
richtige Richtung.
Die Umverteilung von ganz unten nach ganz oben ist ein Fakt geworden. Die Ideen, nun das
komplette Bargeld gleich ganz abzuschaffen ist nur noch ein Nebenschauplatz.
Dieses Buch will kritischen Stimmen ein Gehör schenken und eine Plattform bieten.
Sie, geneigter Leser, können hier der täglichen Gehirnwäsche entfliehen und sich mit eigenem
Verstand ein Bild machen.
Kapitel Nr. 1 – Dr. med. Michael Spitzbart

Wird es wieder unsere alte Normalität geben?

Meine Antwort vorweg: ganz klar nein! Denn die derzeitige Krise hat sich tief ins (Unter-)
Bewusstsein der Menschheit eingefressen. In Zukunft wird nach der Krise vor der Krise sein.
Viren und Bakterien sowie deren Mutationen werden zukünftig wie der Wetterbericht zu
unserem Leben dazu gehören. Denn die Pharmaindustrie hat diesen lukrativen Markt jetzt für
sich entdeckt und wird ihn in Zukunft kräftig bedienen. Parallel haben unsere Volksvertreter
unser Immunsystem an die Industrie verkauft. Die willfährige Presse wiederum spielt mit und
begleitet alles nur allzu gerne mit ihrer eskalierenden Berichterstattung. Macht aus einer Krise
eine Katastrophe. Da die deutsche Regierung die Medien mit 220 Millionen Euro unterstützt,
wird man kritische Berichterstattung auch in der Zukunft vermissen. In
Österreich wird sogar eine Milliarde an die Medien ausgeschüttet.
Frage am Rande: wäre das Geld bei einer doch so großen Bedrohung wie Corona nicht besser
im Gesundheitswesen aufgehoben als bei der Presse, die nur über die Krankheit berichtet –
anstatt sie zu heilen? Oder bei den 20 Krankenhäusern, die in Deutschland vom Mai bis
November 2020 parallel zur Pandemie mit insgesamt 3000 Betten weg rationalisiert wurden?
Als wir Menschen in die viel ältere Welt der Mikroorganismen eingewandert sind, haben wir
ein kompetentes Immunsystem entwickelt, um uns gegen die Umwelt abzugrenzen und zu
schützen. Die letzten Jahrmillionen haben wir uns ganz gut miteinander arrangiert. Viren und
Bakterien haben gelernt, dass es nicht gut ist, seinen Wirt zu töten - wenn sie selbst überleben
wollen. Das kompetente Immunsystem wird daher mit den meisten Erregern fertig. Das haben
auch die Einwohner von Ischgl bewiesen, von denen über 50 % überhaupt nichts von ihrer
durchgemachten Corona-Infektion bemerkt haben.
Bei älteren und vorerkrankten Menschen kann das natürlich anders aussehen. Am Ende ist es
fast immer ein Atemwegsinfekt, der das letzte schwache Lebenslicht aushaucht. Was sich
jüngere Menschen, die noch im vollen Saft stehen, gar nicht vorstellen können: oft empfinden
ältere Menschen den Tod sogar als Erlösung. Besonders wenn sie einsam im Altenheim vor sich
hin vegetieren. Es liegt in der Natur der Sache, dass man sich im reiferen Alter gedanklich mit
der eigenen Endlichkeit anfreundet. Das erleichtert das Loslassen und den Übergang.

Vitamin C, Corona und der Semmelweis-Reflex


Ich habe ja seit Beginn der Pandemie schon mehrfach auf die schützende Wirkung von Vitamin
C und D aufmerksam gemacht.
Das hat mir nicht nur Freunde eingebracht.
Aktuell verblüffen zwei Aussagen der Charite´ und der Universität
Heidelberg, die so gar nicht in das Bild der herkömmlichen COVID19 Therapie passen. Dort ist
nämlich aufgefallen, dass die Patienten mit einem schweren Verlauf unter einem extremen
Vitamin C Mangel leiden. Die Vitamin C Spiegel im Blut der Patienten waren unter der
Nachweisgrenze, genau wie einem Skorbut-Kranken.
Wir erinnern uns: beim Skorbut (extremen Vitamin C Mangel) werden Blutgefäße geschädigt,
was u.a. zu spontanen Einblutungen in die Haut führt. Worüber berichten die Ärzte auf den
COVID-Stationen? Von einer Gefäßbeteiligung der
Erkrankung, die prinzipiell jedes Organ betreffen kann, nicht nur die Lunge. Unter anderem
treten petechiale - kleine Blutungen- in die Haut auf. Könnte hier das ‚missing link‘ und die
Lösung zugleich sein?
Zumindest raten die Ärzte nun dazu, den extremen Mangel an Antioxidantien wie Vitamin C
auszugleichen, BEVOR ein schwerer
Verlauf entsteht. Bei schwerem Verlauf erst recht! Das haben die
Ärzte in China sehr erfolgreich bei schwerkranken COVID-19 Patienten gemacht. Sie gaben bis
zu 40 Gramm Vitamin C intravenös, worauf viele Patienten bereits nach 5-6 Stunden von
Intensiv- auf Normalstation verlegt werden konnten. Wissenschaftliche Begründung: Vitamin C
in hohen Dosen unterbinde eine lebensgefährliche Entgleisung des Immunsystems und den
Zytokin-Sturm (starke Entzündungsreaktion) in den Blutgefäßen.

Aber auch in der Prophylaxe ist Vitamin C ein effektives Schutzschild. Die Spike-Proteine des
Corona-Virus, diese charakteristischen Stacheln, müssen erst aktiviert werden, damit das Virus
überhaupt in unsere Zellen gelangen kann. Dazu benutzt des Virus ein körpereigenes Enzym
(Furin), welches besonders unter Vitamin C Mangel entsteht. Unter dem Strich öffnen wir dem
Virus selbst die Tür, wenn wir eine schlechte Abwehrlage haben.
Anekdote am Rande: ein befreundetes Ehepaar infizierte sich gleichzeitig mit SARS-CoV-2.
Noch in der Inkubationsphase ohne Kenntnis einer Infektion kam der Ehemann zu einer
Vitamin-
Infusion in unsere Praxis (Praxisinterner Sprachgebrauch „WuhanCocktail“). Darin sind unter
anderem 15 Gramm Vitamin C enthalten. Fazit: Er hat von der ganzen Infektion praktisch nichts
mitbekommen, wohingegen seine Ehefrau 2 Wochen unter deutlichen Symptomen litt.
Bemerkenswert war, dass der Herr vom Alter her voll in der Risikogruppe lag, die jüngere
Ehefrau noch nicht.
Für mich ist es unverständlich, dass sich die „seriöse“ Medizin oft so hochmütig gegen diese
einfachen Maßnahmen sperrt. Das wird auch als Semmelweis-Reflex bezeichnet: das
wissenschaftliche Establishment lehnt eine neue Entdeckung quasi „reflexhaft“ ohne
ausreichende Überprüfung erst einmal ab. Der Urheber wird eher bekämpft als unterstützt, wenn
die Aussage weit verbreiteten Normen oder Überzeugungen widerspricht.
Zur Erinnerung: der Arzt Ignaz Semmelweis galt als „Retter der Mütter“. Er zwang seine
ärztlichen Kollegen und
Medizinstudenten, sich nach Sektionen in der Pathologie die zu Hände zu waschen, bevor sie im
Kreißsaal bei Geburten Hand anlegen durften. Das brachte ihm zunächst viel Gegenwind ein.
Meinen Patienten empfehle ich gerade in diesen Tagen die Einnahme der entsprechenden
Vitamine. Viele Menschen machen das bereits, daher ist Vitamin C in vielen Apotheken
ausverkauft, aber man kann sich heute Vitamin C auch problemlos im Internet bestellen und
bekommt es direkt nachhause geliefert.
Empfehlung: Vitamin C plus E und Vitamin D3 plus K2 jeweils 3mal eine Kapsel am Tag.
Genau diese Kombinationen potenzieren die Einzelwirkung. Diese „Impfung“ ist erprobt und
hat keine Nebenwirkungen.

PCR-Test

Im Fernsehen und in allen Nachrichten gilt ja der PCR-Test als das Maß aller Dinge. Positive
Tests werden uns als Neuinfektionen verkauft, obwohl die überwiegende Mehrzahl gar keine
Symptome aufweist. Die Menschen werden uns dann als „Erkrankte ohne Symptome“ verkauft.
Früher, als die Medizin noch nicht so fortgeschritten war, nannte man das einfach nur
„Gesunde“.
Ein portugiesisches Berufungsgericht hat den PCR-Test als nicht beweisend für eine Infektion
einkassiert. In den USA, Canada und in Deutschland sind ebenfalls Klagen gegen den PCR-
Tests anhängig.

Der Leserbrief eine Arztes - veröffentlicht im deutschen Ärzteblatt


- brachte es auf den Punkt: es sei irreführend, ständig von
Neuinfektionen zu sprechen. Richtig wäre es, von positivPCRGetesteten zu sprechen. Das ist
nämlich nicht gleichbedeutend mit
Infektion. Das nur als Hintergrundinformation, wenn in den Nachrichten wieder die Ziehung der
Corona-Zahlen verlesen wird.
Jetzt wünsche all meinen treuen Lesern frohe Weihnachten, und ein hoffentlich gesundes neues
Jahr. Die Corona-Diskussion hat ja ganze Familien gespalten. Hier hoffe ich und wünsche , dass
über die Festtage Harmonie eingekehrt. Vertragt Euch und seid nett zueinander!
Kapitel Nr. 2 – Existenznachweis des Virus

Führende Corona Forscher geben zu, dass sie keinen wissenschaftlichen Beweis für die
Existenz eines Virus haben

Meine ersten Worte des Artikels lauten: "Schnallen Sie sich an, der Schock wird heftig".
Das, was Sie in diesem Artikel erfahren werden, sprengt Ihren Horizont. Die neuesten
Information haben die Sprengkraft den größten Betrug an der Menschheit aufzudecken. Nach
diesen Informationen sollte jeder Bürger die Leute unterstützen, die für diese wichtigen
Informationen gekämpft haben. Es ist endlich raus, alle führenden Wissenschaftler zu COVID-
19 (SARS-CoV-2) haben zugegeben, dass die wissenschaftlichen Regeln um COVID19
nachzuweisen, nicht erbracht wurden.
Aber der Reihe nach. Ich werde Ihnen erklären, was dies bedeutet. Ich bitte Sie diesen Artikel
bis zum Ende zu lesen. Verbreiten Sie diesen Artikel. Die Pandemie (Telegram Post) müsste
durch diese Aussagen mit sofortiger Wirkung beendet sein, mehr noch, damit muss die
komplette Virologie in Frage gestellt werden!

Das Nachweisverfahren der PCR-Tests ist völlig bedeutungslos


Der PCR-Test ist nicht validiert! PCR: Ein DNA-Test wird zum Manipulationsinstrument
behandelt. Dort beweise ich zweifelsohne, dass der PCR-Test, der bei COVID-Tests als
„Goldstandard“ gilt, völlig „bedeutungslos“ ist.
Die Frage ist nun: Was ist zuerst für die Isolierung / den Nachweis von Viren erforderlich? Wir
müssen wissen, woher die RNA stammt, für die die PCR-Tests kalibriert sind.
Aus Lehrbüchern (z.B, White/Fenner. Medical Virology, 1986, S. 9), sowie führende
Virusforscher wie Luc Montagnier oder Dominic Dwyer stellen fest, dass die Partikelreinigung
- d.h. die Trennung eines Objekts von allem, was nicht dieses Objekt ist, wie z.B. die
Nobelpreisträgerin Marie Curie 1898 100 mg Radiumchlorid durch Extraktion aus Tonnen von
Pechblende reinigte - eine wesentliche Voraussetzung ist, um die Existenz eines Virus
nachzuweisen und damit zu beweisen, dass die RNA des betreffenden Partikels von einem
neuen Virus stammt.
Der Grund dafür ist, dass die PCR extrem empfindlich ist, d.h. sie kann selbst kleinste DNA-
oder RNA-Stücke nachweisen - aber sie kann nicht feststellen, woher diese Partikel stammen.
Das muss vorher bestimmt werden.
Und weil die PCR-Tests auf Gensequenzen (in diesem Fall RNASequenzen, weil SARS-CoV-2
vermutlich ein RNA-Virus ist) kalibriert sind, müssen wir wissen, dass diese Genschnipsel Teil
des gesuchten Virus ist. Und um das zu wissen, muss eine korrekte Isolierung und Reinigung
des vermuteten Virus durchgeführt werden.
Die Koch'schen Postulate sind die entscheidenden Kriterien, um ein Virus wissenschaftlich
nachzuweisen
Vor der Erfindung des Elektronenmikroskops in den 1930er Jahren war es nicht möglich, so
kleine Partikel zu sehen. Mit dem Elektronenmikroskop begann die neue Generation von
Virologen unsaubere Materialien zu untersuchen und behaupteten, sie könnten die Viren
entdecken. Das Problem ist, dass man allein durch das Betrachten eines Teilchens nicht sagen
kann, was es ist oder was es tut, ohne die Postulate von Koch zu erfüllen.
Die Koch'schen Postulate wurden von dem großen deutschen Bakteriologen Robert Koch im 19.
Jahrhundert erstellt.
Definition:
Vier von Robert Koch aufgestellte Forderungen, die erfüllt sein müssen, damit ein
Mikroorganismus als Erreger einer bestimmten Krankheit bezeichnet werden darf.
1. Kochsches Postulat
• Der Mikroorganismus muss in allen Krankheitsfällen gleicher Symptomatik detektiert werden
können, bei gesunden Individuen jedoch nicht.
2. Kochsches Postulat
• Der Mikroorganismus kann aus dem erkrankten Individuum in eine Reinkultur überführt
werden (Isolation)
3. Kochsches Postulat
• Ein vorher gesundes Individuum zeigt nach Infektion mit dem Mikroorganismus aus der
Reinkultur dieselben Symptome wie das, aus dem der Mikroorganismus ursprünglich stammt.
4. Kochsches Postulat
• Der Mikroorganismus kann aus den so infizierten und erkrankten Individuen wieder in eine
Reinkultur überführt werden.
Die führenden Wissenschaftler geben zu, dass keiner von Ihnen ein Virus isoliert hat!
Torsten Engelbrecht ( preisgekrönter Journalist) und Konstantin Demeter (unabhängiger
Forscher) haben die Wissenschaftsteams der einschlägigen Arbeiten auf die im Zusammenhang
mit SARSCoV-2 Bezug genommen wird, um den Nachweis gebeten, ob die in ihren in vitro-
Experimenten abgebildeten
Elektronenmikroskopischen Aufnahmen gereinigte Viren zeigen.
Aber kein einziges Team konnte diese Frage mit "ja" beantworten - und niemand sagte, dass die
Reinigung kein notwendiger Schritt sei. Wir erhielten nur Antworten wie "Nein, wir haben
keine elektronenmikroskopische Aufnahme erhalten, die den Grad der Reinigung zeigt".
Wir fragten mehrere Studienautoren: "Zeigen Ihre elektronenmikroskopischen Aufnahmen das
gereinigte Virus (eine Isolierung)?", und sie gaben folgende Antworten:
Studie 1: Leo L. M. Poon; Malik Peiris. “Emergence of a novel human coronavirus threatening
human health” Nature Medicine, March 2020 [Nature]
Antwortender Autor: Malik Peiris
Datum: May 12, 2020
Antwort: “The image is the virus budding from an infected cell. It is not purified virus.”
Übersetzt: "Das Bild ist das aus einer infizierten Zelle austretende Virus. Es ist kein gereinigtes
Virus". ________________________________________
Studie 2: Myung-Guk Han et al. “Identification of Coronavirus Isolated from a Patient in Korea
with COVID-19”, Osong Public
Health and Research Perspectives, February 2020
[Pubmed ncbi]
Antwortender Autor: Myung-Guk Han
Datum: May 6, 2020
Antwort: “We could not estimate the degree of purification because we do not purify and
concentrate the virus cultured in cells.”
Übersetzt: "Wir konnten den Grad der Reinigung nicht abschätzen, weil wir das in Zellen
gezüchtete Virus nicht reinigen und konzentrieren."
________________________________________
Studie 3: Wan Beom Park et al. “Virus Isolation from the First Patient with SARS-CoV-2 in
Korea”, Journal of Korean Medical
Science, February 24, 2020 [Pubmed ncbi]
Antwortender Autor: Wan Beom Park
Datum: March 19, 2020
Antowrt: “We did not obtain an electron micrograph showing the degree of purification.”
Übersetzung: "Wir haben keine elektronenmikroskopische
Aufnahme erhalten, die den Grad der Reinigung zeigt."
________________________________________
Studie 4: Na Zhu et al., “A Novel Coronavirus from Patients with Pneumonia in China”, 2019,
New England Journal of Medicine, February 20, 2020 [nejm]
Antwortender Autor: Wenjie Tan
Datum: March 18, 2020
Answer: “[We show] an image of sedimented virus particles, not purified ones.”
Übersetzt: "[Wir zeigen] ein Bild von sedimentierten Viruspartikeln, nicht von gereinigten".
Anmerkung: Bei dieser Publikation hätte es der Nachfrage nicht bedurft, die Autoren geben hier
offen zu "our study does not fulfill Koch’s postulates"
Übersetzt: "unsere Studie erfüllt nicht die Postulate von Koch"
________________________________________
Quelle: COVID19 PCR Tests are Scientifically Meaningless Hinsichtlich der erwähnten
Arbeiten ist klar, dass das, was in den elektronenmikroskopischen Aufnahmen (EMs) gezeigt
wird, das Endergebnis des Experiments ist, d.h. es gibt kein anderes Ergebnis, aus dem sie EMs
hätten herstellen können.
Das heißt, wenn die Autoren dieser Studien zugeben, dass ihre veröffentlichten EMs keine
gereinigten Partikel zeigen, dann besitzen sie definitiv keine gereinigten Partikel, von denen
behauptet wird, dass sie viral sind. (In diesem Zusammenhang muss angemerkt werden, dass
einige Forscher in ihren Arbeiten den Begriff "Isolierung" verwenden, aber die darin
beschriebenen Verfahren stellen keinen ordnungsgemäßen Isolierungs- (Reinigungs-) Prozess
dar. Folglich wird in diesem Zusammenhang der Begriff "Isolierung" missbräuchlich
verwendet).
So räumen die Autoren von vier der wichtigsten Anfang 2020 veröffentlichten Arbeiten, in
denen die Entdeckung eines neuen Coronavirus behauptet wird, ein, dass sie keinen Beweis
dafür hatten, dass der Ursprung des Virusgenoms virenähnliche Partikel oder Zelltrümmer, rein
oder unrein, oder Partikel jeglicher Art, waren. Mit anderen Worten, die Existenz der SARS-
CoV-2-RNA beruht auf dem Glauben, nicht auf Tatsachen.
Torsten Engelbrecht ( preisgekrönter Journalist) und Konstantin Demeter (unabhängiger
Forscher) haben Dr. Charles Calisher kontaktiert, der ein erfahrener Virologe ist. Im Jahr 2001
veröffentlichte Science ein "leidenschaftliches Plädoyer... an die jüngere Generation" von
mehreren altgedienten Virologen, unter ihnen Dr. Charles Calisher
[moderne Virusnachweismethoden wie] die geschmeidige Polymerase-Kettenreaktion [...] sagen
wenig oder nichts darüber aus, wie sich ein Virus vermehrt, welche Tiere es in sich tragen,
[oder] wie es Menschen krank macht. Es ist, als ob man versucht zu sagen, ob jemand
Mundgeruch hat, indem man auf seinen Fingerabdruck schaut" [1].
Und deshalb fragten die beiden Dr. Calisher, ob er ein einziges Papier kennt, in dem SARS-
CoV-2 isoliert und schließlich wirklich gereinigt wurde. Seine Antwort:
"I know of no such a publication. I have kept an eye out for one.”
Übersetzt: "Ich kenne keine solche Publikation. Ich habe nach einer solchen Publikation
Ausschau gehalten" [2]
Was bedeutet das?
Kurz gesagt: KEIN EINZIGES KOCH'SCHES POSTULAT WURDE EINGEHALTEN!
Länger ausgedrückt:
Das bedeutet eigentlich, dass man nicht schlussfolgern kann, dass die RNA-Gensequenzen, die
die Wissenschaftler aus den in den erwähnten In-vitro-Versuchen aufbereiteten Gewebeproben
entnahmen und für die, die PCR-Tests schließlich "kalibriert" werden, zu einem bestimmten
Virus - in diesem Fall SARS-CoV-2 - gehören.
Darüber hinaus gibt es keinen wissenschaftlichen Beweis dafür, dass diese RNA-Sequenzen der
Erreger des so genannten COVID19 sind.
Um auf die eine oder andere Weise, d.h. über die Virusisolierung und -reinigung hinaus, einen
Kausalzusammenhang herzustellen, wäre es absolut notwendig gewesen, ein Experiment
durchzuführen, das die vier Koch'schen Postulate erfüllt. Doch ein solches Experiment gibt es
nicht, wie Amory Devereux und Rosemary Frei kürzlich für OffGuardian aufzeigten.
Die Notwendigkeit, diese Postulate bezüglich SARS-CoV-2 zu erfüllen, zeigt sich nicht zuletzt
daran, dass versucht wurde, sie zu erfüllen. Aber selbst Forscher, die behaupteten, dies getan zu
haben, waren in Wirklichkeit nicht erfolgreich.
Quellen:
[1] Martin Enserink. Virology. Old guard urges virologists to go back to basics, Science,
July 6, 2001, p. 24
Zusatz: Science

[2] E-mail from Charles Calisher from May 10, 2020


Diese können bei Torsten Engelbrecht und Konstantin Demeter angefordert werden.

[3] Hauptquelle: COVID19 PCR Tests are Scientifically Meaningless

Die Publikation im Nature "The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice"


erfüllt ebenfalls keine der Koch'schen Postulate
Ein Beispiel dafür ist eine Studie, die am 7. Mai in Nature veröffentlicht wurde. Diese Studie
hat neben anderen Verfahren, die die Studie ungültig machen, keines der Postulate erfüllt.
So wiesen die angeblich "infizierten" Labormäuse keine relevanten klinischen Symptome auf,
die eindeutig auf eine Lungenentzündung zurückzuführen sind, die gemäß dem dritten Postulat
eigentlich auftreten müsste, wenn dort tatsächlich ein gefährliches und potenziell tödliches
Virus am Werk wäre. Und die leichten Borsten und der Gewichtsverlust, die vorübergehend bei
den Tieren beobachtet wurden, sind vernachlässigbar, nicht nur, weil sie durch den Eingriff
selbst verursacht worden sein könnten, sondern auch, weil sich das Gewicht wieder
normalisierte.
Auch ist kein Tier gestorben, außer denen, die sie zur Durchführung der Autopsien getötet
haben. Und vergessen wir nicht: Diese Experimente hätten vor der Entwicklung eines Tests
durchgeführt werden müssen, was nicht der Fall ist.

Keiner der führenden deutschen Vertreter der offiziellen Theorie zu SARS-Cov-2/COVID-19


konnte die Frage beantworten, wie sie sich sicher sein können, ohne ein gereinigtes Virus zu
haben, dass die RNA-Gensequenzen dieser Partikel zu einem bestimmten neuen Virus
gehören?
Torsten Engelbrecht ( preisgekrönter Journalist) und Konstantin Demeter (unabhängiger
Forscher) haben den führenden deutschen Vertreter der offiziellen Theorie zu SARS-
Cov2/COVID19 - das Robert-Koch-Institut (RKI), Alexander S. Kekulé (Universität Halle),
Hartmut Hengel und Ralf Bartenschlager (Deutsche Gesellschaft für Virologie), der bereits
erwähnte Thomas Löscher, Ulrich Dirnagl (Charité Berlin) oder Georg Bornkamm (Virologe
und emeritierter Professor am HelmholtzZentrum München) folgende Frage gestellt:
"Wenn die Partikel, die angeblich SARS-CoV-2 sein sollen, nicht gereinigt wurden, wie wollen
Sie dann sicher sein, dass die RNAGensequenzen dieser Partikel zu einem bestimmten neuen
Virus gehören?
Vor allem, wenn es Studien gibt, die zeigen, dass Substanzen wie Antibiotika, die bei den in
vitro-Experimenten zum Virusnachweis in die Reagenzgläser gegeben werden, die Zellkultur so
"stressen" können, dass neue Gensequenzen gebildet werden, die vorher nicht nachweisbar
waren - ein Aspekt, auf den die Nobelpreisträgerin Barbara McClintock bereits 1983 in ihrer
Nobelvorlesung hingewiesen hat."
Es sollte nicht unerwähnt bleiben, dass wir schließlich die Charité - den Arbeitgeber von
Christian Drosten, Deutschlands einflussreichstem Virologen in Bezug auf COVID-19, Berater
der deutschen Regierung und Mitentwickler des PCR-Tests, der als erster von der WHO
weltweit "akzeptiert" (nicht validiert!) wurde - für die Beantwortung von Fragen zu diesem
Thema gewinnen konnten.
Aber wir haben erst am 18. Juni 2020, nach Monaten der Nichtbeantwortung, Antworten
erhalten. Letztendlich haben wir es nur mit Hilfe der Berliner Anwältin Viviane Fischer
geschafft.

Zu unserer Frage: "Hat sich die Charité davon überzeugt, dass eine entsprechende
Partikelreinigung durchgeführt wurde", räumt die Charité ein, dass sie keine gereinigten Partikel
verwendet hat.
Und obwohl sie behaupten, dass "die Virologen der Charité sicher sind, dass sie auf das Virus
testen", stellen sie in ihrer Arbeit (Corman et al.) fest:
"RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg,
Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden,
Germany)”
Übersetzt:
"RNA wurde aus klinischen Proben mit dem MagNA Pure 96System (Roche, Penzberg,
Deutschland) und aus
Zellkulturüberständen mit dem viralen RNA-Minikit (QIAGEN,
Hilden, Deutschland) extrahiert."
Das heißt, sie nahmen einfach an, die RNA sei viral.
Übrigens durchlief das am 23. Januar 2020 veröffentlichte Papier von Corman et al. nicht
einmal ein ordentliches PeerReviewVerfahren, und die darin beschriebenen Verfahren wurden
auch nicht von Kontrollen begleitet - obwohl wissenschaftliche Arbeit erst durch diese beiden
Dinge wirklich solide wird.
Es ist aber noch viel schlimmer, der Test der Charité wurde vor der ersten Veröffentlichung der
Chinesen erstellt. Es standen also noch keine klinischen Daten zu Verfügung, um überhaupt
einen Test entwickeln zu können. Drosten gibt es sogar zu!
Bitte lesen Sie dafür meine vorab zusammengefasste Chronologische Veröffentlichung
"Der Wissenschaftsbetrug von Prof. Christian Drosten" oder den
Kompletten Artikel im Wissenschaftsplus Magazin von Dr. Stefan Lanka. Lesen Sie auch eine
Eilmeldung im Newsletter von Dr. Stefan Lanka vom 13. Juni, dort werden Sie unter anderem
erfahren, dass Dr. Stefan Lanka, Herrn Prof. Drosten wegen Verbrechen gegen die
Menschlichkeit angezeigt hat!
Dr. Stefan Lanka hat in einer unfassbar guten Analyse aufgezeigt, dass Covid-19 zu keinem
Zeitpunkt nachgewiesen wurde.
Auszug aus dem Wissenschaftsplus Magazin 1. Ausgabe 2020:
Nun folgt ein Auszug aus dem Magazin, welchen Dr. Stefan Lanka (Molekularbiologe und
Virologe) im Zusammenhang der Fehlannahme zum SARS-CoV-2 geschrieben hat. Es lohnt
sich seine komplette Ausgabe zu erwerben!
"Aus den Bestandteilen der gestorbenen Gewebe und Zellen werden einzelne Bestandteile
entnommen, als Bestandteile eines Virus fehlgedeutet und gedanklich zu einem Virusmodell
zusammengefügt. Ein reales und komplettes Virus taucht in der gesamten „wissenschaftlichen“
Literatur nicht auf. Der Konsensfindungsprozess, bei dem die Beteiligten stritten, was zum
Virus gehört und was nicht, dauerte beim Masern-Virus noch Jahrzehnte. Beim angeblich neuen
China-Coronavirus-2019 (2019nCoV, mittlerweile umbenannt) dauerte dieser
Konsensfindungsprozess nur noch ein paar Maus-Klicks. Mit ein paar Mausklicks wurde in
einem Programm, das aus der Molekülabfolge von kurzen Stückchen der Nukleinsäuren der
abgestorbenen Gewebe und Zellen, deren Zusammensetzung biochemisch bestimmt wurde, je
nach Vorgabe die viel längere, nun angeblich vollständige und vermeintliche Erbsubstanz eines
bestimmten alten oder eben eines neuen Virus konstruiert. In Wirklichkeit ergeben nicht einmal
diese Manipulationen, genannt
„Alignement“ (ein Ausrichtungsverfahren),
eine „vollständige“ Erbsubstanz eines Virus, das als dessen Genom bezeichnet wird. Beim
Vorgang der gedanklichen Konstruktion des
„viralen Erbgutstrangs“ werden nicht passende Sequenzen
„geglättet“ und fehlende ergänzt. So wird eine „ErbsubstanzSequenz“ erfunden, die es nicht
gibt, die niemals als Ganzes entdeckt und nachgewiesen wurde. Zusammengefasst: Aus kurzen
Stückchen wird, gedanklich und ausgerichtet an einem Modell eines viralen Erbgutstrangs,
gedanklich ein größeres Stück konstruiert, das es in Wirklichkeit nicht gibt. Zum Beispiel fehlen
bei der nur „geistigen“ Konstruktion des Masern-Virus-Erbstrangs
bei den tatsächlich vorliegenden, kurzen Bruchstücken zelleigener Moleküle weit mehr als die
Hälfte der Molekülabfolgen, die ein ganzes Virus darstellen sollen. Diese werden zum Teil
künstlich biochemisch erzeugt und der Rest einfach frei erfunden."
Wer des Englischen mächtig ist, kann die Tatsache der nur gedanklichen Konstruktion des
„Virus-Erbgutstrangs“ (Complete genome) in dieser Publikation, an der das RKI maßgeblich
beteiligt war, direkt erkennen: „Complete Genome Sequence of a WildType Measles Virus
Isolated during the Spring 2013 Epidemic in Germany“, zu finden unter: RKI
Frau Prof. Mankertz, Ko-Autorin dieser Publikation und Leiterin des Nationalen
Referenzinstitutes für Masern, Mumps und Röteln am Robert Koch-Institut
(RKI), hat auf Nachfragen behauptet, dass für diese Studie die
Kontrollexperimente getätigt wurden, die ausschließen, dass typische zelleigene Bestandteile als
Virusbestandteile fehlgedeutet werden. Sie verweigerte jedoch die Herausgabe der
Dokumentation dieser Kontrollversuche. Im Beschwerdeweg antwortete Frau Prof. Mankertz,
dass ihr doch keine
Kontrollversuche vorliegen und dass ihre Münchner Kollegen diese Kontrollversuche sicherlich
durchgeführt und dokumentiert haben. Dr. Stefan Lanka hat alle Autoren und deren Laborleiter
angeschrieben und nach den Kontrollexperimenten gefragt, die seit dem Jahr 1998 unbedingt
Pflicht sind. Keiner der Angeschriebenen hat geantwortet. Auch die Rektoren der
angeschriebenen Institute haben nicht geantwortet und so ist das Beschwerdeverfahren im
Sande verlaufen
Dr. Stefan Lanka analysierte die ersten beiden maßgebliche Publikation der CCDC zu Covid-19
In der ersten maßgeblichen Publikation der Autoren der CCDC (A Novel Coronavirus from
Patients with Pneumonia in China, 2019) zu den Ergebnissen ihrer Recherche, "Ein neues
Coronavirus con Patienten mit Lungenentzündung in China, 2019" wird über keine Häufung
von Fällen mit atypischer Lungenentzündung ("patient with pneumonia of unknown cause")
berichtet. Sie berichten darüber, dass die vorgefundenen Patienten zu einem "Cluster", zu einer
Gruppe mit gemeinsamen Merkmalen zusammengefasst werden können. Das gemeinsame
Merkmal war der mehr oder weniger häufige Besuch eines Meeresfrüchte-Marktes (seafood
wholesale market) in Wuhan. Wie klein die Gruppe der Patienten mit atypischer
Lungenentzündung tatsächlich war, erkennt man daran, dass die CCDC von nur vier Patienten
Abstriche und Flüssigkeiten des unteren Atemtraktes nahmen, um darin nach bekannten und
unbekannte Erregern zu suchen.
In dieser Studie, die als maßgeblich gilt, heißt es unter Discussion:
"Our study does not fulfill Koch’s postulates"
Übersetzt: "Unsere Studie erfüllt nicht die Koch'schen Postulate"
Damit ist eindeutig belegt, dass diese Studie zu keinem Zeitpunkt ein Nachweis für ein
neuartiges Virus sein kann!
Quelle: Dr. Stefan Lanka - Wissenschafftplus-fehldeutungvirusteil-2
________________________________________
Bei den Untersuchungen der fünf Menschen, die in den beiden für die Corona-Krise
maßgeblichen Publikationen dokumentiert sind [1] [2], wurde nicht nach einer möglichen
Anwesenheit oder Vorgeschichte, Anzeichen, Mechanismen und Wirkungen dieser bekannten
Ursachen der atypischen Lungenentzündungen geforscht. Das machen Virologen meistens
sowieso nicht und war den Mitgliedern der CCDC auch aus den gegebenen Umständen der
Panik nicht möglich. Das Ausschließen der Erwähnung atypischer Lungenentzündungen
beweist einen schweren ärztlichen Kunstfehler und verhindert korrektes behandeln der
Patienten. Die Betroffenen laufen daher Gefahr, mit einem nebenwirkungsreichen Cocktail aus
antibiotischen Substanzen fehlbehandelt zu werden, der vor allem bei Überdosierung in der
Lage ist, eigenständig den Tod von Patienten herbeizuführen. So geschehen und im Lancet
dokumentiert.
Die Virologen der CCDC sagen in beiden Publikationen aus, dass es über diese Sequenz-
Vorschläge noch keine Beweise gibt, dass sie tatsächlich Krankheiten auslösen können. Am
10.01 und 12.01.2020 waren die chinesischen Sequenzvorschläge noch vorläufig und waren
noch nicht dem strengen Prozess der wissenschaftlich vorgeschriebenen Überprüfung
unterzogen wurden.
[1] A Novel Coronavirus from Patients with Pneumonia in China, 2019
[2] A new coronavirus associated with human respiratory disease in China
Weitere Quelle: Dr. Stefan Lanka -
Wissenschafftplusfehldeutungvirus-teil-2

Weitere Autoren waren so ehrlich, zuzugeben, dass sie nicht die Koch'schen Postulate
eingehalten haben
In der Publikation vom 24.01.2020 Huang C et al. Clinical features of patients infected with
2019 novel coronavirus in Wuhan, China. Lancet. geben die Autoren ganz offen zu:
“we did not perform tests for detecting infectious virus in blood”
Übersetzt: "Wir haben keine Tests zum Nachweis eines infektiösen
Virus im Blut durchgeführt" (Damit sind auch hier keineswegs die Koch'schen Postulate erfüllt)
Für eine umfangreiche Analyse zu den Publikationen und weiteren Studien zu Coivid-19
empfehle ich dringend die gigantische Zusammenfassung von
David Crowe - Flaws in Coronavirus Pandemic Theory.
Diese Arbeit wird stetig durch die neuesten Erkenntnisse geupdatet. Sie bietet eine der
umfassendsten Analysen, die es bisher gibt.
________________________________________
Matthew B. Frieman, Phd außerordentlicher Professor für Mikrobiologie und Immunologie,
sowie Virologe an der School of Medicine der University of Maryland, war skeptisch! er sagte:
“I am stunned by the timeline and speed of this isolation and characterization, if it’s all true,”
Übersetzt "Ich bin verblüfft über den zeitlichen Ablauf und das Tempo dieser Isolation und
Charakterisierung, wenn das alles wahr ist"

Dr. Andrew Kaufman analysierte ebenfalls die Studien zu SARS


Andrew Kaufman MD Referenzen:
-Bachelors of Science in Biology MIT
-Doktor der Medizin, Medizinische Universität von South Carolina
-Psychiatrie-Residenz, Duke University
-Ehemaliger medizinischer Dozent für Hämatologie und Onkologie, Medizinische Universität
South Carolina
-Ehemaliger Assistenzprofessor für Psychiatrie, SUNY Upstate Medical University
-Lizenziert und vom Vorstand zertifiziert in Psychiatrie und forensischer Psychiatrie
Kaufman beschäftigte sich nicht nur mit den Publikationen des neuen Coronavirus SARS-CoV-
2, sondern auch mit seinem Vorgänger aus 2003 (SARS-CoV-1).
Er erkannte, dass nicht nur SARS-CoV-2 nicht wissenschaftlich nachgewiesen ist, sondern
bemerkte, dass die gleichen Fehler ebenfalls beim behaupteten Virus SARS-CoV-1 gemacht
wurden sind. Um es vorwegzunehmen:
Für alle Publikationen gilt:
--> Die Koch'schen Postulate wurden nicht eingehalten!
--> Die Postulate nach Rivers wurden nicht eingehalten (modifizierte Postulate)
Ergo: kein einziger wissenschaftlicher Nachweis für ein pathogenes Virus.
Wer sich lieber ein Video anschauen möchte, um alle Details zu bekommen (ich werde nur
einige Informationen schriftlich auflisten) sollte dies in einem der beiden folgenden Videos tun.
Das Video von Andrew Kaufmann (Deutsch) | (Englisch) Backups sind erhältlich.
SARS 2003
In der Veröffentlichung im NATURE - Koch's postulates fulfilled for SARS virus suggeriert die
Überschrift, wie so oft, dass die Koch'schen Postulate erfüllt wurden.
Dort werden 5 maßgebliche Studien angegeben.
Allerdings heißt es unter MAIN "According to Koch's postulates, as modified by Rivers for
viral diseases, six criteria are required to establish a virus as the cause of a disease"
Übersetzt: "Nach den Koch'schen Postulaten, die von Rivers für Viruserkrankungen modifiziert
wurden, sind sechs Kriterien erforderlich, um ein Virus als Ursache einer Krankheit zu
etablieren"
Hier wird also klar, es handelt sich nicht um die Koch'schen Postulate, sondern um modifizierte
Postulate.
In dem Video von Dr. Andrew Kaufmann werden die Koch'schen Postulate mit denen von
RIVERS gegenübergestellt, damit können Sie die Unterschiede nachvollziehen.
Rivers Postualte bestehen nicht aus 4 (Koch'schen Postulate), sondern aus 6.

1. Rivers, T. M. J. Bacteriol. 33, 1–12 (1937).

• Genetisches Material (DNA, RNA) wird in keinem Kriterium erwähnt


Englisch
•...now it is possible to bring excellent evidence that an organism is the cause of a malady
without the complete satisfaction of the [Kochs] postulates. (Seite 3)
•...particularly those [diseases] caused by viruses, the blind adherence to Koch's postulates may
act as a hindrance instead of an aid. (Seite 4)
•...It is obvious that Koch's postulates have not been satisfied in viral diseases. (Seite 6)
•...In the first place, it is not obligatory to demonstrate the presence of a virus in every case of
the disease produced by it. (Seite 6)
•...Viruses, regardless of whether they are parasites or the fabrications of autocatalytic
processes, are intimately associated with host cells (Seite 6)
•..."by means of inoculation of material...
obtained from patients with the natural disease" (seite 11)
•...If the inoculated animals become sick or die in a characteristic manner, and, if the disease in
them can be transmitted from animal to animal by means of inoculations with blood or
emulsions of involved tissues free from ordinary microbes or rickettsiae, one is fairly confident
that the malady in the experimental animals is induced by a virus (Seite 7)

Deutsch
•...Nun ist es möglich hervorragende Beweise dafür zu erbringen, dass ein Organismus die
Ursache einer Krankheit ist, ohne die Postulate [Kochs] vollständig zu erfüllen. (Seite 3)
•...Insbesondere bei den durch Viren verursachten [Krankheiten] kann das blinde Festhalten an
Kochs Postulaten eher hinderlich als hilfreich sein. (Seite 4)
•...Es ist offensichtlich, dass die Postulate Kochs bei den Viruserkrankungen nicht erfüllt
wurden. (Seite 6)
•...Erstens ist es nicht obligatorisch, das Vorhandensein eines Virus in jedem Fall, der von ihm
verursachten Krankheit nachzuweisen. (Seite 6)
•...Viren, ob es sich jetzt um Parasiten oder autokatalytischen
Prozesse handelt, sind eng mit den Wirtszellen verbunden. (Seite 6)
•...Viren, ob es sich jetzt um Parasiten oder autokatalytischen
Prozessen handelt, sind eng mit den Wirtszellen verbunden. (Seite 6)
•... Durch Impfung von Material, das von Patienten mit der natürlichen Krankheit gewonnen
wurde. (Seite 11) (Also nicht etwa, dass in einem Labor oder aus einem Labor hergestellt
wurde, sondern von einem anderen Patienten mit der natürlichen Krankheit, dies zu verstehen
ist sehr wichtig)
•...Wenn die geimpften Tiere krank werden oder in einer charakteristischen Art und Weise, und,
wenn die Krankheit in ihnen von Tier zu Tier durch Impfungen mit Blut oder Emulsionen von
beteiligten Geweben, die frei von gewöhnlichen Mikroben sind oder Rickettsien, ist man
ziemlich sicher, dass die Erkrankung bei den Versuchstieren durch ein Virus ausgelöst wird.
(Seite 7)
________________________________________
Er sagt also zusammengefasst, wenn man seine Kriterien anwendet und alle einhält, ist es nicht
gewiss, aber man kann ziemlich zuversichtlich sein, dass ein Virus diese Krankheit verursacht
hat. Mit anderen Worten, selbst wenn alle 6 Kriterien angewendet wurden, führt dies nur dazu,
dass sie ziemlich zuversichtlich sind, nicht schlüssig, nicht sicher, nicht 100%ig, nur ziemlich
zuversichtlich.
In dem Nature Artikel wird behauptet, dass die ersten 3 Kriterien (Rivers), für die nachfolgenden
Publikationen erfüllt wurden.
The first three criteria — isolation of virus from diseased hosts, cultivation in host cells, and
proof of filterability — have been met for SCV by several groups2,3,4,5.
Übersetzt:
Die ersten drei Kriterien - Isolierung des Virus von erkrankten Wirten, Kultivierung in
Wirtszellen und Nachweis der Filtrierbarkeit - wurden für SCV von mehreren Gruppen
erfüllt2,3,4,5.
Nun werde ich kurz Zusammenfassen, was Dr. Kaufman analysiert hat, bitte denken Sie daran,
dass dies nur kurze Informationen sind und Sie das Video (siehe oben) wirklich sehen sollten.
Vorab möchte ich sagen, dass keine der folgenden Studien (auch die von Prof. Drosten nicht)
auch nur eines der Postulate Rivers einhält.
________________________________________
2. Poutanen, S. M. et al. N. Engl. J. Med. (in the press).

• Keine positive Isolation eines Virus (es wurde tatsächlich versucht zu isolieren,
allerdings war diese negativ).

• Sie haben nicht in Wirtszellen kultiviert (sie nahmen Verozellen von Affen) Diese
erzeugen in Verbindung mit Antibiotika (Exosome = Körpereigene RNA!).
•Bewies keine Filtrierbarkeit. Sie verwendeten stattdessen verschiedene Screening-Tests auf das
Vorhandensein von Bakterien und anderen Viren.
________________________________________
3. Drosten, C. et al. N. Engl. J. Med. (in the press).

• Keine Isolation eines Virus, interessanterweise fanden Sie Partikel, die wie ein anderes Virus
aussah (paramyxovirus), in einer Probe, aber nicht in anderen Proben.

• Sie haben nicht in Wirtszellen kultiviert (sie nahmen Verozellen von Affen).

• Keine Filtrierbarkeit nachgewiesen.

Also auch die Arbeit von Prof. Christian Drosten hält nicht mal die modifizierten leichteren
Postulate von Rivers ein.
________________________________________
4. Ksiazek, T. G. et al. N. Engl. J. Med. (in the press).

• Keine Isolation eines Virus (wieder nur, wie bei Drostens Arbeit, nur gewonnenes
genetisches Material).

• Sie haben nicht in Wirtszellen kultiviert (sie nahmen unterschiedliche Zellen von Vero
E6, NCIH292, MDCK, LLC-MK2 und B95-8 cells).

• Bewies keine Filtrierbarkeit. Sie verwendeten stattdessen verschiedene Screening-Tests


auf das Vorhandensein von Bakterien und anderen Viren.
________________________________________
5. Peiris, J. S. M. et al. Lancet 361, 1319–1325 (2003).

• Keine Isolation eines Virus (wieder wurde wie bei Drostens Arbeit, nur gewonnenes
genetisches Material verwendet)

• Sie haben nicht in Wirtszellen kultiviert (sie nahmen fetale Resusaffen-Zellen)


• Bewies keine Filtrierbarkeit, Sie verwendeten stattdessen verschiedene Screening-Tests
auf das Vorhandensein von Bakterien und anderen Viren
________________________________________
Zusammengefasst (SARS 2003):
In keiner dieser Studien wurden auch nur die ersten 3 Kriterien eingehalten und können somit
nicht als Nachweis eines pathogenen Virus behauptet werden.

SARS-CoV-2 (2019)
Nehmen wir also die Rivers Kriterien für Covid-19 und überprüfen, ob diese in den
Veröffentlichungen eingehalten wurden.
Vorab: keine der folgenden Studien
1. Erfüllte die ersten 3 Kriterien.

2. versuchte das 4. und 5. Kriterium einzuhalten


Dadurch, dass nicht mal versucht wurde, das 4. und 5. Kriterium einzuhalten, kann man alleine
daraus den Schluss ziehen, dass man nicht sagen kann, dass es sich hierbei um einen neuen
Erreger handeln könnte.
Vorab: keine der folgenden Studien

1. erfüllte die ersten 3 Kriterien.

2. versuchte überhaupt das 4. und 5. Kriterien anzugehen Dadurch, dass nicht mal versucht
wurde, das 4. und 5. Kriterium einzuhalten, kann man alleine daraus den Schluss ziehen,
dass man nicht sagen kann, dass irgendwas eine Ursache sein könnte
________________________________________
1. Peng Zhou - Discovery of a novel coronavirus associated with the recent pneumonia outbreak
in humans and its potential bat origin

• Keine Isolation eines Virus (nur gewonnenes genetisches


Material).

• Sie haben nicht in Wirtszellen kultiviert (sie nahmen Verozellen und Huh7 Zellen, sie taten
dies nur bei 1/7 Patienten).

• Bewies keine Filtrierbarkeit


Sie gaben in Ihrer Studie zu, dass diese Studie keine Aussage für einen Beweis liefern kann,
sondern, dass viele weitere klinische Studien nötig sind, um eine Aussage treffen zu können.
Sie gingen durch einen PCR-Sequenztest davon aus, dass das gefundene dem Coronavirus 2003
ähnelt, da der Test eine Übereinstimmung von 80 % ergeben hat. Die DNA eines Menschen ist
zu 96% identisch mit der eines Schimpansen ....
________________________________________
2. Na Zhu - A Novel Coronavirus from Patients with Pneumonia in China, 2019 (2020 Feb
20;382(8):727-733)
• Keine Isolation eines Virus (nur gewonnenes genetisches
Material).

• Sie haben nicht in Wirtszellen kultiviert (sie nahmen


Lungenkrebszellen).
• Bewies keine Filtrierbarkeit (sie verwendeten Zentrifugation).
Sie geben in Ihrer Publikation unter Diskussion zu:
"Our study does not fulfill Koch’s
"unsere Studie erfüllt nicht die Postulate von Koch"
________________________________________
3. Jeong-Min Kim - Identification of Coronavirus Isolated from a Patient in Korea with COVID-
19 () 2020 Feb; 11(1): 3–7
• Keine Isolation eines Virus (nur gewonnenes genetisches
Material).
• Sie haben nicht in Wirtszellen kultiviert (sie nahmen Verozellen und verwendeten ebenfalls
Antibiotika)

• bewies keine Filtrierbarkeit


________________________________________
4. McMaster University Canada
Zu dieser Studie sind nur sehr wenig Informationen vorhanden. Da nur ein Bruchteil
veröffentlicht wurde.

• Keine Isolation eines Virus (nur gewonnenes genetisches


Material).
• Sie haben nicht in Wirtszellen kultiviert (sie nahmen eine andere Art von
Säugetierzellen).
________________________________________
Zusammengefasst:
Dr. Andrew Kaufmann kommt zu demselben Ergebnis wie auch alle anderen, dass es keinen
wissenschaftlichen Nachweis für ein pathogenes Virus gibt. (SARS-CoV-1 und 2)
Trotz der Behauptung im (NATURE) die Öchschen Postulate zu erfüllen, wurde in keiner der
Publikationen zum SARS-CoV-1/2, wurden die Koch'schen, noch die Rivers Postulate erfüllt
(0/6 Kriterien), lediglich eines der Kriterien für 2019 wurde erfüllt. Das 6. Kriterium, das
Unwichtigste aller Kriterien.
Gerüchte und Lügen haben eine Pandemie erzeugt, obwohl keine Beweise vorlagen!
Bis dahin sollten wir aber natürlich möglichst aktiv sein und alles tun, um unsere natürliche
Abwehr zu stärken. Zu Hause sitzen gehört leider nicht dazu.
Kapitel Nr. 3 - von David Claudi Siber

FDA-Dokument gibt zu, dass der PCR-Test "Covid" ohne isolierte Proben für die
Testkalibrierung entwickelt wurde, und gibt damit zu, dass er etwas anderes testet.

In einem soeben von der US-amerikanischen Lebens- und Arzneimittelbehörde (FDA)


veröffentlichten Dokument wird offen zugegeben, dass der berüchtigte PCR-Test für das
Wuhan Coronavirus (Covid-19) nicht mit echten Proben entwickelt wurde, sondern mit
genetischem Material, das von einem Erkältungsvirus zu stammen scheint.
In dem FDA-Dokument wird eindeutig festgestellt, dass gewöhnliches genetisches Material der
saisonalen Grippe als Testmarker in den PCR-Testkits verwendet wurde, was erklärt, warum die
Influenza "plötzlich" verschwunden ist und warum die Behörden angeordnet haben, nur noch
auf Covid-19 und nicht mehr auf Influenza oder andere Grippeerreger zu testen in Kliniken.
Erkennen wir endlich den offensichtlichen Betrug. Es gibt keinen seriösen Test, der das
Vorhandensein von SARS-CoV-2 genau feststellt.

Die FDA stellt im wahrsten Sinne des Wortes erst Daten her, um ein falsches Narrativ zu
stützen.
Wir befinden uns jetzt weltweit an einem Scheideweg. Es ist an der Zeit zu entscheiden, ob wir
zulassen, dass diese Art von medizinischem Missbrauch zulassen, oder ob wir endlich NEIN zu
einer unaufrichtigen Regierungspolitik sagen werden.
Kapitel Nr. 4 – Zweifel am PCR-Test

FDA-Dokument gibt zu, dass der PCR-Test "Covid" ohne isolierte Proben für die
Testkalibrierung entwickelt wurde, und gibt damit zu, dass er etwas anderes testet.
In einem soeben von der US-amerikanischen Lebens- und Arzneimittelbehörde (FDA)
veröffentlichten Dokument wird offen zugegeben, dass der berüchtigte PCR-Test für das
WuhanCoronavirus (Covid-19) nicht mit echten Proben entwickelt wurde, sondern mit
genetischem Material, das von einem Erkältungsvirus zu stammen scheint.
In dem FDA-Dokument wird eindeutig festgestellt, dass gewöhnliches genetisches Material der
saisonalen Grippe als Testmarker in den PCR-Testkits verwendet wurde, weil die Behörden
wussten, dass viele Menschen darauf "positiv" testen würden, so dass sie diese Ergebnisse
nutzen konnten, um die "Covid"-Behauptung aufzustellen.
Die Lektüre ist etwas langwierig, aber sehen Sie selbst und erkennen Sie den offensichtlichen
Betrug. Es gibt keinen seriösen Test, der das Vorhandensein von SARS-CoV-2 genau feststellt.
Aus dem Dokument:
"Da zum Zeitpunkt der Entwicklung des Tests und der
Durchführung dieser Studie keine quantifizierten Virusisolate des 2019-nCoV für die CDC zur
Verfügung standen, wurden Tests zum Nachweis der 2019-nCoV-RNA mit charakterisierten
Beständen von in vitro transkribierter Volllängen-RNA (N-Gen; GenBankZugang:
MN908947.2) mit bekanntem Titer (RNAKopien/µL) getestet, die in ein Verdünnungsmittel
bestehend aus einer Suspension menschlicher A549-Zellen und einem viralen Transportmedium
(VTM) gegeben wurden, um eine klinische Probe nachzuahmen."
Eine weitere Enthüllung in dem Dokument ist das Eingeständnis der FDA, dass Testergebnisse
"gepoolt" werden, um ungenaue Zahlen zu erhalten.
Die FDA stellt im wahrsten Sinne des Wortes Daten her, um ein falsches Narrativ zu stützen.
Wir befinden uns jetzt weltweit an einem Scheideweg. Es ist an der Zeit zu entscheiden, ob wir
zulassen, dass diese Art von medizinischem Faschismus fortbesteht und sich auf die Zukunft
unserer Kinder auswirkt. Oder ob wir endlich Nein zu einer tyrannischen Regierungspolitik
sagen werden.
Sie können das Dokument HIER herunterladen:
https://www.fda.gov/media/134922/download www.fda.gov (http://www.fda.gov/)
fda.gov
(http://fda.gov/) www.fda.gov (http://www.fda.gov/) fda.gov
(http://fda.gov/)
Kapitel Nr. 5 - von James Corbett

In den nächsten Monaten steht eine vierte Welle von Covid-19 bevor. Darüber brauchen wir
nicht zu spekulieren. Wir haben dies in den letzten Monaten nicht nur von allen möglichen
Politikern und Gesundheits-“Behörden” gehört, sondern es war auch ein integraler Bestandteil
des inzwischen berüchtigten Artikels “We’re not going back to normal” der MIT Technology
Review, der enthüllte, wie die Wellen des Einsperrens und Freilassens unser Leben
umstrukturieren und uns in die Corona-Weltordnung konditionieren werden. Und um keinen
Zweifel daran aufkommen zu lassen, dass dies ein wichtiger Teil der Pandemie-Erzählung ist,
hat Bill Gates dies gerade in seinen jüngsten “GatesNotes” über “Die erste moderne Pandemie”
bekräftigt.

Tatsächlich haben die Pandemieplaner die Öffentlichkeit schon so oft vor einer zweiten und
dritten und vierten und fünften Welle dieser Krise gewarnt, dass wir praktisch garantieren
können, dass es zu einer solchen “nächsten Welle” kommen wird. Nun könnte eine solche
zweite Krankheitswelle tatsächlich eintreten, und sei es nur, weil – wie Dr. Dan Erickson in
seinem jüngsten Covid19Briefing anmerkt – Menschen, die aus ihrer Isolation aus dem
Lockdown herauskommen, ihr Immunsystem geschwächt haben und damit anfälliger für
Krankheitserreger aller Art sind. Aber diese gefürchtete “nächsten Welle” muss in der Realität
gar nicht erst stattfinden; auf die statistischen Schikanen der Betrüger ist immer Verlass, um in
den Köpfen der Öffentlichkeit den Eindruck einer neuen Runde von Infektionen zu erwecken.
Verdammt, wenn die japanische Regierung noch am selben Tag, an dem sie die Verschiebung
der Olympischen Spiele 2020 ankündigte (genau wie ich vorausgesagt habe), auf magische
Weise eine “Welle” von SARS-CoV-2-Infektionen herbeizaubern kann, dann glauben Sie
besser daran, dass Regierungen auf der ganzen Welt die Erzählung jeder weiteren Welle
erfüllen können, unabhängig davon, wie viele Menschen krank sind oder nicht.
Hier liegt der Hund begraben: Was auch immer passiert, die Pandemie-Propagandisten werden
die Schuld an dieser vierten Welle jenen bösen, niederträchtigen Demonstranten zuschieben, die
sich darüber beschwerten, unter Hausarrest gestellt worden zu sein. Sie wissen schon, diese
schrecklichen, herzlosen Großmuttermörder, die es gewagt haben, sich den Befehlen zur
Schließung des Geschäfts, das sie ihr ganzes Leben lang aufgebaut haben, zu widersetzen, und
diese verabscheuungswürdigen, ekelerregenden Krankheitsverbreiter, die sich weigerten, ihre
plötzliche Zwangsarbeitslosigkeit kleinlaut hinzunehmen.
Sie können die Umrisse dieser Erzählung bereits in der Art der
Berichterstattung über die wachsende Lockdown-
Protestbewegung erkennen. Es sind diese dummen, ignoranten Bauerntölpel, die da draußen
gegen “offene Scheuklappen” protestieren, die das Leben dieser tapferen medizinischen Helden
aufs Spiel setzen, indem sie es wagen, von ihrem Recht Gebrauch
zu machen, sich friedlich zu versammeln und eine Wiedergutmachung ihrer Beschwerden zu
fordern!
Wenn die Dinge also schließlich (auch nur ein wenig) geöffnet werden, sollten Sie besser
glauben, dass auch die “nächste Welle”
mit voller Wucht zuschlagen wird … zumindest in den Medien. Und jeder einzelne Tod in der
täglichen Todesbilanz wird den Menschen angelastet werden, die sich über ihre Hausarrest und
Zwangsarbeitslosigkeit beklagt haben.
Ich verlasse Sie mit dieser erschreckenden Beobachtung: Erinnern
Sie sich an die letzten “GatesNotes”, die ich bereits in Vorhersage Nr. 1 erwähnt habe? Sie
wissen schon: “Die erste moderne Pandemie”? Nun, so spricht Bill “Pandemieplaner” Gates in
seiner Schlussfolgerung über diese aktuelle Krise:
Melinda und ich sind mit der Erkenntnis aufgewachsen, dass der Zweite Weltkrieg der
entscheidende Moment der Generation unserer Eltern war. In ähnlicher Weise wird die
COVID-19Pandemie – die erste moderne Pandemie – diese Ära definieren. Niemand, der die
Pandemie I durchlebt, wird sie je vergessen. Und man kann den Schmerz, den die Menschen
jetzt empfinden und noch jahrelang empfinden werden, gar nicht hoch genug einschätzen. Ja,
nicht nur vergleicht er diesen “Kampf” gegen den “unsichtbaren Feind” mit dem Zweiten
Weltkrieg – wie es heutzutage jeder Politiker und Experte zu tun scheint -, sondern er geht
sogar so weit, dies Pandemie 1 zu nennen. Wie im ersten Teil. Die offensichtliche Implikation
hier ist, dass auf den Ersten Weltkrieg der Zweite Weltkrieg folgte, so wie auf Pandemie I
auch Pandemie II folgen wird.
Da fragt man sich doch, was er noch alles im Ärmel hat, nicht wahr?
(henrymakow.com)
Kapitel Nr. 6 – 26 Fragen zum Pandemiegeschehen

1. Warum hören wir nicht Tag und Nacht konstant die Sirenen der Rettungsfahrzeuge?

2. Warum sind die Bestattungsinstitute nicht höher ausgelastet wir in den vorherigen
Jahren?

3. Warum sehen wir nicht endlose Reihen von Menschen auf den Friedhöfen, die ihre
Lieben zu Grabe tragen?

4. Warum sagt die Statistik, dass die Sterblichkeit im Jahre 2020 nicht zugenommen hat?

5. Wohin sind die Influenza-Toten verschwunden?

6. Wenn der erste Lockdown wirkte, warum wiederholen wir ihn dann?

7. Wenn die Lockdowns nicht wirken, warum wiederholen wir sie dann?

8. Warum hört die Regierung nur auf die sehr kleine Auswahl der immer gleichen Experten
und hört nicht auf die anerkannten Stimmen der Experten der Wissenschaft?

9. Warum sehen wir im Fernseher überfüllte Intensivstationen, wenn sie in der Realität nicht
überfüllt sind?

10. Warum haben ausgebildete Krankenschwestern keine Arbeit und warum schließen
Kliniken wegen Unterbelastung?
11. Warum haben Regierungen auf der ganzen Welt den PCR-Test schon 2018 bestellt?

12. Wenn Masken kontaminiert mit dem hochansteckenden Virus sind, warum sehen wir
sie dann an jeder Straßenecke liegen?

13. Warum haben wir unterschiedliche Abstandsregeln von Land zu Land?

14. Wenn der Virus nicht von Kindern übertragen wird, warum sind die Schulen
geschlossen?

15. Wenn Masken wirken, warum haben wir sie nicht schon seit Jahren im Einsatz gegen
die Grippe?

16. Warum sehen wir Menschen nicht auf der Straße sterben?

17. Warum sind große Lebensmittelmärkte auf, in denen hunderte von Menschen
gleichzeitig einkaufen gehen, während die kleinen Läden in der Innenstadt, die nur zwei-
drei Leute fassen können, zu sind?

18. Warum werden mit dem PCR-Test positiv Getestete


"CoronaFälle" genannt und nicht einfach nur positiv Getestete.

19. Warum vergisst man die Leute darüber zu informieren, dass die WHO eingestanden
hat, dass der PCR-Test nicht zuverlässig ist?

20. Wenn ein Nieser bis zu zwei Meter gehen kann, warum halten wir anderthalb Meter
Abstand?

21. Warum ist es okay, seine Hände zehnmal am Tag zu desinfizieren, wenn das die Haut
maßgeblich schädigt.

22. Warum brauchen wir einen experimentellen Impfstoff für ein Virus mit einer
Überlebensrate von 99,9 %?
23. Wenn der Impfstoff wirkt, warum kannst Du das Virus immer noch übertragen?

24. Wenn Du geimpft bist, warum musst Du weiterhin eine Maske tragen und Abstand
halten?

25. Wie viele Menschen kennst Du persönlich, die an Corona gestorben sind?

26. Wie viele Menschen kennst Du persönlich, die an Impffolgen erkrankt oder gar
gestorben sind?
Kapitel Nr. 7 – Maskenhysterie greift um sich

Dummheit ist schwer zu ertragen:

Neulich in der Innenstadt…….


Passant schreit: MASKE!!!
Ich: Wie Maske? Ich hab doch gar keine Maske auf?
Passant: Darum geht es ja! Maske!
Ich: Warum soll ich eine Maske aufsetzen? Und warum tragen Sie überhaupt eine Maske?
Passant: Um Sie zu schützen!
Ich: Das ist ja nett von Ihnen. Und das, obwohl Sie mich nicht mal kennen. Vielen Dank!
Passant: Nein, nicht Sie persönlich. Sondern alle.
Ich: Sie wollen alle Menschen schützen? Da haben Sie sich ganz schön was vorgenommen.
Vor was möchten Sie schützen, wenn ich fragen darf?
Passant: Vor was? Blöde Frage! Vor Corona natürlich!
Ich: Sie haben Corona? Warum sind Sie dann nicht zu Hause im Bett?
Passant: Nein, ich habe natürlich kein Corona! Mein letzter Test ist gerade mal 4 Stunden her
und ich habe definitiv kein Corona!
Ich: Wozu dann die Maske?
Passant: Um Sie zu schützen.
Ich: Ich dachte, Sie haben kein Corona? Haben Sie nicht eben gesagt….
Passant: Ich könnte ja jederzeit Corona bekommen!
Ich: Warum setzen Sie nicht dann erst die Maske auf, wenn Sie es haben?
Passant: Dumme Frage. Da es jederzeit so sein kann, muss man ja auch jederzeit darauf
vorbereitet sein.
Ich: Aha, ich verstehe
Passant: Setzen Sie jetzt Ihre Maske auf?
Ich: Warum sollte ich? Habe ja kein Corona und noch dazu Ihren Schutz davor. Denke, ich bin
auf der sicheren Seite bei so viel Vorsorge.
Passant: SIE SIND ASOZIAL!
Ich: Warum das denn jetzt?
Passant: Weil Sie keine Maske aufsetzen!
Ich: Aber ich bin doch gar nicht krank……
Passant: Darum geht es gar nicht! Alle setzen die Maske auf. Das ist eine Frage der
Solidarität!
Ich: Nicht eine Frage von Corona?
Passant: Nein! Um Corona geht es nur nachgelagert. Zuerst braucht man die Solidarität für
alle!
Ich: Gibt es denn keinen Impfstoff gegen dieses Corona? Damit könnten wir uns doch die
Diskussion rund um die Maske sparen.
Passant: Es gibt doch eine Impfung!
Ich: Na wunderbar! Lassen Sie sich impfen, dann können Sie dieses alberne Ding ja absetzen
Passant: Ich bin geimpft.
Ich: Und tragen trotzdem noch die Maske? Passant:

Die Impfung schützt ja nicht vor Corona Ich: Nicht? Wovor


schützt sie dann?

Passant: das weiß ich auch nicht so genau. Das wird noch erforscht. Wichtig ist aber, dass alle
geimpft werden.
Ich: Aber - wenn die Impfung nicht vor Corona schützt, wieso ist es dann so wichtig, die Leute
zu impfen?
Passant: Damit die alten Leute in Sicherheit sind!
Ich: Aber haben Sie nicht eben gesagt, die Impfung schützt nicht vor Corona?
Passant: Ja, aber es wird angenommen, dass man dann keine anderen mehr ansteckt
Ich: „Wird angenommen?“
Passant: Ja, genau weiß man es noch nicht...
Ich: Warum wartet man dann nicht so lange, bis man es weiß?
Passant: Das weiß ich auch nicht, aber das muss schon so sein, sagt die Regierung und das
RKI!
Ich: Und deswegen müssen jetzt alle Masken tragen, weil man nicht weiß, ob die Impfung
irgendjemanden schützt?
Passant: Ja!
Ich: Hmmmmm….
Passant: Ziehen Sie jetzt eine Maske auf?
Ich: Denke eher nicht. Das ist mir alles zu esoterisch...
Passant: DANN WERDE Ich SIE ANZEIGEN UND DER POLIZEI MELDEN!!!
Ich: Das finde ich jetzt aber sehr unhöflich von Ihnen...
Passant: Es bleibt mir nichts anders übrig, weil Sie die Menschen gefährden!
Ich: Aber ich habe doch gar kein….
Passant: Papperlapapp! Entweder Sie setzen jetzt die Maske auf, oder ich rufe laut um Hilfe.

Ich: Um Hilfe? Sie benötigen Hilfe, weil ich keine Maske aufhabe? Passant: Ja, schließlich
geht es um mein Leben!
Ich: Ich dachte, Sie sind geimpft? Wieso gefährde ich dann Ihr Leben?
Passant: Die Impfung ist nicht sicher. Das sagte ich bereits.
Ich: Verstehe…. also ich muss mir eine Maske aufsetzen, damit Sie sich sicherer fühlen?
Passant: Ja!
Ich: verstehe...
Passant: Und? Was ist jetzt?
Ich: Es ist Sonntag, viertel vor drei
Passant: Nein, Sie wissen schon, was ich meine...
Ich: Was meinen Sie denn?
Passant: OB SIE JETZT DIE MASKE AUFSETZEN!!!!!
Ich: Denke eher nicht.
Passant: DANN SIND SIE ASOZIAL UND MÜSSEN DAFÜR BÜSSEN!!!
Ich: Ok...
Passant: Ich meine das ernst!
Ich: Ok...
Passant: Gleich rufe ich die Polizei. Das ist mein voller ernst!
Ich: Ok...
Passant: Ich zähle bis 10...
Ich: Eins…
Passant: Machen Sie sich über mich lustig???
Ich: Wenn Sie schon so fragen……ja.
Passant: Das werden Sie noch bereuen.
Ich: Ok...
Passant: Sie glauben mir nicht, oder?
Ich: Ungefähr in dem Umfang, wie ich den ganzen anderen Käse glaube, den Sie da erzählen!
Passant: Wegen Corona?
Ich: Auch das...
Passant: Dass Masken schützen?
Ich: Naja, vielleicht vor Mundgeruch, aber sonst...
Passant: Mir reicht es jetzt...
Ich: Ok...
Passant: Setzen Sie jetzt Ihre Maske auf?
Ich: Nö, eher nicht.
Also das war jetzt ein sehr interessantes Gespräch, aber ich muss jetzt weiter. Dort kommen
ein paar Leute ohne Maske und da können Sie gerne weitermachen.
Kapitel Nr. 8 - Dr. med. Wolfgang Wodarg

Krieg gegen einen Joker


Die Pharmaindustrie und ihre Virologen versuchen derzeit, den Erreger SARS-CoV-2 als
stabilen Feind zu definieren. Für den "Krieg gegen das Virus" braucht man die Gefahr in Form
einer Stachelkugel. Eine "coronafreie Welt" ist das erklärte Ziel von Bill Gates und seinen
politischen Freunden. Auch im Hinblick auf eine mögliche Impfung wird versucht, der
Öffentlichkeit die Illusion eines klar definierbaren Gegners in der Welt der Viren einzureden.
Aus wissenschaftlicher Sicht handelt es sich bei all diesen Bemühungen – schonend
ausgedrückt – um gefährliche Irrwege.

Es ist völlig sicher, dass sich auch das SARS-Virus laufend und in großer Geschwindigkeit
ändert. Und was nützt eine Impfung gegen etwas, das sich längst unkalkulierbar geändert hat?
Auch unser Immunsystem reagiert unvorhersehbar. Kreuzimmunitäten? Immungedächtnis?
Die Spezifität und Aussagekraft von Tests ist schnell vergänglich, ebenso die Wirkung eines
Impfstoffes. Deshalb sind Immunitätsnachweise eine Farce und wenn sie Gesetz werden
sollten, eine gesundheitlich nicht begründbare Schikane.
Aus dem gleichen Grund sind Massenimpfungen gegen respiratorische Viren ein riskanter
Nonsens und gegebenenfalls Körperverletzung. Bei sich rasch wandelnden Erregern ist – wie
bei der Influenza-Impfung – der Impferfolg Glückssache. Erst hinterher kann festgestellt
werden, ob die Geimpften besser dran waren als die Nichtgeimpften. Das bleibt ein gutes
Geschäft, da eine evidenzbasierte vorherige Nutzenprüfung natürlich nie möglich sein wird.
Bisher war es außerdem so, dass sich andere Viren ausbreiten, wenn einer Virusart durch
Impfung das Leben schwerer gemacht wurde.
Die Wuhan-Viren sind längst Schnee von gestern
Entscheidend ist die extrem hohe Mutationsrate von RNA-Viren, zu denen auch SARS-CoV-2
gehört. Die Rate wird eindrucksvoll von Forschern der Universität Glasgow demonstriert, die
für das Virus schon in einem sehr kurzen Zeitraum von circa 4 Monaten folgende Mutationen
beschreiben:
7237 nicht-synonyme, das heißt, Aminosäure verändernde
Mutationen (replacements)
6 Einfügungen von zusätzlichen Basen (insertions)
87 Wegfälle von Basen in der Gensequenz (deletions)
Das ist für ein Genom, das selbst nur aus etwa 30.000 Basen besteht, eine enorme Anzahl von
Mutationen, Insertionen und Deletionen in kürzester Zeit. Und das sind nur die Daten von ein
paar Tausend SARS-CoV-2 Viren, die man sequenziert hat. Die Natur kennt viele, viele
weitere.

Nicht-synonyme Mutationen führen dazu, dass andere


Aminosäuren in die Proteine des Virus eingebaut werden. Diese verändern so die chemischen
Eigenschaften dieser Proteine. Diese Mutationen akkumulieren bereits innerhalb von Wochen
(!), wie die Daten zeigen.
Insertions und Deletions sind von besonderer Bedeutung, da sie unter anderem zu einem
"Frameshift" führen können, bei dem die gesamte nachfolgende Kette anders gelesen wird.
Hinzu kommen synonyme Mutationen, die zwar die Primärstruktur der SARSCoV2-Proteine
nicht ändern, aber dennoch eine Rolle in der Diagnostik spielen können. Es gibt außerdem
noch viele offene Fragen zu weiteren Effekten von synonymen Mutationen. Zweifel am PCR-
Test bestanden von Anfang an.
Momentaufnahmen einer unendlichen Geschichte
Ein weiterer wesentlicher Punkt ist, dass die bislang sequenzierten SARS-CoV-2-Viren einen
extrem kleinen Ausschnitt der Natur zeigen. Im Verhältnis zum Gesamtgenom aller
Coronaviren in allen Menschen fällt dieser Ausschnitt kaum ins Gewicht. Man darf auch nicht
vergessen, dass neben SARS-CoV-2 weiterhin auch andere humane Coronaviren existieren –
und diese mutieren auch. Sonst wäre man ja nicht irgendwann beim SARS-CoV-2-Virus
gelandet.
Computer-Analysen, zum Beispiel zum Stammbaum von SARSCoV2 (phylogenetische
Analysen) sind auf Basis dieses extrem kleinen Ausschnitts der Natur, wie sie heute existiert,
sehr problematisch. Die letzten 15 Jahre hat man Coronaviren kaum betrachtet, weder beim
Menschen noch beim Tier. Der weitaus überwiegende Teil der Coronavirus-Gensequenzen in
den Datenbanken stammt aus den letzten 4 Monaten oder ist 15 Jahre alt.
Die Kritik daran ist nicht neu, insbesondere an der sehr inhomogenen geographischen
Verteilung der gefundenen Gensequenzen, worauf etwa Forscher der Universität Florida
hinweisen:
"In einem neuen Baum, der nur eine Woche später abgeleitet wurde, als mehr als 135 neue
vollständige Genomsequenzen auf [der Virusdatenbank] GISAID zur Verfügung gestellt
wurden, ist die direkte Verbindung zwischen Deutschland und Italien jedoch aufgrund der
zusätzlichen Clusterung bisher nicht beprobter Sequenzen aus Portugal, Brasilien, Wales und
den Niederlanden verschwunden."
Einige Veröffentlichungen sprechen davon, dass Haplotypen (also genetische Muster) von
SARS-CoV-2 schon wieder verschwunden sind, also nicht mehr bei neu sequenzierten
Basenfolgen gefunden werden. Auch SARS 1 ist seit langem wieder verschwunden. Welchen
Sinn macht dann ein genetischer Abstand zwischen zwei Gensequenzen?
Zoonose? Ein überflüssiger Kampfbegriff, denn der Mensch ist auch ein Zoon (Lebewesen)
Doch die Virologie tut das, was sie die letzten 30 Jahre gemacht hat. Sie findet eine virale
Gensequenz, die sie noch nicht kannte und erklärt das neu entdeckte Virus zum Todesvirus.
Damit das funktioniert, braucht sie die Zoonose-Hypothese. [Zoonose: Übertragung von
Infektionskrankheiten zwischen Mensch und Tier] Ohne die geht es nicht!
Denn nur dank der Hypothese, dass ein Erreger Ende 2019 auf dem Fischmarkt in Wuhan neu
von einem tierischen Wirt auf den Menschen übergegangen sei, lässt sich pauschal eine
erhöhte Pathogenität (= ein erhöhtes Potential krank zu machen) unterstellen. Der Erreger sei
für den Menschen neu, deshalb, so heißt es, hätten die Menschen, im Gegensatz zu den
ursprünglichen Wirttieren, keine Gelegenheit gehabt, sich an den neuen Erreger anzupassen.
Diese Argumentation funktioniert auch deshalb so gut, weil immer von schwerstkranken
Patienten ausgegangen wird, die dann auch zumeist an mehreren Krankheiten leiden, und man
Menschen ohne oder mit schwachen Symptomen kaum testet. Somit entsteht der scheinbare
Beweis, dass positiver Test und Tod Hand in Hand gehen.
Als Beweis dafür halten Drosten, Wieler & Co. zwei Gensequenzen hoch, eine von einem
tierischen Coronavirus und eine von einem humanen Coronavirus und verweisen auf den
großen genetischen Abstand. Diese Behauptung kann man deshalb so einfach aufstellen, da es
für alles, was dazwischen liegt, keine Daten gibt. Niemand hat in der notwendigen Dichte
tierische und humane Coronaviren in den letzten 15 Jahren vermessen.
Eine sehr große Anzahl an SARS-CoV-2-positiven Menschen zeigt keine oder nur milde
Symptome. Als Anteil asymptomatischer Menschen, die keine Symptome zeigen, werden 50 –
70 % genannt. Das geht nicht, ohne dass das Immunsystem auf das Virus vorbereitet gewesen
ist. Dieser Zusammenhang legt eine kontinuierliche Entwicklung bis zu SARS-CoV-2 (und
seiner vielen Varianten) nahe.
Wer von Ursprung redet, zeigt damit nur, wo er angefangen hat zu denken
Es gibt zunehmend auch phylogenetische Analysen, die versuchen, aus den zahlreichen
unterschiedlichen Gensequenzen einen anderen Stammbaum aufzubauen – gegen die
Hypothese, SARSCoV-2 sei Ende 2019 neu durch Zoonose entstanden.
Analysen dieser Art sind aufgrund des sehr kurzen Sample-Zeitraums problematisch. Mehr hat
man derzeit jedoch nicht. Dazu kommt, dass der Nullpunkt, also die Referenzsequenz, gegen
die man Mutationen bewertet, beliebig gewählt ist. Man hat lediglich in China mit dem neuen
PCR-Test angefangen zu messen und dort auch die ersten Gensequenzen generiert. Erst
danach hat man das in anderen Teilen der Welt getan. Was eine Vorwärts- und was eine
Rückmutation ist, ist eine relative Aussage im Verhältnis zur Referenzsequenz. Die
vermeintliche Ausbreitung spiegelt nur die geographische Abfolge der Tests wieder. Das
nutzen die Panikmacher bei der Johns Hopkins University und anderswo trotzdem weiterhin.
Man sollte das Bild eines "Stammbaumes" endlich aufgeben – das Bild rekursiver Netze
erscheint passender
Die Diversität von SARS-CoV-2 ist so groß, dass sich schon in kleinen Samples Cluster
bilden. Eine eindeutige Zuordnung, wie das Virus nach New York gekommen ist, ist nicht
mehr möglich. Forscher aus New York erläutern in einer aktuellen Studie:
"Die phylogenetische Analyse von 84 verschiedenen SARS-CoV2Genomen deutet auf
multiple, unabhängige, aber isolierte Einführungen hauptsächlich aus Europa und anderen
Teilen der Vereinigten Staaten hin. Darüber hinaus finden wir Hinweise auf eine Übertragung
innerhalb der Community, worauf Cluster verwandter Viren hindeuten, die bei Patienten aus
verschiedenen Stadtvierteln gefunden wurden."
Diese Cluster müssen sich in den USA in den letzten drei Monaten gebildet haben. Es sei
denn, SARS-CoV-2 und alles was dazu führte, ist wesentlich älter. Alternative Interpretationen
derselben Daten (!) aus den Gen-Datenbanken legen nahe, dass SARS-CoV-2 sich schon seit
mehr als 40 Jahren beim Menschen verbreitet. So schreiben Forscher aus Taiwan:
"Da das früheste verfügbare Genom fast einen Monat nach dem Ausbruch am 24.12.2019
erfasst wurde, könnte der tatsächliche
Ursprung des aktuellen Ausbruchs tatsächlich früher liegen als unsere Schätzung. Unter der
Annahme einer synonymen
Substitutionsrate (...) wurde geschätzt, dass die Rekombination vor etwa 40 Jahren
stattgefunden hat (...). Wenn dies wahr ist, könnte SARS-CoV-2 jahrelang verborgen unter den
Menschen zirkuliert haben, bevor es vor kurzem bemerkt wurde."
Das sind sehr aktuelle Auswertungen und es bleibt abzuwarten, ob dieses Preprint es durch
den vielgerühmten Peer-Review-Prozess schafft, mit dem die Wissenschaft sich selbst und den
Stand der Kenntnis „reguliert”.
Was Glyphosat für die Felder, sind Virostatika für den Menschen
Viren sind vermutlich genauso alt wie Bakterien. Das Immunsystem der Wirbeltiere ist als
einziges in der Lage, den Körper mit den immer neuen Virenvarianten zu harmonisieren.
Genau dazu ist es im Rahmen der Evolution entstanden. Die Gruppe der Wirbeltiere entstand
vor etwa 500 Millionen Jahren und das Konzept des Immunsystems ist möglichweise noch
älter. 500 Millionen Jahre entwickelte sich das Immunsystem der Wirbeltiere, an deren
vorläufigem Endpunkt der Mensch steht, in engstem Kontakt mit den Viren. Doch die
moderne Medizin regelt die Immunantwort mit Hilfe von Corticosteroiden herunter, wie viele
COVID-19Behandlungsprotokolle, vor allem aus den USA, zeigen.
Inzwischen bewirbt die Industrie immer neue Medikamente. Wo werden diese angewendet?
98% der Test-Positiven zeigen keine oder nur milde Symptome. Aber die Medien mischen
unkritisch Test und Infektion, Infektion und symptomatische Erkrankung, symptomatische
Erkrankung und Tod. Die Schwerbetroffenen sind im Schnitt älter als 80 Jahre und leiden in
der weit überwiegenden Mehrzahl der Fälle unter schweren Vorerkrankungen. Wie viele
davon an den Folgen der voreiligen Beatmung gestorben sind, kann niemand sagen.
Inzwischen wird den Intensivpatienten unter anderem mit Fentanyl das Atmen abgewöhnt,
sonst funktioniert künstliche Beatmung nicht. Diese Patienten wachen, wenn überhaupt, als
Junkies auf.
Die Angst kommt aus den Intensivstationen, doch was ist da los?
Die Intensivmedizin zeigt, was sie kann. Dazu kommen Medikamente wie Remdesivir, das für
die Ebola-Therapie zu giftig gewesen ist und in weiteren Tests durchfällt. Alle Zweifel haben
jedoch nicht verhindert, Remdesivir in den USA im Blitzverfahren für den Gebrauch
freizugeben.

Ein anderes Beispiel sind Chloroquin und Azithromycin-Kombinationstherapien, die bei


Menschen mit kardiovaskulären Vorerkrankungen zum Herzstillstand führen können. Oder
eine Chloroquin-Monotherapie, die bei Menschen mit Glucose6Phosphat-Dehydrogenase
Mangel zur Schädigung der roten Blutkörperchen führt. Glucose-6-Phosphat-Dehydrogenase-
Mangel ist der weltweit häufigste erbliche Gendefekt mit einer Häufigkeit von bis zu 20 - 30
% in Afrika. Besonders betroffen sind auch Länder mit einem hohen Anteil
afrikanischstämmiger Menschen.

Falsche Prioritäten und täuschende Zahlen


Das alles wurde ausgelöst durch einen maroden Test, überhastete Maßnahmen und ein durch
nichts zu rechtfertigendes Vertrauen in einen minimalen Ausschnitt aus der
Evolutionsmaschine Natur, der in den Gendatenbanken abgelegt ist.
Die Wissenschaft und die von ihr beratene Politik werden weiterhin ihrer selbstgemachten
Krise nachlaufen müssen. Obwohl es sehr zweifelhaft ist, dass ein Virus, das bei 50 – 70 % der
Infizierten keine (!) Symptome hervorruft, genau dann in Europa ankam, als man die
Tests gestartet hat – wie einige jetzt mit Hilfe der Kurven zur Übersterblichkeit glauben
machen wollen. Und das bei einer Krankenpopulation, bei der 40 % der Intensivpatienten
schwerstpflegebedürftig direkt aus dem Pflegeheim auf die Intensivstation kamen. So schildert
Matthias Thöns, Facharzt für Notfall- und Palliativmedizin: „Wir müssen ja bedenken, dass es
sich bei den schwer erkrankten COVID-19-Betroffenen um hochaltrige, vielfach erkrankte
Menschen handelt. 40 Prozent von denen kommen schwerstpflegebedürftig aus Pflegeheimen,
und in Italien sind von 2.003 Todesfällen nur drei Patienten ohne schwere Vorerkrankungen
gewesen. Also es ist eine Gruppe, die üblicherweise und bislang immer mehr Palliativmedizin
bekommen hat als Intensivmedizin, und jetzt wird so eine neue Erkrankung diagnostiziert und
da macht man aus diesen ganzen Patienten Intensivpatienten.“
Fehlalarme – eine soziale Autoimmunkrankheit
In dem derzeitigen medialen Klima und unter dem immensen politischen Druck, auch
nachträglich die drakonischen Maßnahmen und deren Folgen zu rechtfertigen, ist es sehr
zweifelhaft, dass es zur Zoonose-Hypothese und zu einer umsichtigen Risikoabschätzung noch
eine unabhängige wissenschaftliche Diskussion geben wird. Für welche Forschungsanträge
wird wohl Geld bewilligt werden?
Die Evolution läuft schon Millionen Jahre, doch in den letzten 20 Jahren werden durch
Virologen alle 3-5 Jahre neue "Todesviren" entdeckt, welche angeblich die Menschheit schwer
bedrohen: MERS, SARS 1, SARS 2, Schweinegrippe, Vogelgrippe und so weiter. Sind wir
wirklich so blind? Oder sehen wir, dass der Kaiser nackt ist?
Über den Autor: Dr. med. Wolfgang Wodarg, Jahrgang 1947, ist Internist und Lungenarzt,
Facharzt für Hygiene und Umweltmedizin sowie für öffentliches Gesundheitswesen und
Sozialmedizin. Nach seiner klinischen Tätigkeit als Internist war er unter anderem 13 Jahre
Amtsarzt in Schleswig-Holstein, gleichzeitig Lehrbeauftragter an Universitäten und
Fachhochschulen und Vorsitzender des Fachausschusses für gesundheitlichen Umweltschutz
bei der Ärztekammer Schleswig-Holstein; 1991 erhielt er ein Stipendium an der Johns
Hopkins University, Baltimore, USA (Epidemiologie).
Als Mitglied des Deutschen Bundestages von 1994 bis 2009 war er Initiator und Sprecher in
der Enquête-Kommission "Ethik und Recht der modernen Medizin", Mitglied der
Parlamentarischen Versammlung des Europarates, dort Vorsitzender des Unterausschusses
Gesundheit und stellvertretender Vorsitzender des Ausschusses für Kultur, Bildung und
Wissenschaft. 2009 initiierte er in Straßburg den Untersuchungsausschuss zur Rolle der WHO
bei der H1N1 (Schweinegrippe) und war dort nach seinem Ausscheiden aus dem Parlament als
wissenschaftlicher Experte weiter beteiligt. Seit 2011 ist er als freier Hochschullehrer, Arzt
und Gesundheitswissenschaftler tätig und war bis 2020 ehrenamtlich als Vorstandsmitglied
und Arbeitsgruppenleiter Gesundheit bei Transparency International Deutschland engagiert.
Hinweis: Dieser Artikel erschien zuerst auf wodarg.com. Er wurde leicht bearbeitet.
Kapitel Nr. 9 – Fragen zur WHO

Wenn irgendwo auf der Welt Krankheiten ausbrechen, ist sie gefragt: Die
Weltgesundheitsorganisation (WHO), die auch bei Corona die Zügel als globaler
Befehlskörper in der Hand hält. In Genf, in der Schweiz, hat die WHO ihren Hauptsitz. 194
Staaten sind Mitglied der UN-Sonderorganisation. Über 7000 Menschen arbeiten weltweit für
sie. Am 11. März 2020 erklärte sie Corona offiziell zu einer Pandemie. Kritiker werfen der
WHO jedoch vor, oft zugunsten der Pharmaindustrie und weniger zum Wohl der Menschheit
zu handeln. Die Organisation hänge zu sehr von privaten Spendern ab. Was ist dran an diesen
Vorwürfen?

Wussten Sie, dass die Agenda der WHO längst von einem Superreichen vorgegeben wird? Das
behaupteten die deutsche Zeitung ZEIT und der Sender ARTE in einer Dokumentation «Die
WHO: Im Griff der Lobbyisten». Rund zwei Milliarden Dollar hat die WHO pro Jahr zur
Verfügung. Nicht viel mehr als ein großes Krankenhaus. Die 194 Mitgliedsländer zahlen
Pflichtbeiträge. Die WHO kann frei entscheiden, was sie damit macht. Doch das ist nicht mal
ein Viertel des Gesamtbudgets. Der Großteil besteht aus Spenden von finanzstarken Ländern
wie den USA, Großbritannien oder Japan, aber kommt auch von Stiftungen und anderen
Organisationen. Ganz vorne mit dabei: Die Bill-und-MelindaGatesStiftung als zweitgrößter
Geldgeber der WHO hinter den USA. Die von Gates aufgebaute Impfallianz GAVI ist bei den
Geldgebern an vierter Stelle.
Deshalb kommt die deutsche Wochenzeitung ZEIT zu dem Schluss: «Der heimliche WHO-
Chef heißt Bill Gates», so der Titel eines Artikels. «Die wichtigste Organisation der
Weltgesundheit, die WHO, hat ein Problem: Sie ist pleite und deshalb auf Spenden
angewiesen. Verliert sie darüber ihre Unabhängigkeit?» David McCoy, einer der führenden
Experten im Bereich Weltgesundheit, wird von der ZEIT als Experte herangezogen. Er sagt,
die Agenda der WHO werde immer mehr von privaten Spendern bestimmt, vor allem von Bill
Gates. Würde die Bill-und-Melinda-Gates-Stiftung aufhören, jährlich Millionen US-Dollar
nach Genf zu schicken, würde die WHO womöglich in sich zusammenfallen. Entsprechend
großen Einfluss habe der Milliardär auf das inhaltliche Programm.
Was sagt das über die Glaubwürdigkeit der WHO, wenn einer der reichsten Menschen der
Welt sie anscheinend als sein persönliches Werkzeug einsetzen kann?
Aus Gates´ Steuererklärung von 2014 gehen übrigens Investitionen in Pharmaunternehmen
wie Novartis und Glaxosmithkline klar hervor. Wenn die WHO den UN-Staaten empfiehlt,
Medikamente und Impfstoffe einzukaufen, wird demnach auch der schon prall gefüllte
Geldbeutel von Bill Gates noch etwas dicker. Sollte man die empfohlenen Maßnahmen dieser
laut ZEIT fremdgesteuerten Behörde nicht mit höchster Vorsicht genießen?
YouTube.com, Die WHO - Im Griff der Lobbyisten - Doku HD,
14.03.2018 zeit.de, Der heimliche WHO-Chef heiß Bill Gates,
04.04.2017
Kapitel Nr. 10 – Aktuelle Meldung von PFITZER

Leider ist die Meldung, die am 5.11.2021 durchs Internet rausche nur eine Ente. Aber die
Meldung ist so gut gemacht, dass man leicht darauf hereinfallen konnte. Allerdings zeigt sie
mir deutlich an, dass die Menschen schon wissen, wo die Täter, die Kriegsgewinnler im
Corona-Krieg sitzen. Daher Chapeau an die Macher der Satire:

Der CEO von Pfizer, Albert Bourla, wurde am Freitagmorgen 5.11.2021 in seinem Haus im
wohlhabenden Vorort Scarsdale, New York, vom FBI verhaftet und wegen Betrugs in
mehreren Fällen angeklagt. Bourla wird bis zu einer Kautionsanhörung festgehalten.
Bundesbeamte sind dabei, einen Durchsuchungsbefehl in seinem Haus und in mehreren
anderen Immobilien, die er im ganzen Land besitzt, zu vollstrecken.
Albert Bourla wird wegen seiner Rolle bei der Täuschung von Kunden über die Wirksamkeit
des COVID-19-"Impfstoffs" wegen Betrugs angeklagt. Pfizer wird vorgeworfen, Daten
gefälscht und hohe Bestechungsgelder gezahlt zu haben. Einem FBI-Agenten zufolge, der mit
dem Konservativen Biber sprach, hat Pfizer über die Wirksamkeit der Impfstoffe gelogen und
die Kunden über die schweren Nebenwirkungen, die die Impfstoffe hervorrufen können,
getäuscht. Pfizer wird beschuldigt, Regierungen und die Mainstream-Medien zu bezahlen,
damit sie schweigen.
Albert Bourla stand bereits in der Kritik, als bekannt wurde, dass Pfizer und ein
Forschungspartner "Daten fälschten, Patienten entblindeten (Anmerkung des Autors: Patienten
entblinden, bedeutet, bei Doppelblindstudien dem teilnehmenden Patienten offenzulegen, ob er
beispielsweise ein Testmedikament oder ein Placebo verabreicht bekommt), unzureichend
ausgebildete Impfärzte beschäftigten und unerwünschten Ergebnissen nur langsam
nachgingen". Die Whistleblowerin Brook Jackson wurde entlassen, nachdem sie versucht
hatte, den Betrug zu stoppen, wie das BMJ berichtete.
Im Oktober veröffentlichte Project Veritas eine Reihe von Leaks unter dem Namen
"PfizerLeaks". In dem Video enthüllt ein anderer Pfizer-Whistleblower, wie das Unternehmen
abgetriebene fötale Zellen in dem COVID-19-Impfstoff" verwendet. Pfizer hat versucht, diese
Tatsache vor der Öffentlichkeit geheim zu halten.
Bei einer Verurteilung könnte Albert Bourla den Rest seines Lebens im Gefängnis verbringen.
Bourla gilt bis zum Beweis seiner Schuld als unschuldig.
Die Polizei hat eine Mediensperre angeordnet, die sofort von einem Richter genehmigt
wurde.
Kapitel Nr. 11 – Das Weimarer Skandalurteil

Was nicht passend wird passend gemacht


Ähnlich wie bei Wahlergebnissen, die der Regierung nicht ins Programm passen, werden in
Deutschland auch ganze, solide Urteile von unabhängigen Richtern mit fadenscheinigen
Argumenten kassiert und verschwinden in einer anschließend unauffindbaren Schublade.
Damit die hervorragende Arbeit des Weimarer Amtsrichters nicht in Vergessenheit gerät, hier
das Originalurteil:

Gericht: AG Weimar

Entscheidungsdatum: 11.01.2021

Aktenzeichen: 6 OWi - 523 Js 202518/20

Dokumenttyp: Urteil

Quelle:

Zitiervorschlag: AG Weimar, Urteil vom 11. Januar


2021 – 6 OWi - 523 Js 202518/20 –, juris
Tenor

Der Betroffene wird freigesprochen.


Die Kosten des Verfahrens und die notwendigen Auslagen des Betroffenen hat die Staatskasse
zu tragen.

Gründe
I.
Am 24.04.2020 hielt sich der Betroffene in den Abendstunden zusammen mit mindestens
sieben weiteren Personen im Hinterhof des Hauses X-Straße 1 in W. auf, um den Geburtstag
eines der Beteiligten zu feiern. Die insgesamt acht Beteiligten verteilten sich auf sieben
verschiedene Haushalte.
Diese Feststellungen beruhen auf den glaubhaften Angaben des Betroffenen in der
Hauptverhandlung und dem verlesenen Einsatzbericht der Polizei.
II.
Dieses Verhalten des Betroffenen verstieß gegen § 2 Abs. 1 und § 3 Abs. 1 der Dritten
Thüringer Verordnung über erforderliche Maßnahmen zur Eindämmung der Ausbreitung des
Coronavirus SARS-CoV-2 (3. ThürSARS-CoV-2-EindmaßnVO) vom 18.04.2020 in der
Fassung vom 23.04.2020.
Diese Normen lauteten wie folgt.
§ 2 Abs. 1: Der Aufenthalt im öffentlichen Raum ist nur allein, im Kreise der Angehörigen des
eigenen Haushalts und zusätzlich höchstens mit einer weiteren haushaltsfremden Person
gestattet.
§ 3 Abs. 1: Veranstaltungen, Versammlungen im Sinne des § 1 des Versammlungsgesetzes in
der Fassung vom 15. November 1978 (BGBl. I S. 1789) in der jeweils geltenden Fassung,
Demonstrationen, Ansammlungen und sonstige Zusammenkünfte mit mehr als zwei Personen
sind verboten mit der Ausnahme, dass es sich um Angehörige des eigenen Haushalts handelt
und zusätzlich höchstens eine haushaltsfremde Person hinzukommt. Dies gilt auch für
Zusammenkünfte in Kirchengebäuden, Moscheen und Synagogen sowie in Kulträumen
anderer
Religionsgesellschaften und Weltanschauungsgemeinschaften.
§ 2 Abs. 2 3.ThürSARS-CoV-2-EindmaßnVO regelte Ausnahmen vom Verbot nach § 2 Abs. 1
für die Berichterstattung durch Medienvertreter, die Ausübung bestimmter beruflicher
Tätigkeiten im Freien und die Benutzung des öffentlichen Personennahverkehrs und von
Kraftfahrzeugen, § 3 Abs. 2-4 regelten Ausnahmen vom Verbot nach § 3 Abs. 1 für bestimmte
Arten von Veranstaltungen, (öffentliche) Versammlungen in geschlossenen Räumen und unter
freiem Himmel, Gottesdienste und sonstige religiöse Zusammenkünfte, Trauerfeiern und
Eheschließungen. Keine dieser Ausnahmen ist vorliegend einschlägig.

Dieser Verstoß stellt eine Ordnungswidrigkeit gem. § 14 Abs. 3 Nr. 2 und Nr. 3 3.

ThürSARS-CoV-2-EindmaßnVO i. V. m. § 73 Abs. 1a Nr. 24 i. V. m. § 32 Satz 1 IfSG dar.

Der Betroffene war dennoch aus rechtlichen Gründen freizusprechen, weil § 2 Abs. 1 und
§ 3 Abs. 1 3. ThürSARS-CoV2EindmaßnVO verfassungswidrig und damit nichtig sind.
Das Gericht hatte selbst über die Verfassungsmäßigkeit der Normen zu entscheiden, weil die
Vorlagepflicht gem. Art. 100 Abs.
1 GG nach ständiger Rechtsprechung des
Bundesverfassungsgerichts (grundlegend BVerfGE 1, 184 (195ff)) nur für förmliche Gesetze
des Bundes und der Länder, nicht aber für nur materielle Gesetze wie Rechtsverordnungen
gilt. Über deren Vereinbarkeit mit der Verfassung hat jedes Gericht selbst zu entscheiden.
III.
§ 2 Abs. 1 und § 3 Abs. 1 3. ThürSARS-CoV-2-EindmaßnVO sind aus formellen Gründen
verfassungswidrig, da die tief in die Grundrechte eingreifenden Regelungen von der
gesetzlichen Ermächtigungsgrundlage im Infektionsschutzgesetz nicht gedeckt sind.

1. Gemäß Art. 80 Abs. 1 S. 1 GG kann die Exekutive durch ein Gesetz ermächtigt werden,
Rechtsverordnungen zu erlassen. Dabei müssen gemäß Art. 80 Abs. 1 S. 2 GG Inhalt, Zweck
und Ausmaß der erteilten Ermächtigung im Gesetz bestimmt werden. Das
Bundesverfassungsgericht hat die sich daraus ergebenden Anforderungen an ein
ermächtigendes Gesetz in ständiger Rechtsprechung mit drei sich gegenseitig ergänzenden
Konkretisierungsformeln, der sog. Selbstentscheidungsformel (der Gesetzgeber hat selbst die
Entscheidung darüber zu treffen, welche Fragen durch die Rechtsverordnung geregelt werden
sollen, welche Grenzen der Normierung gesetzt sind und welchem Ziel sie dienen soll;
BVerfGE 2, 307 (334)), der Programmformel (anhand des Gesetzes muss sich bestimmen
lassen, welches gesetzgeberische Programm verordnungsrechtlich umgesetzt werden soll;
BVerfGE 5, 71 (77)) und der Vorhersehbarkeitsformel (der Bürger muss dem ermächtigenden
Gesetz entnehmen können, in welchen Fällen und mit welcher Tendenz von der Ermächtigung
Gebrach gemacht wird und welchen Inhalt die Rechtsverordnung haben wird; BVerfGE 56, 1
(12)) näher expliziert. Darüber hinaus hat es zur Frage des Grades der Bestimmtheit der
Ermächtigung die sog. Wesentlichkeitslehre entwickelt. Nach der Wesentlichkeitslehre muss
der Gesetzgeber in grundlegenden normativen Bereichen, zumal im Bereich der
Grundrechtsausübung – soweit diese staatlicher Regelung überhaupt zugänglich ist – alle
wesentlichen Entscheidungen selbst treffen und darf diese nicht an die Exekutive delegieren
(BVerfGE 142, 1 (109); BVerfGE 98, 218 (251); BVerfGE 116, 24 (58)). Je wesentlicher
Rechtsverordnungen oder andere Rechtsakte der Exekutive in Grundrechte eingreifen, umso
genauer und intensiver müssen die Regelungen des ermächtigenden Gesetzes sein. Das
Bundesverfassungsgericht sieht dabei die Anforderungen von Art. 80 Abs. 1 S. 2 GG und der
Wesentlichkeitslehre als deckungsgleich an (BVerfGE 150, 1 (100)). Ist im Hinblick auf
bestimmte Normen einer Rechtsverordnung den Anforderungen der
Wesentlichkeitslehre durch das ermächtigende Gesetz nicht Genüge getan, führt dies zur
Verfassungswidrigkeit der Normen der Verordnung (BVerfGE 150, 1 (209) BVerfGE 136, 69
(92)).

Rechtsgrundlage für das hier zur Rede stehende sog. allgemeine Kontaktverbot ist § 32 IfSG i.
V. m. § 28 Abs. 1 Satz 2 IfSG in der Fassung vom 27.03.2020. Auf die Generalklausel des §
28 Abs. 1 Satz 1 IfSG muss insoweit nicht zurückgegriffen werden (vgl. Kießling/ Kießling
IfSG, § 28 Rn. 35, 44).

§ 28 Abs. 1 Satz 1 und 2 IfSG in der Fassung vom 27.03.2020 lauten:


(Satz 1) Werden Kranke, Krankheitsverdächtige,
Ansteckungsverdächtige oder Ausscheider festgestellt oder ergibt sich, dass ein Verstorbener
krank, krankheitsverdächtig oder
Ausscheider war, so trifft die zuständige Behörde die notwendigen Schutzmaßnahmen,
insbesondere die in den §§ 29 bis 31 genannten, soweit und solange es zur Verhinderung der
Verbreitung übertragbarer Krankheiten erforderlich ist; sie kann insbesondere Personen
verpflichten, den Ort, an dem sie sich befinden, nicht oder nur unter bestimmten Bedingungen
zu verlassen oder von ihr bestimmte Orte oder öffentliche Orte nicht oder nur unter
bestimmten Bedingungen zu betreten. (Satz 2) Unter den Voraussetzungen von Satz 1 kann die
zuständige Behörde Veranstaltungen oder sonstige Ansammlungen von
Menschen beschränken oder verbieten und Badeanstalten oder in § 33 genannte
Gemeinschaftseinrichtungen oder Teile davon schließen.“

Da unter „Ansammlungen von Menschen“ Personenmehrheiten von mindestens drei Personen


mit einem inneren Bezug oder einer äußeren Verklammerung zu verstehen sind (Kießling,
aaO, Rn. 38f), lassen sich § 2 Abs. 1 und das Ansammlungsverbot des § 3 Abs. 1 3.
ThürSARS-CoV-2-EindmaßnVO zwar unter den Wortlaut von § 28 Abs. 1 S. 2 IfSG
subsumieren, für eine eingriffsintensive Maßnahme wie ein allgemeines Kontaktverbot ist § 28
Abs. 1 S. 2 IfSG aber keine den Anforderungen der Wesentlichkeitslehre genügende
Ermächtigungsgrundlage. Ein allgemeines
Kontaktverbot stellt zumindest – die Frage der Betroffenheit der Menschenwürdegarantie
muss an dieser Stelle zurückgestellt werden und wird unter IV. erörtert – einen schweren
Eingriff in die allgemeine Handlungsfreiheit gem. Art. 2 Abs. 1 GG, darüber hinaus aber auch
in die Versammlungs-, Vereinigungs-, Religions-, Berufs- und Kunstfreiheit dar, nicht nur,
weil es alle Bürger adressiert und zwar unabhängig von der Frage, ob sie Krankheits- oder
Ansteckungsverdächtige i. S. v. § 28 Abs. 1 S. 1 IfSG sind oder nicht. Indem allen Bürgern
untersagt wird, mit mehr als einer haushaltsfremden Person zusammenzukommen, wobei dies
vorliegend nicht nur für den öffentlichen Raum (§ 2 Abs. 1 3. ThürSARS-CoV-2-
EindmaßnVO), sondern gem. § 3 Abs. 1 3. ThürSARS-CoV-2-EindmaßnVO auch für den
privaten Raum galt, sind die Freiheitsrechte im Kern betroffen. Das allgemeine Kontaktverbot
zieht dabei zwangsläufig weitere
Grundrechtseinschränkungen nach sich. So ist es nur logisch folgerichtig, dass unter der
Geltung eines allgemeinen Kontaktverbotes Einrichtungen aller Art (§ 5 3. ThürSARS-
CoV2EindmaßnVO), Einzelhandelsgeschäfte, Beherbergungsbetriebe (§ 6 3. ThürSARS-CoV-
2-EindmaßnVO) und Gastronomiebetriebe (§ 7 3. ThürSARS-CoV-2-EindmaßnVO) ebenfalls
geschlossen oder jedenfalls beschränkt werden.
Der Gesetzgeber hatte als Eingriffsvoraussetzung für ein allgemeines Kontaktverbot vor der
Schaffung von § 28a IfSG mit Gesetz vom 18.11.2020 lediglich in § 28 Abs. 1 IfSG bestimmt,
dass Kranke, Krankheitsverdächtige, Ansteckungsverdächtige etc. einer übertragbaren
Krankheit festgestellt wurden und dass die Maßnahme nur „soweit und solange es zur
Verhinderung der Krankheitsverbreitung erforderlich ist“, getroffen werden darf, wobei
letzteres nicht mehr als ein expliziter Verweis auf das ohnehin geltende
Verhältnismäßigkeitsprinzip ist. Damit sind nur absolute Minimalvoraussetzungen geregelt.
Das Gesetz kann in dieser Form nur Einzelmaßnahmen wie z.B. die in § 28 Abs. 1 Satz 2 IfSG
genannte Schließung von (einzelnen) Badeanstalten tragen, nicht aber ein allgemeines
Kontaktverbot. Soweit ein allgemeines Kontaktverbot überhaupt verfassungskonform sein
kann (dazu näher unter IV. und V.), wäre dafür zumindest eine präzise Regelung der
Anordnungsvoraussetzungen im Sinne einer genauen Konkretisierung der erforderlichen
Gefahrenlage zu fordern, aber auch auf der Rechtsfolgenseite wären konkretisierende
Regelungen notwendig (vgl. Kießling, aaO Rn. 63;
Papier, Freiheitsrechte in Zeiten der Pandemie, DRiZ, 2020, 180; Bäcker, Corona in
Karlsruhe, VerfBlog v. 25.03.2020, https://verfassungsblog.de/corona-in-karlsruhe-ii/;
Möllers, Parlamentarische Selbstentmächtigung im Zeichen des Virus, VerfBlog v.
26.03.2020,
https://verfassungsblog.de/parlamentarischeselbstentmaechtigu
ng-im-zeichen-des-virus/)

2. Dass § 28 IfSG hinsichtlich der tiefgreifenden Grundrechtseingriffe einschließlich


eines Kontaktverbots durch die verschiedenen Corona-Verordnungen der Länder jedenfalls im
Grundsatz nicht den Anforderungen der Wesentlichkeitsdoktrin genügt, ist in Rechtsprechung
und Literatur inzwischen weitgehend Konsens. Der Gesetzgeber hat darauf zwischenzeitlich
auch mit der Einfügung von § 28a IfSG zu reagieren versucht. Die Rechtsprechung hat aber,
um einer sonst unvermeidlichen Verwerfung der Verordnungen zu entgehen, vielfach darauf
verwiesen, dass anerkannt sei, dass es im Rahmen unvorhergesehener Entwicklungen aus
übergeordneten Gründen des Gemeinwohls geboten sein könne, nicht hinnehmbare
gravierende Regelungslücken für einen Übergangszeitraum auf der Grundlage von
Generalklauseln zu schließen und auf diese Weise selbst sehr eingriffsintensive Maßnahmen,
die an sich einer besonderen Regelung bedürften, vorübergehend zu ermöglichen
(exemplarisch: OVG NRW, Beschluss vom 06.04.2020 13 B 398/20.NE -, juris, Rn. 59 unter
Berufung auf OVG NRW, Urteil vom 5. Juli 2013 - 5 A 607/11 juris, Rn. 97 ff.; Saarl. OVG,
Urteil vom 6. September 2013 - 3 A 13/13 -, juris, Rn. 77 ff.; VGH Bad.-Württ., Urteil vom
22. Juli 2004 - 1 S 2801/03 juris, Rn. 30; BVerfG, Beschluss vom 8. November 2012 - 1 BvR
22/12 -, juris, Rn. 25; BVerwG, Beschluss vom 31. Januar 2019 - 1 WB 28.17 - juris, Rn. 35;
Bethge, Ausgangssperre, VerfBlog v. 24.03.2020). Diese Voraussetzungen lägen vor, da es
sich bei der Corona-Pandemie um ein derart beispielloses Ereignis handele, dass vom
Gesetzgeber nicht verlangt werden könnte, die erforderlichen Regelungen bereits im Voraus
getroffen zu haben. Es bestehe auch ein dringender Handlungsbedarf, der zur Schließung
gravierender, bei einer Abwägung der gegenläufigen verfassungsrechtlichen Positionen nicht
mehr vertretbarer Schutzlücken den
vorübergehenden Rückgriff auf die infektionsschutzrechtliche Generalklausel gebieten würde
(OVG NRW, Beschluss vom 06.04.2020 - 13 B 398/20.NE -, juris, Rn. 61).

Je länger die Freiheitsbeschränkungen in der Corona-Krise andauerten, wurde in der


Rechtsprechung zunehmend die Frage diskutiert, ob der „Übergangszeitraum“ nicht bereits
abgelaufen sei [vgl. etwa BayVGH, Beschluss vom 29.10.2020 - 20 NE 20.2360 -, juris, der
dieser Frage breiten Raum widmet und sie an einer
Stelle zumindest implizit bereits bejaht (Rn. 30): „Bis zu welchem Ausmaß und für welchen
Zeitraum die §§ 32, 28 IfSG möglicherweise noch ausreichend waren , um die mit einer
bislang nicht dagewesenen Pandemie … entstandene Gefahrenlage zu bewältigen, bedarf an
dieser Stelle keiner abschließenden Entscheidung …“ (Hervorhebung hinzugefügt), um dann
mit dem Argument, dass der Bayerische Landtag die Staatsregierung mittlerweile aufgefordert
habe, sich für die Schaffung konkreter Befugnisnormen im IfSG einzusetzen, am Ende die
Frage doch wieder in die Schwebe zu bringen und von einer Verwerfung der angegriffenen
Norm abzusehen.]

3. Es kann hier dahinstehen, ob die damit vorgenommene Relativierung der Geltung der
Wesentlichkeitslehre mit der Rechtsprechung des Bundesverfassungsgerichts in Einklang zu
bringen ist (ablehnend etwa Möllers, aaO: „Sollten wir aus der Krise mit der Einsicht
herausgehen, dass fundamentale Normen der Arbeitsteilung zwischen Parlament und
Regierung … befristet unter einem ungeschriebenen verfassungsrechtlichen
Notstandsvorbehalt stehen, wäre das fatal.“), es soll diesbezüglich lediglich noch darauf
hingewiesen werden, dass die einzige in diesem Zusammenhang zitierte Entscheidung des
Bundesverfassungsgerichts, der Beschluss vom 08.11.2012 - 1 BvR
22/12 -, kaum als Beleg angeführt werden kann, da in dieser Entscheidung lediglich
unbeanstandet gelassen wurde, dass die Untergerichte die polizeiliche Generalklausel in
einem Verfahren des einstweiligen Rechtsschutzes als noch ausreichende Rechtsgrundlage für
eine Maßnahme, die möglicherweise einer detaillierten Ermächtigungsgrundlage bedurft hätte,
angesehen haben, die Entscheidung über die Frage der Rechtsgrundlage somit in das
Hauptsacheverfahren verlagert wurde. Dass gesetzliche Regelungslücken von der Exekutive
unter bestimmten Bedingungen durch die Anwendung von Generalklauseln geschlossen
werden könnten und insoweit die Anforderungen der Wesentlichkeitslehre vorübergehend
suspendiert seien, ist damit in dieser Entscheidung nicht gesagt.

Soweit eingriffsintensive Maßnahmen, die an sich einer besonderen Regelung bedürften, unter
Rückgriff auf Generalklauseln nur im Rahmen „unvorhergesehener
Entwicklungen“ zulässig sein sollen, ist diese Voraussetzung vorliegend nicht erfüllt. Bereits
im Jahr 2013 lag dem Bundestag eine unter Mitarbeit des Robert Koch-Instituts erstellte
Risikoanalyse zu einer Pandemie durch einen „Virus Modi-SARS“ vor, in der ein Szenario mit
7,5 Millionen (!) Toten in Deutschland in einem Zeitraum von drei Jahren beschrieben und
antiepidemische Maßnahmen in einer solchen Pandemie diskutiert wurden
(Bundestagsdrucksache 17/12051). Der Gesetzgeber hätte daher im Hinblick auf ein solches
Ereignis, das zumindest für „bedingt wahrscheinlich“ (Eintrittswahrscheinlichkeit Klasse C)
gehalten wurde, die Regelungen des Infektionsschutzgesetzes prüfen und ggf. anpassen
können.

Hinzu kommt – und dieses Argument ist gewichtiger –, dass am


18.04.2020, dem Tag des Erlasses der 3. ThürSARS-CoV2EindmaßnVO, weder in
Deutschland im Ganzen betrachtet, noch in Thüringen eine epidemische Lage bestand,
angesichts derer es ohne die Ergreifung von einschneidenden Maßnahmen durch die
Exekutive unter Rückgriff auf die infektionsschutzrechtliche
Generalklausel bzw. die (den Anforderungen der
Wesentlichkeitslehre ebenfalls nicht genügenden) Spezialermächtigungen des § 28 Abs. 1 S.
2 IfSG zu „nicht mehr vertretbaren Schutzlücken“ gekommen wäre. Es gab keine „epidemische
Lage von nationaler Tragweite“ (§ 5 Abs. 1 IfSG), wenngleich dies der Bundestag mit Wirkung
ab 28.03.2020 festgestellt hat.

Diese Einschätzung ergibt sich bereits allein aus den veröffentlichten Daten des Robert Koch-
Instituts:

- Der Höhepunkt der COVID-19-


Neuerkrankungen
(Erkrankungsbeginn = Beginn der klinischen Symptome) war bereits am 18.03.2020 erreicht.
Dies ergibt sich aus einer Grafik, die seit dem 15.04.2020 täglich in den Situationsberichten
des
Robert Koch-Instituts veröffentlicht wurde und die den zeitlichen Verlauf der
Neuerkrankungen zeigt (z.B. Lagebericht vom
16.04.2020, S. 6, Abb. 6). Bringt man hier noch die laut Robert Koch-Institut durchschnittliche
Inkubationszeit von 5 Tagen in
Abzug, ergibt sich als Tag des Höhepunktes der Neuinfektionen der
13.03.2020. Zum Zeitpunkt des Beginns des Lockdowns am 22.03.2020 sank damit die Zahl
der Neuinfektionen bereits seit 10
Tagen. Einschränkend ist lediglich zu bemerken, dass die Ermittlung des Verlaufs der
Neuerkrankungen durch das Robert Koch-Institut insoweit mit einer Unsicherheit behaftet ist,
als sie allein auf den gemeldeten Positivtests (und dem dabei entweder mit gemeldeten
Erkrankungsbeginn bzw. – so weit nicht bekannt – dem geschätzten Erkrankungsbeginn) beruht
und die Zahl der durchgeführten Tests nicht konstant war. Da aber von der 11. Kalenderwoche
(09.-15.03.) bis zur 14. Kalenderwoche die wöchentlichen Testzahlen gesteigert wurden – von
der 11. auf die 12. Kalenderwoche sprunghaft, danach nur noch mäßig – wäre für den Peak der
Kurve der Neuerkrankungen eine zeitliche Verzerrung nach hinten zu erwarten, er wäre somit
„verspätet“ registriert worden und könnte in Wirklichkeit noch etwas vor dem 18.03.2020
gelegen haben. Dies kann hier aber dahingestellt bleiben, da es die vorliegende Argumentation
nur noch verstärken würde.
- Vor dem Lockdown gab es dementsprechend auch keine exponentielle Steigerung der
Neuinfektionen. Zwar stieg die Zahl der Positivtests von 7.582 in der 11.
Kalenderwoche (09.15.03.) auf 23.820 in der 12. Kalenderwoche (16.22.03.) und
damit um 214 %, dieser Anstieg war aber vor allem auf eine Steigerung der Testzahlen
von 127.457 (11. KW) um 173 % auf 348.619 (12. KW) zurückzuführen (Lagebericht
vom 15.04.2020, Tabelle 4, S. 8). Der Anteil der Positivtests an den Gesamttests (sog.
Positivenquote) stieg nur von 5,9% auf 6,8%, was einer Steigerung um lediglich 15%
entspricht.

- Wie sich aus dem Epidemiologischen Bulletin 17/2020 des Robert Koch-Instituts,
veröffentlicht am 15.04.2020, ergibt, sank die effektive Reproduktionszahl R nach den
Berechnungen des RKI bereits am 21.03.2020 unter den Wert
1
(https://edoc.rki.de/bitstream/handle/176904/6650.2/17_2020_ 2.Artikel.pdf?
sequence=3&isAllowed=y) und blieb dann mit
kleineren Schwankungen ungefähr bei 1. Da nach den
Erläuterungen des Robert Koch-Instituts (Erläuterung der Schätzung der zeitlich variierenden
Reproduktionszahl R, https://www.rki.de/DE/content/InfAZ/N/Neuartiges_Coronavirus
/Projekte_RKI/R-Wert-Erlaeuterung.pdf? __blob=publicationFile) die an einem bestimmten
Tag berichtete Reproduktionszahl die Neuinfektionen im Zeitraum 13 bis 8 Tage vor diesem
Tag beschreibt, ist diese Zeitverzögerung noch in Abzug zu bringen, so dass danach der R-Wert
(bei einer Korrektur um 10 Tage) bereits am 11. März unter 1 lag, was obigem Befund zum
Höhepunkt der Neuinfektionen entspricht (vgl. Kuhbandner, Warum die
Wirksamkeit des Lockdowns wissenschaftlich nicht bewiesen ist,

https://www.heise.de/tp/features/Warum-die-Wirksamkeit-
desLockdowns-wissenschaftlich-nicht-bewiesen-ist- 4992909.html?seite=all.)

- Da die Zahl der Neuinfektionen bereits seit Mitte März rückläufig war, ist es nicht
überraschend, dass in Deutschland zu keinem Zeitpunkt im Frühjahr 2020 eine konkrete
Gefahr der Überlastung des Gesundheitssystems durch eine „Welle“ von COVID-19Patienten
bestand. Wie sich dem am 17.03.2020 neuetablierten DIVI-Intensivregister entnehmen lässt,
waren im März und April in Deutschland durchgehend mindestens 40% der Intensivbetten frei.
In Thüringen wurden am 03.04.2020 378
Intensivbetten als belegt gemeldet, davon 36 mit COVID19Patienten. Dem standen 417 (!)
freie Betten gegenüber. Am
16.04.2020, also zwei Tage vor dem Erlass der Verordnung wurden 501 Intensivbetten als
belegt gemeldet, davon 56 mit COVID-19Patienten. Dem standen 528 (!) freie Betten
gegenüber
(https://www.intensivregister.de/#/aktuelle-lage/zeitreihen Die Zunahme der Gesamtbettenzahl
ist dadurch zu erklären, dass anfangs nicht alle Kliniken an das DIVI-Intensivregister
meldeten, erst ab dem 25. April kann von einer Meldung nahezu aller Kliniken ausgegangen
werden.) Die Höchstzahl der gemeldeten COVID-19- Patienten betrug in Thüringen im
Frühjahr 63 (28. April), die Zahl der COVID-19-Patienten lag damit zu keinem Zeitpunkt in
einem Bereich, bei dem eine Überlastung des Gesundheitssystems zu befürchten gewesen
wäre.

- Diese Einschätzung der tatsächlichen Gefahren durch COVID-19 im Frühjahr 2020


wird bestätigt durch eine Auswertung von Abrechnungsdaten von 421 Kliniken der Initiative
Qualitätsmedizin (https://www.initiative-qualitaetsmedizin.de/ effekte-der-sarscov-2-
pandemie-auf-die-stationaere-versorgungim-ersten-halbjahr-2020), die zu dem Ergebnis kam,
dass die Zahl der in Deutschland im ersten Halbjahr 2020 stationär behandelten SARIFälle
(SARI = severe acute respiratory infection = schwere Atemwegserkrankungen) mit insgesamt
187.174 Fällen sogar niedriger lag als im ersten Halbjahr 2019 (221.841 Fälle), obwohl darin
auch die COVID bedingten SARI-Fälle mit eingeschlossen waren. Auch die Zahl der
Intensivfälle und der Beatmungsfälle lag nach dieser Analyse im ersten Halbjahr 2020
niedriger als im Jahr 2019.

- Auch die Sterbestatistik unterstützt diesen Befund. Laut Sonderauswertung des


Statistischen Bundesamts
(https://www.destatis.de/DE/Themen/Gesellschaft-
Umwelt/Bevoelkerung/Sterbefaelle-
Lebenserwartung/Tabellen/sonderauswertungsterbefaelle.html? nn=209016)
starben im ersten Halbjahr 2020 in Deutschland 484.429 Menschen, im ersten Halbjahr 2019
waren es 479.415, 2018 501.391, 2017 488.147 und 2016 461.055 Menschen. Sowohl 2017 als
auch 2018 gab es danach im ersten Halbjahr mehr Todesfälle als in 2020 (für die weitere
Entwicklung vgl. den CoDAG-Bericht Nr.
4 des Instituts für Statistik der Ludwig-Maximilians-Universität München vom 11.12.2020,

https://www.covid19.statistik.unimuenchen.de/pdfs/bericht4.pdf
).
- Die Schreckenszenarien, die im Frühjahr die Entscheidung über den Lockdown maßgeblich
beeinflussten (dazu näher unter V.1.), beruhten auch auf falschen Annahmen zur Letalität des
Virus (sog. infection fatality rate = IFR) und zur Frage einer bereits vorhandenen bzw.
fehlenden Grundimmunität gegen das Virus in der Bevölkerung. Die Kontagiosität wurde
dagegen von Anfang nicht als dramatisch höher beurteilt als bei einem Influenzavirus (das
Robert Koch-Institut gibt die Basisreproduktionszahl R0 von SARS-CoV-2 mit 3,3 - 3,8 an,
bei Influenza liegt sie nach den meisten Angaben bei 1 - 3, bei Masern bei 12 - 18). Die
Letalität beträgt nach einer Metastudie des Medizinwissenschaftlers und Statistikers John
Ioannidis, eines der meistzitierten Wissenschaftler weltweit, die im Oktober in einem Bulletin
der WHO veröffentlicht wurde, im Median 0,27%, korrigiert 0,23 % und liegt damit nicht
höher als bei mittelschweren
Influenzaepidemien
(https://www.who.int/bulletin/online_first/BLT.20.265892.pdf).

Der Altersmedian der an oder mit SARS-CoV-2 Verstorbenen beträgt in Deutschland 84 Jahre
(vgl. Situationsbericht des RKI vom 05.01.2021, S. 8). Und entgegen den ursprünglichen
Annahmen, die von einer fehlenden Immunität gegen das „neuartige“ Virus ausgingen,
weshalb zum Erreichen einer Herdenimmunität 60-70% Bevölkerung infiziert werden
müssten, gibt es bei bis zu 50% der Bevölkerung, die nicht SARS-CoV-2 exponiert waren,
bereits eine Grundimmunität durch kreuzreaktive T-Zellen, die durch Infektionen mit früheren
Corona-Viren entstanden sind (Doshi, Covid-19: Do many people have pre-existing
immunity?
https://www.bmj.com/content/370/bmj.m3563

dazu auch: SARS-CoV-2: Ist die Grundimmunität größer als


angenommen? DAZ.online vom 14.10.2020,

https://www.deutscheapothekerzeitung.de/news/artikel/2020/10/14/sars-cov-
2istdiegrundimmunitaet-hoeher-als-angenommen).

Da nach allem keine Situation bestand, die ohne einschneidende Maßnahmen zu


„unvertretbaren Schutzlücken“ geführt hätte, sind § 2 Abs. 1 und § 3 Abs. 1 3. ThürSARS-
CoV-2EindmaßnVO auch wenn man der Rechtsauffassung folgt, dass in einer solchen
Situation ein Rückgriff auf Generalklauseln verfassungsgemäß ist, wegen Verstoßes gegen die
Anforderungen der Wesentlichkeitslehre verfassungswidrig.
IV.
Das allgemeine Kontaktverbot bzw. das Ansammlungsverbot gem. § 2 Abs. 1 und § 3 Abs. 1
3. ThürSARS-CoV-2-EindmaßnVO ist aus materiellen Gründen verfassungswidrig, weil es die
in Art. 1 Abs. 1 GG als unantastbar garantierte Menschenwürde verletzt.
Unantastbarkeit der Menschenwürde heißt, dass eine Verletzung der Menschenwürde nicht mit
anderen Grundwerten der Verfassung gerechtfertigt werden kann; der Achtungsanspruch der
Menschenwürde ist kategorisch. Dies bedeutet aber nicht, dass der Inhalt dieses
Achtungsanspruchs, das, was der Würde des Einzelnen geschuldet ist, unabhängig von der
konkreten Situation bestimmt werden könnte. Insbesondere die Rücksicht auf Würde und
Leben anderer prägt den Inhalt des Achtungsanspruchs mit (Maunz/ Dürig/Herdegen, GG, Art.
1 Abs. 1 Rn. 46.) So kann z. B. physischer Zwang oder Freiheitsentzug in bestimmten
Situationen die Würde des Betroffenen verletzen, in anderen dagegen nicht. In den Worten des
Bundesverfassungsgerichts: „Was den Grundsatz der Unantastbarkeit der Menschenwürde
angeht, so hängt alles von der Festlegung ab, unter welchen Umständen sie verletzt sein kann.
Dies lässt sich nicht generell sagen, sondern immer nur in Ansehung des konkreten Falls.“
(BVerfG NJW 1993, 3315). Unbestritten bleibt dabei, dass es einzelne Handlungen gibt, die
unabhängig von dem mit ihnen verfolgten Zweck (Finalität) eine Würdeverletzung darstellen.
Dazu zählen Folter, Genozid oder Massenvertreibung. Daneben gibt es bestimmte
Handlungen, die allein aufgrund ihrer Finalität würdeverletzend sind, als Beispiel ist hier die
rassistische Diskriminierung zu nennen (Herdegen, aaO, Rn. 47). Abgesehen von diesen
Fällen kommt es aber immer auf eine wertende Gesamtwürdigung an. Für diese wird von der
Rechtsprechung häufig die sog. Objektformel herangezogen, nach der die Menschenwürde
betroffen ist, wenn der konkrete Mensch zum bloßen Objekt herabgewürdigt wird. Diese
Formel ist aber insofern nur begrenzt operationalisierbar, als sie nicht frei von tautologischen
Elementen ist. Sie kann daher nur die Richtung weisen, in der Fälle der Verletzung der
Menschenwürde gefunden werden können (BVerfG 30, 1 (25)). Richtungsweisend in diesem
Sinne erscheint auch ein Ansatz, der den Menschenwürdesatz als
Schutz vor Tabuverletzungen begreift (Sachs/Höfling, GG Art. 1 Rn. 18).

Auf den vorliegenden Fall bezogen ergibt sich daraus folgendes: Bei einem allgemeinen
Kontaktverbot handelt es sich um einen schweren Eingriff in die Bürgerrechte. Es gehört zu
den grundlegenden Freiheiten des Menschen in einer freien Gesellschaft, dass er selbst
bestimmen kann, mit welchen Menschen (deren Bereitschaft vorausgesetzt) und unter welchen
Umständen er in Kontakt tritt. Die freie Begegnung der Menschen untereinander zu den
unterschiedlichsten Zwecken ist zugleich die elementare Basis der Gesellschaft. Der Staat hat
sich hier grundsätzlich jedes zielgerichteten regulierenden und beschränkenden Eingreifens zu
enthalten. Die Frage, wie viele Menschen ein Bürger zu sich nach Hause einlädt oder mit wie
vielen Menschen eine Bürgerin sich im öffentlichen Raum trifft, um spazieren zu gehen, Sport
zu treiben, einzukaufen oder auf einer Parkbank zu sitzen, hat den Staat grundsätzlich nicht zu
interessieren.

Mit dem Kontaktverbot greift der Staat – wenn auch in guter Absicht – die Grundlagen der
Gesellschaft an, indem er physische Distanz zwischen den Bürgerinnen und Bürgern erzwingt
(„social distancing“). Kaum jemand konnte sich noch im Januar 2020 in Deutschland
vorstellen, dass es ihm durch den Staat unter Androhung eines Bußgeldes untersagt werden
könnte, seine Eltern zu sich nach Hause einzuladen, sofern er nicht für die Zeit ihrer
Anwesenheit die übrigen Mitglieder seiner Familie aus dem Haus schickt. Kaum jemand
konnte sich vorstellen, dass es drei Freunden verboten sein könnte, zusammen auf einer
Parkbank zu sitzen. Noch nie zuvor ist der Staat auf den Gedanken verfallen, zu solchen
Maßnahmen zur Bekämpfung einer Epidemie zu greifen. Selbst in der Risikoanalyse
„Pandemie durch Virus Modi-SARS“ (BTDrs. 17/12051), die immerhin ein Szenario mit 7,5
Millionen Toten beschrieb, wird ein allgemeines Kontaktverbot (ebenso wie
Ausgangssperren und die weitgehende Stilllegung des öffentlichen Lebens) nicht in Erwägung
gezogen. Als antiepidemische
Maßnahmen werden neben Quarantäne von Kontaktpersonen Infizierter und Absonderung von
Infizierten nur Schulschließungen, die Absage von Großveranstaltungen und
Hygieneempfehlungen genannt (BT-Drs.17/12051, S. 61f).

Wenngleich es scheint, dass es in den Monaten der Corona-Krise zu einer Werteverschiebung


mit der Folge gekommen ist, dass zuvor als absolut exzeptionell betrachtete Vorgänge
inzwischen von vielen Menschen als mehr oder weniger „normal“ empfunden werden, was
selbstverständlich auch den Blick auf das
Grundgesetz verändert, sollte nach dem Gesagten an sich kein Zweifel daran bestehen, dass
mit einem allgemeinen Kontaktverbot der demokratische Rechtsstaat ein – bisher als
vollkommen selbstverständlich angesehenes – Tabu verletzt.

Hinzu kommt und als gesondert zu würdigender Aspekt ist zu beachten, dass der Staat mit
dem allgemeinen Kontaktverbot zum Zwecke des Infektionsschutzes jeden Bürger als
potenziellen Gefährder der Gesundheit Dritter behandelt. Wird jeder Bürger als Gefährder
betrachtet, vor dem andere geschützt werden müssen, wird ihm zugleich die Möglichkeit
genommen, zu entscheiden, welchen Risiken er sich selbst aussetzt, was eine grundlegende
Freiheit darstellt. Ob die Bürgerin abends ein Café oder eine Bar besucht und um der
Geselligkeit und Lebensfreude willen das Risiko einer Infektion mit einem Atemwegsvirus in
Kauf nimmt oder ob sie vorsichtiger ist, weil sie ein geschwächtes Immunsystem hat und
deshalb lieber zu Hause bleibt, ist ihr unter der Geltung eines allgemeinen Kontaktverbotes
nicht mehr zur Entscheidung überlassen. Das freie Subjekt, das selbst Verantwortung für seine
und die Gesundheit seiner Mitmenschen übernimmt, ist insoweit suspendiert. Alle Bürger
werden vom Staat als potenzielle Gefahrenquellen für andere und damit als Objekte betrachtet,
die mit staatlichem Zwang „auf Abstand“ gebracht werden müssen.

Mit der Feststellung, dass mit dem allgemeinen Kontaktverbot ein Tabu verletzt und der
Bürger als Objekt behandelt wird, ist allerdings noch nicht entschieden, ob damit die
Menschenwürde verletzt ist. Im Rahmen der wertenden Gesamtwürdigung ist die Frage zu
beantworten, ob grundsätzlich Umstände denkbar wären, unter denen ein allgemeines
Kontaktverbot dennoch als mit der Würde der Menschen vereinbar angesehen werden könnte.
Da eine Tabuverletzung im Bereich grundrechtseingreifenden Handeln des Staates allenfalls
zur Abwendung einer ganz außergewöhnlichen Notlage hinnehmbar erscheint, wäre dies nur
bei einem allgemeinen Gesundheitsnotstand – einem drohenden flächendeckenden
Zusammenbruch des Gesundheitssystems durch Überlastung bzw. der Drohung von
Todesfällen in vollkommen anderen Dimensionen als bei den regelmäßig vorkommenden
Grippewellen – und auch nur dann gegeben, sofern von dem tabuverletzenden
Grundrechtseingriff ein substantieller Beitrag zur Abwendung oder Begrenzung des
Notstandes zu erwarten wäre. Beides war nicht der Fall. Dass im Frühjahr kein allgemeiner
Gesundheitsnotstand in Deutschland bestand, wurde bereits gezeigt. Dass von einem
allgemeinen Kontaktverbot kein substanzieller Beitrag zur positiven Beeinflussung einer
Epidemie zu erwarten ist, wird unter V. noch näher ausgeführt.
Unter den tatsächlich gegebenen Umständen verletzt der Staat danach mit einem allgemeinen
Kontaktverbot den mit der Menschenwürde bezeichneten Achtungsanspruch der Bürger. V.
Soweit der Auffassung, dass die hier zur Rede stehenden Normen die Menschenwürde
verletzen, nicht gefolgt wird, genügen die Normen jedenfalls nicht dem
Verhältnismäßigkeitsgebot.

Mit dem allgemeinen Kontaktverbot und dem Verbot von Ansammlungen wird in die
allgemeine Handlungsfähigkeit gem. Art. 2 Abs. 1 GG und in Spezialgrundrechte eingegriffen.
Die
Prüfung kann hier auf die Frage der Verhältnismäßigkeit des Eingriffs in die allgemeine
Handlungsfreiheit beschränkt werden, da bei Verneinung der Verhältnismäßigkeit dieses
Eingriffs auch die Eingriffe in die Spezialgrundrechte (soweit die Eingriffe nicht über den
Regelungsinhalt des Kontaktverbotes hinausgehen) unverhältnismäßig sind.

1. Verhältnismäßigkeit setzt voraus, dass mit einem Grundrechtseingriff ein legitimes Ziel
verfolgt wird, der Eingriff geeignet ist, die Zielerreichung zu fördern, der Eingriff erforderlich
ist, weil es kein milderes Mittel gibt, das in gleicher Weise geeignet ist, und er schließlich auch
angemessen, d.h. verhältnismäßig im engeren Sinne ist.

Als Ziel des Lockdowns wurde anfangs ausschließlich die


Verhinderung einer Überlastung des
Gesundheitssystems bezeichnet. In dem Lockdown-Beschluss vom
22.03.2020 gaben die Bundeskanzlerin und die
Ministerpräsidenten der Länder als Ziel an: „Wir müssen alles
dafür tun, um einen unkontrollierten Anstieg der Fallzahlen
zu verhindern und unser
Gesundheitssystem leistungsfähig zu halten.
Dafür ist die Reduzierung von Kontakten entscheidend.“
(https://www.bundesregierung.de/bregde/themen/coronavirus/b esprechung-der-
bundeskanzlerin-mitden-regierungschefinnenund-regierungschefs-der-laender-vom22-03-2020-
1733248).

Um eine Überlastung des Gesundheitssystems durch einen unkontrollierten Anstieg der


Patientenzahlen zu verhindern, sollte der Anstieg der Neuinfektionen gebremst werden, um die
erwartete Zahl an Intensivpatienten auf einen längeren Zeitraum zu verteilen („flatten the
curve“). Dies war auch das maßgebliche
Ziel der Thüringer Landesregierung seit dem Erlass der Thüringer CoronaEindämmungsVO
vom 24.03.2020 und auch der 3. ThürSARS-CoV-2-EindmaßnVO vom 18.04.2020, der eine
erneute Beratung der Bundeskanzlerin mit den Ministerpräsidenten der Länder am 15.04.2020
vorausging, bei der beschlossen wurde, den Lockdown zu verlängern. Da die Ausbreitung des
Virus als unvermeidlich angesehen wurde, ging es anfangs dagegen nicht darum, die Zahl der
Infektionen so gering wie möglich zu halten.
Erst nachdem unübersehbar wurde, dass es zu keiner Überlastung des Gesundheitssystems
kommen würde, wurde als Ziel der Maßnahmen zunehmend die bloße Minimierung der
Infektionszahlen genannt.

Zum Verständnis des Hintergrundes des Lockdown-Beschlusses ist ein im März verfasstes
Strategiepapier des
Bundesinnenministeriums mit dem Titel „Wie wir COVID-19 unter Kontrolle bekommen“
von Bedeutung (das als Verschlusssache deklarierte Papier ist inzwischen auf der Webseite
des Bundesinnenministeriums öffentlich zugänglich https://
www.bmi.bund.de/SharedDocs/downloads/DE/veroeffentlichung
en/2020/corona/szenarienpapier-covid19.html). In diesem Papier wurden in einem Worst-
Case-Szenario über eine Million Tote allein in Deutschland bis Ende Mai 2020 prognostiziert.
Der Bedarf an Intensivbetten sollte in dem Szenario etwa am 09.04.2020 erstmals die Zahl der
verfügbaren Betten übersteigen. Die Pandemie wurde als „größte Herausforderung seit dem
Ende des Zweiten Weltkriege“ bezeichnet - genau diese Worte verwendete auch die
Bundeskanzlerin in ihrer Fernsehansprache vom 18.03.2020, was dafür spricht, dass die
Prognosen aus dem Strategiepapier bei der Entscheidung über den Lockdown eine
maßgebliche Rolle spielten. Allerdings gab es auch im März schon gegenteilige Äußerungen
renommierter Wissenschaftler wie die von John Ioannidis, der in einem Artikel vom
17.03.2020 darauf hinwies, dass die bisher verfügbaren Daten solche Szenarien nicht stützen
könnten (A fiasco in the making? As the coronavirus pandemic takes hold, we are making
decisions without reliable data, StatNews 17.03.2020,

https:// www.statnews.com/2020/03/17/a-fiasco-in-themakingas-the-coronavirus-pandemic-
takes-hold-we-aremakingdecisions-without-reliable-data/).

Bei beiden Zielen – Verhinderung einer Überlastung des Gesundheitssystems und


Minimierung der Infektionen – handelt es sich grundsätzlich um legitime Ziele des
Verordnungsgebers, die Verhältnismäßigkeitsprüfung muss aber für jedes Ziel gesondert
erfolgen. Dabei ist eine von den übrigen Lockdown-Maßnahmen isolierte Betrachtung des hier
zu beurteilenden allgemeinen Kontaktverbotes kaum möglich, aber auch nicht erforderlich, da
die Reduzierung von Kontakten die grundlegende Logik des Lockdowns darstellt. Mit einem
allgemeinen Kontaktverbot müssen zwangsläufig weitere Maßnahmen wie die Schließung von
Einrichtungen einhergehen, da ein allgemeines Kontaktverbot im öffentlichen und privaten
Raum bei gleichzeitiger uneingeschränkter Begegnungsmöglichkeit in Kino, Theater, Konzert,
in Sporteinrichtungen, in der Gastronomie etc. weitgehend leerliefe.
2. Da es für die Geeignetheit einer Maßnahme im Rahmen der
Verhältnismäßigkeitsprüfung als ausreichend angesehen wird, wenn sie die Zielerreichung in
irgendeiner Weise fördert, kann das allgemeine Kontaktverbot als geeignet hinsichtlich beider
Ziele angesehen werden, da unbestreitbar die Reduktion von Kontakten grundsätzlich zur
Reduktion von Infektionen beitragen kann. (Die Frage der Wirksamkeit von Lockdowns ist
damit allerdings noch nicht entschieden.)

3. Um eine Überlastung des Gesundheitssystems zu vermeiden, waren allerdings zum


Zeitpunkt des Erlasses der 3. ThürSARS-CoV2-EindmaßnVO, wie bereits unter III. 3. gezeigt,
die Verhängung eines allgemeinen Kontaktverbotes und auch sonstige Lockdownmaßnahmen
nicht erforderlich.

Da aber dem Verordnungsgeber ein Einschätzungsspielraum einzuräumen ist, stellt sich die
Frage, ob die Landesregierung zum
Zeitpunkt des Verordnungserlasses im Rahmen ihres Einschätzungsspielraumes zu einer
anderen als der hier dargelegten Situationsbewertung kommen und die Anordnung eines
Kontaktverbotes (und anderer Maßnahmen) zur Verhinderung einer Überlastung des
Gesundheitssystems für erforderlich halten durfte. Dazu ist festzuhalten, dass von dem
Verordnungsgeber erwartet werden muss, dass er in Vorbereitung seiner Entscheidungen, die
ihm zur Verfügung stehenden und durch ihn auswertbaren Erkenntnisquellen nutzt und die
dadurch gewonnenen Erkenntnisse in den Entscheidungsprozess einfließen lässt.
Einschätzungsspielraum heißt nicht, dass es dem Verordnungsgeber gestattet wäre, bei
widerstreitenden Ansichten und Bewertungen sich ohne Ausschöpfung der eigenen
Erkenntnismöglichkeiten „auf eine Seite zu schlagen“. Es heißt auch nicht, dass er sich unter
Verweis darauf, dass dem Robert Koch-Institut nach § 4 IfSG vom Bundesgesetzgeber eine
zentrale Stellung bei der Einschätzung des Infektionsgeschehens zuerkannt worden ist, auf die
in den Täglichen Situationsberichten enthaltene zusammenfassende Risikobewertung
zurückziehen und allein wegen einer Risikoeinschätzung für die Gesundheit der Bevölkerung
als „hoch“ bzw. „sehr hoch“ einschneidende Maßnahmen für gerechtfertigt halten dürfte. Der
Verordnungsgeber trägt die volle Verantwortung für die Verfassungsmäßigkeit der von ihm
erlassenen Verordnung und kann diese auch nicht teilweise an das Robert Koch-Institut
delegieren. Um dieser Verantwortung gerecht zu werden, muss er sich – soweit nötig,
selbstverständlich unter Zuhilfenahme sachkundiger Expertise und Beratung – eigene
Sachkunde verschaffen, was vorliegend heißt, dass er sich mit den vom Robert Koch Institut
bereitgestellten Daten und mit Daten aus anderen, ihm zugänglichen Quellen selbst
auseinandersetzen muss.

Unter Beachtung dieser Anforderungen ist die Frage, ob der Verordnungsgeber die
Verlängerung des Lockdowns als erforderlich zur Abwendung einer Überlastung des
Gesundheitssystems erachten durfte, eindeutig mit „Nein“ zu beantworten. Dem
Verordnungsgeber standen die Daten des Intensivregisters zur Verfügung; unabhängig davon
war ihm eine Abfrage der Situation in den Thüringer Kliniken ohne weiteres möglich und
wurde sehr wahrscheinlich auch durchgeführt. Auch die oben bereits erläuterten Daten aus den
Täglichen Situationsberichten und dem Epidemiologischen Bulletin 17/2020 des Robert Koch-
Instituts standen dem Verordnungsgeber zur Verfügung. Die Grafik über den Verlauf der
Neuerkrankungen wurde erstmals im Situationsbericht vom 15.04.2020 veröffentlicht, konnte
daher vom Verordnungsgeber berücksichtigt werden. Davor hatte das Robert Koch-Institut
bereits wochenlang eine Grafik zum Verlauf der Neuerkrankungen veröffentlicht, die zwar
weniger genau war, weil in ihr bei den Fällen, bei denen der Erkrankungsbeginn nicht bekannt
war, keine Schätzung des Erkrankungsbeginns vorgenommen, sondern ersatzweise das
Meldedatum verwendet wurde (z. B. Täglicher
Situationsbericht vom 01.04.2020, S. 4, Abb. 3), aber auch dieser
Grafik war zu entnehmen, dass der
Höhepunkt der Neuerkrankungen bereits Mitte März erreicht war. Die am 15.04.2020
veröffentlichte Grafik kam daher keinesfalls überraschend, sondern entsprach ziemlich genau
dem, was bereits wochenlang in den Situationsberichten zum Verlauf der Neuerkrankungen
veröffentlicht wurde. Der Verordnungsgeber konnte danach wissen, dass die Zahl der
Neuinfektionen in Deutschland bereits seit Mitte März sank. Es gab danach für ihn keinen
Grund für die Annahme, es könnte doch noch eine Welle von COVID-19-Patienten auf die
Thüringer Kliniken zukommen. Dafür hätte es eine Trendumkehr geben müssen, für die es
keinerlei Anhaltspunkte gab.

Der Verordnungsgeber konnte aus den Daten des Robert KochInstituts auch erkennen, dass es
keine Hinweise auf die Wirksamkeit des am 22. März beschlossenen Lockdowns gab, so dass
für den Fall der Aufhebung des Lockdowns auch nicht mit einem erneuten Anstieg der
Infektionen zu rechnen war. Schließlich war für den Verordnungsgeber auch ohne weiteres
erkennbar, dass selbst für den Fall eines – entgegen den sich aus dem bisherigen Verlauf der
Epidemie ergebenden Erwartungen – erneuten Anstieges der Neuinfektionen aufgrund der
enormen Zahl freier Betten (528 freie Intensivbetten bei 56 COVID19Patienten am 16. April)
noch ausreichend Zeit bliebe, um auf die veränderte Situation zu reagieren. Es gab also auch
bei einem ungeachtet der klaren Datenlage verbliebenen Misstrauen hinsichtlich der Stabilität
der Entwicklung keinen Grund für eine vorsorgliche Verlängerung des Lockdowns. Und nicht
zuletzt hätte es der Landesregierung zu denken geben und das Vertrauen in die eigene
Bewertung der Situation stärken müssen, dass sich Schreckensszenarien wie die aus dem
Strategiepapier des Bundesinnenministeriums vom März ganz offensichtlich als science-
fiction erwiesen hatten.

4. Soweit die Minimierung der Infektionen als eigenständiges Ziel, unabhängig von der Frage,
ob eine Überlastung des
Gesundheitssystems drohte, verfolgt wurde, ist das Kontaktverbot in Bezug auf dieses Ziel
als erforderlich anzusehen, da ohne ein Kontaktverbot die Erreichung des Ziels nicht in
gleicher Weise gefördert werden konnte. Es ist aber nicht verhältnismäßig im engeren Sinne.
a. Für die Prüfung der Verhältnismäßigkeit im engeren Sinne sind der Nutzen der
Maßnahmen und die Kosten, die sich aus den Freiheitseinschränkungen und ihren
Kollateralschäden und Folgekosten zusammensetzen, gegeneinander abzuwägen. Dafür
müssen die Vorteile und die Nachteile beschrieben, gewichtet und bewertet werden
(Murswiek, Verfassungsrechtliche Probleme der Corona-Bekämpfung. Stellungnahme für die
Enquete-Kommission 17/2 „Corona-Pandemie“ des Landtags Rheinland-Pfalz, S. 24,

https://dokumente.landtag.rlp.de/landtag/vorlagen/2-1217.pdf).

b. Als Nutzen des Lockdowns wäre die Zahl der verhinderten COVID-19-Todesfälle und
schweren Erkrankungen anzusehen, wobei, präzise formuliert, nach dem Nutzen zu fragen ist,
den der Verordnungsgeber zum Zeitpunkt des Verordnungserlasses am
18.04.2020 unter Berücksichtigung seines
EinschätzungsSpielraums berechtigterweise erwarten durfte. Hierzu ist erneut darauf zu
verweisen, dass der Verordnungsgeber wissen musste, dass die Zahl der Neuinfektionen
bereits seit Mitte März sank, dass die effektive Reproduktionszahl seit Beginn des Lockdowns
am 23.03.2020 um den Wert 1 schwankte und ein positiver Effekt des bereits dreieinhalb
Wochen andauernden Lockdowns nicht erkennbar war. Auch die Grafik betreffend den
Verlauf der Neuerkrankungen zeigte eine nahezu gleichmäßig abfallende Kurve ohne
erkennbare Stufung, so dass auch an ihr ein Effekt des Lockdowns nicht ablesbar war. Dafür,
dass die Zahl der Neuerkrankungen durch die Verlängerung des Lockdowns mit der
Verordnung vom 18.04.2020 signifikant beeinflusst werden könnte, gaben die Daten des
Robert Koch-Instituts keinerlei Anhaltspunkte. Der Verordnungsgeber konnte somit allenfalls
eine sehr geringfügige Reduzierung der Zahl der Neuerkrankungen (und damit der Todesfälle)
erwarten. Tatsächlich zeigte die Fortschreibung der Kurve der Neuerkrankungen in den
Täglichen Situationsberichten dann auch nach dem 18.04.2020 keinen erkennbaren Effekt der
Verlängerung des Lockdowns.

Dass der Lockdown seit dem 23. März keinen messbaren Effekt hatte, ist auch insofern nicht
überraschend, als die WHO erst in einer im Oktober 2019 veröffentlichten Metastudie zur
Wirksamkeit von sog. nicht-pharmazeutischen Interventionen (non-pharmaceutical
interventions = NPI) bei Influenzaepidemien zu dem Ergebnis kam, dass es für die
Wirksamkeit sämtlicher untersuchter Maßnahmen (Arbeitsstättenschließungen, Quarantäne,
social distancing u.d.) nur geringe oder gar keine Evidenz gebe (Non-pharmaceutical public
health measures for mitigating the risk and impact of epidemic and pandemic influenza,
https://www.who.int/influenza/publications/public_health_meas ures/publication/en/). Ob
diese Studie von der Bundesregierung oder der Landesregierung vor der Entscheidung über
den Lockdown zur Kenntnis genommen wurde, ist dem Gericht nicht bekannt, angesichts der
Folgenschwere der Entscheidung konnte aber erwartet werden, dass die verfügbaren
wissenschaftlichen Erkenntnisse zu Lockdowns bzw. NPIs ausgewertet werden.

Inzwischen gibt es mehrere wissenschaftliche Studien, die zu dem Ergebnis kommen, dass die
in der Corona-Pandemie in verschiedenen Ländern angeordneten Lockdowns nicht mit einer
signifikanten Verringerung von Erkrankungs- und Todeszahlen verbunden waren. Eine im
August in der Fachzeitschrift EClinicalMedicine veröffentlichte Beobachtungsstudie
(Chaudhry, A country level analysis measuring the impact of government actions, country
preparedness and socioeconomic factors on COVID-19 mortality and related health outcomes,
https://www.thelancet.com/action/showPdf?pii=S25895370%28
20%2930208-X), in der die 50 Länder mit den meisten registrierten Fällen von
COVID-19 zum Stichtag 01.04.2020 untersucht und Daten aus öffentlich zugänglichen Zahlen
für den Zeitraum 01.04. bis 01.05.2020 ausgewertet wurden, kam zu dem Ergebnis, dass die
Faktoren, die am stärksten mit der Zahl der COVID-19-Todesfälle in einem Land korrelieren,
die Adipositasrate, das Durchschnittsalter der Bevölkerung und das Ausmaß der
Einkommensunterschiede sind. Zwischen der Schwere und Dauer der Lockdowns und der
Zahl der COVID-19-Todesfälle, zwischen Grenzschließungen und COVID19-Todesfällen und
zwischen durchgeführten Massentests und COVID-19-Todesfällen konnte dagegen keine
Korrelation festgestellt werden, was für fehlende oder jedenfalls nur schwache Kausalität
spricht. Diese Ergebnisse wurden durch eine im November veröffentlichte Studie (De
Larochelambert, Covid-19
Mortality: A Matter of Vulnerability Among Nations Facing Limited
Margins of Adaptation,
https://www.frontiersin.org/articles/10.3389/fpubh.2020.604339 /full), in welcher für 160
Länder der Einfluss verschiedenster Faktoren auf die Anzahl der COVID-19-Todesfälle
untersucht wurde, und zuletzt durch eine Studie von Bendavid/Ioannidis bestätigt
(Bendavid/Ioannidis, Assessing mandatory stay-at-home and business closure effects on the
spread of COVID-19, https:// onlinelibrary.wiley.com/doi/epdf/10.1111/eci.13484; Hinweise
auf weitere Studien bei Kuhbandner, Warum die Wirksamkeit des Lockdowns
wissenschaftlich nicht bewiesen ist).

Auch der im November zunächst nur für einen Monat (“Wellenbrecherlockdown“)


angeordnete und inzwischen zweimal verlängerte Lockdown erbringt offensichtlich noch
einmal den Beweis, dass sich mit Lockdowns das Infektionsgeschehen und insbesondere die
Zahl der tödlich verlaufenden Fälle nicht signifikant beeinflussen lässt. Nach dem aktuellen
Thesenpapier der Autorengruppe um Schrappe (Thesenpapier 7 vom
10.01.2021, S. 5, 24f, http://www.matthias.schrappe.com/index_htm_files/
Thesenpap7_210110_endfass.pdf)
ist die Lockdown-Politik gerade für die vulnerablen Gruppen, für die COVID-19 die größte
Gefahr darstellt, wirkungslos. Zu demselben Ergebnis kommt auch der bereits erwähnte
CoDAGBericht Nr. 4 des Instituts für Statistik der LMU München.
c. Hinsichtlich der Kosten des Lockdowns ist zunächst erneut festzuhalten, dass es sich bei den
mit dem Lockdown verbundenen Freiheitseinschränkungen um die umfassendsten und
weitreichendsten Grundrechtseinschränkungen in der Geschichte der Bundesrepublik handelte.
Schon daraus ergibt sich, dass die Freiheitseinschränkungen ein so großes Gewicht haben, dass
sie allenfalls dann gerechtfertigt sein können, wenn die Gefahr, deren Bekämpfung sie dienten,
ganz außergewöhnlich groß war (Murswiek, aaO, S. 33) und durch die Maßnahmen des
Lockdowns zugleich ein großer positiver Effekt erwartet werden konnte, was aber nach dem
Gesagten nicht der Fall war.

Zu der unmittelbaren Wirkung der Freiheitseinschränkungen kommen die Kollateralschäden


und Folgeschäden hinzu. Diese lassen sich (vgl. Murswiek, aaO, S. 33-38) wie folgt
differenzieren:
aa) Ökonomisch bewertbare Schäden (1)
Gewinneinbußen/Verluste von Unternehmen-HandwerkernFreiberuflern, die unmittelbare
Folgen der an sie adressierten Freiheitseinschränkungen sind Gewinneinbußen/Verluste von
Unternehmen/Handwerkern/Freiberuflern, die mittelbare Folgen der Lockdown-Maßnahmen
sind (z.B. Gewinneinbußen von Zulieferern von unmittelbar betroffenen Unternehmen;
Gewinneinbußen, die aus der Unterbrechung von Lieferketten resultieren und z.B. zu
Produktionsausfällen führten;
Gewinneinbußen, die aus Reisebeschränkungen resultierten)
Lohn- und Gehaltseinbußen durch Kurzarbeit oder Arbeitslosigkeit
Konkurse/Existenzvernichtungen Folgekosten von Konkursen und Existenzvernichtungen.

Dazu mit Murswiek (aaO, S. 33f): „Die meisten dieser Schäden werden sich ziemlich genau
ermitteln lassen. Sie sind insgesamt mit Sicherheit gigantisch. Eine Vorstellung von ihrer
Größenordnung erhält man, wenn man sich vor Augen hält, welche Summen der Staat als
Corona-Hilfen in den Wirtschaftskreislauf einspeist. So umfasst der von der Bundesregierung
beschlossene „Corona-Schutzschild“ 353,3 Mrd. Euro Zuschüsse und zusätzlich 819,7 Mrd.
Euro Garantien, also insgesamt über 1 Billion Euro. Es handelt sich, wie die Bundesregierung
sagt, um das größte Hilfspaket in der Geschichte Deutschlands. Hinzu kommen Hilfen der
Länder. Da die staatlichen Hilfen großenteils Kredite beziehungsweise Kreditgarantien
umfassen, stehen ihnen nicht notwendigerweise entsprechend hohe Verluste der privaten
Wirtschaft gegenüber. Andererseits werden die privaten Verluste jedenfalls
wesentlich größer sein als die staatlichen
Entschädigungen oder als verlorene Zuschüsse gezahlten Hilfsgelder.
Noch nie zuvor in der Geschichte der Bundesrepublik Deutschlands sind wirtschaftliche
Schäden in dieser Größenordnung durch eine staatliche Entscheidung verursacht worden. Was
die Bewertung der Schäden der Privatwirtschaft und der privaten Haushalte angeht, so muss
berücksichtigt werden, dass die Einbußen zum Teil durch staatliche Leistungen kompensiert
worden sind oder noch kompensiert werden. Die staatlichen Leistungen vermindern also den
ökonomischen Schaden der privaten Wirtschaftssubjekte. Sie vermindern aber nicht den
volkswirtschaftlichen Gesamtschaden, denn sie belasten ja die öffentlichen Haushalte und
somit letztlich die Steuerzahler. Diese Kosten dürfen bei der Berechnung der Nachteile des
Lockdown nicht unter den Tisch fallen.“

bb) Leben und Gesundheit der Menschen in Deutschland (1) die Zunahme häuslicher Gewalt
gegen Kinder und Frauen Zunahme von Depressionen infolge sozialer Isolation
AngstPsychosen/Angst-
Störungen infolge Corona-Angst andere psychische Störungen/nervliche Überlastung wegen
familiärer/persönlicher/beruflicher Probleme infolge des Lockdown, Zunahme von Suiziden,
beispielsweise infolge von Arbeitslosigkeit oder Insolvenz(6) gesundheitliche
Beeinträchtigungen infolge von Bewegungsmangel Unterlassung von Operationen und
stationären Behandlungen, weil Krankenhausbetten für Coronapatienten reserviert wurden
Unterlassung von Operationen, stationären Behandlungen, Arztbesuchen, weil Patienten
Infizierung mit Covid-19 befürchten
Diese Folgen hätten vor der Entscheidung über den Lockdown jedenfalls grob abgeschätzt
werden müssen. Für die Verhältnismäßigkeitsprüfung ist es vorliegend ausreichend, wenn zur
Erläuterung einzelne Schlaglichter geworfen werden:

Zu (1): Für Berlin wurde durch die Senatsverwaltung für das erste Halbjahr 2020 ein Anstieg
der Kindesmisshandlungen um 23% berichtet (Gewalt eskaliert in Berlin immer häufiger. Der
Tagesspiegel vom 02.07.2020,

https://www.tagesspiegel.de/berlin/corona-krise-trifft-frauenundkinder-besonders-gewalt-
eskaliert-inberlinimmerhaeufiger/25970410.html).

Laut einer repräsentativen Befragungstudie (Steinert/Ebert,


Gewalt an Frauen und Kindern in Deutschland während COVID19bedingten
Ausgangsbeschränkungen,

https://drive.google.com/file/d/19Wqpby9nwMNjdgO4_FCqqlfYy LJmBn7y/view)

wurden in der Zeit des Lockdowns im Frühjahr rund 3 Prozent der Frauen in Deutschland zu
Hause Opfer körperlicher Gewalt, 3,6 Prozent wurden von ihrem Partner vergewaltigt, in 6,5
Prozent aller Haushalte wurden Kinder gewalttätig bestraft.

Zu (5): Die Zahl der Suizide, die in Deutschland statistisch erfasst wird, liegt für das Jahr 2020
zwar noch nicht vor, einen Hinweis auf einen möglicherweise erheblichen Anstieg der Suizide
gibt aber folgende Mitteilung der Senatsinnenverwaltung Berlin: Bis Oktober gab es bei der
Berliner Feuerwehr unter dem Stichwort „Beinahe Strangulierung/ Erhängen, jetzt wach mit
Atembeschwerden“ (Einsatzcode 25D03) 294 Einsätze, im Jahr 2018 gab es dagegen nur
sieben und im Jahr 2019 nur drei solcher Einsätze (Möglicher Suizid: Zahl der
Rettungseinsätze steigt massiv an. Berliner Zeitung vom 10.11.2020,

htttps://www.berliner-zeitung.de/news/berliner-feuerwehr-
zahlder-einsaetze-wegen-moeglichem-suiziden-steigt-massivanli.117723)

Zu (7): Während des Lockdowns im Frühjahr wurden in Deutschland mehr als 908.000
Operationen abgesagt, und zwar nicht nur sog. elektive Operationen wie die Implantation von
Kniegelenks- und Hüftgelenksendoprothesen,
Kniegelenksarthroskopien, Katarakt-Operationen u.ä., sondern auch 52.000 Krebs-
Operationen (In Deutschland wurden fast eine Million Operationen abgesagt. WELT v.
29.05.2020, https://www.welt.de/ wirtschaft/article208557665/WegenCorona-In-Deutschland-
wurden-908-000-OPsaufgeschoben.html). Laut einer im British Medical Journal im November
veröffentlichten Meta-Analyse (Hanna, Mortality due to cancer treatment delay: systematic
review and meta-analysis, BMJ 2020, 371, https://www.bmj.com/content/371/bmj.m4087)
erhöht bereits eine vierwöchige Verschiebung einer Krebstherapie das Sterberisiko je nach
Krebsart um sechs bis 13 Prozent, ein Aufschub von acht Wochen bei Brustkrebs das
Sterberisiko um 13 Prozent, ein Aufschub um zwölf Wochen um 26 Prozent. Ohne dies hier
näher beziffern zu können, kann danach kein Zweifel daran bestehen, dass die Absage von
Operationen auch in Deutschland zu Todesfällen geführt hat.
Zu (8): In einer Studie des Klinikums Hochrhein Waldshut-Tiengen
(Kortüm, CoronaIndependent Excess Mortality Due to Reduced Use of Emergency Medical
Care in the Corona Pandemic: A Population-Based Observational Study,

https://www.medrxiv.org/
content/10.1101/2020.10.27.20220558v1) wurde die
Übersterblichkeit im Landkreis Waldshut (170.000 Einwohner) im
April 2020 untersucht. Dort starben im Durchschnitt der Jahre 2016 bis 2019 im April 165
Menschen, 2020 waren es 227, was einer Übersterblichkeit von 37 Prozent entspricht. Von den
62 zusätzlichen Todesfällen ließen sich aber nur 34 mit Corona in Verbindung bringen, 28 und
damit 45% der Übersterblichkeit gingen auf andere Todesursachen zurück. Die Studienautoren
führen diese Fälle auf die reduzierte Nutzung medizinischer Notfallstrukturen zurück, wofür
auch spricht, dass mehr als doppelt so viele Menschen als im Vergleichsdurchschnitt tot alleine
zu Hause aufgefunden wurden. Ähnliche Untersuchungen für andere Regionen Deutschlands
fehlen. Kuhbandner hat aber mit einer Gegenüberstellung der Anzahl der Todesfälle in
Deutschland im Zeitraum 1.-47. Kalenderwoche mit dem
Durchschnitt der Jahre 2016-2019 und der Anzahl der mit oder am SARS-CoV-2-Virus
verstorbenen Personen gezeigt, dass nur 51,1 % der Übersterblichkeit auf mit oder am SARS-
CoV-2Virus verstorbene Personen zurückgeht (Kuhbandner, Über die ignorierten
Kollateralschäden von Lockdowns,

https://www.heise.de/tp/features/Ueber-die-ignorierten- Kollateralschaedenvon-Lockdowns-
4993947.html?seite=all).

Dies bedeutet zwar nicht, dass sämtliche anderen Übersterblichkeitstodesfälle als


Kollateralschäden des Lockdowns gewertet werden könnten, insbesondere die starke
Übersterblichkeit in der 33. Kalenderwoche ist vermutlich auf eine Hitzewelle
zurückzuführen. Dennoch geben diese Zahlen einen deutlichen Hinweis auf Todesfälle, die auf
unterbliebene oder verspätete Inanspruchnahme medizinischer Versorgung aus Angst vor
Corona-Infektionen zurückzuführen sind.

cc) Ideelle Schäden


(1) Bildungseinbußen und Beeinträchtigung der psychosozialen Entwicklung von Kindern
durch Ausfall oder Einschränkungen des
Schulunterrichts bzw. der Schließung anderer Bildungseinrichtungen

Verlust an kulturellen Anregungen/Erlebnissen durch Schließung von Theatern, Konzert- oder


Opernhäusern und vielen anderen kulturellen Einrichtungen, Verlust musischer
Entfaltungsmöglichkeiten durch Verbote, die gemeinsames Musizieren in Orchestern oder
Chören unterbinden Verlust von Gemeinschaftserlebnissen/persönlichem sozialem
Miteinander durch Verbot von Zusammenkünften in Vereinen, Verbot von Veranstaltungen,
Verbot von Ansammlungen, Schließung von Kneipen usw.

Einschränkung sozialer Entwicklungsmöglichkeiten für Kinder durch Schließung von


Kindergärten Isolierung von Kindern in Wohnungen ohne Kontakte zu anderen Kindern durch
Schließung von Schulen, Kindergärten und Spielplätzen Zu (1) Die Schule ist nicht nur ein Ort
der Wissensvermittlung, sondern ein Ort sozialen Lernens. Durch die Schulschließungen
entfällt das soziale Lernen praktisch vollständig, die Vereinzelung der Kinder und
Jugendlichen wird gefördert. Homeschooling kann gerade von Eltern in migrantischen oder
bildungsfernerem Milieu nicht geleistet werden. Die soziale Spaltung der Gesellschaft wird
daher verstärkt. Auch das Erlernen der deutschen Sprache bei Kindern aus migrantischen
Familien wird massiv gestört. Zu diesen Problemen gibt es inzwischen eine Vielzahl von
Berichten aus der Praxis (exemplarisch:
„Der Stand in Deutsch? Der ist bei einem Drittel der Schüler katastrophal". WELT vom
11.01.2021,
https://www.welt.de/politik/deutschland/plus224000152/Geschl ossene-Schulen-Was-das-fuer-
Kinder-in-sozialen-
Brennpunktenbedeutet.html), wissenschaftliche Studien stehen – soweit ersichtlich – noch
aus.

dd) Folgekosten
(1) von Bund und Ländern an die Wirtschaftssubjekte geleistete Corona-Hilfen Steuerausfälle
infolge der Einschränkung der Wirtschaftstätigkeit durch den Lockdown Kurzarbeitergeld und
Arbeitslosenhilfe, die infolge des Lockdown gezahlt werden mussten Sozialhilfe für infolge
des Lockdown auf Sozialhilfe angewiesene Menschen Allein der „Corona-Schutzschild“, ein
am 27.03.2020 beschlossenes Gesetzespaket, hatte ein Volumen von 1,173 Billionen Euro
(353,3 Mrd. Euro Hilfsleistungen, 819,7 Mrd. Euro Garantien. Die letzten Bundeshaushalte
hatten ein Volumen von 356,4 Mrd. Euro (2019) und 346,6 Mrd. Euro (2018). Auch wenn die
gegebenen Garantien nicht per se „verloren“ sind, dürften die Belastungen insgesamt die Höhe
von mehreren Bundeshaushalten erreichen (Murswiek, aaO, S. 38).
ee) gesundheitliche und ökonomische Schäden in Ländern des Globalen Südens
Der Lockdown im Frühjahr in Thüringen war Teil eines aus 16 Lockdowns der Bundesländer
zusammengesetzten, ganz
Deutschland umfassenden Lockdowns, der wiederum im Zusammenhang mit der Lockdown-
Politik in nahezu allen Ländern der westlichen Welt gesehen werden muss. Daher ist es
berechtigt und notwendig, auch nach den Auswirkungen dieser Politik auf die Länder des
Globalen Südens zu fragen. Die hier bereits eingetretenen bzw. noch zu erwartenden
Kollateralschäden sind enorm. Gründe sind die Unterbrechung von
AntiTuberkuloseProgrammen, die Unterbrechung von
Impfprogrammen gegen Kinderkrankheiten, Unterbrechungen in der
Nahrungsmittelversorgung durch den Zusammenbruch von Lieferketten u.a.m. Die UN
rechnet mit dem Hungertod von mehr als 10.000 Kindern pro Monat im ersten Pandemiejahr
(Mehr als 10.000 Kinder verhungern wegen Corona jeden Monat, RP Online vom
28.07.2020,

https://rponline.de/panorama/coronavirus/mehr-als10000kinder-verhungern-jeden-monat-
krisedurchcoronaverschaerft_aid-52446949)

Allein in Afrika werden laut Bundesentwicklungsminister Müller zusätzlich 400.000 Opfer


durch Malaria und HIV und eine halbe Million Tuberkulose-Tote als Folge des Lockdowns
erwartet (Mehr Corona-Opfer durch Lockdown als durch das Virus: In Afrika wurden die
Krisen massiv verschärft, Berliner Zeitung vom 01.10.2020, https://www.berliner-
zeitung.de/gesundheitoekologie/mehrtotedurch-lockdown-als-durch-corona-in-afrikahat-
diepandemie-die-krisen-massiv-verschaerft-li.108228).
Laut einem Artikel von John Ioannidis (Global perspective of COVID-19 epidemiology for a
full-cycle pandemic, https://onlinelibrary.wiley.com/doi/full/10.1111/ eci.13423) sollen in den
nächsten 5 Jahren sogar 1,4 Millionen zusätzliche TuberkuloseTote zu befürchten sein.
Langfristig werde die Übersterblichkeit durch die Maßnahmen wahrscheinlich deutlich größer
als die Zahl der COVID-19-Toten sein.

Da die Lockdown-Politik in Thüringen ein – wenn auch natürlich sehr kleiner – Teil einer
nahezu alle westlichen Industrieländer betreffenden Lockdown-Politik ist, sind diese Schäden,
soweit sie nicht aus von den betroffenen Staaten selbst zu verantwortenden politischen
Entscheidungen resultieren, sondern indirekte Folge der Lockdowns in den Industrieländern
sind, auch anteilig ihr zuzurechnen und deshalb grundsätzlich in die
Verhältnismäßigkeitsprüfung mit einzustellen.

d. Nach dem Gesagten kann kein Zweifel daran bestehen, dass allein die Zahl der Todesfälle,
die auf die Maßnahmen der Lockdown-Politik zurückzuführen sind, die Zahl der durch den
Lockdown verhinderten Todesfälle um ein Vielfaches übersteigt. Schon aus diesem Grund
genügen die hier zu beurteilenden Normen nicht dem Verhältnismäßigkeitsgebot. Hinzu
kommen die unmittelbaren und mittelbaren Freiheitseinschränkungen, die gigantischen
finanziellen Schäden, die immensen gesundheitlichen und die ideellen Schäden. Das Wort
„unverhältnismäßig“ ist dabei zu farblos, um die Dimensionen des Geschehens auch nur
anzudeuten. Bei der von der Landesregierung im Frühjahr (und jetzt erneut) verfolgten Politik
des Lockdowns, deren wesentlicher Bestandteil das allgemeine Kontaktverbot war (und ist),
handelt es sich um eine katastrophale politische Fehlentscheidung mit dramatischen
Konsequenzen für nahezu alle Lebensbereiche der Menschen, für die Gesellschaft, für den
Staat und für die Länder des Globalen Südens.
Kapitel Nr. 12 – Ironie am Rande

Nichts liegt den Politikern und der Pharma-Mafia mehr am Herzen, wie die Volksgesundheit.
Das erkennt man daran, wie hier Milliarden verpulvert werden, immer neue Krankenhäuser
entstehen und immer weitere Intensivbetten angeschafft und mit Personal versehen werden.
Die Bestatter müssten eigentlich Kurzarbeit machen, wäre da nicht heute die Schlagzeile zu
lesen:

"Wir stehen schlechter da als vor einem Jahr." https://www.welt.de/.../Corona-Patienten-in-


Kliniken-Wir...
Scheinbar haben also alle die Masken, das ständige Einreiben der Hände mit Alkohol-Gel, der
soziale Abstand und die zig Millionen Impfungen nicht das gebracht, was man sich eigentlich
hätte davon versprechen müssen. Mainstream und die ganzen wissenschaftlichen Experten
lagen also alle zusammen komplett daneben - das beweisen die Fallzahlen. Es ist müßig, zu
fragen, wo wir heute ständen, hätte man auf das eigene Immunsystem vertraut und Corona
einfach als weitere klinische Krankheit behandelt. Ich tippe mal, dass wir dann längst die
vielumwobene Herdenimmunität erreicht hätten - ohne tausende Impftote. Weltweit sind es
mittlerweile über eine Million Menschen, die an den Scheiß-Impf-Plörren gestorben sind.
Dieser Schnellschuss ist vollkommen nach hinten losgegangen.
Kapitel Nr. 13 – Interview mit Prof. Dr. Sucharit Bhakdi

Talk Spezial 29.04.2020

Dr. Ferdinand Wegscheider interviewt Prof. Dr. Sucharit Bhakdi

- "Wir sind zu Gast bei Herrn Professor Dr. Sucharit Bhakdi, einem renommierten
Mikrobiologen und Infektionsepidemiologen. Guten Tag und vielen Dank, Herr Professor.

- "Guten Tag"

- "In der humanmedizinischen Forschung ist Herr Professor Bhakdi seit vielen Jahren, um
nicht zu sagen Jahrzehnten bekannt und anerkannt. Er hat als 20 Jahre lang das Institut für
medizinische Mikrobiologie an der Uni Mainz geleitet, tausende Ärzte ausgebildet und ist
vielfach ausgezeichnet für seine Erfolge in der Forschung.
Seit einigen Wochen ist er Millionen von Internet-Usern aber überdies auch bekannt für seine
Kritik an den CoronaMaßnahmen. Das sind Millionen von Menschen, die sich im Internet
informieren, weil sie den Eindruck haben, dass Kritik an den CoronaMaßnahmen in den
öffentlichen Medien und den öffentlichrechtlichen Fernsehanstalten weitgehend ausgespart
bleibt.
Deswegen sind wir heute hier und darüber wollen wir heute reden. Herr Professor Bhakdi, Sie
sind renommierter Arzt und Forscher, Sie haben jahrzehntelang gelehrt, Ärzte ausgebildet und
sind seit einigen Jahren eigentlich im Ruhestand. Nachdem Sie jetzt im Internet Kritik
geäußert haben an den Corona-Maßnahmen, sind Sie von vielen Medien angegriffen und als
fragwürdig hingestellt worden. Bereuen Sie es, dass Sie die Stimme erhoben haben?"

- "Natürlich nicht, denn ich hab meine Stimme nicht erhoben, um irgendwelche Menschen
herauszufordern, sondern weil ich es als meine Pflicht empfunden habe, das zu tun. Wissen
Sie, wenn etwas nicht richtig läuft in einem Land und wenn man denkt, dass seinen
Mitmenschen ein Unrecht angetan wird, dann hat man die Pflicht als Bürger eines Landes
aufzustehen und seine Meinung zu sagen. Ich habe Kritik geäußert, aber die Kritik war nicht
destruktiv, die war konstruktiv gemeint und so bleibt es bis heute."

- "Nun haben auch viele Kritiker den Regierungen, die in vielen Ländern einen Lockdown
verhängt und die Wirtschaft fast auf null heruntergefahren haben, gesagt, zunächst waren die
Maßnahmen in den ersten Tagen und Wochen aus Vorsicht sicher gerechtfertigt, aber
aus heutiger Sicht sind sie das nicht mehr. Warum?"

- "Nun, die Meinungen, ob ein Lockdown überhaupt Sinn macht oder nicht, gehen von
vorneherein auseinander. Die WHO selbst hat im letzten Herbst geschrieben,
dass Lockdowns nicht funktionieren werden. Warum diese Meinung plötzlich geändert wurde,
drei Monate später wird ihr Geheimnis bleiben. Ich hätte einen Lockdown nie befürwortet,
aber ich hätte Verständnis dafür gehabt in den ersten Wochen. Das habe ich auch wiederholt
gesagt, das kann man der Regierung nicht zum Vorwurf machen. Nur, wissen Sie, die
Tatsache ist, und das ist von
Professor Homburg (Anmerkung: Prof. Dr. Stefan Homburg, Uni Hannover) so deutlich
dargelegt worden in den letzten Tagen, dass die Epidemie bereits am Abebben war, als dieser
Lockdown kam. Das ist das, was nicht in Ordnung gewesen ist aus meiner Sicht, und das war
auch der Grund, weswegen ich
mich geäußert habe dazu. Die Epidemie war Ende März bereits am Abebben und ist weiterhin
am Abebben trotz aller Behauptungen zum Gegenteil. Das ist der Fall.
Deshalb war ein Lockdown eigentlich von sehr fragwürdigem Wert und hätte auf jeden Fall
vor zwei Wochen oder vor zehn Tagen aufgehoben werden müssen."

- "Damit stimmt es aber auch nicht, wie viele Regierungen argumentieren, dass eben durch
den Lockdown die Epidemie so schnell abgeebbt ist?"

- "Ich denke, es ist hinlänglich klar geworden, dass der Lockdown nichts erwirkt hat.
Konnte auch nicht, kam zu spät. Und wenn man ganz nüchtern beispielsweise Schweden
betrachtet, Schweden ist als einziges Land hingegangen und hat den Mut gehabt, es anders
zu tun als alle anderen (Länder). Es ist auch nichts anders passiert in Schweden. Die
Zahlen sind genauso niedrig an Corona-Toten, wie hier in Deutschland. Diese ganze
Aufregung und der Aufruhr sind umsonst gewesen."

- "Die Lockdowns wurden ja verhängt, von den Regierungen, weil es geheißen hat, dass
das Corona-Virus so besonders gefährlich sei. Deshalb ist die zentrale Frage ja nach wie
vor: Wie gefährlich ist dieses Virus denn nun tatsächlich?"
- "Als ich mich zum ersten Mal geäußert habe, habe ich gerade diese Frage angesprochen.
Ich habe gesagt, bevor wir Zahlen haben, klare Zahlen, klare Informationen, dürfen wir
nichts machen, weil aufgrund von Hochrechnungen -
Hochrechnungen sind immer spekulativ, und man kann nicht so wichtige Entscheidungen
treffen aufgrund von
Hochrechnungen. Und die erste Frage, das war auch die erste Frage, die ich an die
Kanzlerin gestellt habe: "Wie unterscheiden Sie zwischen jemand, der ins Krankenhaus
geliefert wird, wegen einer Corona-Infektion, einer schweren oder mit? Wie unterscheiden
Sie" -das war die zweite Frage- "ob jemand mit oder an dem Virus gestorben ist?" Und
bevor man nicht versucht, das wirklich zu klären, bringen alle Hochrechnungen nichts.
Auch die Zahl der Neuinfektionen sagt an sich nichts. Ich will noch einmal sagen, was ich
schonmal gesagt habe: Ein Agens - ein Virus - kann sehr sehr gefährlich sein, zum
Beispiel Tollwut. Sie haben einen Mensch mit Tollwut, dieser Mensch wird sterben. Sie
haben eine Million Menschen, die Tollwut haben, diese Million Menschen werden
sterben. Offensichtlich liegt COVID irgendwo dazwischen, aber wo? Und dieses
festzustellen war eine Pflicht eigentlich - und diese Pflicht wurde nicht erfüllt. Nicht von
der Ärzteschaft, nicht von dem Gesundheitsministerium. Diese Pflicht war die erste
Pflicht, die erfüllt werden musste. Das ist bis heute auch nicht gemacht. Nun, trotzdem
haben wir jetzt genug Daten, um zu sagen, dass
COVID19 nicht ein gemeingefährliches Virus ist. Und weil genug Daten vorlagen, hat
wahrscheinlich der renommierteste Forscher auf diesem Gebiet auf der Welt, John
Ioannidis in Stanford (medizinischer Professor an der Stanford Prevention Research,
Epidemiologe), er leitet das Institut, das uns lehrt, wie man Wissenschaft betreibt. Er hat
sich dann geäußert, das war am 4. April 2020. Er hat gesagt: "Leute, ich habe jetzt die
Daten gesammelt, gesichtet und zusammengestellt...

- "Da will ich vielleicht nur ganz kurz einmal für das breite Publikum dazusagen, wer John
Ioannidis ist, der Professor ist einer der meistzitierten Wissenschaftler der Welt. Er wurde
für die Qualität seiner Forschungen, die Richtigkeit seiner Aussagen auch mehrfach
ausgezeichnet und er hat jetzt diese Studie vor wenigen Tagen herausgebracht."

- "Ein beeindruckender Mensch! Was er getan ist, er hat gesagt: "Die ganze Welt
unterscheidet nicht unter mit oder an." Und deshalb habe ich Probleme von vorneherein
gehabt, aber er hat am 4. April gesagt, "die Zahlen unbereinigt reichen", und das ist doch
ein Wort. Das heißt, er hat die Zahlen von dort genommen und sagt: "Wie viele
Menschen, die über 80 Jahre sind, haben ein absolutes Risiko, an COVID-19 zu sterben
während dieser Epidemie?" Bis zum 4. April war die Zahl "2". Zwei pro Zehntausend!
Das heißt, zwei Menschen über 80 Jahre von zehntausend über 80-jährigen sind an
COVID-19 verstorben in diesem Zeitraum der Epidemie. Wenn Sie gucken, wie viele es
heute sind, also zweieinhalb-drei Wochen später, ist diese Zahl "7". Ich hab
nachgerechnet. So, jetzt werden Sie sagen, oh sieben sind aber sieben zu viel, denn jeder
Tote ist zu beklagen. Und da sage ich, ja, das ist so. Nur man muss diese Zahl in Relation
setzen zu ganz anderen Zahlen, die existieren. Wenn wir zu den über 80jährigen in
Deutschland gehören würden, was hätten wir für eine Wahrscheinlichkeit zu sterben von
10.000 Leuten in der Gruppe der über 80-jährigen? Da haben ungefähr 1200 Menschen
eine Wahrscheinlichkeit zu sterben. (ganz ohne Epidemie). Das ist so, denn unser Leben
ist mit 100 zu Ende, eigentlich. Und von diesen 1200 Menschen, die in
Deutschland sterben werden, dieses Jahr über 80-jährig von
10.000, werden ungefähr zehn Prozent an
Atemwegsinfektionen sterben, außerhalb und innerhalb der Krankenhäuser. Das sind 120
von 10.000. Wenn Sie diese 120 setzen gegen 7 oder 8 Covid-Tote, dann haben Sie
Zahlen, die belastbar sind. Denn die Zahl der Covid-19-Toten wird nicht jetzt noch
astronomisch steigen. Das wird eher so bleiben, oder ein bisschen steigen, vielleicht auf 8,
9, 10. Das bedeutet, dass wir 120 Atemwegserkrankungs-Tote haben, und COVID-19
wird vielleicht 10 dazu beigetragen haben. Weil die Epidemie ja zu Ende geht,
bekanntermaßen. Nachdem COVID-19 weg ist aus der Szene kommen die anderen dran.
Kommen die bakteriellen, Lungenentzündung, Pneumo-Kokken, kommt die Grippe im
Herbst etc. etc. etc. Diese Liste von Erregern, die tödliche Atemwegsinfektionen bei den
über 80-jährigen verursachen, ist gar nicht so kurz. Da sind sechs bis zehn Erreger, die ein
Mediziner in der Mikrobiologie lernt, normalerweise und es muss doch hinlänglich klar
sein für alle, dass COVID-19 sich einreiht in diese Liste von zehn Erregern, die eine Rolle
spielen. Nicht mehr und nicht weniger. Oder umgekehrt, nicht weniger, aber auch nicht
mehr."

- "Wenn man das hört, Herr Professor, dann könnte man aufatmen und denken, alles wird
gut. Dem gegenüber wird in den verschiedenen Ländern - auch in Österreich - nach wie
vor werden Informationen verteilt, AUFPASSEN, AUFPASSEN, AUFPASSEN, es ist
noch nicht vorbei. Es könnte eine zweite Welle kommen, eine dritte Wellen kommen und
man sagt den Leuten, dass es eine Rückkehr zur Normalität nicht geben wird, bevor es
einen Impfstoff gibt."

- "Ohhh, jetzt kommen wir bald auf ein Thema, das sehr, sehr brenzlig ist. Also zunächst
mal, ich halte diese Art von Desinformation gegenüber der Bevölkerung für
unverantwortlich. Es gibt keinen Grund, anzunehmen, dass diese Epidemie wieder
aufflackert. Eine Epidemie ist eine zeitlich begrenzte Ausbreitung einer Infektion. Zeitlich
begrenzt! Es hat noch eine echte zweite Welle bei einer Epidemie nach 1918 - das war
eine ganz besondere Situation, die kann man nicht mit heute vergleichen. Wer das tut, hat
seine Infektiologie nicht gelernt. Also, warum sollte sie wiederkommen? Das ist so. Und
meine Vermutung ist, dass wenn diese Antikörpertestung im großen Stil durchgeführt
wird, es sich herausstellen wird, dass viel, viel mehr Menschen diese CoronaInfektion
durchgemacht haben, als man ahnt. Und wenn ich vielleicht eine Idee abgeben könnte an
diese - weil ich weiß, dass viele Länder dabei sind, stichprobenartig die Bevölkerung zu
testen. Ich glaube es wird in Österreich auch gemacht, nicht wahr?"

- "Ja"

- "...dann würde ich vorschlagen an Österreich, dass sie explizit die Älteren testen, ab 65
aufwärts. Und wenn sie dann sehen, dass auch die über 65-jährigen Antikörper haben und
die Infektion schadlos überstanden haben, das haben sie auch. Dann würden sie diesen
Menschen die Angst nehmen. Sie würden sofort den Menschen die Angst nehmen, diese
Angstmacherei finde ich unerträglich. Es ist nicht in Ordnung, dass ein Mensch, nur weil
er oder sie über 65 ist, plötzlich denkt, 'oh ich bin gefährdet, komm mir nicht zu nah'.
'Meine eigenen Kinder, meine Enkel sollen nicht zur Schule gehen, weil sie aus der Schule das
Virus an mich bringen, und dann muss ich sterben.' Das ist so was von unverantwortlich. Und
jetzt werde ich noch etwas los! Wissen Sie, diese Einschränkung von Menschenrechten, von
Grundrechten ist nur erlaubt, wenn es sich um einen richtigen Notstand handelt. Notstand!
Das
Infektionsschutzgesetz hat dies nie vorgesehen, bis Ende März, als das Gesetz in Deutschland
überarbeitet wurde. Blitzschnell überarbeitet, so dass niemand davon eine Ahnung hatte, bis
das Gesetz schon durch war. Ich bin kein Verschwörungstheoretiker, aber wie es hier passiert
ist, war es einfach frappierend. Plötzlich war das Gesetz das, das dem Gesundheitsministerium
im Prinzip Vollmacht gibt. In dem Moment, in dem eine Epidemie von nationaler Tragweite
da ist, sind sie im Stande, alle Grundrechte einzuschränken, und zwar nach Gutdünken und es
ist das, was sie machen. Ich war bereit, das eine Zeitlang hinzunehmen, aber jetzt nicht mehr,
denn es steht in der Verfassung Deutschlands - ich weiß nicht, wie es in Österreich ist - in
unserer Verfassung - ich bin jetzt auch Deutscher geworden - steht, dass wenn die Grundrecht
eingeschränkt werden, dann müssen die Maßnahmen kontinuierlich, täglich überprüft werden
auf Wissenschaftlichkeit, und wenn sie das nicht tun, dann ist es verfassungswidrig. Das ist so
einfach und so klar, wie das Amen in der Kirche. Ich bin Buddhist, ja - aber es muss Ihnen
auch klar sein und Österreichern klar sein. Warum ist es den Deutschen nicht klar und warum
verlangen sie nicht, dass die Regierung da nicht nur von dem 'inneren Kreis' beraten wird,
sondern auch auf Leute hört, die eine andere Meinung vertreten?
Wissenschaftler, die eine andere Meinung vertreten und klar vertreten haben die letzten
Wochen. Ich bin weiß Gott nicht der Einzige. Es gibt in diesem Land so viele, so unglaublich
kluge Menschen und die haben sich durchaus klar geäußert. Es ist die Pflicht der Politiker, sie
anzuhören. Dass sie das nicht tun... ich weiß nicht in Österreich?"

- "In Österreich war die Situation ganz ähnlich und man kann sich dieses Hinnehmen der
Maßnahmen in weiten Teilen der
Bevölkerung eigentlich nur erklären, dass viele Menschen einfach Angst haben, weil man
ihnen gesagt hat, dieses Virus sei so gefährlich und in Österreich mit 8 Millionen Einwohnern
hat selbst der Bundeskanzler davon gesprochen, dass, wenn diese Maßnahmen so nicht
getroffen werden, einhunderttausend Tote uns drohen würden."

- "Wissen Sie, also ich sage Ihnen ganz offen, ich war ein großer Bewunderer von Kurz
(ehemaliger Bundeskanzler Österreichs). Ich hielt ihn für einen Lichtblick. Gott sei Dank
ist ein junger
Mann da, der intelligent ist... mindestens so intelligent wie Frau Merkel... habe ich immer
gedacht. Und dann hat er Dinge gesagt, wo ich dachte, Oh Gott, habe ich mich doch
vertan. Und dann trat er auf mit dieser Maske, sah so lächerlich aus, so nahezu dumm. Ich
meine, wie kann man nur? Wie kann man nur? Ich kann es bis heute nicht verstehen.
Diese Maskenpflicht. Es ist doch hinlänglich bekannt, dass diese Masken a) nichts nutzen,
wenn sie so gebraucht werden, wie sie gebraucht werden und 2. sogar gefährlich sind. Sie
sind für die Kinder nicht gut, für die alten Leute nicht gut. Es ist ein Virus und
Keimfänger und jetzt geht man hin und nötigt die Leute, dass sie diese Masken tragen.
Auch Herr Kurz! Das gibt's doch nicht."

- "In Österreich hat sich das abgespielt, dass ganz am Anfang waren einige wenige Leute
mit Masken unterwegs. Da hat man das belächelt. Das kannte man in Österreich eigentlich
nur vom Tourismus, von den fernöstlichen Touristen. Dann hat man in Österreich auch
gesagt, das sei eben sinnlos, solche Masken zu tragen. Und plötzlich hat die Regierung
einen 180-GradSchwenk gemacht und hat gesagt, nein die Masken sind wichtig und
notwendig und jetzt haben wir Maskenpflicht in Österreich in vielen Bereichen."

- "Ja klar. Und das ist das, was ich nicht verstehen konnte und was ich noch weniger
verstehen kann, ist, dass das Deutschland auch einführt, jetzt. Wissen Sie, ab Übermorgen,
wenn ich bei Aldi einkaufe, muss ich eine Maske... ich hab keine Maske. Ich muss mal
gucken, ob ich bei Amazon vielleicht eine Maske."

- "In Österreich kriegen sie die Masken am Eingang vom Supermarkt."

- "Und wenn man sie nicht trägt?"

- "Dann gibt's Strafen."

- "Auch hier? Es gibt bei uns einen Strafkatalog. Wissen Sie die Landesregierung, jedes
Land hat einen Strafkatalog. Ich meine, ich habe auch eine gute Meinung von dieser
Landesregierung gehabt bislang und jetzt ist fertig. Auch die Landesregierung berät nicht
mit Andersdenkenden, der Gesundheitsminister, der von Medizin gar keine Ahnung hat,
der wäre gut beraten, mal die andere Meinung zu hören. Vielleicht vertut er sich. Stellen
Sie sich vor, Politiker finden heraus, zu spät, sie haben sich geirrt, Zeit vertan. Desaströs
für sie. Ja, es gibt einen Spruch, der kommt von einem amerikanischen Präsidenten: Ein
Politiker ist so gut, wie seine
Berater. Es muss doch hinlänglich klar sein, das hier - nicht nur in Deutschland, sondern
weltweit - furchtbare Fehler gemacht wurden. Und wenn ein Politiker nicht in der Lage ist, das
zu realisieren und dann zu reflektieren, was soll ich jetzt tun? Wahrscheinlich sollte ich noch
einen anderen Ratschlag noch mit einholen. Wenn er das nicht tut, dann ist er ein
grottenschlechter Politiker."

- "Herr Professor, den Menschen wird über Pressekonferenzen und Medien seit Wochen
gesagt, bevor es nicht einen Impfstoff gibt oder Medikamente gibt, bevor nicht eine
Herdenimmunität erreicht ist, wirds dauern, das kann Monate, wenn nicht gar Jahre
dauern. Deshalb auch der Titel dieser Sendung: Wie lange dauert dieser Corona-Wahn?
Wie lange dauert es wirklich mit dieser Corona-Krise?"

- "Diese Krise ist von den Politikern selbst herbeigeführt. Diese Krise existiert nicht als
echte Krise. Insofern ist diese Krise dann zu
Ende, wenn die Politiker das definieren. Das hat nichts mit dem Virus zu tun. Diese Krise hat
nie existiert, diese Epidemie von nationaler Tragweite hat nie existiert. Verstehen Sie? Es ist
ein Spuk! Und wenn Sie mich fragen, wann ist ein Spuk zu Ende? Ein
Spuk ist nie zu Ende, wenn man den Spuk nicht beendet. Selbst!"

- "Herr Professor, in Österreich wird seit Wochen nur über dieses eine Thema diskutiert. Es
wird darüber diskutiert, ob die Maßnahmen der Regierung richtig sind oder nicht. Da hört
man auch immer wieder eine Aussage, dass viele Österreicherinnen und Österreicher
sagen, ja ihnen tut der Bundeskanzler, ihnen tut die Regierung fast leid. Sie würden nicht
gern in dieser Rolle sein, sie würden nicht tauschen wollen. Wenn ich Sie jetzt fragen
würde, würden Sie tauschen wollen mit einem Politiker, mit einem Bundeskanzler, der
entscheiden muss, welche Maßnahmen es gibt und ob ein Lockdown über ein Land
verhängt wird?"

- "Also ich hätte keine Angst davor!"

- "Sie würden, wie in diesem Gespräch ja schon mehrfach besprochen, sagen, 'Ich verhänge
keinen Lockdown und ich hätte auch keine Angst vor den Konsequenzen?"
- "Nein, natürlich nicht, natürlich nicht. Es gibt keine
Konsequenzen. Nur positive." (Bhakdi lacht)

- "Sie haben in bisherigen Interviews mehrfach betont, dass es Ihnen in Ihrer Kritik nicht
darum geht, zu spalten zu trennen, verschiedene Meinungen aufs Tapet zu bringen,
sondern dass es Ihnen um gemeinsame Lösungen geht und um transparente Diskussionen
geht."

- "Ausschließlich! Ausschließlich! Warum soll ich spalten wollen? Ich habe keine
politische Agenda. Ich gehöre keiner Partei an und ich möchte nur, dass das Land
funktioniert. Ich möchte nur das dies Land so wird, - so, jetz werde ich ein bisschen
emotional - das ich liebe. Und dieses Land liebe ich nicht mehr. Viele Leute sind
außerordentlich unglücklich. So viele Menschen sind ruiniert, so viele Menschen sind
krank geworden durch diese Maßnahmen. Es ist einfach an der Zeit, dass wir
menschlicher werden, miteinander. Menschlicher verstehen Sie. Das wir wieder
Menschen werden. Im Moment ist das die Zeit der Unmenschlichkeit. Es kann doch nicht
sein, dass wenn ich irgendwo hingehe, "bleib mir fern, bleib mir fern". Was soll das? Der
Mensch ist nicht für sowas geschaffen, für die Isolation, der Mensch ist ein geselliges
Wesen. Gott sei Dank, der Mensch will zusammenkommen, zusammen gesellig sein,
früher wollten sie zusammen beten, zusammen trauern, zusammen singen. Das ist alles
nicht mehr möglich.

- "Ist es nicht vielmehr so, dass gerade die Isolation und gerade die
Angst, Hauptgründe dafür sind, dass das Immunsystem geschwächt wird?"

- "Oh, jetzt... wissen Sie ich bin auch Immunologe. Ich habe in der Immunologie habilitiert
und später das erweitert auf Mikrobiologie. Also ich glaube, etwas von Immunologie zu
verstehen. Dies ist auch ein Wort, das sehr oft gebraucht wird, aber mit sehr wenig
Verständnis, sehr wenig Verständnis! Und deswegen ist meine Antwort auf Ihre Frage:
Das kann ich nicht in zwei Minuten beantworten, nicht einmal in fünf. Aber was klar ist,
ist dass die Isolation für die Psyche des Menschen extrem schlecht ist. Es sei denn, Sie
möchten Mönch werden und meditieren. Aber dann sind Sie auf dem Weg - der Buddhist
würde sagen - dem Weg zum Nirvana. Sie versuchen das zu bekommen. Aber zwingen
kann ihn niemand. Und wenn Sie das unter Zwang machen, werden Sie ihr Nirvana nie
erreichen, weil Sie noch nicht reif genug sind. Außerordentlich schlecht ist auch, wenn
ältere Menschen sich nicht mehr bewegen. Der Professor Püschel (Professor Dr. Klaus
Püschel Rechtsmedizin), der auch der einzige ist in Deutschland, der obduziert hat - das
wissen Sie wahrscheinlich - finde ich so toll, dass er das gemacht hat. Zunächst gegen die
Empfehlung des RKI (Robert-KochInstitut). RKI empfiehlt, dass die Corona-Toten sofort
in einen Sack getan werden und dann verbrannt werden. Also sowas!
Gesundheitsministerium unter Herrn Spahn... "Ja das wollen wir auch". Und Herr Püschel hat
jetzt auch - ich glaube vorgestern - hat auch ganz klar gesagt: "Von den über hundert, die jetz
seziert habe, hatten alle schwere Vorerkrankungen! Mindestens eine, oft zwei."
Eine Sache, die ihm auffiel, sehr viele hatten Lungenembolien. Er konnte nicht ausführen, was
das bedeutet, aber hat gesagt, sie müssen sich mehr bewegen. Weil diese Lungenembolien
kommen daher, wenn älter Leute zuhause sitzen und sich nicht mehr bewegen, dann
bekommen sie Thrombosen und dann schießt diese Thrombose in die Lunge und dann bist Du
so schnell tot, das glauben Sie nicht. Und wenn Sie Corona noch dazu bekommen, dann sind
Sie noch schneller tot. Verstehen Sie, das sind Dinge, die die Leute verstehen müssen. Und ich
habe auch schon in meinem ersten Video gesagt, diese älteren Menschen sie müssen doch
unter die Leute kommen, sie müssen ihr Leben so weiterführen wie immer. Sie müssen mit
ihren Lieben zusammenkommen. Jetzt sind die Krankenhäuser zu, man kann seine
Verwandten nicht besuchen. Ist das normal? Ist das intelligent? Ist das in irgendeiner Weise zu
begründen? Die Antwort ist: NEIN! Ein schlichtes NEIN, und das muss so schnell wie
möglich, so schnell wie möglich geändert werden."

- "Wenn Sie von den älteren Menschen sprechen, auch das ist immer wieder ein Punkt, der
viel diskutiert wird, der Schutz der sogenannten Risikogruppen. Der wird oft in den Mund
genommen, aber wie kann man sich aus fachlicher Sicht den Schutz der Risikogruppen,
vor allem der älteren Menschen vorstellen?"

- "Moment mal, die Risikogruppen sind ältere Menschen MIT schweren Vorerkrankungen
nicht ältere Menschen schlechthin. Es ist nicht so. Die Risikogruppen sind ältere
Menschen mit schweren Vorerkrankungen. Die können Sie ganz klar schützen, die
müssen tatsächlich etwas besser isoliert werden. Die Leute, die sie besuchen, müssen
tatsächlich dann Masken tragen, die HändeDesinfektion ist ganz wichtig und überhaupt,
das was bislang auch immer gemacht wurde. Und wenn man hustet, geht man nicht so
einen Menschen besuchen. Klar, aber das ist commun sense, verstehen Sie, das hat man
schon immer gemacht. Diese Menschen schützen zu wollen ist auch in Ordnung, aber
nicht auf Kosten der gesamten Gesellschaft, das ist unverhältnismäßig, DAS ist
unverhältnismäßig. Das müssten wir dann ja auch machen für alle anderen Risikofaktoren.
Die Menschen werden an CoronarHerzerkrankungen sterben, was tun Sie dagegen?
Nichts! Die Leute werden gar nicht aufgeklärt, wie das kommt, was sie tun müssten, damit
das nicht kommt. Gar keine Aufklärung, das ist unverantwortlich. Und weil die ganzen
Maßnahmen unverhältnismäßig sind, sind sie auch verfassungswidrig. So einfach ist das.
Und wissen Sie was, ich werde Ihnen was vorlesen: Strafgesetzbuch § 240 Nötigung! Wer
einen Menschen durch Drohung mit einem empfindlichen Übel (bis zu 5000 Euro in
Bayern) zu einer Handlung nötigt (Mundschutz tragen), wird mit einer Freiheitsstrafe bis
zu drei Jahren oder mit einer Geldstrafe bestraft. Rechtswidrig ist die Tat, wenn die
Androhung des Übels (Maske tragen) für den angestrebten Zweck als verwerflich
anzusehen ist.'
Es ist wissenschaftlich erwiesen, dass dieses Maskentragen nichts bewirkt und wenn man
einen älteren Menschen zwingt, eine Maske zu tragen, ist das gesundheitsschädlich. Und jetzt
geht man hin ... und das ist strafbar. 'Der Versuch ist strafbar. Und in besonders schweren
Fällen ist die Strafe von sechs Monaten bis zu fünf Jahren. Wann ist es ein besonders schwerer
Fall? Ein besonders schwerer Fall liegt in der Regel vor, wenn der Täter seine Befugnisse oder
seine Stellung als Amtsträger missbraucht.' Oh, oh! Gehen Sie mal hin und sagen Sie das
Herrn Kurz. Wir werden versuchen, es hier zu sagen (in Deutschland) aber unsere
Landesregierung hört nicht zu."

- "Herr Professor, ich möchte noch mal zurückkommen, wir haben zuvor schon vom
Thema Impfen gesprochen. In Österreich ist es wie gesagt so, aber ich denke, nicht nur in
Österreich... selbst der Gesundheitsminister den Leuten schon gesagt hat, dass es
offensichtlich so ist, bis wir einen Impfstoff bekommen, nicht möglich sein wird, dass wir
zu einer Normalität wie früher zurückkehren."

- "Ihr Gesundheitsminister, ist der Mediziner?"

- "Nein, ist er nicht."

- "Was ist er von Beruf?"

- "Er ist Politiker und in seinem Zivilberuf Lehrer."

- "Lehrer? Ich meine so eine Aussage kann eigentlich nicht von jemandem, der Human
Infektiologie gelernt hat, kommen. Es ist, wenn jemand ... in einer Prüfung so was zu mir
gesagt hätte, der wäre durchgefallen. Das geht nicht, das zeugt von solcher
Ahnungslosigkeit, das es nahezu peinlich ist."

- "Aber Politiker, namhafte Politiker,


Regierungspolitiker verbreiten es und viele der Medien verbreiten es ebenfalls, ohne es
zu kritisieren oder zu hinterfragen."

- "Diese Politiker sind alle namhaft, sonst wären sie nicht an der Spitze, und die Medien
haben gar keine eigene Meinung. Die Medien haben auch gar keine Leute, die sie wirklich
konsultieren können. Oder wenn sie es tun könnten, tun sie es nicht. Sie wollen es nicht,
sie wollen das tun, was gerade en vouge ist. Und das ist sehr traurig und sehr bedenklich
eigentlich. Wissen Sie, wenn ich sehe, wie die Menschen in diesem Land und auch in
ihrem Land innerhalb von acht Wochen von Dingen überzeugt werden können, die
überhaupt nicht Hand und Fuß haben und nicht wahr sind, dann ist es in höchstem Maße
bedenklich. Und diese ganze Geschichte mit der Impfung - was soll ich sagen - wissen
Sie, ich bin kein Impfgegner, im Gegenteil, ich habe gelehrt und gelehrt, dass sinnvolle
Impfungen sehr sinnvoll sind und durchgeführt werden sollten. Aber ich habe auch
gelehrt, wann die Impfung sinnvoll ist. Wenn ich das kurz ausführen darf?"

- "Bitte sehr."

- "Also, Impfungen sind nur indiziert bei Infektionskrankheiten, die wirklich gefährlich
sind. Und dann nur mit hohem Erfolg, mit einer hohen Erfolgswahrscheinlichkeit
versehen, wenn dieses Agens sich nicht dauernd wandelt. So, deshalb gibt es... die ersten
Impfungen waren gegen Bakteriengifte. Das war Diphterie und Wundstarrkrampf -
Tetanus. Diese Impfungen, von Behring eingeführt, wofür er auch den Nobelpreis
bekommen hat, sind bis heute unantastbar. Die sind absolut indiziert, die sind
hervorragend, es gibt nichts was dagegen spricht und alles spricht dafür. Dann kam
Keuchhusten dazu, Keuchhusten ist eine sehr gefährliche Krankheit eigentlich, ist nicht
nur eine Kinderkrankheit. Und ich gehöre zu den Leuten, die gejubelt haben, auch gegen
die Gifte des Bakteriums. Also gegen Gifte kann man sehr gut Impfstoffe machen -
Impfstoffe entwickeln. Dann kamen die Viren. Masern, Mumps, Röteln, alles gut.
Kinderlähmung, sehr gut. Aber das waren Viren, die beim Menschen hausen, nicht bei
Tieren, nicht dauern hin- und herspringen und nicht dauernd mutieren. Das Masern-Virus
kann zum Beispiel kann sich gar nicht mutieren. Wenn es sich mutierte, ist es selbst tot.
Das ist so. Und ich sage auch immer wieder, diese Viren, die es gelernt haben, den
Menschen nicht umzubringen, aber relativ schwer krank zu machen, "nur" krank zu
machen, das sind eher die erfolgreichen, weil sie bringen den Wirt nicht um und es
entsteht da eine Koexistenz. Dazu gehören Viren, wie Corona-Viren und es gehören die
Grippeviren auch dazu, obwohl die Grippeviren nicht ganz so klug sind, wie die Corona-
Viren, sie sind ziemlich gefährlich - trotzdem. Deswegen gibt es eine Impfung auch gegen
die Grippe, aber diese Impfstoffentwicklung ist viel aufwendiger, denn sie müssen das
Virus von diesem Jahr nehmen, müssen gucken, wie es sich verändert hat und müssen
davon ausgehen, dass das Virus vom nächsten Jahr ähnlich gebaut sein wird mit einigen
kleinen Änderungen. Deswegen muss die Industrie dauernd den Impfstoff anpassen. Das
ist teuer, aufwendig, können Sie sich vorstellen, und die Sache ist, es gibt Impfstoffe mit
Verstärker und ohne
Verstärker. Und diese Verstärker sind immer wieder Ursache von Nebenwirkungen gewesen.
Das ist der Grund, warum der Grippeimpfstoff, der verabreicht wird, vorwiegend an ältere
Menschen, normalerweise ohne Verstärker ist. Deswegen ist er extrem gut verträglich.
Als die Schweinegrippe kam, wurde in Windeseile ein Impfstoff entwickelt, mit Verstärker
und ich glaube mit Herrn Wodarg, wir waren die einzigen, die gesagt haben: "Macht das nicht,
Leute. Das ist nicht gut, der Impfstoff ist nicht geprüft." So, Sie wissen auch, was daraus
geworden ist, denn es ist nicht indiziert, weil die Schweinegrippe nicht schwerer verläuft als
die anderen Grippewellen, sondern sogar leichter. So und jetzt kommt Corona. Corona ist die
kleine Schwester der Grippe, nicht die große Schwester. COVID ist die große Schwester der
Coronas, die liegt irgendwo in der Größenordnung der Grippe, die
Wahrscheinlichkeit, dass dieses Virus abermals gefährlich wird, ist extrem klein. Wenn sie
jetzt hingehen und einen Impfstoff gegen COVID-19 machen, ist die Wahrscheinlichkeit, dass
die nächste Corona-Welle, nächstes Jahr, Sommergrippe, Frühlingsgrippe, Coronagrippe nicht
unbedingt ansprechen wird, kann, aber muss nicht. Es besteht keine Indikation."

- "Und wie ja viele befürchten, überhaupt die Coronakrise zum


Anlass zu nehmen, für eine allgemeine Impfpflicht..."

- "Ja, das wäre natürlich etwas, wo ich aufstehen werde und sagen werde: "Leute, jetzt geht
es zu weit. Jetzt ist die rote Linie absolut überschritten." Denn wenn das der Fall sein
sollte, dann muss ich doch diese Stimmen ernster nehmen. Sie und ich wir hören doch
diese Stimmen, das kommt von Bill Gates, das kommt von der WHO, von der Pharma-
Industrie, das ist
Geldmacherei, will ich nichts dazu sagen, weiß ich nichts von."

- "Aber man kann es auch nicht ausschließen."

- "Ich kann es nicht ausschließen, aber ich möchte nicht daran glauben. Ich möchte auch
nicht daran glauben, dass diese drohende Impfpflicht diesen "Hintergrund" hat, sondern
ich möchte daran glauben, dass dieser "Glaube an die Impfung" aus Ignoranz kommt -
Nichtwissen. Jetzt werde ich etwas los: Meine Freunde aus dem inneren Kreis fragen mich
manchmal, woher kommt es, dass diese Gesellschaft, die Politiker, die Leute, die das
Sagen haben, so sind. Auch die Medien. Und da habe ich gesagt, es gibt ein Virus, das
nennt sich nicht COVID-19, es nennt sich GIER. G-I-E-R! Und das Gier-Virus löst das
GierSyndrom aus. Ein Syndrom ist eine Zusammenkunft von Symptomen, von
Krankheitserscheinungen und die vier Erscheinungen des GierSyndroms sind Gier, Ignoranz,
Eitelkeit und Rückständigkeit. Das nehmen Sie mal auf."

- "Sehr gerne, ich glaube, dass diese Worte von Ihnen, nicht Impfgegner, sondern
impfkritische Menschen in Deutschland und in Österreich wie Balsam wirken, denn in den
vergangenen Wochen war es so, dass jeder impfkritische und jeder mündige Bürger
eigentlich verunglimpft wurde, nach dem Motto, ja haben Sie es denn immer noch nicht
begriffen, dass die Impfung wichtig ist und dass sie verantwortungsvoll ist."
- "Ja und ich würde zurückfragen: "Woher wissen Sie das?" Ja wissen Sie, vor allen
Dingen, ich werde auch verunglimpft, ich werde belehrt von Menschen, die es eigentlich
nie gelernt haben und ich frage mich immer wieder, wieso wissen die Leute das so gut?
Woher? Wo steht das? Wo kann man das
nachlesen? Ich kann es nicht."

- "Wird nachgebetet, nicht nachgelesen."

- "Ja es wird nachgebetet, aber nicht in der Kirche, in der Kirche kann man nicht mehr
beten, das alles ist für mich einfach unverständlich, unbegreiflich und extrem ... ich muss
Ihnen sagen, bedrohlich. Es ist so."

- "Ein Thema war in den vergangenen Wochen war natürlich auch immer Stichwort
'Übersterblichkeit' in Europa, in den einzelnen Ländern. Was gibt es dann da für
Erfahrungen, für Fakten dazu zu sagen?"

- "Na ja gut, ich meine, das sind Zahlen, die man nachschlagen kann, es gibt eine
Übersterblichkeit gerade jetzt in dieser Coronazeit in Europa, nur was die Leute meistens
nicht angucken ist, wo rührt diese Übersterblichkeit her? Und da habe ich zwei
Antworten, die Sie bitte nachvollziehen, jeder kann nachgucken, diese Übersterblichkeit
kommt von den Daten aus vier Ländern: Italien, Spanien, Frankreich und Großbritannien.
In allen anderen europäischen Ländern gibt es keine Übersterblichkeit. Im Gegenteil, in
Deutschland gibt es eine Untersterblichkeit in dieser Zeit. Jetzt werden Sie mich fragen,
wieso tötet COVID nur in diesen vier Ländern? Und da sage ich: Das ist das Problem, es
ist wahrscheinlich gar nicht COVID-19. Schauen Sie, wenn Sie in die britische Statistik
gehen, dann sehen Sie, dass auch in der Altersgruppe 15- bis 64-jährig eine unglaubliche
Übersterblichkeit gibt. In dieser Gruppe gibt es so wenige echte Corona-Tote, dass man
sie wahrscheinlich mit ein-zwei Händen zählen kann. Die anderen sind nicht daran
gestorben, die sind vielleicht - aber das ist nur ein Vielleicht - verstorben, weil das
Gesundheitssystem nicht gut funktioniert und sie deswegen in den Krankenhäusern nicht
so behandelt werden konnten, wie sie sonst behandelt werden. Dasselbe gilt für Italien,
Frankreich und Spanien übrigens."

- "Sprechen Sie damit auch an, mangelnde Hygiene?"

- "Hygiene ist ein Punkt, aber es ist nicht alles. Wissen Sie, dass die italienischen
Krankenhäuser bei jeder Grippewelle eigentlich überfordert sind, ist eigentlich hinlänglich
bekannt. Notstand ohne Ende. Und wenn in Frankreich und in Spanien und Italien hinzu
bei Corona kommt, dass das Personal nicht mehr arbeiten darf, es in Quarantäne geschickt
wird, unter Hausarrest sozusagen, dann haben Sie überhaupt niemand mehr. Und es ist
auch hinlänglich bekannt, dass die Krankenhausinfektionen in diesen Ländern ganz andere
Dimensionen einnehmen als hier. Wegen Hygiene, wegen - ja - mangelnden Standards."

- "Aber hinlänglich bekannt ist es natürlich in Medizinerkreisen, in der Medizin, in der


Forschung. In der breiten Öffentlichkeit war es so offenbar nicht bekannt und da sagt man
jetzt, diese
Zustände seien jetzt neu und schiebt es auf COVID-19."

- "Ich sage Ihnen noch etwas mit Italien. Es ist auch hier schon so, dass Menschen, die
behandelt werden sollten und müssten, nicht ins Krankenhaus kommen, weil Betten
freigehalten werden für die COVID-Patienten, die gar nicht da sind. Diese ganze Welt
wird hochgerechnet, wir werden überfordert. Ich habe bereits am 22. März gesagt, dass
wird niemals eintreten, ist auch nicht eingetreten. Aber was habe ich für Beschimpfungen
gehört, "der hat keine Ahnung, der ist im Ruhestand und hält nicht stand mit der
Wissenschaft und kann nicht rechnen" und so. "Leute vielleicht, vielleicht habe ich aber
nicht so Unrecht und was dann? Was sagt Ihr dann?" "Warum setzt Ihr Euch nicht hin,
und überlegt, was man besser machen kann, anstatt dauernd vorwärtszugehen?"
VORWÄRTS IMMER - RÜCKWÄRTS NIMMER Ich weiß nicht, ob Sie wissen, wo das
herkommt?"

- "Nein"

- "Nicht? Das waren die Worte von Honnecker. Vorwärts immer, rückwärts nimmer. Es
gab eine Zeit, wo diese Worte nur aus einem Teil Deutschlands kamen, jetzt kommen sie
aus allen Deutschlands und bei Ihnen, und was ist passiert? Das deutsche Volk geht weiter
und weiter, vorwärts vorwärts und das Wasser steht ihnen schon zum Hals aber rückwärts
nimmer."

- "Gott sei Dank, kannte ich diesen Spruch als Österreicher nicht. Sie haben gesagt, Sie
sind auch dafür beschimpft worden, dass Sie diese Kritik geäußert haben, es ist über Sie
geschimpft worden in verschiedenen deutschen Fernsehanstalten, aber Sie sind kein
einziges Mal eingeladen worden, um sich einer Diskussion zu stellen und Möglichkeit zu
haben, auch darüber zu sprechen,"
- "Ich bin im Ruhestand. Und ein Ruheständler hat einen großen Vorteil, ich kann meinen
Job nicht verlieren. Ich beziehe als Beamter eine Pension, die mir eigentlich
lebenslänglich zugesprochen wird und das, was ich tue ist nicht rechtswidrig. Ich glaube
nicht, dass man etwas gegen mich tun kann, und deswegen wollen die Öffentlich-
Rechtlichen mich auch nicht haben. Ich kann mich outen, wie ich will."

- "Man hat in der ganzen Diskussion seit Wochen den Eindruck, dass die
Regierungspolitiker und auch die nationalen Gesundheitsbehörden in einer Kette von oben
nach unten einfach nur immer das nachsagen, was die WHO vorgibt. Ist das nicht auch ein
Grund für die Krise, dass unkritisch weitergegeben wird, was die WHO sagt?"

- "Ja, also die WHO ist für mich ein rotes Tuch. Was diese WHO verbrochen hat, in den
letzten 20 Jahren, da haben Leute Bücher drüber geschrieben. Die WHO hat im Gegensatz
zu den Staaten - also Regierungen - einen besonderen Stand, nämlich die
Landesregierungen und die Bundesregierung ist verpflichtet laut Verfassung alles zu
begründen. Die WHO hat keine Verfassung, die sie respektieren muss. Die WHO kann
alles machen und wird nie belangt, nie. Und das führt natürlich zu einem Missstand -
Allmacht. Und diese Allmacht ist erschreckend, weil die
Bundesregierung, die
Landesregierungen glauben der WHO. Sie sehen nicht, dass die WHO nie von jemandem
geführt worden ist, der wirklich medizinische Praxis hat. Der jetzige
WHOGeneraldirektor hat überhaupt keine medizinische Ausbildung. Der ist wie Herr
Spahn, ich meine, was soll das? Das geht nicht. Dafür ist diese Organisation zu groß, zu
mächtig, zu allmächtig. Die Tatsache, dass diese Entwicklung überhaupt möglich
geworden ist, ist mit durch die WHO. Sie führen dazu - wissen Sie, ich komme aus einem
Land, das ist nicht wie Deutschland, ich bin weggegangen aus Thailand, weil das kein
demokratisches Land war und ist. Ich wollte frei sein, ich wollte Ihre Grundrechte haben.
Einigkeit, Recht und Freiheit habe ich gesucht und ich habe sie eigentlich hier gefunden.
Ich bin so - das ist meine zweite Heimat, ich liebe diese zweite Heimat. Aber wo ist jetzt
die Einigkeit? Es gibt bloß Streit. Wo ist Recht? Wir sind entrechtet. Wo ist Freiheit, wir
haben keine Freiheit mehr. Wir werden genötigt, Dinge zu tun. Die Geschichte macht
mich nicht nur wahnsinnig traurig, sondern sie ängstigt mich. Nicht für mich, wie gesagt,
mir kann nichts mehr passieren. Aber meine Kinder und meine Enkelkinder. Wissen Sie,
vor 90 Jahren hatte man die Möglichkeit noch zu fliehen, aus so einem Land. Wir können
nicht mehr fliehen, weil es überall gleich ist. Wir könnten vielleicht nach Schweden, aber
da ist es zu kalt. Und nach Österreich können wir auch nicht fliehen, weil die Österreicher
nicht die Chance nutzen, den Deutschen zu zeigen, was Klugheit ist."

- "Die Hoffnung stirbt zuletzt, Herr Professor, ich habe sie noch."

- "Ich glaube, dass Sie etwas haben, was ich nicht mehr habe."
- "Ich hoffe, dass diese Hoffnung wieder zu Ihnen zurückkehrt und möchte mich ganz
herzlich für dieses Gespräch bedanken.
Sehr interessant ist auch das erläuternde Video über Sinn und
Unsinn der Corona-Impfung-Kampagnen
https://volkmarortlepp.de/wirkung-neuartiger-impfung/

Nachtrag zu den Ausführungen von Professor Dr. Sucharit Bhakdi: Im November 2021 nimmt
er Stellung zu den Enthüllungen über Vorkommnisse bei Pfizer:

Der Investigativ-Journalist Paul Thacker berichtet im renommierten British Medical Journal


(BMJ) über unglaubliche, skandalöse Vorkommnisse bei der Firma „Ventavia Research
Group“, die für das Pharma-Unternehmen Pfizer wichtige Phase IIIZulassungsstudien für den
zusammen mit der deutschen Firma BioNtech produzierten und vertrieben COVID-Impfstoff
„Comirnaty“ durchgeführt hat. Eine Regionaldirektorin dieser Firma, namens Brooke Jackson,
hat nun „ausgepackt“ und liefert dem BMJ Beweise für zahlreiche Unregelmäßigkeiten bei der
Durchführung dieser Studien, die die Voraussetzung für die Zulassung des Impfstoffes
Comirnaty erneut in Frage stellen.

Dr. Ronald Weikl spricht hierüber mit Prof. Sucharit Bahkdi, der selbst jahrzehntelang in der
Forschung tätig war und die gewaltige Tragweite dieser Enthüllungen beleuchtet.

Hier ein paar Zitate von Prof. Sucharit Bhakdi aus diesem Video:

https://rumble.com/vosxxf-prof.-sucharit-bhakdi-zum-bmjenthllungsbericht-ber-us-
forschungsfirma.html
Zur Bedeutung dieser Aufdeckungen: „Es ist völlig klar, dass Daten manipuliert wurden, in
wissenschaftlicher Sprache heißt es „gefälscht“ wurden. Und in dem Moment, in dem bekannt
ist, dass Daten einer wissenschaftlichen Studie gefälscht sind, gilt jede wissenschaftliche Studie
als nicht mehr existent. Denn die Fälschung der Daten macht sofort jede wissenschaftliche
Studie ungültig. (…) und wenn die Wirksamkeit eines Impfstoffes nicht belegt ist, dann darf der
Impfstoff nicht zugelassen werden, es ist nämlich die Voraussetzung für die Zulassung. (…) und
damit müsste sofort das ganze „Kartenhaus“ zusammenbrechen!“

Zur Booster-Impfung (3. Impfung): „Da wir jetzt wissen, dass es keinen Beleg gibt für die
Wirksamkeit dieser Impfung, da wir definitiv wissen, dass sehr viele Menschen durch die
Impfung zu Schaden gekommen sind, leicht krank, schwerkrank, tot-krank geworden sind,
warum soll irgendein vernünftiger Mensch dieses Risiko der dritten Impfung auf sich nehmen?
Warum „RussischRoulette“ spielen, wo man damit auch nichts gewinnen kann? Es gibt keine
Logik. Macht das nicht!“
Kapitel Nr. 14 – COVID-19 gar keine Frage des
Immunsystems

Forschung aus Oxford: COVID-19 gar keine Frage des Immunsystems. COVID-Impfungen
gehen wohl ins Leere
Downes, D.J., Cross, A.R., Hua, P. et al. (2021).
Der Beitrag ist für alle, die sich in der Nomenklatura der Genetik nicht auskennen, schwer
verdaulich, wenn überhaupt. Es hat viel Zeit gekostet, sich durch den Beitrag zu lesen und
ansatzweise zu verstehen, was die Autoren hier gemacht haben. Am Schluss des Aufsatzes der
LINK zur Original-Website.
Versuchen wir die Krux zusammenzutragen.
Die Idee hinter dem Beitrag lautet: COVID-19 ist letztlich keine Krankheit, die das
Immunsystem einschließt. Die ursprüngliche
Idee, die unter Genetikern kursiert ist, war wohl die, dass das Immunsystem durch fehlerhafte
Gene in seiner Funktion beeinträchtigt wird, so dass z.B. weiße Blutkörperchen, Leukozyten
anfälliger für eine Infektion mit SARS-CoV-2 werden.
SARS-CoV-2 dringt über ACE2-Rezeptoren in menschliche Zellen ein, vorzugsweise in
Zellen der Lunge. Die Forschung von Downes et al. (2021) die sich einer neuen Methode mit
dem wohlklingenden Namen Micro-Capture-C bedient, kommt nun zu einem ganz anderen
Ergebnis. Micro-Capture-C macht es möglich, in bestimmte Bereiche der menschlichen DNA
zu “zoomen” und einzelne Gene an bestimmten Orten zu identifizieren.
Im Zuge ihres Zoomings und detaillierter Analysen im Endothel der Lunge sind die Autoren
um die Professoren Jim Hughes und James Davies von der Universität Oxford darauf
gestoßen, dass eine größere Anfälligkeit für eine Infektion mit SARS-CoV-2 nichts mit dem
Immunsystem zu tun hat.
Um eine Infektion abzuwehren, entledigen sich gesunde Lungenzellen einiger ihrer ACE2-
Rezeptoren und machen es dem Pathogen auf diese Weise schwer, Lungenzellen zu infizieren.
Verantwortlich für diese physischen Änderungen an Zellen ist ein Gen. Ist dieses Gen defekt,
dann sind die Betroffenen nicht in der Lage, auf die beschriebene Weise zu reagieren. Sie
bilden weiterhin ACE2-Rezeptoren auf Zellen und geraten in einen regelrechten
Belagerungszustand durch das Pathogen.
Eine Anfälligkeit für SARS-CoV-2 wäre somit nicht einer Schwäche des Immunsystems
geschuldet, sondern einem defekten Gen, das dafür sorgt, dass Lungenzellen ACE2-Zellen
auch unter Belagerung durch ein Pathogen in unveränderter Zahl bilden. Das Gen, das dafür
verantwortlich sein soll, ist LZTFL1. Es findet sich in ca. jedem sechsten Europäer und in rund
6 von 10 Asiaten. LZTFL1 erhöht das Risiko, an COVID-19 zu erkranken, um satte 50%.

https://www.nature.com/articles/s41588-021-00955-3#citeas
Kapitel Nr. 15 – WORDING

Hört bitte auf IHR WORDING zu benutzen (Beitrag von ‚Der Akupunkteur‘ TELEGRAM)

In meinem letzten Post habe ich ein paar der aktuell verbreiteten Corona-Lügen aufgezählt.
Heute bin ich durch einen Post wieder einmal daran erinnert worden, warum diese Lügen so
gut funktionieren.

Prof. Mausfeld thematisiert es immer wieder in seinen Vorträgen: das wording. Also, welche
Begrifflichkeiten verwenden bestimmte Personengruppen, um einen bestimmten Effekt zu
erzeugen.

Warum z.B. verwenden SIE den Begriff "Impfung", obwohl es sich um eine Gentherapie
handelt. Der Begriff "Impfung" ist seit Jahrzehnten geprägt und in der Gesellschaft
überwiegend positiv belegt (schützt vor Erkrankung), während die bekannten, unangenehmen
Nebenwirkungen, wie aktuell auch, kaum publik gemacht werden.
Gemäß dem Motto "was der Bauer ned kennt, frisst er ned", verkauft man uns hiermit eine
kaum erprobte, risikobehaftete, wahrscheinlich auch sehr gefährliche, neue Methode
(Gentherapie) als etwas Altbekanntes und Bewährtes (ob es dabei jemals um eine Therapie
ging, sei mal dahingestellt, aber als solche sind die Mittel zumindest patentiert und bedingt
zugelassen).
Und siehe da, der Bauer nimmt es dankend an. Die meisten von euch wissen das und fragen
sich, warum funktioniert es dennoch so gut.

Meine These dazu:

1. Diejenigen, die das alles zu verantworten haben, sind sehr diszipliniert. Sie besprechen
auf ihren Treffen die Marschrichtung und wahrscheinlich gibt es auch konkrete
Handlungsanweisungen, wie die Agenda umgesetzt werden soll. U.a durch das wording. Und
das wird dann mit eiserner Disziplin durchgezogen. Von sog.
Politikern, sog. Journalisten, sog. Experten etc. Wenn der Begriff Impfung festgelegt wurde
(aus o.g. Gründen), dann wird auch nur noch dieser Begriff verwendet - basta.

2. Diejenigen, die dagegen Widerstand leisten, also ihr, sind zu undiszipliniert. Warum?
Weil ihr deren Vorgaben umsetzt, indem ihr IHRE Wörter benutzt und damit, wohl eher
unbewusst, deren Lügen verfestigt - auch innerhalb der
Widerstandsbewegung.
Macht euch bewusst:
Dieser Krieg findet vorwiegend auf psychologischer Ebene statt. Es gilt, die Psychotricks zu
erkennen UND sie im Gegenzug zu kontern oder gar umzukehren.
Deswegen meine Bitte an Euch‼
Egal ob in Postings oder auch in realen Diskussionen, lasst euch nicht auf deren wording ein.
Hört auf im Zusammenhang mit dieser verabreichten Spritze von Impfung zu sprechen.
Auch ich muss mir immer wieder auf die Zunge beißen, um nicht auf deren Tricks
hereinzufallen.
Wenn jemand fragt: "Bist du geimpft?"
Fragst Du: „Wogegen?"
"Na gegen Corona!"
"Dagegen gibt's doch in D noch keine Impfung"
"Natürlich, ich bin schon zweimal geimpft."
"Ach, du meinst die Gentherapie." usw.

Wichtig in solchen Diskussionen ist, dass ihr euer Gegenüber immer wieder verbessert. Nervt
die Leute, bis sie aufgeben oder besser noch, bis sie anfangen EUER wording zu benutzen.

Sie nennen es Covid 19 (oder Coronaerkrankung) -


Ich nenne es Erkältung (oder Grippe oder Atemwegsinfektion)

Sie nennen es Infizierte -


Ich nenne es Testpositive (auf Erkältungserregerschnipsel, Zellenabfall)
Sie nennen es Coronatote -
Ich nenne es Verstorbene mit positivem Testergebnis (Positiv
Verstorbene)

Sie nennen es Impfung - Ich nenne es


Gentherapie

Sie nennen es Impfdurchbruch - Ich nenne es


Gentherapieversagen

Sie nennen es asymptomatisch Infizierte -


Ich nenne es Gesunde

Und um der Virusdiskussion aus dem Wege zu gehen:

Sie nennen es Virus -


Ich nenne es Erreger

Der angeblich neue Erreger SARS Cov 2 wurde nie isoliert. Daher wurde die PCR auf
irgendwelche Erkältungserreger kalibriert.

Sie nennen es SARS Cov 2 -


Ich nenne es Grippe - oder Erkältungserreger

Euch fallen sicher noch viele weitere Beispiele ein. Viel Vergnügen beim disziplinierten
Lernen eures neuen wordings.

Mit friedlichen Grüßen


Der Akupunkteur
Kapitel Nr. 16 – Joachim Kuhs, Rechtspfleger

Joachim Kuhs vor dem europäischen Parlament:

"Herr Präsident, Frau Kommissarin, sehr geehrte Damen und Herren!


Der Kollegin Montserrat kommt der Verdienst zu, dass dieses wichtige Thema heute auf der
Tagesordnung steht. Vielen Dank dafür.
Es wurde auch schon viel Wichtiges gesagt zu den Themen
Entwicklung,
Ankauf und Verteilung der COVID-Impfstoffe, aber Fragen zu den zum Teil verheerenden
Folgen der Impfungen wurden bisher ausgeklammert.
Dazu möchte ich etwas sagen:
Wussten Sie, dass in diesem Jahr mehr Menschen an den Folgen der COVID-19- Impfung
gestorben sind als in den letzten 20 Jahren an den Folgen aller anderen Impfungen? Und wie
ist das mit unzähligen weiteren, teils schweren Impfschäden? Warum hören wir so wenig
davon?
Wird hier etwas verheimlicht?
Als vor einigen Jahren die Impfung gegen die Schweinegrippe negative Folgen zeitigte, hat
man den Impfstoff schnell aus dem Verkehr gezogen.
Noch heute leiden tausende, vor allem junge Menschen unter den Folgen der Impfung.
Ich kenne einen jungen Menschen, der damals geimpft wurde und der heute unter Narkolepsie
leidet. Er hat seine Ausbildung beendet und würde gerne arbeiten, er darf aber wegen der
steten Gefahr des plötzlichen Einschlafens keinen Führerschein machen. Und er findet auch
keine Arbeit.
Leider wird seine Krankheit nicht als Impfschaden anerkannt.
Der Hersteller der Impfung wurde wohl von der Haftung für Impfstofffolgen freigestellt.
Offensichtlich passiert heute das gleiche wieder.
Aber trotz massiv steigender Impfschäden von denen wir wie gesagt nichts hören, kaum was
hören, wird, als gäbe es kein Morgen einfach weitergeimpft.
Warum werden die Impfstoffe nicht aus dem Verkehr gezogen, wie einst bei der
Schweinegrippe? Und wer haftet eigentlich für diese zunehmend offenbar werdenden
Impfschäden?
Liebe Kommission, mit diesen Impfstoffen ziehen Sie endlich die Reißleine und stoppen Sie
dieses Experiment an den Menschen. Ich bitte Sie inständig, klären Sie die Haftungsfrage.
Und die vielen Geschädigten geimpften werden es Ihnen danken.“
Kapitel Nr. 17 – Das perfide Geschäft der Impfung

Von Vera Sandström 06. Nov 2021


Man liest ja hier und da über die Gründe, warum Menschen sich nicht impfen lassen wollen. In
den üblichen Konformitätsmedien sollen diese Gründe wie im Beispiel des Fußballers
Kimmich möglichst lächerlich erscheinen, um dem geimpften Leser, Hörer oder Zuschauer
dieser systemischen Medien das Gefühl zu geben, alles richtig gemacht zu haben. Und
natürlich, um zu spalten – denn „teile und herrsche“, das funktioniert immer. Das einstudierte
Narrativ dabei: „Wegen diffuser unbegründeter Ängste lassen sich asoziale und dumme
Menschen nicht impfen. Mit denen willst du nichts zu tun haben, sie zu verachten ist
notwendige staatsbürgerliche Pflicht!“. Die möglicherweise ebenso „diffusen und
unbegründeten“ Ängste der Geimpften haben dagegen staatliche Legitimation und werden von
der staatlich akkreditierten „Heulboje“ Lauterbach in die Welt hinausposaunt.
Gesundheitliche Angelegenheiten sind privat, deshalb ist niemand über seinen „Impfstatus“
Rechenschaft schuldig – nicht dem Arbeitgeber gegenüber und schon gar nicht einem
übergriffig gewordenen Staat.
Ich möchte hier dennoch den wesentlichen Punkt ansprechen, warum ich mich persönlich
unter den jetzigen Umständen mit Sicherheit nicht impfen lassen werde, nicht mit Astra, nicht
mit Moderna und schon gar nicht mit Pfizer/Biontech. Ich möchte das deshalb
niederschreiben, weil ich das Gefühl habe, dass mein Hauptargument für viele skeptische
Menschen eine Rolle spielt, dass es quasi immer zwischen den Gehirnwindungen und
gesprochenen Worten mitschwebt, ohne direkt ausgesprochen zu werden. Es ist ja wirklich
eine Krankheit unserer Zeit, dass vieles gedacht, aber nicht mehr öffentlich gesagt wird.
Deshalb sage ich es ganz explizit:
Mich widern diese Firmen an, die mit der staatlich erzeugten Angst auch noch komplett durch
den Steuerzahler finanziert das Geschäft ihres Lebens machen. Für die es Geschäft ist und
alles um sie herum „Märkte“, einschließlich der Kinder. Ich habe keine diffusen Ängste, bin
gegen alles Mögliche auf dieser Welt geimpft, aber ich möchte dieses verlogene und durch und
durch korrupte System von Lobbyismus und politischer Einflussnahme nicht unterstützen.
Zumindest nicht in einem größeren Ausmaß, als ich es ohnehin durch den Einkauf des Corona-
Impfstoffs und die Finanzierung der „Maßnahmen“ mit meinen Steuern leider gezwungen bin
zu tun.
Wer seine Plörre so „bewirbt“, wie dies geschieht, dem geht es offensichtlich nicht um
Gesundheit, nicht um Verantwortung, nicht um ein „Ende der Pandemie“, sondern
offensichtlich vor allem um sehr viel Geld. Das Aufnötigen der bislang zugelassenen
Impfstoffe verbinde ich unweigerlich mit dem Aufdrängen windiger Finanzprodukte, die
keinem wirklich nutzen außer dem Herausgeber, der auch nicht „ehrlich“ an der
Kursentwicklung verdient, sondern an der Provision durch den Verkauf. Auch wenn die
Produkte komplett wertlos würden, hat der Herausgeber seinen Schnitt gemacht und keinen
Nachteil. Der Emittent ist rechtlich abgesichert, denn der Kunde macht alles auf eigenes
Risiko, ist sich eines möglichen „Totalausfalls“ bewusst und wurde darüber ja „aufgeklärt“
(wenn er denn das Kleingedruckte liest, das er unterschreibt).
Diese Impfstory ist das absolut größte Beispiel für die Sozialisierung möglicher Verluste bei
gleichzeitiger Privatisierung sicherer Gewinne in Friedenszeiten, noch wesentlich frecher und
krimineller (wohl nicht juristisch, aber zumindest aus der zuletzt so oft beschworenen
moralischen Sicht) als alles, was während und nach der Finanzkrise 2008/2009 geschah. Da
ging es ans Portemonnaie, aber wenigstens nicht an die Freiheit und nicht an die Gesundheit.
Die neuen mRNA-Firmen, ob Biontech oder Moderna, haben nicht einen einzigen Euro/Dollar
wirklich am Markt verdient, also von einem echten Menschen, der sich impfen lassen wollte,
als Bezahlung erhalten, es sind zu 100 % Einnahmen staatlich gesteuerter Programme aus von
Steuergeld finanzierten Quellen. Sie übernehmen null Verantwortung, lassen sich von den
staatlichen Abnehmern rechtlich komplett freistellen und fordern vertraglich auch noch ein,
von ihren Kunden selbst, also den Staaten, gegen alle Ansprüche verteidigt zu werden! Wow!
Was die Staaten ja auch fleißig tun, wie man in der Praxis sehen kann, wenn sie jeden
Zusammenhang zwischen Impfung und Schaden so lange abstreiten, bis es so absolut
offensichtlich ist, dass man es nicht mehr abstreiten kann.
Mit welchem Recht kann während einer weltweiten pandemischen Notlage eine mit staatlichen
Geldern aufgebaute Firma wiederum den Staaten Preise für das entwickelte Produkt diktieren?
Und zwar Preise, die keineswegs nur kostendeckend sind (würde man nicht das erwarten in
einer „normalen“ Welt?), sondern die für enorme private Gewinne dieser Firmen sorgen, so
dass hier einige neue Milliardäre begrüßt werden konnten. Die dann auf China als ultimativen
Markt hoffen. Warum lassen sich unsere(?!) Staaten freiwillig auf solche Deals ein? Mir fällt
nur eine logische Antwort ein: weil die Entscheidungsträger von der entsprechenden Lobby
vollständig korrumpiert sind, nicht umsonst ist Pfizer die Nummer 1 in der Pharmawelt.
Dazu passt auch, dass man sehr effektiv alle Mitbewerber aus dem Geschäft hält. Ich will gar
nicht von Sputnik reden, hinter dem ja der böse Systemfeind steht, der natürlich nicht
mitverdienen darf. Selbst einheimische Konkurrenten wie Curevac werden erfolgreich von
Futternapf ferngehalten. Zugelassen ist zugelassen, da wird nicht mehr später unabhängig
geprüft, wie eine Impfung gegen neue Virusvarianten wirkt. Das müssen nur die Neuen
beweisen und das schaffen die nicht, weil keine Impfung wirklich gut wirkt. Und schon gar
nicht gegen Ansteckung. Müsste man da nicht die Notfallzulassung für Biontech widerrufen,
bis dieselben Kriterien erfüllt sind wie bei einem neuen Impfstoffkandidaten? Nein, im
Zweifel macht man einen Impfstoff schlecht (Astra), um den Hauptplayer unbefleckt zu lassen
(Pfizer/Biontech, der Champagner) und ihn auch Kindern zu spritzen – obwohl ja die
Nebenwirkungsbilanz des Letzteren wesentlich schlechter ist.
Und man schwadroniert weiterhin ernsthaft von Wirkungsraten gegen Ansteckung von über 90
% (jetzt nach einem Booster!) und gegen schwere Erkrankung ebenso – natürlich nur in
eigenen Studien des Herstellers.
Im Finanzgeschäft gibt es den Begriff des »Moral Hazard«, am besten zu übersetzen als ein
falsches Anreizsystem für Geschäftspraktiken. So ein falscher Anreiz wäre es zum Beispiel,
wenn ich sicher sein kann, dass ich bei einem Defekt meines Produkts einen Nachfolgeauftrag
bekomme und dadurch noch mehr verdiene. Meine Motivation, sauber und gewissenhaft zu
arbeiten, wäre aus nachvollziehbaren Gründen nicht besonders hoch. Anders wäre es, wenn ich
wüsste, dass bei einem schlechten Produkt ein Konkurrent zum Zuge kommt und ich verklagt
werde. In der Finanzwelt spricht man von einem Moral Hazard, wenn Banken oder Systeme zu
groß sind („too big to fail“), um sie pleitegehen zu lassen, wenn sie also von vornherein
wissen, dass ihre Verluste am Ende vom Steuerzahler getragen werden müssen.
Für mich beruht das Geschäft mit der Impfung auf einem extrem falschen Anreizsystem –
sozusagen Moral Hazard in der schlimmsten Ausprägung: keinerlei Risiko für die Hersteller,
ein abgeschotteter Markt ohne Konkurrenz, jeder Mensch ein zum Produkt genötigter Kunde,
wobei das Produkt scheinbar „kostenlos“ ist – der Staat bezahlt. Und: Wenn es nicht
funktioniert, wird der Kunde gezwungen, immer wieder nachzubestellen. Welchen Anreiz
habe ich dann, dass mein Produkt funktioniert? Ein Auslaufen der Pandemie wäre das Ende
meiner aktuellen Geschäfte. Und das Beste: Niemand darf sich in der Sache politisch oder
wissenschaftlich die Blöße geben, weil hier systemisch alles längst „too big to fail“ ist.
Das polit-ökonomische Geschäft mit den Impfungen stinkt zum Himmel und ich empfinde
Ekel bei dem Gestank.
Kapitel Nr. 18 - Aktuelles Forschungsergebnis zu den
mRNASeren Wenner-Gren-Institute Stockholm

Atemberaubende neue Forschungsergebnisse, die in der Fachzeitschrift Viruses, Teil


der SARS-CoV-2 Host Cell Interactions Edition von MDPI (Open Access Journals)
veröffentlicht wurden, zeigen, dass Impfstoff-Spike-Proteine in Zellkerne eindringen und den
DNA-Reparaturmechanismus der Zellen zerstören, indem sie die DNA-Reparatur um bis zu
90% unterdrücken.
Die Forschungsarbeit trägt den Titel "SARS-CoV-2 Spike Impairs DNA Damage Repair and
Inhibits V(D)J Recombination In Vitro" und wurde von Hui Jiang und Ya-Fang Mei am
Department of Molecular Biosciences, The Wenner-Gren-Institute, Stockholm University, SE-
10691 Stockholm, Sweden, bzw. dem Department of Clinical Microbiology, Virology, Umeå
University, SE-90185 Umeå, Sweden, verfasst.
In der Schlussfolgerung der Arbeit schreiben die Autoren:
"Wir fanden heraus, dass das Spike-Protein sowohl die Bildung von
BRCA1- als auch von 53BP1-Foci deutlich hemmt (Abbildung 3D- G). Zusammengenommen
zeigen diese Daten, dass das SARS-CoV2Spike-Protein in voller Länge die Reparatur von
DNA-Schäden hemmt, indem es die Rekrutierung von DNA-Reparaturproteinen behindert".
Der DNA-Reparaturmechanismus, bekannt als NHEJ (NonHomologous End Joining), ist eine
Art intrazelluläres "Notfallreaktionssystem", das doppelsträngige DNA-Brüche repariert. Ohne
den NHEJ-Mechanismus würde alles fortgeschrittene mehrzellige Leben aufhören zu
existieren. Kein Mensch, kein Tier und keine Pflanze kann überleben, wenn die Integrität ihres
genetischen Codes nicht durch mehrere Mechanismen geschützt und ständig repariert wird.
DNA-Schäden können durch Strahlenbelastung, Chemikalien in Lebensmitteln und
Körperpflegeprodukten oder sogar durch Mammographiegeräte verursacht werden.
Übermäßige
Sonneneinstrahlung kann ebenfalls DNA-Brüche verursachen, und kleinere DNA-Mutationen
treten spontan in allen lebenden Organismen auf. Piloten von Fluggesellschaften zum Beispiel
sind aufgrund ihrer Flughöhe routinemäßig ionisierender Strahlung ausgesetzt.
Bei einem normalen, gesunden Menschen repariert der NHEJMechanismus die DNA und
verhindert das Auftreten einer pathogenen Mutation.
In Anwesenheit des Impfstoff-Spike-Proteins wird die Wirksamkeit von NHEJ jedoch um bis
zu 90 % unterdrückt, d. h., er kann seine Aufgabe nicht erfüllen, weil er nicht mehr in der Lage
ist, Proteine für die Reparatur zu rekrutieren.
Infolgedessen werden die folgenden "Fehler" in die Chromosomen in den Kernen
menschlicher Zellen eingeschleust, die alle auf die Anwesenheit des Spike-Proteins aus
mRNA-Impfstoffen zurückzuführen sind:
Mutationen oder "Fehler" in der genetischen Sequenz.
LÖSCHEN ganzer Abschnitte des genetischen Codes.
EINFÜGEN von fehlerhaften Abschnitten.
Vermischung und Anpassung / Permutationen des genetischen Codes.
Diese Fehler führen, wenn sie bei der Zellteilung und -vermehrung zum Ausdruck kommen,
zu:
Eine Explosion von Krebs und Krebstumoren im ganzen Körper
Verlust der Produktion von B- und T-Zellen des Immunsystems (d. h. induzierte
Immunschwäche)
Autoimmunkrankheiten
Beschleunigte Alterung und verkürzte Telomerlänge
Funktionsverlust komplexer Organsysteme wie des Kreislaufs, der Neurologie, des
Hormonsystems, des Muskel-Skelett-Systems usw.
Zellschäden, die einer Strahlenvergiftung ähneln, da sich die Zellen von innen heraus
zerstören
Mechanistisch gesehen haben wir herausgefunden, dass das
Spike-Protein im Zellkern lokalisiert ist und die Reparatur von DNA-
Schäden hemmt, indem es die Rekrutierung der wichtigen DNAReparaturproteine BRCA1 und
53BP1 an der Schadensstelle behindert.
Das bedeutet, dass das Spike-Protein, das in den Ribosomen der Zelle gebildet wird, nachdem
die Zellen durch mRNA-Impfstoffe gekapert wurden, nicht immer die Zelle verlässt und in
den Blutkreislauf gelangt, wie uns die Befürworter von mRNAImpfstoffen erzählen.
In einigen Fällen gelangt das Spike-Protein in den Zellkern. Dort stört es, wie in diesem
Artikel beschrieben, den DNAReparaturmechanismus.

Für den fachlich versierten Mediziner hier das Original der Arbeit in Englisch und
nachfolgend die deutsche Übersetzung:
Original:
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J
Recombination In Vitro by
Hui Jiang

1,2,* and
Ya-Fang Mei
2,*

Department of Molecular Biosciences, The Wenner–Gren Institute,


Stockholm University, SE-10691 Stockholm, Sweden
2

Department of Clinical Microbiology, Virology, Umeå University, SE-


90185 Umeå, Sweden
*

Authors to whom correspondence should be addressed.

Academic Editor: Oliver Schildgen

Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056

Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021

(This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions)

Citation Export

Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19)
pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against
SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients
with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–
CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2
spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive
immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by
impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential
molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of
full-length spike-based vaccines.

Keywords: SARS–CoV–2; spike; DNA damage repair; V(D)J recombination; vaccine

1. Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS– CoV–2) is responsible for the ongoing coronavirus disease
2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–
sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and
dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have
shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild
and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells,
and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively,
these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by
which SARS–CoV–2 suppresses adaptive immunity remains unclear.

As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher
organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two
systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand
DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific
recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse
repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair
proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of
functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage
via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress
[12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced
pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby
affecting adaptive immunity in vitro.

2. Materials and Methods

2.1. Antibodies and Reagents


DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat
#H1009), and β-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat
#12698), H2A (Cat #12349), H2A.X (Cat #7631), γ–H2A.X (Cat #2577), Ku80 (Cat
# 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat
#NB100304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals,
Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA– PK (Cat #sc–5282), and BRCA1(Cat #sc–
28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264)
antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).

2.2. Plasmids pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476
and #26477) [15]. pimEJ5GFP was a gift from Jeremy
Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and
nucleocapsid proteins were first synthesized with codon optimization and then cloned into a
mammalian expression vector pUC57 with a C– terminal 6xHis tag. A 12–spacer RSS–GFP inverted
complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the
sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–
23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5′–
CACAGTGCTACAGACTGGAACAAAAACC–3′. 23– spacer
RSS sequence: 5′–
CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3′.
RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329)
[17].

2.3. Cells and Cell Culture


HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5%
CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA,
USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100 μg/mL).
HEK293T–DR–GFP and HEK293T– EJ5–GFP reporter cells were generated as previously described and cultured under 5%
CO2 at 37 °C in the abovementioned culture medium.

2.4. HR and NHEJ Reporter Assays


HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable
cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6– well plates and transfected with 2 μg I–SceI
expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–
transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The
means were obtained from three independent experiments.

2.5. Cellular Fractionation and Immunoblotting


For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the
manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL,
USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to
nitrocellulose membranes (Amersham protran, 0.45 μm NC), and immunoblotted with specific primary antibodies followed by
HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto
Chemiluminescence kit (Thermo
Fisher Scientific).
2.6. Comet Assay
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis.
Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a
ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100
mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides
were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature
(RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis
chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with
distilled water, stained with 10 μg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with
approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail
moment).

2.7. Immunofluorescence
Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the
cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4%
paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were
blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C.
Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted
in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako
Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was
performed under blinded conditions.

2.8. Analysis of V(D)J Recombination


Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously
expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the
cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated
in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the
readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone
(background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg
RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and
analyzed by flow cytometry for GFP and RFP expression.

2.9. Statistical Analysis


All experiments were repeated at least three times using independently collected or prepared samples. Data were
analyzed by Student’s t test or ANOVA followed by Tukey’s multiplecomparison tests using GraphPad 8.

3. Results

3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair


DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are
synthesized in the cytosol [1], some viral proteins are also detectable in the nucleus, including Nsp1, Nsp5, Nsp9, Nsp13,
Nsp14, and Nsp16 [19]. We investigated whether these nuclear-localized SARS–CoV– 2 proteins affect the host cell DNA
damage repair system. For this, we constructed these viral protein expression plasmids together with spike and nucleoprotein
expression plasmids, which are generally considered cytosol–localized proteins. We confirmed their expression and
localization by immunoblotting and immunofluorescence (Figure 1A and Figure S1A). Our results were consistent with those
from previous studies [19]; Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 proteins are indeed localized in the nucleus, and
nucleoproteins are mainly localized in the cytosol. Surprisingly, we found the abundance of the spike protein in the nucleus
(Figure 1A). NHEJ repair and homologous recombination (HR) repair are two major DNA repair pathways that not only
continuously monitor and ensure genome integrity but are also vital for adaptive immune cell functions [9]. To evaluate
whether these viral proteins impede the DSB repair pathway, we examined the repair of a site-specific DSB induced by the I–
SceI endonuclease using the direct repeat–green fluorescence protein (DR–GFP) and the total-NHEJ-GFP (EJ5–GFP) reporter
systems for HR and NHEJ, respectively [15,16]. Overexpression of Nsp1, Nsp5, Nsp13,
Nsp14, and spike proteins diminished the efficiencies of both HR and NHEJ repair (Figure 1B–E and Figure S2A,B).
Moreover, we also found that Nsp1, Nsp5, Nsp13, and Nsp14 overexpression dramatically suppressed proliferation compared
with other studied proteins (Figure S3A,B). Therefore, the inhibitory effect of Nsp1, Nsp5, Nsp13, and Nsp14 on DNA
damage repair may be due to secondary effects, such as growth arrest and cell death. Interestingly, overexpressed spike
protein did not affect cell morphology or proliferation but significantly suppressed both HR and NHEJ repair (Figure
1B–E, Figures S2A,B and S3A,B).
Figure 1. Effect of severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) nuclear-localized proteins on DNA
damage repair. (A) Subcellular distribution of the SARS–CoV–2 proteins. Immunofluorescence was performed at 24 h after
transfection of the plasmid expressing the viral proteins into HEK293T cells. Scale bar: 10 µm. (B) Schematic of the EJ5-GFP
reporter used to monitor nonhomologous end joining (NHEJ). (C) Effect of empty vector (E.V) and SARS–CoV–2 proteins
on NHEJ DNA repair. The values represent the mean ± standard deviation (SD) from three independent experiments (see
representative FACS plots in Figure S2A). (D) Schematic of the DR-GFP reporter used to monitor homologous
recombination (HR). (E) Effect of E.V and SARS– CoV–2 proteins on HR DNA repair. The values represent the mean ± SD
from three independent experiments (see representative FACS plots in Figure S2B). The values represent the mean ± SD, n =
3. Statistical significance was determined using one-way analysis of variance (ANOVA) in (C,E). ** p < 0.01, *** p < 0.001,
**** p <  0.0001.

3.2. SARS–CoV–2 Spike Protein Inhibits DNA Damage Repair


Because spike proteins are critical for mediating viral entry into host cells and are the focus of most vaccine strategies
[20,21], we further investigated the role of spike proteins in DNA damage repair and its associated V(D)J recombination.
Spike proteins are usually thought to be synthesized on the rough endoplasmic reticulum (ER) [1]. After posttranslational
modifications such as glycosylation, spike proteins traffic via the cellular membrane apparatus together with other viral
proteins to form the mature virion [1]. Spike protein contains two major subunits, S1 and S2, as well as several functional
domains or repeats [22] (Figure 2A). In the native state, spike proteins exist as inactive full–length proteins. During viral
infection, host cell proteases such as furin protease activate the S protein by cleaving it into S1 and S2 subunits, which is
necessary for viral entry into the target cell [23]. We further explored different subunits of the spike protein to elucidate the
functional features required for DNA repair inhibition. Only the full– length spike protein strongly inhibited both NHEJ and
HR repair (Figure 2B–E and Figure S4A,B). Next, we sought to determine whether the spike protein directly contributes to
genomic instability by inhibiting DSB repair. We monitored the levels of DSBs using comet assays. Following different DNA
damage treatments, such as γ–irradiation, doxorubicin treatment, and H2O2 treatment, there is less repair in the presence of the
spike protein (Figure 2F,G). Together, these data demonstrate that the spike protein directly affects DNA repair in the
nucleus.
Figure 2. Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) spike protein inhibits DNA damage repair. (A)
Schematic of the primary structure of the SARS–CoV–2 spike protein. The S1 subunit includes an N–terminal domain (NTD,
14– 305 residues) and a receptor–binding domain (RBD, 319–541 residues). The S2 subunit consists of the fusion peptide
(FP, 788– 806 residues), heptapeptide repeat sequence 1 (HR1, 912–984 residues), HR2 (1163–1213 residues), TM domain
(TM, 1213–1237 residues), and cytoplasm domain (CT,1237–1273 residues). (B,C) Effect of titrated expression of the spike
protein on DNA repair in HEK–293T cells. (D,E) Only full-length spike protein inhibits nonhomologous end joining (NHEJ)
and homologous recombination (HR) DNA repair. The values represent the mean ± SD from three independent experiments
(see representative FACS plots in Figure S4A,B). (F) Full–length spike (S–FL) protein– transfected HEK293T cells exhibited
more DNA damage than empty vector-, S1–, and S2–transfected cells under different DNA damage conditions. For
doxorubicin: 4 µg/mL, 2 h. For γ–irradiation: 10 Gy, 30 min. For H2O2: 100 µM, 1 h. Scale bar: 50 µm. (G) Corresponding
quantification of the comet tail moments from 20 different fields with n > 200 comets of three independent experiments.
Statistical significance was assessed using a two-way analysis of variance (ANOVA). NS (Not Significant): * p > 0.05, ** p
< 0.01, *** p < 0.001, **** p < 0.0001.

3.3. Spike Proteins Impede the Recruitment of DNA Damage Repair Checkpoint Proteins
To confirm the existence of spike protein in the nucleus, we performed subcellular fraction analysis and found that
spike proteins are not only enriched in the cellular membrane fraction but are also abundant in the nuclear fraction, with
detectable expression even in the chromatin–bound fraction (Figure 3A). We also observed that the spike has three different
forms, the higher band is a highly glycosylated spike, the middle one is a full–length spike, and the lower one is a cleaved
spike subunit. Consistent with the comet assay, we also found the upregulation of the DNA damage marker, γ–H2A.X, in
spike protein–overexpressed cells under DNA damage conditions (Figure 3B). A recent study suggested that spike proteins
induce ER stress and ER–associated protein degradation [24]. To exclude the possibility that the spike protein inhibits DNA
repair by promoting DNA repair protein degradation, we checked the expression of some essential DNA repair proteins in
NHEJ and HR repair pathways and found that these DNA repair proteins were stable after spike protein overexpression
(Figure 3C). To determine how the spike protein inhibits both NHEJ and HR repair pathways, we analyzed the recruitment of
BRCA1 and 53BP1, which are the key checkpoint proteins for HR and NHEJ repair, respectively. We found that the spike
protein markedly inhibited both BRCA1 and 53BP1 foci formation (Figure 3D–G). Together, these data show that the SARS–
CoV–2 full–length spike protein inhibits DNA damage repair by hindering DNA repair protein recruitment.
Figure 3. Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) spike protein impedes the recruitment of DNA
damage repair checkpoint proteins. (A) Membrane fraction (MF), cytosolic fraction (CF), soluble nuclear fraction (SNF), and
chromatin-bound fraction (CBF) from HEK293T cells transfected with SARS–CoV–2 spike protein were immunoblotted for
His-tag spike and indicated proteins. (B) Left: Immunoblots of DNA damage marker γH2AX in empty vector (E.V)– and
spike protein–expressing HEK293T cells after 10 Gy γ-irradiation. Right: corresponding quantification of immunoblots in left.
The values represent the mean ± SD (n = 3). Statistical significance was determined using Student’s t-test. **** p < 0.0001.
(C) Immunoblots of DNA damage repair related proteins in spike protein–expressing HEK293T cells. (D) Representative
images of 53BP1 foci formation in E.V– and spike protein-expressing HEK293 cells exposed to 10 Gy γ– irradiation. Scale
bar: 10 µm. (E) Quantitative analysis of 53BP1 foci per nucleus. The values represent the mean ± SEM, n = 50. (F) BRCA1
foci formation in empty vector- and spike proteinexpressing HEK293 cells exposed to 10 Gy γ–irradiation. Scale bar: 10 µm.
(G). Quantitative analysis of BRCA1 foci per nucleus. The values represent the mean ± SEM, n = 50. Statistical significance
was determined using Student’s t-test. **** p < 0.0001.

3.4. Spike Protein Impairs V(D)J Recombination In vitro


DNA damage repair, especially NHEJ repair, is essential for
V(D)J recombination, which lies at the core of B and T cell immunity [9]. To date, many approved SARS–CoV–2 vaccines,
such as mRNA vaccines and adenovirus–COVID–19 vaccines, have been developed based on the full–length spike protein
[25]. Although it is debatable whether SARS–CoV–2 directly infects lymphocyte precursors [26,27], some reports have
shown that infected cells secrete exosomes that can deliver SARS–CoV–2 RNA or protein to target cells [28,29]. We further
tested whether the spike protein reduced NHEJ–mediated V(D)J recombination. For this, we designed an in vitro V(D)J
recombination reporter system according to a previous study [18] (Figure S5). Compared with the empty vector, spike protein
overexpression inhibited RAG–mediated V(D)J recombination in this in vitro reporter system (Figure 4).

Figure 4. Spike protein impairs V(D)J recombination in vitro. (A) Schematic of the V(D)J reporter system. (B) Representative
plots of flow cytometry show that the SARS–CoV–2 spike protein impedes V(D)J recombination in vitro. (C) Quantitative
analysis of relative V(D)J recombination. The values represent the mean ± SD, n = 3. Statistical significance was determined
using Student’s ttest. **** p < 0.0001.

4. Discussion
Our findings provide evidence of the spike protein hijacking the DNA damage repair machinery and adaptive immune
machinery in vitro. We propose a potential mechanism by which spike proteins may impair adaptive immunity by inhibiting
DNA damage repair. Although no evidence has been published that SARS–CoV–2 can infect thymocytes or bone marrow
lymphoid cells, our in vitro V(D)J reporter assay shows that the spike protein intensely impeded V(D)J recombination.
Consistent with our results, clinical observations also show that the risk of severe illness or death with COVID–19 increases
with age, especially older adults who are at the highest risk [22]. This may be because SARS–CoV– 2 spike proteins can
weaken the DNA repair system of older people and consequently impede V(D)J recombination and adaptive immunity. In
contrast, our data provide valuable details on the involvement of spike protein subunits in DNA damage repair, indicating that
full– length spike–based vaccines may inhibit the recombination of V(D)J in B cells, which is also consistent with a recent
study that a full– length spike–based vaccine induced lower antibody titers compared to the RBD–based vaccine [28]. This
suggests that the use of antigenic epitopes of the spike as a SARS– CoV–2 vaccine might be safer and more efficacious than
the full– length spike. Taken together, we identified one of the potentially important mechanisms of SARS–CoV–2
suppression of the host adaptive immune machinery. Furthermore, our findings also imply a potential side effect of the full–
length spike–based vaccine. This work will improve the understanding of COVID–19 pathogenesis and provide new strategies
for designing more efficient and safer vaccines.

Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/v13102056/s1, Figure S1: Expression of
nuclear–localized SARS–CoV–2 proteins in human cells, Figure S2: Effect of nuclear SARS–CoV–2 proteins on NHEJ– and
HR–DNA repair pathway, Figure S3: Nsp1, Nsp5,
Nsp13, Nsp14 but not spike inhibit cell proliferation, Figure S4: Effect of SARS–CoV–2 spike mutants on NHEJ– and HR–
DNA repair pathway, Figure S5: In vitro V(D)J recombination assay.
Author Contributions
H.J. conceived and designed the study. H.J. and Y.-F.M. supervised the study, performed experiments, and interpreted
the data. Writing—original draft preparation, H.J.; Writing—review and editing, H.J. and Y.-F.M.; funding acquisition, Y.-
F.M. All authors have read and agreed to the published version of the manuscript.

Funding
This work was supported by Umeå University, Medical Faculty’s Planning grants for COVID–19 (research
project number: 3453 16032 to Y.F.M.); the Lion’s Cancer Research Foundation at Umeå University (grants: LP 17–2153,
AMP 19–982, and LP 20–
2256 to Y.F.M.), and the base unit’s ALF funds for research at academic healthcare units and university healthcare units in the
northern healthcare region (ALF–Basenheten: 2019, 2020, 2021 to Y.F.M.).

Institutional Review Board Statement


Not applicable, because of this study not involving humans or animals.

Informed Consent Statement


Not applicable, because of this study not involving humans.

Data Availability Statement


The data presented in this study are available in the main text and Supplementary Materials.

Conflicts of Interest
The authors have declared that no competing interests exist. The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.

References

1. V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications
for
SARSCoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
2. Suryawanshi, R.K.; Koganti, R.; Agelidis, A.; Patil, C.D.; Shukla, D. Dysregulation of Cell Signaling by SARS-
CoV-2. Trends
Microbiol. 2021, 29, 224–237. [Google Scholar] [CrossRef]
3. Qin, C.; Zhou, L.; Hu, Z.; Zhang, S.; Yang, S.; Tao, Y.; Xie, C.; Ma, K.; Shang, K.; Wang, W.; et al.
Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin.
Infect. Dis. 2020, 71, 762–768. [Google Scholar] [CrossRef] [PubMed]
4. Wang, F.; Nie, J.; Wang, H.; Zhao, Q.; Xiong, Y.; Deng, L.; Song, S.; Ma, Z.; Mo, P.; Zhang, Y.
Characteristics of Peripheral Lymphocyte Subset Alteration in COVID-19 Pneumonia. J.
Infect. Dis. 2020, 221, 1762–1769. [Google Scholar]
[CrossRef] [PubMed]
5. Zhang, G.; Nie, S.; Zhang, Z.; Zhang, Z. Longitudinal Change of Severe Acute Respiratory Syndrome
Coronavirus 2 Antibodies in Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020, 222, 183–188.
[Google Scholar] [CrossRef] [PubMed]
6. Long, Q.X.; Liu, B.Z.; Deng, H.J.; Wu, G.C.; Deng, K.; Chen, Y.K.;
Liao, P.; Qiu, J.F.; Lin, Y.; Cai, X.F.; et al. Antibody responses to SARS-CoV-2 in patients with COVID-19.
Nat. Med. 2020, 26,
845–848. [Google Scholar] [CrossRef]
7. Bednarski, J.J.; Sleckman, B.P. Lymphocyte development: Integration of DNA damage response signaling. Adv.
Immunol. 2012, 116, 175–204. [Google Scholar] [PubMed]
8. Malu, S.; Malshetty, V.; Francis, D.; Cortes, P. Role of nonhomologous end joining in V(D)J recombination.
Immunol. Res. 2012, 54, 233–246. [Google Scholar] [CrossRef]
9. Bednarski, J.J.; Sleckman, B.P. At the intersection of DNA damage and immune responses. Nat. Rev. Immunol.
2019, 19, 231–242. [Google Scholar] [CrossRef]
10. Gapud, E.J.; Sleckman, B.P. Unique and redundant functions of ATM and DNA-PKcs during V(D)J
recombination. Cell. Cycle 2011, 10, 1928–1935. [Google Scholar] [CrossRef]
11. Difilippantonio, S.; Gapud, E.; Wong, N.; Huang, C.Y.;
Mahowald, G.; Chen, H.T.; Kruhlak, M.J.; Callen, E.; Livak, F.; Nussenzweig, M.C.; et al. 53BP1
facilitates long-range DNA end-joining during V(D)J recombination. Nature 2008, 456,
529–533. [Google Scholar] [CrossRef] [PubMed]
12. Schwarz, K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996, 21, 641–649.
[Google Scholar] [CrossRef]
13. Xu, L.H.; Huang, M.; Fang, S.G.; Liu, D.X. Coronavirus infection induces DNA replication stress partly through
interaction of its nonstructural protein 13 with the p125 subunit of DNA polymerase delta. J. Biol. Chem. 2011,
286, 39546–39559. [Google Scholar] [CrossRef] [PubMed]
14. Delgado-Roche, L.; Mesta, F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome
Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020, 51, 384–387. [Google Scholar]
[CrossRef] [PubMed]
15. Pierce, A.J.; Hu, P.; Han, M.; Ellis, N.; Jasin, M. Ku DNA endbinding protein modulates homologous repair of
doublestrand breaks in mammalian cells. Genes Dev. 2001, 15,
3237–3242. [Google Scholar] [CrossRef]
16. Bennardo, N.; Cheng, A.; Huang, N.; Stark, J.M. AlternativeNHEJ is a mechanistically distinct pathway of
mammalian chromosome break repair. PLoS Genet. 2008, 4, e1000110. [Google Scholar] [CrossRef]
17. Sadofsky, M.J.; Hesse, J.E.; McBlane, J.F.; Gellert, M. Expression and V(D)J recombination activity of mutated
RAG-1 proteins. Nucleic Acids Res. 1993, 21, 5644–5650. [Google Scholar] [CrossRef]
18. Trancoso, I.; Bonnet, M.; Gardner, R.; Carneiro, J.; Barreto, V.;
Demengeot, J.; Sarmento, L. A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG
Activity. Front. Immunol. 2013, 4, 110. [Google Scholar] [CrossRef]
19. Zhang, J.; Cruz-cosme, R.; Zhuang, M.-W.; Liu, D.; Liu, Y.; Teng, S.; Wang, P.-H.; Tang, Q. A systemic and
molecular study of subcellular localization of SARS-CoV-2 proteins. Signal Transduct. Target. Ther. 2020, 5,
269. [Google Scholar] [CrossRef]
20. Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of SARS-CoV-2.
Proc. Natl. Acad. Sci.
USA 2020, 117, 11727–11734. [Google Scholar] [CrossRef]
21. Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV—A target for vaccine
and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226–236. [Google Scholar] [CrossRef] [PubMed]
22. Huang, Y.; Yang, C.; Xu, X.F.; Xu, W.; Liu, S.W. Structural and functional properties of SARS-CoV-2 spike
protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149.
[Google Scholar] [CrossRef] [PubMed]
23. Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.;
Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and
TMPRSS2 and Is Blocked by a Clinically Proven Protease
Inhibitor. Cell 2020, 181, 271–280.e8. [Google
Scholar] [CrossRef]
24. Hsu, A.C.-Y.; Wang, G.; Reid, A.T.; Veerati, P.C.; Pathinayake, P.S.; Daly, K.; Mayall, J.R.; Hansbro, P.M.;
Horvat, J.C.; Wang, F.; et al. SARS-CoV-2 Spike protein promotes hyperinflammatory response that can be
ameliorated by Spikeantagonistic peptide and FDA-approved ER stress and MAP kinase inhibitors in vitro.
bioRxiv 2020, 2020, 317818. [Google Scholar]
25. Poland, G.A.; Ovsyannikova, I.G.; Kennedy, R.B. SARS-CoV-2 immunity: Review and applications to phase 3
vaccine candidates. Lancet 2020, 396, 1595–1606. [Google Scholar] [CrossRef]
26. Davanzo, G.G.; Codo, A.C.; Brunetti, N.S.; Boldrini, V.; Knittel,
T.L.; Monterio, L.B.; de Moraes, D.; Ferrari, A.J.R.; de Souza,
G.F.; Muraro, S.P.; et al. SARS-CoV-2 Uses CD4 to Infect T Helper Lymphocytes. medRxiv 2020, 2020,
20200329. [Google Scholar]
27. Borsa, M.; Mazet, J.M. Attacking the defence: SARS-CoV-2 can infect immune cells. Nat. Rev. Immunol. 2020,
20, 592. [Google Scholar] [CrossRef]
28. Barberis, E.; Vanella, V.V.; Falasca, M.; Caneapero, V.; Cappellano, G.; Raineri, D.; Ghirimoldi, M.; De
Giorgis, V.;
Puricelli, C.; Vaschetto, R.; et al. Circulating Exosomes Are Strongly Involved in SARS-CoV-2 Infection.
Front. Mol.
Biosci. 2021, 8, 632290. [Google Scholar] [CrossRef]
29. Sur, S.; Khatun, M.; Steele, R.; Isbell, T.S.; Ray, R.; Ray, R.B. Exosomes from COVID-19 patients carry
tenascin-C and fibrinogen-β in triggering inflammatory signals in distant organ cells. bioRxiv 2021, 2021,
430369. [Google Scholar]

© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms
and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

DEUTSCHE ÜBERSETZUNG:

SARS-CoV-2-Spike beeinträchtigt die DNA-Schadensreparatur und hemmt die V(D)J-Rekombination in vitro von Hui Jiang
1,2,* und YaFang Mei 2,*

Abteilung für Molekulare Biowissenschaften, The Wenner-Gren- Institut, Universität Stockholm, SE-10691 Stockholm,
Schweden

2
Abteilung für klinische Mikrobiologie, Virologie, Universität Umeå,
SE-90185 Umeå, Schweden

Autoren, an die die Korrespondenz gerichtet werden sollte.

Akademischer Herausgeber: Oliver Schildgen

Viren 2021, 13(10), 2056; https://doi.org/10.3390/v13102056


Eingereicht am: 20 August 2021 / Überarbeitet: 8 September 2021 / Akzeptiert: 8. Oktober 2021 / Veröffentlicht: 13. Oktober
2021 (Dieser Artikel gehört zur Sonderausgabe SARS-CoV-2 Host Cell Interactions)

Zusammenfassung

Das Schwere Akute Respiratorische Syndrom Coronavirus 2 (SARS-CoV-2) hat zur Pandemie der Coronavirus-Krankheit
2019 (COVID-19) geführt, die die öffentliche Gesundheit und die Weltwirtschaft schwer beeinträchtigt. Die adaptive
Immunität spielt eine entscheidende Rolle bei der Bekämpfung der SARS-CoV2Infektion und beeinflusst direkt die klinischen
Ergebnisse der Patienten. Klinische Studien haben gezeigt, dass Patienten mit schweren COVID-19-Infektionen eine
verzögerte und schwache adaptive Immunantwort zeigen. Der Mechanismus, durch den SARS-CoV-2 die adaptive Immunität
behindert, ist jedoch noch unklar. Mit Hilfe einer In-vitro-Zelllinie berichten wir, dass das SARS-CoV-2-Spike-Protein die
DNA-Schadensreparatur, die für eine wirksame V(D)J-Rekombination in der adaptiven Immunität erforderlich ist, erheblich
hemmt. Mechanistisch gesehen haben wir herausgefunden, dass das Spike-Protein im Zellkern lokalisiert ist und die DNA-
Schadensreparatur hemmt, indem es die Rekrutierung der wichtigen DNA-Reparaturproteine BRCA1 und 53BP1 an der
Schadensstelle behindert. Unsere Ergebnisse zeigen einen potenziellen molekularen Mechanismus auf, durch den das Spike-
Protein die adaptive Immunität behindern könnte, und unterstreichen die potenziellen Nebenwirkungen von Impfstoffen auf
Spike-Basis in voller Länge.

Stichworte: SARS-CoV-2; Spike; DNA-Schadensreparatur; V(D)J-


Rekombination; Impfstoff

1. Einleitung

Das Coronavirus 2 des Schweren Akuten Respiratorischen


Syndroms (SARS-CoV-2) ist für die derzeitige
CoronavirusPandemie 2019 (COVID-19) verantwortlich, die zu mehr als 2,3 Millionen Todesfällen geführt hat. SARS-CoV-2
ist ein umhülltes Single-Positive-Sense-RNA-Virus, das aus strukturellen und nichtstrukturellen Proteinen besteht [1]. Nach
der Infektion kapern und dysregulieren diese viralen Proteine die zelluläre Maschinerie des Wirts, um sich zu replizieren, zu
assemblieren und Nachkommen zu verbreiten [2]. Jüngste klinische Studien haben gezeigt, dass eine SARS-CoV-2-Infektion
die Anzahl und Funktion der Lymphozyten außerordentlich beeinträchtigt [3,4,5,6]. Im Vergleich zu leichten und
mittelschweren Überlebenden weisen Patienten mit schwerem COVID-19 eine signifikant geringere
Anzahl an GesamtT-Zellen, Helfer-T-Zellen und Suppressor-T-
Zellen auf [3,4]. Außerdem verzögert COVID-19 die IgG- und IgMSpiegel nach Auftreten der Symptome [5,6]. Insgesamt
deuten diese klinischen Beobachtungen darauf hin, dass SARS-CoV-2 das adaptive Immunsystem beeinträchtigt. Der
Mechanismus, durch den SARSCoV-2 die adaptive Immunität unterdrückt, bleibt jedoch unklar.

Das Immunsystem und das DNA-Reparatursystem sind zwei wichtige Überwachungssysteme des Wirts und die wichtigsten
Systeme, auf die sich höhere Organismen bei der Verteidigung gegen verschiedene Bedrohungen und bei der
Gewebehomöostase verlassen. Neue Erkenntnisse deuten darauf hin, dass diese beiden Systeme voneinander abhängig sind,
insbesondere während der Entwicklung und Reifung von
Lymphozyten [7]. Als einer der wichtigsten Reparaturwege für DNA-
Doppelstrangbrüche (DSB) spielt die NHEJ-Reparatur (NonHomologous End Joining) eine entscheidende Rolle bei der
Lymphozyten-spezifischen V(D)J-Rekombination, die durch die aktivierende Gen-Endonuklease (RAG) vermittelt wird und
zu einem äußerst vielfältigen Repertoire an Antikörpern in B-Zellen und T-Zell-Rezeptoren (TCRs) in T-Zellen führt [8]. So
führt beispielsweise der Funktionsverlust wichtiger
DNAReparaturproteine wie ATM, DNA-PKcs, 53BP1 u. a. zu
Defekten bei der NHEJ-Reparatur, die die Produktion funktioneller
B- und TZellen hemmen und zu Immunschwäche führen [7,9,10,11]. Im Gegensatz dazu führt eine Virusinfektion in der
Regel über verschiedene Mechanismen zu DNA-Schäden, z. B. durch die
Produktion reaktiver Sauerstoffspezies (ROS) und
Replikationsstress in der Wirtszelle [12, 13, 14]. Wenn DNASchäden nicht ordnungsgemäß repariert werden können, tragen
sie zur Verstärkung der durch die Virusinfektion ausgelösten Pathologie bei. Daher wollten wir untersuchen, ob SARS-
CoV2Proteine das DNA-Schadensreparatursystem unterwandern und dadurch die adaptive Immunität in vitro beeinträchtigen.

2. Materialien und Methoden

2.1. Antikörper und Reagenzien

DAPI (Kat. #MBD0015), Doxorubicin (Kat. #D1515), H2O2 (Kat. #H1009) und β-Tubulin-Antikörper (Kat. #T4026) wurden
von Sigma-Aldrich erworben. Antikörper gegen His-Tag (Kat. #12698),
H2A (Kat. #12349), H2A.X (Kat. #7631), γ-H2A.X (Kat. #2577),
Ku80 (Kat. #2753) und Rad51(Kat. #8875) wurden von Cell Signaling Technology (Danvers, MA, USA) erworben. Die
Antikörper 53BP1 (Kat. #NB100-304) und RNF168 (Kat.
#H00165918-M01) wurden von Novus Biologicals (Novus
Biologicals, Littleton, CO, USA) bezogen. Die Antikörper Lamin B (Kat. #sc-374015), ATM (Kat. #sc-135663), DNA-PK
(Kat. #sc5282) und BRCA1 (Kat. #sc-28383) wurden von Santa Cruz Biotechnology (Santa Cruz, CA, USA) bezogen. Der
Antikörper
XRCC4 (Kat. #PA5-82264) wurde von Thermo Fisher Scientific (Waltham, MA, USA) erworben.

2.2. Plasmide
pHPRT-DRGFP und pCBASceI wurden freundlicherweise von Maria Jasin zur Verfügung gestellt (Addgene Plasmide
#26476 und
#26477) [15]. pimEJ5GFP war ein Geschenk von Jeremy Stark
(Addgene Plasmid #44026) [16]. Die NSP1-, NSP9-, NSP13-, NSP14-, NSP16-, Spike- und Nukleokapsidproteine wurden
zunächst durch Codon-Optimierung synthetisiert und dann in einen Säugetier-Expressionsvektor pUC57 mit einem C-
terminalen 6xHisTag kloniert. Für den V(D)J-Reportervektor wurde eine invertierte RSS-GFP-Komplementärsequenz mit 12
Spacern synthetisiert - eine RSS mit 23 Spacern. Anschließend wurde die Sequenz in den pBabe-IRES-mRFP-Vektor kloniert,
um den pBabe-12RSS-GFPi-
23RSS-IRES-mRFP-Reporter-Vektor zu
erzeugen. 12-Spacer-RSS-Sequenz:
5′CACAGTGCTACAGACTGGAACAAAAACC-3′. 23-
Abstandshalter-RSS-Sequenz: 5′-
CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC-3′. Die RAG1- und RAG2-Expressionskonstrukte wurden
uns großzügig von Martin Gellert zur Verfügung gestellt (Addgene Plasmid #13328 und #13329) [17].

2.3. Zellen und Zellkultur


HEK293T- und HEK293-Zellen, die von der American Type Culture Collection (ATCC) bezogen wurden, wurden unter 5 %
CO2 bei 37
°C in Dulbecco's modified Eagle's medium (DMEM, hohe Glukose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) mit
10 % (v/v) fetalem Kälberserum (FCS, Gibco), 1 % (v/v) Penicillin (100 IU/mL) und Streptomycin (100 μg/mL) kultiviert.
HEK293T-DR-GFP- und HEK293T-EJ5-GFP-Reporterzellen wurden wie zuvor beschrieben generiert und unter 5 % CO2 bei
37 °C in dem oben genannten Nährmedium kultiviert.

2.4. HR- und NHEJ-Reporter-Assays


Die HR- und NHEJ-Reparatur in HEK293T-Zellen wurde wie zuvor beschrieben mit stabilen DR-GFP- und EJ5-GFP-Zellen
gemessen. Kurz gesagt: 0,5 × 106 stabile HEK293T-Reporterzellen wurden in
6-Well-Platten ausgesät und mit 2 μg I-SceI-Expressionsplasmid
(pCBASceI) zusammen mit SARS-CoV-2-
Proteinexpressionsplasmiden transfiziert. Achtundvierzig Stunden nach der Transfektion und der Aspirin-Behandlung wurden
die Zellen geerntet und mittels Durchflusszytometrie auf die GFPExpression untersucht. Die Mittelwerte wurden aus drei
unabhängigen Experimenten gewonnen.

2.5. Zellfraktionierung und Immunoblotting

Für den Zellfraktionstest wurde das Subcellular Protein Fractionation Kit (Thermo Fisher) gemäß den Anweisungen des
Herstellers verwendet. Die Proteinlysate wurden mit dem BCAReagenz (Thermo Fisher Scientific, Rockford, IL, USA)
quantifiziert.
Die Proteine wurden durch Natriumdodecylsulfat-Polyacrylamid-
Gelelektrophorese (SDS-PAGE) aufgelöst, auf Nitrocellulosemembranen (Amersham protran, 0,45 μm NC) übertragen und
mit spezifischen primären Antikörpern und HRPkonjugierten sekundären Antikörpern immunoblottiert. Die Proteinbanden
wurden mit dem SuperSignal West Pico oder Femto Chemilumineszenz-Kit (Thermo Fisher Scientific) nachgewiesen.

2.6. Comet-Assay
Die Zellen wurden mit verschiedenen DNA-Schadensreagenzien behandelt und dann zu den angegebenen Zeitpunkten für die
Analyse geerntet. Die Zellen (1 × 105 Zellen/mL in kalter phosphatgepufferter Kochsalzlösung [PBS]) wurden bei 40 °C in
1% niedrigschmelzender Agarose im Verhältnis 1:3 vol/vol resuspendiert und auf einen CometSlide pipettiert. Die
Objektträger wurden dann in vorgekühlten Lysepuffer (1,2 M NaCl, 100 mM EDTA, 0,1 % Natriumlaurylsarkosinat, 0,26 M
NaOH pH > 13) getaucht und über Nacht (18-20 h) bei 4 °C im Dunkeln lysiert. Anschließend wurden die Objektträger
vorsichtig herausgenommen und 20 Minuten lang bei Raumtemperatur (RT) im Dunkeln in Spülpuffer (0,03 M NaOH und 2
mM EDTA, pH > 12) getaucht. Dieser Waschschritt wurde zweimal wiederholt. Die Objektträger wurden in eine horizontale
Elektrophoresekammer mit Spülpuffer überführt und 25 Minuten lang bei einer Spannung von 0,6 V/cm getrennt. Schließlich
wurden die Objektträger mit destilliertem Wasser gewaschen, mit 10 μg/mL Propidiumiodid angefärbt und
fluoreszenzmikroskopisch analysiert. Zwanzig Felder mit etwa 100 Zellen in jeder Probe wurden ausgewertet und mit der Fiji-
Software quantifiziert, um die Schwanzlänge (Schwanzmoment) zu bestimmen.

2.7. Immunofluoreszenz

Die Zellen wurden auf Glasdeckgläsern in einer 12-Well-Platte ausgesät und 24 Stunden lang
mit dem angegebenen Plasmid transfiziert. Anschließend wurden die Zellen je nach
Versuchsaufbau mit oder ohne DNA-Schadensreagenzien behandelt. Die Zellen wurden 20
Minuten lang bei RT in 4% Paraformaldehyd (PFA) in PBS fixiert und anschließend 10
Minuten lang in 0,5% Triton X-100 permeabilisiert. Die Objektträger wurden mit 5 %
normalem Ziegenserum (NGS) blockiert und über Nacht bei 4 °C mit in 1 % NGS verdünnten
Primärantikörpern inkubiert. Anschließend wurden die Proben mit den angegebenen, mit Alexa
Fluor 488 oder 555 (Invitrogen) markierten Sekundärantikörpern, verdünnt in 1 %igem NGS,
bei RT 1 Stunde lang inkubiert und anschließend 15 Minuten lang bei
RT mit DAPI gefärbt. Die Deckgläser wurden mit Dako Fluorescence Mounting Medium
(Agilent) aufgezogen und mit einem konfokalen Mikroskop von Nikon (Eclipse C1 Plus)
abgebildet. Alle Auswertungen wurden unter verblindeten Bedingungen durchgeführt.
2.8. Analyse der V(D)J-Rekombination
Kurz gesagt, das V(D)J-Reporterplasmid enthält invertiertes GFP und IRES, das kontinuierlich
exprimiertes RFP antreibt. Kontinuierlich exprimiertes RFP ist die interne
Transfektionskontrolle. Nachdem das Rekombinations- aktivierungsgen 1/2 (RAG1/2) in die
Zellen kotransfiziert wurde, schneidet RAG1/2 die RSS und vermittelt die Induktion von
DSBs. Wenn V(D)J-Rekombination auftritt, werden die invertierten GFPs in positiver
Reihenfolge durch NHEJ-Reparatur ligiert. Dann wird die Zelle funktionelles GFP
exprimieren. Die doppelt positiven GFP- und RFP-Zellen sind also das Ergebnis des V(D)J-
Reporter-Tests [18]. 293T-Zellen mit 70 % Konfluenz wurden mit dem V(D)JGFPReporter
allein (Hintergrund) oder in Kombination mit RAG1- und
RAG2-Expressionskonstrukten in einem Verhältnis von 1 µg V(D)JGFP-Reporter: 0,5 µg
RAG1: 0,5 µg RAG2 transfiziert. Am nächsten Tag wurde das Medium gewechselt, und nach
weiteren 48 Stunden wurden die Zellen geerntet und mittels
Durchflusszytometrie auf GFP- und RFP-Expression untersucht.
2.9. Statistische Auswertung
Alle Experimente wurden mindestens dreimal mit unabhängig voneinander gesammelten oder
vorbereiteten Proben wiederholt. Die Daten wurden mittels Student's t-Test oder ANOVA,
gefolgt von Tukey's Multiple-Comparison-Tests mit GraphPad 8 analysiert. 3. Ergebnisse
3.1. Wirkung der im Zellkern lokalisierten SARS-CoV-2Virusproteine auf die DNA-
Schadensreparatur
Die Reparatur von DNA-Schäden findet hauptsächlich im Zellkern statt, um die Stabilität des
Genoms zu gewährleisten. Obwohl SARS-CoV-2-Proteine im Zytosol synthetisiert werden
[1], sind einige virale Proteine auch im Zellkern nachweisbar, darunter Nsp1, Nsp5, Nsp9,
Nsp13, Nsp14 und Nsp16 [19]. Wir untersuchten, ob diese im Kern lokalisierten SARS-CoV-
2-Proteine das DNA-Schadensreparatursystem der Wirtszelle beeinflussen. Zu diesem Zweck
konstruierten wir diese viralen Proteinexpressionsplasmide zusammen mit Spike- und
Nukleoproteinexpressionsplasmiden, die im Allgemeinen als zytosollokalisierte Proteine
gelten. Wir bestätigten ihre Expression und Lokalisierung durch Immunoblotting und
Immunfluoreszenz (Abbildung 1A und Abbildung S1A). Unsere Ergebnisse stimmten mit
denen früherer Studien überein [19]; die Proteine Nsp1, Nsp5, Nsp9, Nsp13, Nsp14 und
Nsp16 sind tatsächlich im Zellkern lokalisiert, während die Nukleoproteine hauptsächlich im
Zytosol zu finden sind. Überraschenderweise fanden wir die Häufigkeit des Spike-Proteins im
Zellkern (Abbildung 1A).
Die
NHEJ-Reparatur und die Reparatur durch homologe Rekombination (HR) sind zwei
wichtige DNA-Reparaturwege, die nicht nur die Integrität des Genoms kontinuierlich
überwachen und sicherstellen, sondern auch für die Funktionen der adaptiven Immunzellen
unerlässlich sind [9]. Um festzustellen, ob diese viralen Proteine den DSB-Reparaturweg
behindern, untersuchten wir die Reparatur eines ortsspezifischen DSB, der durch die
ISceIEndonuklease induziert wurde, unter Verwendung des direkten
Repeat-Grünfluoreszenzproteins (DR-GFP) und des GesamtNHEJGFP (EJ5-GFP)
Reportersystems für HR bzw. NHEJ [15,16]. Die Überexpression von Nsp1, Nsp5, Nsp13,
Nsp14 und SpikeProteinen verringerte die Effizienz sowohl der HR- als auch der
NHEJReparatur (Abbildung 1B-E und Abbildung S2A,B). Darüber hinaus stellten wir fest,
dass die Überexpression von Nsp1, Nsp5, Nsp13 und Nsp14 die Proliferation im Vergleich zu
anderen untersuchten Proteinen drastisch unterdrückte (Abbildung S3A,B). Die hemmende
Wirkung von Nsp1, Nsp5, Nsp13 und Nsp14 auf die Reparatur von DNA-Schäden könnte
daher auf sekundäre Effekte wie Wachstumsstillstand und Zelltod zurückzuführen sein.
Interessanterweise beeinträchtigte das überexprimierte SpikeProtein weder die
Zellmorphologie noch die Zellproliferation, unterdrückte aber sowohl die HR- als auch die
NHEJ-Reparatur signifikant (Abbildung 1B-E, Abbildungen S2A,B und S3A,B).
Viren 13 02056 g001 550Abbildung 1. Auswirkung der im Kern lokalisierten Proteine des
schweren akuten respiratorischen Syndroms Coronavirus 2 (SARS-CoV-2) auf die Reparatur
von
DNASchäden. (A) Subzelluläre Verteilung der SARS-CoV-2Proteine. Die Immunfluoreszenz
wurde 24 h nach Transfektion des Plasmids, das die viralen Proteine exprimiert, in HEK293T-
Zellen durchgeführt. Maßstabsbalken: 10 µm. (B) Schematische Darstellung des EJ5GFP-
Reporters, der zur Überwachung der nichthomologen
Endverbindung (NHEJ) verwendet wird. (C) Wirkung des leeren
Vektors (E.V.) und der SARS-CoV-2-Proteine auf die NHEJDNAReparatur. Die Werte stellen
den Mittelwert ± SD von drei unabhängigen Experimenten dar (siehe repräsentative FACS-
Plots in Abbildung S2B). Die Werte stellen den Mittelwert ± SD dar, n = 3. Die statistische
Signifikanz wurde mittels einseitiger Varianzanalyse (ANOVA) in (C,E) bestimmt. ** p <
0,01, *** p < 0,001, **** p < 0,0001.
3.2. SARS-CoV-2-Spike-Protein hemmt DNA-Schadensreparatur
Da Spike-Proteine für die Vermittlung des viralen Eintritts in die Wirtszellen entscheidend
sind und im Mittelpunkt der meisten
Impfstrategien stehen [20,21], haben wir die Rolle der SpikeProteine bei der DNA-
Schadensreparatur und der damit verbundenen V(D)J-Rekombination weiter untersucht. Es
wird angenommen, dass Spike-Proteine im rauen endoplasmatischen Retikulum (ER)
synthetisiert werden [1]. Nach posttranslationalen Modifikationen wie der Glykosylierung
werden Spike-Proteine zusammen mit anderen viralen Proteinen durch den zellulären
Membranapparat transportiert und bilden das reife Virion [1]. Das Spike-Protein enthält zwei
Hauptuntereinheiten, S1 und S2, sowie mehrere funktionelle Domänen oder Wiederholungen
[22] (Abbildung 2A). Im nativen Zustand liegen die Spike-Proteine als inaktive Proteine in
voller Länge vor. Während der viralen Infektion aktivieren Proteasen der Wirtszelle, wie z. B.
die Furin-Protease, das S-Protein, indem sie es in die Untereinheiten S1 und S2 spalten, was
für den Eintritt des Virus in die Zielzelle notwendig ist [23]. Wir untersuchten verschiedene
Untereinheiten des Spike-Proteins, um die für die Hemmung der DNA-Reparatur
erforderlichen funktionellen Merkmale zu klären. Nur das Spike-Protein in voller Länge
hemmte sowohl die NHEJ- als auch die HR-Reparatur stark (Abbildung 2B-E und Abbildung
S4A,B). Als Nächstes versuchten wir zu bestimmen, ob das Spike-Protein durch die
Hemmung der DSB-Reparatur direkt zur genomischen Instabilität beiträgt. Wir überwachten
die Anzahl der DSBs mit Hilfe von Comet-Assays. Nach verschiedenen DNA-
Schadensbehandlungen, wie γBestrahlung, Doxorubicin-Behandlung und H2O2-Behandlung,
findet in Gegenwart des Spike-Proteins weniger Reparatur statt (Abbildung 2F und G).
Zusammengenommen zeigen diese Daten, dass das Spike-Protein die DNA-Reparatur im
Zellkern direkt beeinflusst.
Viren 13 02056 g002 550Abbildung 2. Das Spike-Protein des Coronavirus 2 des Schweren
Akuten Respiratorischen Syndroms (SARS-CoV-2) hemmt die Reparatur von DNA-Schäden.
(A)
Schematische Darstellung der Primärstruktur des SARS-CoV2Spike-Proteins. Die S1-
Untereinheit umfasst eine N-terminale Domäne (NTD, 14-305 Reste) und eine
rezeptorbindende Domäne (RBD, 319-541 Reste). Die S2-Untereinheit besteht aus dem
Fusionspeptid (FP, 788-806 Reste), der
HeptapeptidWiederholungssequenz 1 (HR1, 912-984 Reste), HR2 (1163-1213 Reste), der TM-
Domäne (TM, 1213-1237 Reste) und der Zytoplasma Domäne (CT, 1237-1273 Reste). (B,C)
Wirkung der titrierten Expression des Spike-Proteins auf die DNA-Reparatur in HEK-293T-
Zellen. (D,E) Nur das Spike-Protein in voller Länge hemmt die nicht-homologe
Endverbindung (NHEJ) und die homologe Rekombination (HR) der DNA-Reparatur. Die
Werte stellen den Mittelwert ± SD von drei unabhängigen Experimenten dar (siehe
repräsentative FACS-Plots in Abbildung S4A,B). (F) Mit dem Spike-Protein in voller Länge
(S-FL) transfizierte HEK293TZellen wiesen unter verschiedenen DNA-
Schadensbedingungen mehr DNA-Schäden auf als leere Vektor-, S1- und S2-transfizierte
Zellen. Für Doxorubicin: 4 µg/mL, 2 h. Für γ-Bestrahlung: 10 Gy, 30 min. Für H2O2: 100
µM, 1 h. Maßstabsbalken: 50 µm. (G) Entsprechende Quantifizierung der
Kometenschweifmomente aus 20 verschiedenen Feldern mit n > 200 Kometen aus drei
unabhängigen Experimenten. Die statistische Signifikanz wurde mit einer zweifachen
Varianzanalyse (ANOVA) ermittelt. NS (nicht signifikant): * p > 0,05, ** p < 0,01, *** p <
0,001, **** p < 0,0001.
3.3. Spike-Proteine behindern die Rekrutierung von DNASchadensreparatur-
Checkpoint-Proteinen
Um die Existenz des Spike-Proteins im Zellkern zu bestätigen, führten wir eine Analyse der
subzellulären Fraktionen durch und stellten fest, dass Spike-Proteine nicht nur in der
Zellmembranfraktion angereichert sind, sondern auch in der
Kernfraktion reichlich vorhanden sind und sogar in der Chromatingebundenen Fraktion
nachweisbar sind (Abbildung 3A).
Wir beobachteten auch, dass der Spike drei verschiedene Formen hat: die obere Bande ist ein
hoch glykosylierter Spike, die mittlere ist ein Spike in voller Länge und die untere ist eine
gespaltene Spike-Untereinheit. In Übereinstimmung mit dem Comet-Assay fanden wir auch
die Hochregulierung des DNA-Schadensmarkers γH2A.X in Spike-Protein-überexprimierten
Zellen unter DNASchadensbedingungen (Abbildung 3B). Eine kürzlich durchgeführte Studie
legt nahe, dass Spike-Proteine ER-Stress und ERassoziierten Proteinabbau induzieren [24].
Um die Möglichkeit auszuschließen, dass das Spike-Protein die DNA-Reparatur hemmt,
indem es den Abbau von DNA-Reparaturproteinen fördert, überprüften wir die Expression
einiger wesentlicher DNAReparaturproteine in den NHEJ- und HR-Reparaturwegen und
stellten fest, dass diese DNA-Reparaturproteine nach der SpikeProtein-Überexpression stabil
waren (Abbildung 3C). Um festzustellen, wie das Spike-Protein sowohl NHEJ- als auch
HRReparaturwege hemmt, analysierten wir die Rekrutierung von BRCA1 und 53BP1, die die
wichtigsten Checkpoint-Proteine für HR- bzw. NHEJ-Reparatur sind. Wir stellten fest, dass
das Spike-Protein sowohl die Bildung von BRCA1- als auch von 53BP1-Foci deutlich hemmte
(Abbildung 3D-G). Insgesamt zeigen diese Daten, dass das
SARS-CoV-2-Spike-Protein in voller Länge die DNASchadensreparatur hemmt, indem es die
Rekrutierung von DNAReparaturproteinen behindert.
Viren 13 02056 g003 550Abbildung 3. Das Spike-Protein des
Schweren Akuten Respiratorischen Syndroms Coronavirus 2
(SARS-CoV-2) hemmt die Rekrutierung von
DNA-
Schadensreparatur-Checkpoint-Proteinen. (A) Membranfraktion (MF), zytosolische Fraktion
(CF), lösliche Kernfraktion (SNF) und
Chromatin-gebundene Fraktion (CBF) von HEK293T-Zellen, die mit SARS-CoV-2-Spike-
Protein transfiziert wurden, wurden immunoblottiert für His-Tag-Spike und die angegebenen
Proteine. (B) Links: Immunoblots des DNA-Schadensmarkers γH2AX in leeren Vektor- (E.V.)
und Spike-Protein-exprimierenden HEK293T-Zellen nach 10 Gy γ-Bestrahlung. Rechts:
entsprechende Quantifizierung der Immunoblots links. Die Werte stellen den Mittelwert ± SD
dar (n = 3). Die statistische Signifikanz wurde mit dem Student's t-Test ermittelt. **** p <
0.0001. (C) Immunoblots von Proteinen, die mit der DNA-Schadensreparatur
zusammenhängen, in HEK293TZellen, die Spike-Protein exprimieren. (D) Repräsentative
Bilder der 53BP1-Foci-Bildung in E.V- und Spike-Protein-exprimierenden HEK293-Zellen,
die einer 10 Gy γ-Bestrahlung ausgesetzt wurden. Maßstabsleiste: 10 µm. (E) Quantitative
Analyse der 53BP1-Foki pro Zellkern. Die Werte stellen den Mittelwert ± SEM dar, n = 50.
(F) Bildung von BRCA1-Foci in leeren Vektor- und SpikeProteinexprimierenden HEK293-
Zellen, die einer 10 Gy γBestrahlung ausgesetzt wurden. Skalenbalken: 10 µm. (G).
Quantitative Analyse der BRCA1-Foki pro Zellkern. Die Werte stellen den Mittelwert ± SEM
dar, n = 50. Die statistische Signifikanz wurde mit dem Student's t-test ermittelt. **** p <
0.0001.
3.4. Das Spike-Protein beeinträchtigt die V(D)J-Rekombination in vitro
Die DNA-Schadensreparatur, insbesondere die NHEJ-Reparatur, ist wesentlich für die V(D)J-
Rekombination, die das Herzstück der B- und T-Zell-Immunität darstellt [9]. Bislang wurden
viele zugelassene SARS-CoV-2-Impfstoffe, wie mRNA-Impfstoffe und Adenovirus-COVID-
19-Impfstoffe, auf der Grundlage des
SpikeProteins in voller Länge entwickelt [25]. Obwohl es umstritten ist, ob SARS-CoV-2
direkt Lymphozytenvorläufer infiziert [26,27], haben einige Berichte gezeigt, dass infizierte
Zellen Exosomen absondern, die SARS-CoV-2-RNA oder -Protein an Zielzellen abgeben
können [28,29]. Wir haben weiter getestet, ob das SpikeProtein die NHEJ-vermittelte V(D)J-
Rekombination reduziert. Zu
diesem Zweck haben wir ein in vitro
V(D)J-
Rekombinationsreportersystem gemäß einer früheren Studie [18] entwickelt (Abbildung S5).
Im Vergleich zum leeren Vektor hemmte die Überexpression des Spike-Proteins die
RAGvermittelte V(D)J-Rekombination in diesem in vitro Reportersystem (Abbildung 4).
Viren 13 02056 g004 550
Abbildung 4. Das Spike-Protein beeinträchtigt die V(D)J- Rekombination in vitro. (A)
Schematische Darstellung des V(D)JReportersystems. (B) Repräsentative Diagramme der
Durchflusszytometrie zeigen, dass das SARS-CoV-2-Spike-Protein die V(D)J-Rekombination
in vitro behindert. (C) Quantitative Analyse der relativen V(D)J-Rekombination. Die Werte
stellen den Mittelwert ± SD dar, n = 3. Die statistische Signifikanz wurde mit dem Student's t-
test ermittelt. **** p < 0.0001.
4. Diskussion
Unsere Ergebnisse belegen, dass das Spike-Protein die DNASchadensbehebungsmaschinerie
und die Maschinerie des adaptiven Immunsystems in vitro unterwandert. Wir schlagen einen
möglichen Mechanismus vor, durch den Spike-Proteine die adaptive Immunität durch
Hemmung der DNA-Schadensreparatur beeinträchtigen können. Obwohl keine Beweise dafür
veröffentlicht wurden, dass SARS-CoV-2 Thymozyten oder lymphoide Zellen des
Knochenmarks infizieren kann, zeigt unser in vitro V(D)J-Reporter-Assay, dass das Spike-
Protein die V(D)JRekombination stark behindert. Im Einklang mit unseren Ergebnissen zeigen
auch klinische Beobachtungen, dass das Risiko einer schweren Erkrankung oder eines Todes
durch COVID-19 mit dem Alter zunimmt, insbesondere bei älteren Erwachsenen, die das
höchste Risiko tragen [22]. Dies könnte darauf zurückzuführen sein, dass SARS-CoV-2-Spike-
Proteine das DNA-Reparatursystem älterer Menschen schwächen und folglich die
V(D)JRekombination und die adaptive Immunität behindern können. Im
Gegensatz dazu liefern unsere Daten wertvolle Details über die
Beteiligung von Spike-Protein-Untereinheiten an der DNASchadensreparatur, was darauf
hindeutet, dass Impfstoffe auf Spike-Basis in voller Länge die Rekombination von V(D)J in B-
Zellen hemmen können, was auch mit einer kürzlich durchgeführten Studie übereinstimmt, in
der ein Impfstoff auf Spike-Basis in voller Länge niedrigere Antikörpertiter im Vergleich zu
einem Impfstoff auf RBD-Basis induzierte [28]. Dies deutet darauf hin, dass die Verwendung
antigener Epitope des Spikes als SARS-CoV-2-
Impfstoff sicherer und wirksamer sein könnte als der Spike in voller Länge. Insgesamt haben
wir einen der potenziell wichtigen Mechanismen der Unterdrückung des adaptiven
Immunsystems des Wirts durch SARS-CoV-2 identifiziert. Darüber hinaus deuten unsere
Ergebnisse auch auf eine mögliche Nebenwirkung des Impfstoffs auf Basis von Spikes in
voller Länge hin. Diese Arbeit wird das Verständnis der Pathogenese von COVID-19
verbessern und neue Strategien für die Entwicklung effizienterer und sichererer Impfstoffe
liefern.
Ergänzende Materialien
Abbildung S1: Expression von kernständig lokalisierten SARS-CoV2Proteinen in
menschlichen Zellen, Abbildung S2: Wirkung von kernständigen SARS-CoV-2-Proteinen auf
den NHEJ- und HRDNAReparaturweg, Abbildung S3: Nsp1, Nsp5, Nsp13, Nsp14, aber nicht
Spike hemmen die Zellproliferation, Abbildung S4: Wirkung von SARS-CoV-2-Spike-
Mutanten auf den NHEJ- und HRDNAReparaturweg, Abbildung S5:
In vitro V(D)JRekombinationstest.
Beiträge der Autoren
H.J. konzipierte und gestaltete die Studie. H.J. und Y.-F.M. leiteten die Studie, führten die
Experimente durch und interpretierten die Daten. Schreiben - Erstellung des ursprünglichen
Entwurfs, H.J.; Schreiben - Überprüfung und Bearbeitung, H.J. und Y.-F.M.; Beschaffung von
Finanzmitteln, Y.-F.M. Alle Autoren haben die veröffentlichte Fassung des Manuskripts
gelesen und sind damit einverstanden.
Finanzierung
Diese Arbeit wurde durch die Planungszuschüsse der Medizinischen Fakultät der Universität
Umeå für COVID-19
(Forschungsprojektnummer: 3453 16032 für Y.F.M.), die Lion's Cancer Research Foundation
an der Universität Umeå (Zuschüsse:
LP 17-2153, AMP 19-982 und LP 20-2256 für Y.F.M.) und die ALFMittel der Basiseinheit für
die Forschung an akademischen
Gesundheitseinrichtungen und universitären Gesundheitseinrichtungen in der nördlichen
Gesundheitsregion (ALFBasenheten: 2019, 2020, 2021 für Y.F.M.) unterstützt.
Stellungnahme des Institutional Review Board
Nicht zutreffend, da diese Studie weder Menschen noch Tiere umfasst.
Erklärung zur Einwilligung nach Aufklärung
Nicht zutreffend, da diese Studie nicht am Menschen durchgeführt wird.
Erklärung zur Datenverfügbarkeit
Die in dieser Studie präsentierten Daten sind im Haupttext und in den ergänzenden Materialien
verfügbar.
Interessenkonflikte
Die Autoren haben erklärt, dass keine konkurrierenden Interessen bestehen. Die Geldgeber
hatten keinen Einfluss auf das Studiendesign, die Datenerhebung und -analyse, die
Entscheidung zur Veröffentlichung oder die Erstellung des Manuskripts.
Referenzen
V'Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V.
Coronavirus biology and replication: Implikationen für SARS-CoV2. Nat. Rev. Microbiol.
2021, 19, 155-170. [Google Scholar] [CrossRef]
Suryawanshi, R.K.; Koganti, R.; Agelidis, A.; Patil, C.D.; Shukla, D.
Dysregulation der Zellsignalisierung durch SARS-CoV-2. Trends Microbiol. 2021, 29, 224-
237. [Google Scholar] [CrossRef]
Qin, C.; Zhou, L.; Hu, Z.; Zhang, S.; Yang, S.; Tao, Y.; Xie, C.; Ma, K.; Shang, K.; Wang,
W.; et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19)
in Wuhan, China. Clin. Infect. Dis. 2020, 71, 762-768. [Google Scholar] [CrossRef]
[PubMed]
Wang, F.; Nie, J.; Wang, H.; Zhao, Q.; Xiong, Y.; Deng, L.; Song, S.;
Ma, Z.; Mo, P.; Zhang, Y. Characteristics of Peripheral Lymphocyte
Subset Alteration in COVID-19 Pneumonia. J. Infect. Dis. 2020, 221, 1762-1769. [Google
Scholar] [CrossRef] [PubMed]
Zhang, G.; Nie, S.; Zhang, Z.; Zhang, Z. Longitudinal Change of Severe Acute Respiratory
Syndrome Coronavirus 2 Antibodies in
Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020, 222, 183-188. [Google Scholar]
[CrossRef] [PubMed]
Long, Q.X.; Liu, B.Z.; Deng, H.J.; Wu, G.C.; Deng, K.; Chen, Y.K.; Liao, P.; Qiu, J.F.; Lin,
Y.; Cai, X.F.; et al. Antibody responses to SARS-CoV2 in patients with COVID-19. Nat. Med.
2020, 26, 845-848. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. Lymphocyte development:
Integration der DNA-Schadensantwort-Signalgebung. Adv. Immunol. 2012, 116, 175-204.
[Google Scholar] [PubMed]
Malu, S.; Malshetty, V.; Francis, D.; Cortes, P. Role of nonhomologous end joining in V(D)J
recombination. Immunol. Res. 2012, 54, 233-246. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. At the intersection of DNA damage and immune responses.
Nat. Rev. Immunol. 2019, 19, 231-242. [Google Scholar] [CrossRef]
Gapud, E.J.; Sleckman, B.P. Unique and redundant functions of ATM and DNA-PKcs during
V(D)J recombination. Cell. Cycle 2011,
10, 1928-1935. [Google Scholar] [CrossRef]
Difilippantonio, S.; Gapud, E.; Wong, N.; Huang, C.Y.; Mahowald,
G.; Chen, H.T.; Kruhlak, M.J.; Callen, E.; Livak, F.; Nussenzweig,
M.C.; et al. 53BP1 erleichtert die weitreichende
DNAEndverbindung während der V(D)J-Rekombination. Nature 2008, 456, 529-533. [Google
Scholar] [CrossRef] [PubMed]
Schwarz, K.B. Oxidativer Stress während viraler Infektionen: A review. Free Radic. Biol.
Med. 1996, 21, 641-649. [Google Scholar] [CrossRef]
Xu, L.H.; Huang, M.; Fang, S.G.; Liu, D.X. Coronavirus-Infektion induziert DNA-
Replikationsstress zum Teil durch Interaktion seines Nicht-Strukturproteins 13 mit der p125-
Untereinheit der DNAPolymerase delta. J. Biol. Chem. 2011, 286, 39546-39559. [Google
Scholar] [CrossRef] [PubMed]
Delgado-Roche, L.; Mesta, F. Oxidativer Stress als Schlüsselspieler bei der Infektion mit dem
Coronavirus des Schweren Akuten Respiratorischen Syndroms (SARS-CoV). Arch. Med. Res.
2020, 51, 384-387. [Google Scholar] [CrossRef] [PubMed]
Pierce, A.J.; Hu, P.; Han, M.; Ellis, N.; Jasin, M. Ku DNA end-binding protein modulates
homologous repair of double-strand breaks in mammalian cells. Genes Dev. 2001, 15, 3237-
3242. [Google Scholar] [CrossRef]
Bennardo, N.; Cheng, A.; Huang, N.; Stark, J.M. Alternative-NHEJ ist ein mechanistisch
unterschiedlicher Weg der
Chromosomenbruchreparatur bei Säugetieren. PLoS Genet. 2008, 4, e1000110. [Google
Scholar] [CrossRef]
Sadofsky, M.J.; Hesse, J.E.; McBlane, J.F.; Gellert, M. Expression und V(D)J-
Rekombinationsaktivität von mutierten RAG1Proteinen. Nucleic Acids Res. 1993, 21, 5644-
5650. [Google Scholar] [CrossRef]
Trancoso, I.; Bonnet, M.; Gardner, R.; Carneiro, J.; Barreto, V.; Demengeot, J.; Sarmento, L.
A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG Activity. Front.
Immunol. 2013, 4, 110. [Google Scholar] [CrossRef]
Zhang, J.; Cruz-cosme, R.; Zhuang, M.-W.; Liu, D.; Liu, Y.; Teng, S.; Wang, P.-H.; Tang, Q.
A systemic and molecular study of subcellular localization of SARS-CoV-2 proteins. Signal
Transduct. Target. Ther. 2020, 5, 269. [Google Scholar] [CrossRef]
Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of
SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020,
117, 11727-11734. [Google Scholar] [CrossRef]
Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV-A
target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226-236.
[Google Scholar] [CrossRef] [PubMed]
Huang, Y.; Yang, C.; Xu, X.F.; Xu, W.; Liu, S.W. Structural and functional properties of
SARS-CoV-2 spike protein: Potenzielle Entwicklung von Antivirus-Medikamenten für
COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141-1149. [Google Scholar] [CrossRef]
[PubMed]
Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.;
Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends
on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020,
181,
271-280.e8. [Google Scholar] [CrossRef]
Hsu, A.C.-. Y.; Wang, G.; Reid, A.T.; Veerati, P.C.; Pathinayake, P.S.; Daly, K.; Mayall, J.R.;
Hansbro, P.M.; Horvat, J.C.; Wang, F.; et al.
SARS-CoV-2 Spike-Protein fördert hyperinflammatorische Reaktion, die durch Spike-
antagonistisches Peptid und FDAzugelassene ER-Stress- und MAP-Kinase-Inhibitoren in vitro
verbessert werden kann. bioRxiv 2020, 2020, 317818. [Google Scholar]
Poland, G.A.; Ovsyannikova, I.G.; Kennedy, R.B. SARS-CoV-2 immunity: Review and
applications to phase 3 vaccine candidates. Lancet 2020, 396, 1595-1606. [Google Scholar]
[CrossRef]
Davanzo, G.G.; Codo, A.C.; Brunetti, N.S.; Boldrini, V.; Knittel, T.L.; Monterio, L.B.; de
Moraes, D.; Ferrari, A.J.R.; de Souza, G.F.;
Muraro, S.P.; et al. SARS-CoV-2 Uses CD4 to Infect T Helper
Lymphocytes. medRxiv 2020, 2020, 20200329. [Google Scholar]
Borsa, M.; Mazet, J.M. Angriff auf die Abwehr: SARS-CoV-2 kann Immunzellen infizieren.
Nat. Rev. Immunol. 2020, 20, 592. [Google Scholar] [CrossRef]
Barberis, E.; Vanella, V.V.; Falasca, M.; Caneapero, V.; Cappellano, G.; Raineri, D.;
Ghirimoldi, M.; De Giorgis, V.; Puricelli, C.; Vaschetto, R.; et al. Circulating Exosomes Are
Strongly Involved in SARS-CoV-2 Infection. Front. Mol. Biosci. 2021, 8, 632290. [Google
Scholar] [CrossRef]
Sur, S.; Khatun, M.; Steele, R.; Isbell, T.S.; Ray, R.; Ray, R.B. Exosomes from COVID-19
patients carry tenascin-C and fibrinogenβ in triggering inflammatory signals in distant organ
cells. bioRxiv 2021, 2021, 430369. [Google Scholar]

© 2021 by the authors. Lizenznehmer MDPI, Basel, Schweiz. Dieser Artikel ist ein Open-
Access-Artikel, der unter den Bedingungen der Creative-Commons-Attribution (CC BY)-
Lizenz verbreitet wird (https://creativecommons.org/licenses/by/4.0/).
Schlussbemerkung

Bill Gates hatte eigentlich alles zum Thema Impfen und Pandemien gesagt, aber man hat ihm
nicht zugehört. Er präsentierte uns seine Ideen bereits 2011 und das nicht im kleinen Kreis,
sondern öffentlich und für jeden zugänglich. Ihm – und dazu stehen ihm aus eigenem Kapital
ungeheure Mittel zur Verfügung – geht es um die Reduzierung der Weltbevölkerung. Nichts
Geringeres hat er sich zur Aufgabe gemacht.
Nun erleben wir, dass ein Programm durchgezogen wird, das man nur als Menschen
verachtend bezeichnen kann.
Es gibt viele kluge Köpfe, denen die stetige Zunahme der Weltbevölkerung große Sorgen
bereitet.
Es gibt allerdings auch kein Jahrhundert, wo uns Menschen nicht das Ende der Welt, der
Untergang, die kosmische Katastrophe, das ganz große Unheil vorhergesagt wird. Und
mittlerweile ist die Erde 4,7 Milliarden Jahre alt, der Mensch tappst auf ihr seit gut 6 Millionen
Jahren auf ihr herum.
Von der Dampflock bis zum Flug durch den Weltall im eigenen Sonnensystem vergingen
gerade einmal 50 Jahre. Die Entwicklung hat sich um ein Vielfaches beschleunigt. Man kann
gar nicht ahnen, was in den nächsten 50 Jahren alles möglich sein wird.
Vielleicht ist die Corona-Pandemie auch der Übergang zu der neuen Welt Ordnung, von der
schon in den dreißiger Jahren des letzten Jahrhunderts gesprochen worden ist.
Wir werden es erleben und sehen, welchen Einfluss wir noch nehmen können. Die Erfahrung
der letzten 200 Jahre allerdings zeigt klar, dass der Mensch nicht in der Lage oder nicht
willens ist, gute Entscheidungen für die Mehrheit der Bürger zu fällen. Letztlich geht es nur
um das Wohlbefinden der kleinen Gruppe von Eliten, die es sich auf Kosten der großen Menge
noch bequemer machen möchten. Immer weniger einzelne Menschen besitzen immer mehr
Kapital, das der großen Mehrheit mit den perfidesten Programmen entzogen wird.
Eines dieser Programme heißt ganz klar CORONA.
Über den Autor

Peter Echevers H. wurde 1954 in Berlin-Zehlendorf in einer alten Berliner Architekten- und
Baumeisterfamilie geboren. Er wuchs im Rheinland auf und war bis zur Mittleren Reife
eigentlich ein mittelmäßiger Schüler. Danach entwickelte er plötzlich großen Bildungshunger
und schrieb sich in ein Aufbaugymnasium und gleichzeitig am Institut Français ein.
Es folgten zwei gegensätzliche Lehren als Notargehilfe und Tischler; danach ein BWL-
Studium an der Rheinischen Akademie und Seminare an einer Schule für Bildende Künste.
Daneben absolvierte er als externer Schüler mit Erfolg die Fachhochschule für Seefahrt in
Elsfleth bei Oldenburg.
Schon sehr früh zog es ihn zur Literatur. Angeleitet durch das
Elternhaus, welches eine beachtliche
Büchersammlung vorzuweisen hatte, begann sein Einstieg in die geschriebene Welt, kaum, dass
er die ersten beiden Volksschuljahre hinter sich hatte. Mit Beginn der Pubertät begannen auch
seine Versuche, selbst zu schreiben. Seine erste
Veröffentlichung in der Lokalpresse im Alter von 15 war sein Aufsatz über die „Reise nach
Paris“; es folgte mit 18 sein Reisebericht „Auf nach Brasilien“ in der Lokalpresse.
Immer wieder unterbrach er seine Tätigkeiten, er konnte dem lockenden Ruf der Ferne nicht
widerstehen. Zu groß war seine Sehnsucht, andere Länder und andere Menschen und
Gebräuche kennen zu lernen. So lebte er für längere Zeit in acht europäischen und fünf
außereuropäischen Ländern. Aber seine große Liebe ist und bleibt Südamerika, genauer gesagt
Brasilien, wo er sich 2002 nach vielen Einzelreisen niedergelassen hat.
Seitdem hat er die Zeit gefunden, sich ganz dem Schreiben zu widmen. 2013 wurde ihm die
Ehrendoktorwürde verliehen. Neben über 650 im Internet veröffentlichten Berichten,
Aufsätzen und Stellungnahmen hat er bisher folgende Bücher veröffentlicht:

- Die Gaúchos ISBN 978-1-257-96502-1

- Búzios – Mein Paradies ISBN 978-1-4357-8894-7

- Faszination Rio ISBN 978-1-257-95830-6

- Der exzellente Liebhaber ISBN 978-1-257-95244-1


Die exzellente Liebhaberin ISBN 978-1-257-94957-1

- Konfliktparallelen ISBN 978-1-257-95444-5

- Moderne Lesart ISBN 978-1-257-95674-6

- Der Feminist ISBN 978-1-257-87377-7

- Unvergesslicher Senegal ISBN 978-1-257-97175-6

- Afrikaerfahrung Elfenbeinküste SBN 978-1-257-98790-0

- Der Beweis ISBN 978-1-257-98733-7

- Der Autoresponder ISBN 978-1-4717-0821-3

- Nadelöhr Panama ISBN 978-1-257-99773-2

- Immer wieder Schweden ISBN 978-1-105-02047-6

- Stete Kanaren ISBN 978-1-105-06365-7

- São Paulo ISBN 978-1-105-09363-0

- Das Golfspiel ISBN 978-1-105-02974-5

- Tango – Komplex ISBN 978-1-105-20512-5

- Formel 0-1-in-2 ISBN 978-1-300-05252-4

- Die Paläo-Diät ISBN 978-1-300-13178-6

- Elvis Aaron Presley ISBN 978-1-105-97628-5 - Der

Schriftsteller ISBN 978-1-300-20183-0

- Tinnitus… Und nun ISBN 978-1-300-21638-4


Das Gedächtnis ISBN 978-1-291-20373-8

- Tendenzen 3000 ISBN 978-1-300-67248-7

- Sexy Six-Pack ISBN 978-1-300-80704-9

- Top-Tipp – Fibromyalgie ISBN 978-1-291-36125-4

- Top-Tipp – Nie mehr Geldsorgen ISBN 978-1-300-72028-7


- Blue Light – ISBN 978-1-300-99839-6

- Top-Tipp – Der Kellner ISBN 978-1-304-09023-2

- Top-Tipp – Waiter & Waitress ISBN 978-1-304-10065-8

- Impfen? - Der-zweihundert-Jahre-Irrtum ISBN 978-129152573-1

- Silvio Gesell – Die Revolution des Geldsystems ISBN 9781291-52576-2

- Vitamin D3 – Tricks der Pharma-Mafia ISBN 978-132606349-8

- Ein Mann muss Brot backen können ISBN 978-1-29156517-


1

- Slàinte mhath - Schottland aus der Malt-Whisky-


Perspektive, ISBN 978-1-291-62424-3

- "Jet de Schnüss jeschwaadt“ ISBN 978-1-291-66476-8

- 3D Visualisierungen - Ernstes und Verspieltes in Cinema4D ISBN 978-1-291-95209-4


Heilen durch Essen - Ernährung für Multiple Sklerose Patienten ISBN 978-1-291-95085-4

- Pharma-Mafia - Ärzte und Patienten im Würgegriff der Arzneimittelindustrie ISBN


978-1-291-90310-2

- Venustropfen ISBN 978-1-291-22324-8

- Die Liebe kommt aus Panamá ISBN 978-1-326-27509-9

- Annegret 1. Teil ISBN 978-1-326-30273-3

- Anne 2. Teil ISBN 978-1-326-40158-0

- Donna Anna 3. Teil ISBN 978- - Flucht ISBN 978-1-326-

45700-6

- Von Mondstaub und von Feenhaar ISBN 978-1-326-58996-


7

- Vom Wolkenschloss und von Zaubererbsen ISBN 9781326-66370-4

- De Poeira de Luna e de Cabelo de fadas ISBN 978-1-


32671750-6
- Phalluskult ISBN 978-1-326-73147-2

- Mit Wildkräutern gegen den Krebs ISBN 978-1-326-731489

- DAS BÖSE - Lobaczewskis wissenschaftliche Betrachtung ISBN 978-1537610009

- Vom Traumfänger und von der Sonnentänzerin ISBN 978- 1-326-79361-6


- Dona Anna ISBN 979-8-498-22457-2

- Corona – Der Wahnsinn hat einen Namen ISBN 979-876067140-0

Das könnte Ihnen auch gefallen