Molecular Phylogenetics and Evolution 57 (2010) 1329–1333

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Short Communication

The complete mitochondrial genome of Radix balthica (Pulmonata,

Basommatophora), obtained by low coverage shot gun next generation
sequencing
B. Feldmeyer a,⇑, K. Hoffmeier b, M. Pfenninger a
a
Biodiversity and Climate Research Center (BiK-F), Siesmayerstr. 70A, 60323 Frankfurt am Main, Germany
b
GenXPro, Altenhöferallee 3, 60439 Frankfurt am Main, Germany

a r t i c l e i n f o a b s t r a c t

Article history: A 454-FLX low-coverage sequencing approach was used to assemble the mitochondrial genome of Radix
Received 24 June 2010 balthica. The mtDNA sequence is 13,993 nt long and contains 37 genes (13 protein coding genes, two
Revised 14 September 2010 rRNAs and 22 tRNAs). Four genes, the 12S RNA and seven tRNAs are transcribed in reverse order. The
Accepted 20 September 2010
sequence is AT rich (71.3%), similar to other basommatophoran species. Comparison with the most clo-
Available online 27 September 2010
sely related mt genomes available (Biomphalaria glabrata and Biomphalaria tenagophila) revealed identical
gene orders except for five tRNAs. Next generation sequencing proved to be a fast and easy method for
Keywords:
sequencing an entire mitochondrial genome.
Radix balthica
Mitochondrial genome
Ó 2010 Elsevier Inc. All rights reserved.
Low coverage genome shot gun sequencing
Next generation sequencing
454 FLX Titanium

1. Introduction region is involved in the initiation of transcription and replication,

Mitochondria are the ‘‘energy factories” of animal cells (Luo
et al., 2008). In most metazoans, the mitochondrial (mt) DNAs
are in the form of a covalently closed-circular molecule and auton-
omously replicated and transcribed (Nakao et al., 2002). Due to its
presumed lack of recombination, maternal inheritance, and a
relatively rapid mutation rate, mtDNA sequences are extensively
used for comparative and evolutionary genomics, molecular evolu-
tion, phylogenetics, population genetics, and species identification
(Hebert et al., 2002; Moritz and Brown, 1987).
In most metazoan animals, the mitochondrial genome consists of
the same 37 genes: 13 for protein subunits of oxidative phosphory-
lation enzymes, two rRNAs, and 22 tRNAs (Boore, 1999). Although
gene content and organization are quite conserved in most animal
phyla, gene re-arrangements seem to be quite common in the
lophotrochzoa in general and mollusks in particular (Boore et al.,
2004; Boore, 2006; Grande et al., 2008). The mt genome of many
mollusks has several unusual features: the gene arrangement differs
from other mtDNAs; several genes deviate significantly from their
homologs; unusual number of non-coding nucleotides (Boore,
1999). According to Wolstenholme (1992) the major non-coding
⇑ Corresponding author. Address: Forschungszentrum Biodiversität und Klima,
Siesmayerstr. 70A, 60323 Frankfurt am Main, Germany. Fax: +49 (0) 69 798 24910.
E-mail addresses: barbara.feldmeyer@senckenberg.de (B. Feldmeyer), hoff
meier@genxpro.de (K. Hoffmeier), Pfenninger@bio.uni-frankfurt.de (M. Pfenninger).
yet does not correspond to the control region of other metazoans
(Boore, 2006).
To date, the complete mitochondrial genomes of only eight
pulmonates are publicly available (http://www.ncbi.nlm.nih.gov),
of which three are basommatophorans (Biomphalaria glabrata,
Biomphalaria tenagophila, Siphonaria pectinata).
The common pond snail, Radix balthica, is distributed through-
out North-Western Europe and occupies permanent, slow-flowing
rivers, the shore zone of lowland lakes and ponds, and even irriga-
tion channels or fountains (Glöer and Meier-Brook, 1998; Økland,
1990). Within the genus Radix, species determination based on
morphological characters, such as shell shape has been shown to
be inaccurate, as environmental conditions seem to influence mor-
phological traits (Pfenninger et al., 2006). However, an integrative
DNA taxonomy approach using mitochondrial and nuclear marker
as well as breeding experiments delimited five good biological spe-
cies in North-Western Europe that can be reliably identified with
COI barcodes (Pfenninger et al., 2006).
Next generation sequencing, and in particular low coverage
genomic shot gun sequencing, has proven a valuable platform for
fast and easy acquisition of large numbers of sequences at rela-
tively low costs, useful for marker acquisition as well as the assem-
bly of mitochondrial genomes (Rasmussen and Noor, 2009;
Tangphatsornruang et al., 2009). For the latter, next generation
sequencing has been proven useful since many obstacles associ-
ated with methods based on primer walking can be neglected

1055-7903/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2010.09.012
1330 B. Feldmeyer et al. / Molecular Phylogenetics and Evolution 57 (2010) 1329–1333
(Jex et al., 2010). Here in this study we make use of a low coverage
shot gun sequencing approach on a 454-FLX next generation
sequencer, to obtain not only a wealth of possible marker sites
but additionally enough mitochondrial sequences for the assembly
of the mt genome. The hence obtained mt genome of R. balthica is
used to compare the gene content and gene order with three other
available basommatophoran snail species to infer further insights
into the high variability of molluskan mitochondrial genomes. Fur-
thermore it will be useful for future intraspecific functional analy-
sis of respiratory chain genes to investigate potential adaptations
of the snails to different environmental conditions.
2. Material and methods
2.1. Preparation of DNA and sequencing
DNA from 13 individual snails originating from five populations
in Switzerland, France, and Sweden were isolated using the Qiagen
DNeasy kit. Only small fragments of the foot were utilized for DNA
extraction in order to exclude parasite contamination. Six micro-
Fig. 1. Schematic representation of the mitochondrial genome of Radix balthica.
gram of pooled DNA were used for library preparation following
the Roche GS FLX Titanium General Library Preparation and
Sequencing protocol to run half a titanium plate on a 454 sequencer.
2.2. Mt genome assembly
The Roche provided program Newbler (v 2.0.1) was used for
assembly of the reads to contigs, with standard settings. Reads
and contigs were subjected a BlastX search against the SwissProt
database applying a cutoff value of <e 10 and of <e 6, respectively.
The resulting gene information was used to filter out mitochondria
associated reads and contigs. These were subjected a BlastX and
BlastN against the 13 mitochondrial proteins as well as the 12S
and 16S rRNA genes of the closely related snail species B. glabrata
strain 1742 (GenBank Accession No.: AY380531), using the Blastall
program (v 2.2.4).
Contigs were visually inspected using the program EagleView
(v 2.2; Huang and Marth, 2008). Further alignments and assem-
blies were produced using the software Geneious (v 4.8.5; Drum-
mond et al., 2009), which was also used to annotate the genome
and create Fig. 1. As DNA from individuals of different populations
 B. Feldmeyer et al. / Molecular Phylogenetics and Evolution 57 (2010) 1329–1333 1331

Table 1 5 Sequencing Buffer, 0.35 ll BDT (Applied Biosystems), 0.5 ll

Primers designed to close the remaining gaps in the mt genome of R. balthica after (10 lM) Primer and 1 ll (20 ng) PCR-product. The sequencing
assembly of the shotgun reads and contigs (RbGap1 = within ND2; RbGap2 = between
COI and the contig; RbGap3 = between the contig and 16S rRNA).
reaction was carried with denaturation (96 °C for 10 min), anneal-
ing (50 °C for 10 min) and extension (60 °C for 2 min) for 25 cycles.
Primer Forward Reverse Sequencing was performed on an ABI3730xl.
Name
RbGap1 GGCGCCCTTTGCACTATTA GCTCAAATATATCCAAAAATTAAAGCA
RbGap2 CCACCTGATTTTCACAGAAAC AGATCTTTCTAATTCGGGAAATG
2.4. tRNA identification
RbGap3 GGGGCGACACTGAAACATA AAACGCATAAAATCTGCCAAA

The program tRNAscan (Lowe and Eddy, 1997; http://low-

was pooled before sequencing the mt genome presented here is the
consensus sequence of 13 R. balthica individuals from five different
populations.
2.3. Primer design and sequencing the gaps
To close the remaining gaps after assembly, primers flanking
the gap regions were designed using the online tool Primer3
(Rozen and Skaletsky, 1998; http://biotools.umassmed.edu/bio
apps/primer3_www.cgi). Primer sequences can be found in Table 1.
PCR was carried out in 10 ll (total volume) reaction mixture
containing 1 ll template DNA, 1 ll (2 lM) dNTPs, 0.2 ll (10 lM)
per primer, 1 U Hot Start Taq polymerase (Molegene) and 1 ll
10 reaction buffer. Reactions were performed with a starting
denaturation phase at 95 °C for 15 min, followed by 30 cycles of
denaturation (95 °C for 30 s), annealing (56 °C for 60 s), extension
(72 °C for 90 s) and a final extension phase at 72 °C for 10 min in
Eppendorf MasterCyclers. The sequencing reaction was carried
out in 10 ll (total volume) reaction mixture containing 1.83 ll
elab.ucsc.edu/tRNAscan-SE/) was used to identify tRNAs within
the intergenic regions of the mt genome. Additionally tRNA se-
quences were identified by manually aligning tRNA sequences of
B. glabrata strain 1742 and B. tenagophila (GenBank Accession
No.: EF433576) against the mt genome of R. balthica. The predicted
positions were verified by identification of one of the according
anitcodons towards the centre of the predicted tRNA sequence.
3. Results and discussion
3.1. Shotgun sequencing
Sequencing half a picotiter plate on a 454-FLX sequencer re-
sulted in 286,643 high quality reads with an average read length
of 318 bases (sequences are available at NCBI Short Read Archive
Accession No.: SRA023763). Alignment of the reads resulted in
19,209 contigs, containing 129,022 (45%) reads, leaving 119,157
(41%) singletons. The average contig length was 683 nt, ranging
between 85 and 6284 nt.

Table 2
Summary of the mitochondrial genome content of R. balthica.

Name Min Max Length Direction Anti-codon Start codon Stop codon
tRNA-Val 9 84 76 F TAC
16S rRNA 98 1066 969 F
tRNA-Leu 1090 1170 81 F TAG
tRNA-Pro 1162 1216 50 F TGG
tRNA-Ala 1214 1277 64 F TGC
ND6 1278 1707 430 F ATA TAA
ND5 1722 3219 1498 F ATT TAA
tRNA-His 3376 3452 77 F ATG
ND1 3411 4322 912 F ATG TAA
ND4L 4288 4644 357 F ATT TAG
CYTB 4605 5585 981 F ATA TAG
tRNA-Asp 5649 5729 81 F GTC
tRNA-Phe 5710 5778 69 F GAA
COII 5786 6462 677 F ATT TAA
tRNA-Gly 6490 6555 66 F TCC
tRNA-Trp 6556 6628 73 F CCA
tRNA-Cys 6685 6749 65 F GCA
tRNA-Gln 6757 6849 93 F Unknown
tRNA-Leu 6848 6912 65 R CAG
ATP8 6927 7086 160 R ATA TAA
tRNA-Asn 7059 7124 66 R GTT
ATP6 7150 7787 638 R ATT TAA
tRNA-Arg 7805 7873 69 R TCG
tRNA-Glu 7879 7930 52 R TTC
12S rRNA 7934 8646 713 R
tRNA-Met 8646 8712 67 R CAT
ND3 8708 8957 250 R ATT TAA
tRNA-Ser 9074 9148 75 R GGA
tRNA-Ser 9145 9202 58 F TGA
ND4 9204 10531 1328 F ATT TAA
tRNA-Tyr 10405 10461 57 R GTA
tRNA-Thr 10544 10612 69 R TGT
COIII 10624 11411 788 R ATT TAA
tRNA-Ile 11446 11495 50 F GAT
ND2 11526 12399 874 F ATT TAG
tRNA-Lys 12413 12482 70 F TTT
COI 12482 21 1533 F ATT TAA
1332 B. Feldmeyer et al. / Molecular Phylogenetics and Evolution 57 (2010) 1329–1333

3.2. Data analyses of the products. The gaps revealed to be between 1 and 131 bp in
size (within the ND2 gene = 131 bp; between COI and the
A BlastX search of all sequences against the SwissProt database contig = 50 bp; between the contig and 16S rRNA = 1 bp). Thus
yielded 6475 putative similarities which after removing redundant the total resulting mt genome sequence of R. balthica spans
matches resulted in 1874 identified uni-genes. A BlastX search of 13,993 bp in length with an AT content of 71.3% (NCBI Accession
all contigs against the SwissProt database yielded 466 putative No.: HQ330989).
similarities which after removing redundant matches resulted in
299 identified uni-genes. A comparison between the two Blast
3.4. Identification of tRNAs
searches revealed 274 genes that were identified in both, thus
resulting in an overall number of 1899 putative uni-genes. Overall
Seven tRNAs were identified using the program tRNAscan,
114 sequences and 29 contigs could be identified as belonging to
namely Ala, Arg, Asn, Cys, Leu, Phe, Thr. All 20 tRNAs could be iden-
12 mitochondrial protein coding genes, all but ND4L. The BlastX
tified manually by aligning tRNA sequences of B. glabrata strain
search against the B. glabrata mitochondrial genes also resulted
1742 and B. tenagophila against the complete mt genome sequence
in the identification of 12 mitochondrial protein coding genes, here
of R. balthica (Table 2; Fig. 1). The predicted locations were addi-
ATP8 could not be detected. Thus the combination of both searches
tionally validated by confirming the presence of the according
led to the identification of all 13 protein coding mitochondrial
anti-codon (Table 2). We were not able to construct the secondary
genes. The 12S and 16S rRNA genes were identified by an addi-
structure of all tRNAs, however as previously shown tRNA se-
tional BlastN of the R. balthica contigs against the according two
quences of pulmonate snails show aberrant structures and undergo
genes of B. glabrata strain 1742.
post-transcriptional processing to restore base paring of their ami-
noacyl acceptor stem (Boore, 1999; Yokobori and Pääbo, 1995).
3.3. Mt genome assembly

The first alignment of the Blast identified mitochondrial gene
sequences resulted in two large independent mt genome frag-
ments with 11,060 and 1937 bp in length; one starting within
the 16S rRNA to the middle of the ND2 gene; the other starting
within the ND2 gene, ending at the end of the COI gene, respec-
tively. A Blast of the R. balthica contigs against the B. glabrata strain
1742 identified one contig that was predicted to be situated in the
gap between the COI gene and the 16S rRNA.
The closure of the three remaining gaps was achieved by self
designed primers flanking the gap regions and sanger sequencing
3.5. Comparison of gene and tRNA order between mt genomes
Unsurprisingly the composition of the mt genome of the two
sister species B. glabrata and B. tenagophila is identical, for protein
coding genes as well as for RNAs (Fig. 2). In comparison with
R. balthica, the gene order of protein coding genes is similar, how-
ever the position of five tRNAs changed. tRNAs His, Cys as well as
Tyr are found at different locations in the R. balthica mt genome
compared to the two Biomphalaria mt genomes, while Ala and
Pro as well as Gly and Trp switched position.

Fig. 2. Linear representation of the gene order and t/rRNA locations in four basommatophoran snail species. Mt genomes are scaled to 100% (Genes = grey scale; rRNA = black;
tRNA = white. tRNAs are encoded in single letter code according to the amino acid they represent: A, Ala; G, Gly; P, Pro; T, Thr; V, Val; S, Ser; R, Arg; L, Leu; F, Phe; N, Asn; K,
Lys; D, Asp; E, Glu; H, His; Q, Gln; I, Ile; M, Met; Y, Tyr; C, Cys; W, Trp).
 B. Feldmeyer et al. / Molecular Phylogenetics and Evolution 57 (2010) 1329–1333
In comparison of the mt genome of latter three species with
S. pectinata (GenBank Accession No.: AF120638), the only other
basommatophoran species with a complete mt genome, one can
see that the gene NAD4L is located between COII and ATP8 while
in the other three species it is located between NAD1 and CYTB.
The two large tRNA blocks are separated by NAD4L in the case of
S. pectinata, while they are separated by COII in the case of the two
Biomphalaria species. Additionally tRNAs Tyr and Trp are situated
on the first instead of the second tRNA block in S. pectinata. Fur-
thermore the positions of Cys and His changed between the two
blocks.
In R. balthica the tRNAs His, Tyr and Trp are situated at different
locations in comparison with S. pectinata, also Pro and Ala switched
position.
The orientation of the genes and RNAs has not been assessed
for B. tenagophila, thus the following comparison is based exclu-
sively on the other three species. In all three species the orienta-
tion of the 13 protein coding genes is identical, with all genes
situated on the plus strand except four, namely ATP8, ATP6,
NAD3 and COIII. The direction of the rRNAs is also identical with
16S rRNA being coded on the plus strand and 12S rRNA on the
minus strand.
In R. balthica tRNAs Thr, Arg, Asn, Glu, Met, Tyr, one of the Ser and
one of the Leu copies are coded minus strand. Only three of the
tRNAs differ in their orientation between the other two species.
tRNA Tyr is coded on the minus strand in R. balthica, while in both
other species on the plus. tRNA Met is coded on the minus strand in
R. balthica and S. pectinata, not so in B. glabrata. And tRNA Gln is
coded on the minus strand in S. pectianta, while on the plus strand
in R. balthica and B. glabrata.
Nine protein coding genes of the R. balthica mt genome share
the start codon ATT (Table 2). Three others, namely ND6, CYTB,
and ATP8 start with ATA, and ND1 starts with ATG.
In B. glabrata stop codons were predicted by the use ESTs, which
allows also for the prediction of abbreviated stop codons (T–)
(DeJong et al., 2004). Since we lack the information of suitable ESTs,
stop codons for protein coding genes in R. balthica were determined
by the presence of a putative stop codon sequence towards the end
of the predicted gene. Following this method protein coding genes
ND4L, CYTB and ND2 are predicted to be terminated by the stop
codon TAG, while all other genes appear to end with TAA.
The mt genome of R. balthica contains 17 intergenic regions
ranging in size from five to 156 nt, with seven larger than 30 nt.
In comparison, the B. glabrata mt genome has a high coding density
with only 62 nt not assigned to a coding region, which is also the
smallest known mt genome from mollusks to date (13,670 nt)
(DeJong et al., 2004).
In conclusion, we were able to assemble large parts of the mito-
chondrial genome by shot gun sequencing genomic DNA of
R. balthica on a half plate of a 454-FLX sequencer. And we could
show that, in line with previous findings, gene re-arrangements
1333
within gastropods are a common feature, even at low taxonomic
level (Boore, 1999; Valles and Boore, 2006).
Acknowledgments
We thank Moritz Salinger and Timm Haun for providing the
snail material. The study was support by the research funding pro-
gramme ‘‘LOEWE – Landes-Offensive zur Entwicklung Wissens-
chaftlich-ökonomischer Exzellenz” of Hessen’s Ministry of Higher
Education, Research, and the Arts.
References
Boore, J., 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780.
Boore, J., Medina, M., Rosenberg, L., 2004. Complete sequences of the highly
rearranged molluscan mitochondrial genomes of the Scaphopod Graptacme
eborea and the bivalve Mytilus edulis. Mol. Biol. Evol. 21, 1492–1503.
Boore, J.L., 2006. The use of genome-level characters for phylogenetic
reconstruction. Trends Ecol. Evol. 21, 439–446.
DeJong, R.J., Emery, A.M., Adema, C.M., 2004. The mitochondrial genome of
Biomphalaria glabrata (Gastropoda: Basommatophora), intermediate host of
Schistosoma mansoni. J. Parasitol. 90, 991–997.
Drummond, A., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., Stones-Havas,
S., Thierer, T., Wilson, A., 2009. Geneious v4.7. Available from: <http://
geneious.com>.
Glöer, P., Meier-Brook, C., 1998. Süßwassermollusken. Deutscher Jugendband für
Naturbeobachtung, Hamburg.
Grande, C., Templado, J., Zardoya, R., 2008. Evolution of gastropod mitochondrial
genome arrangements. BMC Evol. Biol. 8, 61.
Hebert, P., Cywinska, A., Ball, S., deWaard, J., 2002. Biological identification through
DNA-barcodes. Proc. R. Soc. Lond. Ser. B 270, 313–321.
Huang, W., Marth, G., 2008. EagleView: a genome assembly viewer for next-
generation sequencing technologies. Genome Res. 18, 1538–1543.
Jex, A.R., Hall, R.S., Littlewood, D.T.J., Gasser, R.B., 2010. An integrated pipeline for
next-generation sequencing and annotation of mitochondrial genomes. Nucl.
Acids Res. 38, 522–533.
Luo, Y., Gao, W., Gao, Y., Tang, S., Huang, Q., Tan, X., Chen, J., Huang, T., 2008.
Mitochondrial genome analysis of Ochotona curzoniae and implication of
cytochrome c oxidase in hypoxic adaptation. Mitochondrion 8, 352–357.
Moritz, C., Brown, W., 1987. Tandem duplications in animal mitochondrial DNAs:
variation in incidence and gene content among lizards. Proc. Natl. Acad. Sci. USA
84, 7183–7187.
Nakao, M., Yokoyama, N., Sako, Y., Fukunaga, M., Ito, A., 2002. The complete
mitochondrial DNA sequence of the cestode Echinococcus multilocularis
(Cyclophyllidea: Taeniidae). Mitochondrion 1, 497–509.
Økland, J., 1990. Lakes and Snails: Environment and Gastropoda in 1500 Norwegian
Lakes, Ponds and Rivers. Oegstegeest, The Netherlands: U.B.S./Dr. W. Backhuys.
Pfenninger, M., Cordellier, M., Streit, B., 2006. Comparing the efficacy of
morphologic and DNA-based taxonomy in the freshwater gastropod genus
Radix (Basommatophora, Pulmonata). BMC Evol. Biol. 6, 100.
Rasmussen, D., Noor, M., 2009. What can you do with 0.1 genome coverage? A
case study based on a genome survey of the scuttle fly Megaselia scalaris
(Phoridae). BMC Genomics 10, 382.
Tangphatsornruang, S., Somta, P., Uthaipaisanwong, P., Chanprasert, J., Sangsrakru,
D., Seehalak, W., Sommanas, W., Tragoonrung, S., Srinives, P., 2009. Characteri-
zation of microsatellites and gene contents from genome shotgun sequences of
mungbean (Vigna radiata (L.) Wilczek). BMC Plant Biol. 9, 137.
Valles, Y., Boore, J.L., 2006. Lophotrochozoan mitochondrial genomes. Integ. Comp.
Biol. 46, 544–557.
Wolstenholme, D., 1992. Animal mitochondrial genome: structure and evolution.
Int. Rev. Cytol. 141, 172–216.
Yokobori, S., Pääbo, S., 1995. Transfer RNA editing in land snail mitochondria. Proc.
Nat. Acad. Sci. USA 92, 10432–10435.