Mar Biotechnol
DOI 10.1007/s10126-008-9117-6
ORIGINAL ARTICLE
Analysis of Genes Isolated from Plated Hemocytes
of the Pacific Oyster, Crassostreas gigas
Steven Roberts & Giles Goetz & Samuel White &
Frederick Goetz
Received: 25 April 2008 / Accepted: 21 May 2008
# Springer Science + Business Media, LLC 2008
Abstract A complementary deoxyribonucleic acid library
was constructed from hemocytes of Crassostrea gigas that
had been plated on poly-lysine plates for 24 h. From this
library, 2,198 expressed sequence tags (ESTs) of greater
than or equal to 100 bp were generated and analyzed. A
large number of genes that potentially could be involved in
the physiology of the oyster hemocyte were uncovered.
They included proteins involved in cytoskeleton rearrange-
ment, proteases and antiproteases, regulators of transcrip-
tion and translation, cell death regulators, receptors and
their associated protein factors, lectins, signal transduction
proteins, and enzymes involved in eicosanoid and steroid
synthesis and xenobiotic metabolism. Based on their
relationship with innate immunity, the expression of
selected genes was analyzed by quantitative polymerase
chain reaction in gills from bacterial-challenged oysters.
Several genes observed in the library were significantly
upregulated by bacterial challenge including interleukin 17,
astacin, cystatin B, the EP4 receptor for prostaglandin E,
the ectodysplasin receptor, c-jun, and the p100 subunit of
nuclear factor-kB. Using a similar approach, we have been
Electronic supplementary material The online version of this article
(doi:10.1007/s10126-008-9117-6) contains supplementary material,
which is available to authorized users.
S. Roberts : S. White
School of Aquatic and Fishery Sciences,
University of Washington—Seattle,
1122 NE Boat Street,
Seattle, WA 98105, USA
G. Goetz : F. Goetz (*)
Great Lakes WATER Institute,
University of Wisconsin—Milwaukee,
600 E. Greenfield Ave.,
Milwaukee, WI 53204, USA
e-mail: rick@uwm.edu
analyzing the genes expressed in trout macrophages. While
there are significant differences between the types of genes
present in vertebrate macrophages compared with oyster
hemocytes, there are some striking similarities including
proteins involved in cytoskeletal rearrangement, proteases
and antiproteases, and genes involved in certain signal
transduction pathways underlying immune processes such
as phagocytosis. Finally, C. virginica homologs of some of
the C. gigas genes uncovered in the ESTs were obtained by
aligning the ESTs reported here, against the assembled C.
virginica ESTs at the National Center for Biotechnology
Information.
Keywords Hemocytes . ESTs . Pacific oyster . C. gigas .
Innate immunity . Bacterial challenge
Introduction
In oysters, hemocytes are responsible for cell-mediated
defense. Bivalve hemocytes are composed of several
subclasses of cells that can be discriminated on the basis
of microscopy, flow cytometry, and even functionality
(Cheng 1996). The two major classes of oyster hemocytes
that are generally recognized include granulocytes (con-
taining cytoplasmic granules) and hyalinocytes (lacking
granules).
In oysters, hemocytes are involved in nutrient digestion
and transport, wound and shell repair, and internal defense
against pathogens. A major defense exhibited by hemocytes
involves the direct phagocytosis of antigens. During
phagocytosis, the hemocyte may recognize or bind to an
antigen by the presence of specific lectins either in the
hemolymph or in the membrane of the hemocyte (Cheng
1996; Ford and Tripp 1996). Upon contact with antigens,

hemocytes may also produce reactive oxygen species
(ROS) that are believed to be important cytotoxic, anti-
microbial factors (Adema et al. 1991). It is assumed that
oyster hemocytes possess the biochemical components
necessary for ROS production, and this is based on the
detection of luminol or lucigenin-derived chemilumines-
cence when hemocytes are stimulated with agents such as
zymosan or Perkinsus (Anderson 1999). While a number of
studies have concentrated on the ability of oyster hemo-
cytes to aggregate, encapsulate, and phagocytose antigens,
very few investigations have looked at the biochemical
products actually produced by hemocytes. It has been
demonstrated that oyster hemocytes produce lysozyme
(Yoshino and Cheng 1976), and several other enzymes
have been shown to be associated with oyster hemocytes
including lipase, β-glucuronidase, acid phosphatase, and
aminopeptidase (Cheng and Rodrick 1975).
Recombinant deoxyribonucleic acid (DNA) approaches
have been used to look at the gene products produced by
various oyster tissues including hemocytes. A review of
recent advancements in the field of bivalve genomics
overall is provided by Saavedra and Bachere (2006).
Specifically related to oysters, expressed sequence tag
(EST) libraries have been made for eastern oyster (Cras-
sostrea virginica) hemocytes (Jenny et al. 2002), for
hemocytes obtained from Pacific oysters (Crassostrea
gigas) challenged with bacteria (Gueguen et al. 2003),
and for C. virginica and C. gigas challenged with Perkinsus
marinus (Tanguy et al. 2004). A mixed tissue (including
hemocytes) library and ESTs have also been produced for
C. gigas (Tanguy et al. 2008). In the study on hemocytes
from bacterial-challenged Pacific oysters, a highly
expressed gene was a tissue inhibitor of metalloproteinase
(TIMP) that has been shown to be very responsive to
pathogen stimulation and wounding (Montagnani et al.
2001; Montagnani et al. 2001). Using a targeted gene
approach, oysters have also been shown to produce
defensin (Gueguen et al. 2003), transforming growth factor
β (TGFβ; Lelong et al. 2007), and chitinase-like proteins
(Badariotti et al. 2007). Some of these genes have been
reported to participate in the immune response of the oyster
to pathogen challenge. While there have been additional
targeted gene isolations originating from the oyster hemo-
cyte ESTs (Gonzalez et al. 2005; Gueguen et al. 2003), few
immune-related genes have been reported in oysters from
these or other libraries (Saavedra and Bachere 2006).
It appears that in past studies using oyster hemocytes for
gene discovery, cells have been isolated from hemolymph
by centrifugation and then used immediately for ribonucleic
acid (RNA) isolation. Over the past several years, we have
developed primary cell culture techniques to obtain trout
macrophages from head kidneys (Mackenzie et al. 2003).
These primary cell cultures have been used for EST
Mar Biotechnol
isolation (Goetz et al. 2004a) and also to investigate
pathogen recognition in fish (Iliev et al. 2005, 2006). The
technique involves plating cells isolated from the head
kidney on poly-lysine plates for incubation. Thus, only
adherent cells are used for experimentation. In the present
study, we used a similar protocol for Pacific oyster
hemocytes to obtain adherent cells for the construction of
a C. gigas hemocyte library. Based on the genes obtained
so far, this library appears to have high gene complexity
and a large number of genes that have the potential to be
involved in immunity. For example, two clones of an
interleukin 17 homolog were isolated from this library, and
the C. gigas IL17 was subsequently shown to be highly
regulated in hemocytes by bacterial stimulation (Roberts et
al. 2008). However, in analyzing the ESTs obtained in this
study, we also realized that there are, in fact, a number of
potential genes in the existing oyster ESTs that have not
been characterized or reported and that also appeared in the
current hemocyte library. By assembling all of the ESTs
currently available for C. virginica and using the contigs
obtained as a searchable database, we were also able to
obtain complementary DNAs (cDNAs) for the eastern
oyster homologs of some of the C. gigas ESTs described
here. These could be valuable for comparative studies of
pathogen infection between the two species.
Materials and Methods
Animals and Hemocyte Plating
Pacific oysters (6–8 in.) were purchased from Taylor
Shellfish Farms (Seattle, WA, USA) and held at 10°C in
seawater until use. Shells were opened, and the hemolymph
(8–10 ml) was obtained directly from the heart using a
syringe. The hemolymph was placed in a plastic tube on ice
and an additional volume of cold, sterile-filtered (22 μm)
seawater containing 100 U/ml penicillin, and 100 μg/ml
streptomycin was added (2 ml seawater/5 ml hemolymph).
After gentle mixing, 6–7 ml of the hemolymph/seawater
solution was spread onto 60-mm culture plates coated
with poly-lysine (Becton Dickinson). Hemolymph was
obtained from nine oysters, and each oyster provided
enough hemolymph for two plates. All plates were
incubated at 12°C for 24 h.
RNA Extraction and Library Construction
After 24 h, the plated hemolymph/saltwater solution was
decanted and replaced with 1 ml of Tri Reagent (Molecular
Research Center) per plate. Total RNA was extracted from the
Tri Reagent according to the manufacturer’s protocol
(Chomcynski 1993; Chomcynski and Sacchi 1987), and
Mar Biotechnol
polyA+ RNA was isolated using the Poly-Atract messenger
RNA (mRNA) isolation system (Promega). The mRNA
obtained from the hemocytes was used to construct a
cDNA library in Zap Express (Stratagene). cDNA pro-
duced for library construction was size-fractionated using
sephacryl SF500, and the two largest cDNA size classes
were ligated together with the Zap Express vector. After
packaging and titering, the library was mass-excised to
pBK-CMV phagemids and plated at low density. Individual
colonies were randomly picked, and plasmid preparations
were made using the RevPrep Orbit (GeneMachines).
Plasmid preparations were sequenced from the 5′ end
using the dideoxy chain termination method with “Big
Dye Terminator” (Applied Biosystems) and the BK
reverse vector primer. The reactions were precipitated
and resuspended in “Hi-Di Formamide with EDTA”
(Applied Biosystems) and run on an ABI Prism 3730
automated sequencer (Applied Biosystems).
Sequence Data Analysis
Sequence chromatogram files were trimmed for quality
using phred (http://www.phrap.org/phrap.docs/phred.html),
vector-screened using cross match (http://www.phrap.org/
phrap.docs/phrap.html), and analyzed locally using (1)
Blastx against the National Center for Biotechnology
Information (NCBI) nonredundant protein database, (2)
Blastn against the NCBI nucleotide database, and (3) Blastn
against the existing C. gigas ESTs at NCBI. Sequences
were analyzed for redundancy using CAP3 (Huang and
Madan 1999) and were also annotated locally using the
Gene Ontology Database (version GO.200801). Simple
sequence repeats were identified using the simple sequence
identification tool (http://www.gramene.org/db/searches/
ssrtool; Temnykh et al. 2001).
All ESTs for C. virginica were downloaded from NCBI
to our local cluster and were assembled using CAP3. The
ESTs described in the current paper (Table 4) were aligned
(Blastn) against the contigs generated from these assem-
bled ESTs to obtain possible homologs for C. virginica.
Since NCBI does not allow the third-party submission of
sequences that do not have direct “wet bench” data to
support their annotation, it was not possible to submit
these assembled C. viriginica sequences to NCBI for
accession numbers. Instead, we provide these assembled
sequences, their translated amino acid products, and the
ESTs that went into creating them in an Online Appendix
to the paper.
Animals, Tissue Collection, and Bacterial Challenges
Pacific oysters (C. gigas) were obtained from Taylor
Shellfish Farms and kept in the University of Washington
holding facilities in 15°C seawater, until experimentation.
In preparation for bacterial challenges, 20 oysters (ten
control, ten challenge) were transferred to smaller tanks,
both containing 3 l of 15°C seawater with air stones for
circulation. The oysters were allowed to acclimate to ~20°C
for 24 h prior to exposure. Challenges were conducted with
two species of live bacteria: Vibrio vulnificus and Vibrio
parahaemolyticus. Starter cultures of each species were
grown separately in 100 ml Luria Bertani broth (LB)
overnight at 37°C with shaking at 230 rpm. The following
day, the starter cultures were combined and used to
inoculate 1 l of LB. This large culture was grown at 37°C
with shaking at 230 rpm until the optical density at 550 nm
(OD550)=0.410. One OD550 unit is equivalent to 5×108
bacteria per milliliter (Gueguen et al. 2003), thus resulting
in ~2.05×1011 bacteria. The culture was centrifuged at
4,000 rpm for 30 min at 4°C to pellet the bacteria. The
supernatant was removed, and bacteria were resuspended in
100 ml of ~20°C seawater. This suspension was added to
one tank containing ten oysters. The other tank of ten
oysters received 100 ml of ~20°C seawater. After 24 h of
exposure, the oysters were removed from their tanks, and
gill tissue was collected from all oysters and immediately
frozen on dry ice. The samples were stored at −80°C until
RNA extraction.
Quantitative PCR Analysis
Frozen gill tissue (50 mg) was homogenized in Tri Reagent
(1 ml), and total RNA was extracted according to the
manufacturer’s protocol (Chomcynski 1993; Chomcynski
and Sacchi 1987). Total RNA was treated with TURBO
DNA-free (Ambion) according to the manufacturer’s
protocol to remove any possible genomic DNA carryover.
The treated RNA samples were quantified and all samples
diluted to 0.122 μg/μl. Removal of genomic DNA from
the treated RNAs was verified via real-time polymerase
chain reaction (PCR) using primers known to amplify
genomic DNA (data not shown). First-strand cDNA
synthesis was performed with avian myeloblastosis virus
reverse transcriptase (Promega) according to the manu-
facturer’s protocol, utilizing oligo dT primers. The reverse
transcription reactions each contained 0.61 μg of total
RNA.
All real-time PCR reactions were created as master
mixes, and individual reactions contained the following:
0.5 μL cDNA, 0.04 μM forward/reverse primers (Table 1),
2 μM SYTO-13 (Invitrogen), and 1× Immomix Master Mix
(Bioline). Cycling and fluorescence measurements were
carried out in an Opticon 2 System (Bio-Rad) with the
following cycling parameters: one cycle of 95°C for
10 min, 40 cycles of 95°C for 30 s, 55°C for 1 min, and
72°C for 30 s. Fluorescence readings were taken at the end
 Mar Biotechnol

Table 1 Primer sequences used for expression analysis of selected ESTs (Table 4) in gill tissue of bacterial challenged Pacific oysters

Gene Accession number Primer names Primer sequences

NF-kappa-B p100 subunit EW779317 NFkB p100 5′ ATCTGTGCCAGTTCCAATCC

NFkB p100 3′ TTCTTTTGCTCCATGGCTCT
Focal adhesion kinase EW777781 FAK 5′ ATCACCAAGGCAACCTGAAC
FAK 3′ AATGGTGCTGGGAGTGTAGG
c-type lectin EW778826 C-type lectin 5′ TTCAGCGCAAAAATGAATTG
C-type lectin 3′ AGCGCGTTTTCTGAAATTGT
c-jun protein EW778895 C-jun 5′ CAAGGCAGTGTGAAGATGGA
C-jun 3′ CCAACACATGGGACTGTTTG
Astacin-like protein EW779002 Astacin-like 5′ ACGCCCTAGTTGGATGAATG
Astacin-like 3′ ACTTGGTCTGGGGTTGTTTG
Tissue inhibitor of metalloprotease EW777598 TIMP 5′ AACATCCGGTTTTGTTTCCA
TIMP 3′ GTCAGTGACGGCGAGTTCTT
Preprocathepsin C EW778914 Preprocathep 5′ GCTGGAGGTTGCGAACTAAC
Preprocathep 3′ AAGGTCCGTTCTTCACCAAA
Serine-protease inhibitor EW778389 SPI 5′ ATGGCCGATTGTTATGGTGT
SPI 3′ ACTGCAATTAGCCTGGCACT
Cystatin B EW778247 Cystatin B 5′ GAGATTCCCCCTCACTCCTC
Cystatin B 3′ TGCTGAAAGCCTCCAAATCT
Prostaglandin E2 receptor, EP4 subtype EW777722 PGER EP4 5′ ACCGAGAGTGCTGAGTGGTT
PGER EP4 3′ GGCAAACTGTAAGCCAGGAG
Ectodysplasin A2 receptor EW778669 Ecdysplasin E2 5′ TGTTGATGTGGACCCAGTGT
Ecdysplasin E2 3′ CCGATTCCTGACCATTCTGT
CD45-like EW777914 CD45-like 5′ ACAACAAGCCAAGGAACAGG
CD45-like 3′ TGATGTCTCCATGCGTCACT
Integrin beta-PS precursor EW778853 Integrin 5′ GACGATTTGCTCCAACCATT
Integrin 3′ ACACTGGCACAAACCCTTTC
Tumor necrosis factor receptor-associated factor 3 EW779535 TNFRAF3 5′ CAAGCAACGAAAACAAAGCA
TNFRAF3 3′ AGGCTGGTGTTCAACCATTC
High-mobility group protein EW778188 HMGP 5′ CAAGAAAGCCAAACCTCAGC
HMGP 3′ CTGGGAACCAATGCACTTTT
High-mobility group protein 1 EW778687 HMGP1 5′ TCATCAAAATGGCTGGTGAA
HMGP1 3′ ATGGACTGGCTTTGTTTTGG

of each cycle. Immediately after cycling, a melting curve
protocol was run. Temperature was increased from 55°C to
95°C at a rate of 0.2°C/s with fluorescence readings every
0.5°C increase, followed by an incubation of 21°C for
10 min. Negative controls containing water instead of
cDNA template were run for each primer set.
Raw data were processed with Real-time PCR Miner
(Zhao and Fernald 2005). Quantification was performed by
calculating the relative mRNA concentration (R0) for each
gene for each individual. Briefly, this was calculated using
the following equation: R0 ¼ 1=ð1 þ EÞCt , where E is the
average gene efficiency and Ct is the cycle number at
threshold. The R0 for each gene was normalized to a con-
trol (elongation factor 1) R0 from each individual. Using
the normalized R0, fold increase over the minimum R0
value for each gene was calculated for all individuals (n=
20). All data were analyzed using one-way analysis of
variance with the SPSS 13 software (SPSS). Data with a
significance value less than or equal to 0.05 was considered
to be statistically different.
Results and Discussion
General
Table 2 summarizes the characteristics of the C. gigas
hemocyte cDNA library and the pertinent aspects of the
ESTs that were derived from it. A total of 2,646 clones
were sequenced, and from these, 2,198 ESTs greater than or
equal to 100 bp were analyzed and submitted to NCBI
(EW777381–EW779578). Following assembly with CAP3,
there were 275 contigs of greater than or equal to two
sequences and 987 singletons resulting in a redundancy of
55%. When aligned to the existing C. gigas ESTs at NCBI,
there were 554 sequences (one of four of the total) that had
a blastn E score of greater than or equal to 10−3. Based on
this score, we consider these sequences new ESTs for C.
gigas, and this is a very conservative estimate given our
cutoff. There have been several other bivalve hemocyte
libraries reported in the literature on various species
including the oyster (Gueguen et al. 2003; Jenny et al.
Mar Biotechnol

Table 2 Characteristics of C. gigas hemocyte library and ESTs gene discovery and redundancy between studies may not
Characteristic Value always be appropriate since some ESTs were generated
directly from sequencing cDNA libraries (Kang et al. 2006)
Average library insert size 1,058 bp while others sequenced suppression subtractive hybridiza-
Total number of ESTs sequenced 2,646 tion libraries (Gestal et al. 2007; Pallavicini et al. 2008) that
Total number of ESTs ≥100 bp 2,198
certainly will have different rates of redundancy and
Phred quality score 13 (95%)
sequence size that would affect assembly. Further, some
Average sequence length (all ESTs) 708 bp
Number of cDNA contigs 275 libraries are normalized, and this obviously reduces the
Number of cDNA singletons 987 redundancy as shown in the libraries reported by Quilang et
Percent redundancy 55 al. (2007; 15.4%) and by Tanguy et al. (2008; average 7%)
Number of sequences with no Blastx hit (≥10−3) 876 for various bivalve species and tissues. The redundancy rate
Number of sequences with no significant blastn 554 of the current study (55%) falls in the middle compared to
hit against C. gigas ESTs with a cutoff at 10−3 other hemocyte investigations, but regardless, the rate of
new gene discovery was high.
ESTs containing microsatellites with di-, tri-, and one
2002; Quilang et al. 2007—mixed with other tissues), tetranucleotide repeat were observed (Table 3). Several of
Manila clam (Kang et al. 2006), carpet-shell clam (Gestal et these ESTs also had significant Blastx hits, including one
al. 2007), and mussel (Pallavicini et al. 2008). These EST (EW778460) that we highlight later in the paper
libraries have reported redundancy rates from as low as (Table 4).
15.4% (Quilang et al. 2007) to highs of 72.7% (Gestal et al. Following annotation, the greatest proportion of the
2007) and 78.5% (Pallavicini et al. 2008). Some of the ESTs was in protein metabolism and synthesis and
studies (Jenny et al. 2002) did not report the percent metabolism in general (Fig. 1). Included in these categories
redundancy, and strict comparisons of the rate of novel were ribosomal proteins that, not surprisingly, made up a

Table 3 ESTs with microsatellites including pertinent characteristics of the repeat region

EST accession Repeat Number Start Stop Length Existing EST Blastx hit [Species] Identity
number sequence of repeats bp bp of EST at NCBIa score

EW778058 aac 6 410 427 671 Cathepsin Z [Sus scrofa] 130/172

(75%)
EW778818 aag 11 705 737 904 CU684921 No hit
EW778624 aag 11 690 722 886 CU684921 No hit
EW778956 ag 18 141 176 910 AM855122 No hit
EW779136 ag 14 190 217 873 No hit
EW777687 at 9 109 126 759 BQ426523 No hit
EW778246 ca 9 95 112 788 No hit
EW779536 caa 19 402 458 813 No hit
EW778460 caa 6 319 336 787 AM855218 Mnk [Aplysia californica] 90/121
(74%)
EW777448 ct 9 86 103 830 No hit
EW777476 ct 17 580 613 804 No hit
EW778377 ct 24 453 500 680 No hit
EW778359 ga 25 102 151 588 No hit
EW779138 gga 6 96 113 915 Nucleosome assembly protein 148/237
[Danio rerio] (62%)
EW778453 ggc 9 386 412 897 No hit
EW778928 ggc 9 582 608 835 RNA polymerase I 58/163
[Gallus gallus] (35%)
EW778400 ggc 9 339 365 823 No hit
EW778607 ggc 9 380 406 806 No hit
EW778589 tac 6 701 718 894 No hit
EW777557 tc 13 348 373 862 No hit
EW779289 tgga 6 725 748 797 AM858458 No hit
a
Existing C. gigas ESTs at NCBI with identical sequences
Table 4 Selected genes from the C. gigas hemocyte cDNA library including accession numbers, size, and the most similar Blastx comparison to the Gene Ontology Database

Putative name/function Partial cDNA C. virginica Size Number Blastx identities Species most Accession GO terms GO description
accession contiga (bp) in library similar to number
number of similar
protein

Cell structure and motility

Cyclase-associated protein-1 EW778004 851 1 110/210 (52%) Zebrafish Q6YBS2 GO:0003785 Actin monomer binding
Phospholipid scramblase 1 EW778680 1,347 813 1 120/204 (58%) Human O15162 GO:0017121 Phospholipids scrambling
GO:0030168 Platelet activation
Cofilin (actin-depolymerizing factor 1) EW777946 229 722 2 52/133 (39%) Y. lipolytica Q6C0Y0 GO:0003779 Actin binding
ARP2 (actin-related protein 2) EW777744 784 2 215/253 (84%) Zebrafish NP_998664 GO:0005515 Protein binding
Proteases/antiproteases
Astacin-like protein EW779002 915 7 147/281 (52%) Pearl oyster Q2VU37 GO:0008237 Metallopeptidase activity
Tissue inhibitor of EW777598 1,081 807 3 115/115 (100%) Pacific oyster Q9GPJ2 GO:0008191 Metalloendopeptidase
metalloproteinase (TIMP) inhibitor activity
Cathepsin EW777605 1,402 791 1 33/41 (80%) Lancelet Q7YT27 GO:0004197 Cysteine-type endopeptidase
activity
GO:0008233 Peptidase activity
Thimet oligopeptidase 1 EW77774 1,340 811 1 143/232 (61%) Sea urchin XP_799208 GO:0004222 Metalloendopeptidase activity
GO:0008191 Metalloendopeptidase
inhibitor activity
GO:0008237 Metallopeptidase activity
Blastula protease 10 precursor EW777902 864 1 95/231 (41%) Common urchin P42674 GO:0008233 Peptidase activity
GO:0008237 Metallopeptidase activity
Prepro-cathepsin C EW778914 856 2 155/287 (54%) Rainbow trout Q64HY0 GO:0004197 Cysteine-type endopeptidase
activity
GO:0008234 Cysteine-type peptidase activity
Cathepsin Z EW778927 1,365 911 1 195/273 (71%) X. tropicalis Q5EAM1 GO:0004197 Cysteine-type endopeptidase
activity
GO:0008234 Cysteine-type peptidase activity
Cathepsin-L-like cysteine peptidase EW779434 1,402 760 1 143/257 (55%) Mealworm Q7YXL4 GO:0004197 Cysteine-type endopeptidase
activity
ADAM metalloproteinase EW778307 803 1 52/131 (39%) A. aegypti Q17E69 GO:0004222 Metalloendopeptidase activity
Matrix metalloproteinase EW778009 739 1 44/173 (25%) Sea urchin NP_001028823 GO:0004222 Metalloendopeptidase activity
Serine protease inhibitor EW778389 823 1 73/208 (35%) Scallop Q32TF4 GO:0004867 Serine endopeptidase
inhibitor activity
Bone morphogenetic protein 1 EW778952 856 2 82/266 (30%) X. tropicalis Q28C16 GO:0005509 Calcium ion binding
GO:0008237 Metallopeptidase activity
Cystatin B like EW778247 896 877 1 49/98 (50%) Zebrafish Q7ZUH6 GO:0004866 Endopeptidase inhibitor activity
Cytokines/lytic proteins
Interleukin 17 isoform D. EW779217 840 2 56/173 (32%) Rainbow trout Q70I20 GO:0005125 Cytokine activity
Macrophage expressed gene EW778608 894 1 135/243 (55%) Abalone ABP96718 Unknown
Mar Biotechnol
Putative name/function Partial cDNA C. virginica Size Number Blastx identities Species most Accession GO terms GO description
accession contiga (bp) in library similar to number
number of similar
protein

Receptors and associated proteins

Prostaglandin E2 receptor, EW777722 876 1 63/166 (37%) Human P35408 GO:0007186 G-protein-coupled receptor
EP4 subtype signaling
GO:0007188 G-protein signaling, coupled
Mar Biotechnol

to cAMP
Receptor protein tyrosine EW777914 909 1 70/198 (35%) Catfish Q6UNF4 GO:0004725 Protein tyrosine phosphatase
phosphatase (CD45-like) activity
GO:0016787 Hydrolase activity
Scavenger receptor class F EW777983 846 1 29/99 (29%) Mouse P59222 GO:0005044 Scavenger receptor activity
member 2 precursor
Putative neuropeptide receptor EW778447 905 1 29/89 (32%) Flatworm Q964E5 GO:0001584 Rhodopsin-like receptor activity
GO:0004930 G-protein-coupled receptor activity
GO:0004983 Neuropeptide Y receptor activity
Similar to tachykinin receptor EW778555 907 1 51/210 (24%) Urchin XP_783390 GO:0001584 Rhodopsin-like receptor activity
GO:0004930 G-protein-coupled receptor activity
Ectodysplasin A2 receptor EW778669 774 1 35/97 (36%) Human Q5VYX9 GO:0005031 Tumor necrosis factor
receptor activity
Integrin beta-PS precursor EW778853 843 2 48/137 (35%) Fly P11584 GO:0004872 Receptor activity
(position-specific antigen beta chain) GO:0050839 Cell adhesion molecule binding
Syntenin-1 (Syndecan-binding protein 1) EW779127 1,409 804 1 132/239 (55%) Rat Q9JI92 GO:0005137 Interleukin-5 receptor binding
GO:0008093 Cytoskeletal adaptor activity
TNF receptor-associated factor 3 EW779535 809 1 122/238 (51%) Lancelet A2TK68 GO:0004872 Receptor activity
TNF receptor-associated protein 1 EW778409 626 1 134/210 (63%) Chicken NP_001006175 GO:0000166 Nucleotide binding
GO:0005524 ATP binding
Epidermal growth factor-like receptor EW778003 816 1 157/217 (72%) Mosquito CAC35008 GO:0004714 Receptor protein tyrosine
kinase activity
Lectins/immunoglobulins
Galectin 4-like protein EW777685 765 2 90/144 (62%) Abalone A3FKF6 GO:0005529 Sugar binding
C-type lectin 1 EW778826 737 2 24/66 (36%) Eel Q8AXR7 GO:0005529 Sugar binding
Ficolin 3 EW778094 779 1 66/186 (35%) Sea squirt Q95P98 GO:0005102 Receptor binding
Lachesin 1 EW778576 815 1 79/260 (30%) Grasshopper Q26474 GO:0005515 Protein binding
Lachesin 2 EW778214 771 1 38/131 (29%) Fly Q24372 GO:0007156 Homophilic cell adhesion
GO:0007165 Signal transduction
Transcription/translation/cell cycle
Inhibitor of growth protein 3 EW779472 754 3 103/183 (56%) Zebrafish Q6TEM2 GO:0003677 DNA binding
GO:0005515 Protein binding
GO:0008270 Zinc ion binding
cAMP-responsive element binding EW777507 841 1 42/71 (59%) Sea hare Q16946 GO:0003677 DNA binding
protein 2 GO:0003700 Transcription factor activity
cAMP responsive element binding EW777815 1,385 573 1 89/155 (57%) Cow NP_001096003
protein 3-like 2
Erythroid differentiation-related factor 1 EW777674 750 1 79/215 (36%) P. pygmaeus Q5R9R1 GO:0006355 Regulation of transcription
Myocyte enhancer factor 2 EW777688 796 1 53/60 (88%) Marine jellyfish Q8T363 GO:0003677 DNA binding
GO:0003700 Transcription factor activity
Table 4 (continued)

Putative name/function Partial cDNA C. virginica Size Number Blastx identities Species most Accession GO terms GO description
accession contiga (bp) in library similar to number
number of similar
protein

GO:0043565 Sequence-specific DNA binding

High-mobility group protein EW778188 1,309 783 1 92/116 (79%) Pacific oyster Q70ML6 GO:0003677 DNA binding
High-mobility group protein 1 EW778687 940 1 96/169 (56% Snail Q8ITG9 GO:0003677 DNA binding
Septin 11 EW778483 816 1 93/161 (57%) X. laevis Q66J62 GO:0000166 Nucleotide binding
GO:0005525 GTP binding
Mps One Binder kinase activator-like EW778538 783 1 192/211 (90%) Fly Q95RA8 GO:0019207 Kinase regulator activity
Signal transduction proteins
RAB18, member RAS EW777589 799 3 160/205 (78%) X. tropicalis Q28D30 GO:0005524 ATP binding
oncogene family GO:0005525 GTP binding
GO:0008134 Transcription factor binding
Rab GDP-dissociation inhibitor EW778125 525 806 1 186/259 (71%) A. aegypti Q16KQ6 GO:0005093 Rab GDP-dissociation inhibitor
activity
3′,5′-cyclic nucleotide EW778398 880 1 47/104 (45%) A. aegypti Q16HU8 GO:0003824 Catalytic activity
phosphodiesterase-like GO:0004114 Cyclic AMP phosphodiesterase
activity
Dual specificity protein phosphatase EW778617 834 1 145/288 (50%) Human Q9Y6W6 GO:0004725 Protein tyrosine phosphatase
10 (mitogen-activated protein activity
kinase phosphatase) GO:0017017 MAP kinase phosphatase activity
MAP kinase-interacting EW778460 787 1 90/121 (74%) A. californica Q27SZ8 GO:0004674 Protein serine/threonine
serine/threonine kinase 1 kinase activity
14-3-3 protein gamma (protein kinase EW778905 899 878 1 142/236 (60%) Cow P68252 GO:0003779 Actin binding
C inhibitor protein 1) GO:0008426 Protein kinase C inhibitor activity
GO:0005159 Insulin-like growth factor
receptor binding
cAMP responsive element EW779405 872 2 138/154 (89%) Pacific oyster Q5Y1E2 GO:0043565 Sequence-specific DNA binding
binding protein-like GO:0003700 Transcription factor activity
GO:0046983 Protein dimerization activity
cAMP-dependent protein kinase EW779098 886 1 221/260 (85%) A. californica P31319 GO:0000166 Nucleotide binding
regulatory subunit (N4 subunit GO:0008603 cAMP-dependent pK regulator
of protein kinase A)
G protein beta subunit. EW779259 818 1 265/272 (97%) Pearl oyster Q5GIS3 GO:0004871 Signal transducer activity
G protein alpha S subunit EW779391 816 1 134/265 (50%) Silkworm NP_001093292 GO:0004871 Signal transducer activity
GO:0005525 GTP binding
Nuclear factor NF-kappa-B EW779317 848 1 31/83 (37%) Chicken P98150 GO:0003700 Transcription factor activity
p100 subunit GO:0005515 Protein binding
Rho coiled-coil associated EW779189 844 1 118/279 (42%) Zebrafish Q90Y37 GO:0000166 Nucleotide binding
kinase alpha GO:0004674 Protein serine/threonine
kinase activity
Mar Biotechnol
Putative name/function Partial cDNA C. virginica Size Number Blastx identities Species most Accession GO terms GO description
accession contiga (bp) in library similar to number
number of similar
protein

Rho family small GTP-binding EW779284 504 797 1 171/191 (89%) Aphid Q6PW11 GO:0000166 Nucleotide binding
protein cdc42.
Focal adhesion kinase 1 EW777968 530 1 130/176 (73%) X. laevis AAA99456 GO:0004713 Protein-tyrosine kinase activity
Focal adhesion kinase EW777781 899 1 73/128 (57%) Mosquito EAT43915 GO:0004713 Protein-tyrosine kinase activity
Mar Biotechnol

Growth factor receptor bound EW778129 762 1 131/217 (60%) Chicken ABM91436 GO:0007242 Signaling
protein 2
Mitogen-activated protein EW778383 838 2 156/212 (73%) Human EAW93531 GO:0000166 Nucleotide binding
kinase-activated protein kinase 2 GO:0004674 Protein serine/threonine
kinase activity
Apoptosis
Seven in absentia EW778477 861 2 214/228 (93%) Eastern oyster ABC95994 GO:0005515 Protein binding
GO:0008270 Zinc ion binding
Anamorsin (cytokine-induced EW779007 886 1 80/200 (40%) Human Q6FI81 GO:0006915 Apoptosis
apoptosis inhibitor 1) GO:0006916 Antiapoptosis
BNIP-2 EW779117 346 875 1 133/259 (51%) Mouse Q52KR3 GO:0006915 Apoptosis
C-Jun protein EW778895 1,449 862 1 86/246 (34%) Fugu Q800B5 GO:0043565 Sequence-specific DNA binding
GO:0003700 Transcription factor activity
Oxidative stress induced growth EW779296 641 1 90/146 (61%) Human Q9Y236
inhibitor 2
Phosducin-like protein 3. EW779247 792 1 107/192 (55%) Cow Q0VCW8 GO:0005515 Protein binding
Inhibitor of apoptosis protein EW777636 808 1 85/246 (34%) Xenopus NP_001082290 GO:0005515 Protein binding
Steroidogenic/eicosanoic/metabolic
enzymes
Lipoxygenase 1 EW778068 779 1 96/262 (36%) Human O15296 GO:0016165 Lipoxygenase activity
GO:0016491 Oxidoreductase activity
Lipoxygnease 2 EW779143 876 2 98/299 (32%) G. fruticosa Q2N410 GO:0016165 Lipoxygenase activity
GO:0016491 Oxidoreductase activity
Lipoxygenase 3 EW778932 930 1 93/318 (29%) Rat P12527 GO:0016165 Lipoxygenase activity
GO:0016491 Oxidoreductase activity
15-hydroxyprostaglandin EW777901 824 2 96/248 (38%) Chicken XP_420526 GO:0016491 Oxidoreductase activity
dehydrogenase
Sterol 12-alpha-hydroxylase EW778166 831 2 66/220 (30%) Mouse O88962 GO:0004497 Monooxygenase activity
(CYP8B1) GO:0016491 Oxidoreductase activity
GO:0020037 Heme binding
Cytochrome P450: 1A1-like EW778340 903 1 73/276 (26%) X. tropicalis Q5FVX6 GO:0004497 Monooxygenase activity
GO:0016491 Oxidoreductase activity
Cytochrome P450: 2D28-like EW779033 816 2 243/249 (97%) Pacific oyster ABO38814 GO:0004497 Monooxygenase activity
GO:0005506 Iron ion binding
GO:0016491 Oxidoreductase activity
Cytochrome P450: 17A1-like EW779361 797 1 82/242 (33%) Catfish O73853 GO:0004497 Monooxygenase activity
GO:0004508 Steroid 17-alpha-monooxygenase
activity
GO:0016491 Oxidoreductase activity
Table 4 (continued)

Putative name/function Partial cDNA C. virginica Size Number Blastx identities Species most Accession GO terms GO description
accession contiga (bp) in library similar to number
number of similar
protein

Cytochrome P450: 3A16-like EW779213 348 1 41/84 (48%) Mouse Q64481 GO:0004497 Monooxygenase activity
GO:0016491 Oxidoreductase activity
Cytochrome P450: family 4 EW779105 1,150 842 1 101/288 (35%) Zebrafish Q6PH32 GO:0004497 Monooxygenase activity
peptide-like GO:00016491 Oxidoreductase activity
Cytochrome P450 EW779500 721 1 60/230 (26%) A. aegypti Q16Y74 GO:0004497 Monooxygenase activity
GO:0005506 Iron ion binding
GO:0020037 Heme binding
Cytochrome P450 2C20 EW777670 804 1 54/122 (44% Macaque AAB24950 GO:0004497 Monooxygenase activity
(CYPIIC20) GO:0005506 Iron ion binding
GO:0016491 Oxidoreductase activity
Cytochrome P450, family 4, EW777481 803 1 122/266 (45%) Mouse NP_077762 GO:0004497 Monooxygenase activity
subfamily f, polypeptide 16 GO:0005506 Iron ion binding
GO:0016491 Oxidoreductase activity
Insulin-induced gene 2 protein EW779367 726 4 119/195 (61%) Mouse Q91WG1 GO:0006629 Lipid metabolic process
(INSIG-2) GO:0008202 Steroid metabolic process
GO:0008203 Cholesterol metabolic process
Others
Heat shock protein 25 EW777519 1,405 836 1 32/83 (38%) Zebrafish Q645R1 GO:0009408 Response to heat
Heat shock protein 12B EW777988 887 2 55/181 (30%) Zebrafish Q0R4G9 GO:0002040 Sprouting angiogenesis
GO:0048514 Blood vessel morphogenesis
Heat shock protein 90 EW777936 377 678 2 199/199 (100%) Pacific oyster ABS18268 GO:0005524 ATP binding
GO:0051082 Unfolded protein binding
Heat shock protein 70 EW778010 1,395 924 9 291/303 (96%) Pacific oyster Q9XZJ2 GO:0000166 Nucleotide binding
GO:0005524 ATP binding
Oxidative stress protein EW778471 798 1 83/165 (50%) Moon jelly Q5EN85 GO:0008270 Zinc ion binding
Cavortin EW778149 728 1 158/192 (82%) Pacific oyster Q5QGY9 GO:0004785 Copper/zinc superoxide
dismutase activity
GO:0005507 Copper ion binding
GO:0008270 Zinc ion binding
Dual oxidase 1. EW778215 853 1 193/282 (68%) Urchin Q5XMJ0 GO:0004601 Peroxidase activity
GO:0005506 Iron ion binding
GO:0005509 Calcium ion binding
GO:0016174 NAD(P)H oxidase activity
Histone 3 EW778115 659 1 136/136 (100%) Human NP_002098 GO:0003677 DNA binding
Lysosomal phospholipase EW779151 805 1 103/222 (46%) Human BAD96510 GO:0004622 Lysophospholipase activity
GO:0005543 Binding
a
C. viginica homologs in Appendix 1
Mar Biotechnol
Mar Biotechnol
large proportion of the ESTs. Actin (e.g., EW778950) was
the most frequently observed structural EST followed by
collagen (e.g., EW778483), tubulin (e.g., EW779030), and
a calponin/transgelin-like cDNA (e.g., EW779129). ESTs
involved in metabolism or biosynthesis that were frequently
observed included ferritin (e.g., EW778702), NADH
dehydrogenase 5 (e.g., EW779040), cytochrome b (e.g.,
EW778907), and elongation factor (e.g., EW777741). A
total of 876 ESTs had no annotation when analyzed by
Blastx against the Gene Ontology (GO) Database. These
ESTs were not included in the GO analysis shown in Fig. 1.
A subset of ESTs are provided in Table 4 including size,
accession number, sequence similarity at the protein level,
GO annotation, and where available, C. virginica homologs
that are provided in the Online Appendix. The ESTs
presented in Table 4 were chosen based on their possible
relationship with important hemocyte functions.
Cell Structure and Motility
Locomotion, phagocytosis, and the regulation of cell shape
are crucial elements of hemocyte function in oysters
(Cheng 1975; Fisher 1986). Therefore, the actin cytoskel-
eton and its reorganization are fundamental to the function
of the hemocyte as they are to vertebrate granulocytes.
Sequences were observed that had high identity to genes
involved in actin cytoskeletal organization. A cDNA
(EW777744) was observed that was similar to Arp3, a
protein that, together with Arp2, form a complex that is
involved with actin polymerization (Welch et al. 1997b).
Arps are found in a diverse group of eukaryotes (Welch et
al. 1997a), and the Arp2/3 complex regulates the assembly
of new actin filament networks at the leading front of
Fig. 1 Categorization of ESTs
into cellular processes derived
from Blastx comparisons to the
Gene Ontology Database (ver-
sion GO.200801). ESTs without
annotation were not included in
this analysis
moving cells that drives cell motility and chemotaxis (Jones
2000). An EST (EW777946) was also found that had
sequence similarity to cofilin, an actin-binding protein that
controls actin assembly and has also been reported in
Manila clam hemocytes (Kang et al. 2006). Finally, an EST
(EW778680) was observed that had high sequence similar-
ity to phospholipid scrambalase. Scrambalase is a palmi-
toylated, lipid raft-associated endofacial plasma membrane
protein that accelerates bidirectional movement of plasma
membrane phospholipids during conditions of elevated
calcium (Zhou et al. 1997). Scrambalase is stimulated by
cytokines such as stem cell factor and granulocyte colony-
stimulating factor, suggesting that it functionally contrib-
utes to cytokine-regulated cell proliferation and differenti-
ation during myelopoiesis (Zhou et al. 2002).
Proteases and Antiproteases
A number of ESTs were obtained that had sequence
similarities to known proteases and protease inhibitors.
Proteases are specifically classified into groupings based
primarily on the activity of their active site, their preferred
substrate, and the pH range of their proteolytic activity. As
such, four classes are observed in mammalian leukocytes
including serine, metalloproteinases, cysteine, and aspartic
proteinases (Owen and Campbell 1999). The ESTs observed
in the C. gigas hemocyte library covered nearly all of these
protease classifications. Several cathepsins were observed
in the library including cathepsin C (EW778914), Z
(EW778927), and L (EW779434). Cathepsin C (dipeptidyl
peptidase I) is recognized as a multifunctional protease that
is essential for the activation of other enzymes (Turk et al.
2001). Cathepsin L is involved in the degradation of the

invariant chain of the major histocompatibility class II
complexes (Nakagawa et al. 1998) but is also capable of
generating kinin from kininogen and, therefore, may act as
a kininogenase at inflammatory sites (Desmazes et al.
2003). Cathepsin Z (also called cathepsin Y) is a cysteine
endopeptidase originally isolated from rat blood, which
produces bradykinin-potentiating peptide from rat plasma
and thereby has a dramatic effect on the action of kinins
(Nakazono et al. 2002; Sakamoto et al. 1999).
In invertebrates, there have been investigations on the
function of several cathepsins. However, these have been
primarily related to digestion (Cristofoletti et al. 2005) or
other very specific functions such as the role of cathepsin L
in early development in brine shrimp (Liu and Warner
2006) and cathepsins B and D in oyster development
(Donald et al. 2003). To our knowledge, there have not
been reports linking cathepsins to immune functions in
bivalves, though past EST investigations on oyster hemo-
Fig. 2 Messenger RNA expres-
sion levels of selected ESTs in
gill tissue of Pacific oysters
challenged with bacteria. Bars
represent the means of ten rep-
licate oysters±standard error.
Asterisks indicate genes for
which there was a significant
difference (p<0.05) between
control and bacterial-challenged
oysters
Mar Biotechnol
cytes have reported the presence of cathepsin B (Jenny et
al. 2002), cathepsin Z (Jenny et al. 2002), and cathepsin L
(Gueguen et al. 2003). Interestingly, one of the most highly
upregulated genes in mussels exposed to metal or organic
mixtures is cathepsin L (Venier et al. 2006).
Besides cathepsins, ESTs for two members of the astacin
metalloproteinase family were observed. This included an
EST (EW779002) that was most similar to a recently
cloned astacin metalloproteinase that was upregulated by
lipopolysaccharide (LPS) challenge in the pearl oyster
(Pinctada fucata; Xiong et al. 2006). This protease was
also significantly upregulated by bacterial challenge in
oysters in the current study (Fig. 2). The astacin family also
includes proteases such as bone morphogenetic protein 1
(BMP-1), and an EST (EW778952) for BMP-1 was also
found in the C. gigas hemocyte library. BMP-1 has a
number of functions in vertebrates including the formation
of the extracellular matrix, the activation of latent com-
Mar Biotechnol
Fig. 2 (continued)
plexes of certain TGFβ superfamily members, and the
cleavage of specific proteins (e.g., prolactin) to form
angiogenic factors (Ge et al. 2007). ESTs for several
metalloproteinases were also observed including a matrix
metalloproteinase (EW778009) and a cDNA (EW778307)
for an ADAM (“a metalloprotease and disintegrin”) metal-
loproteinase. The ADAM metalloproteinases are particular-
ly intriguing since they are one of the major factors
involved in the proteolytic release of extracellular domains
from membrane-bound precursors such as cytokines,
receptors, and growth factors (Huovila et al. 2005).
ESTs for several protease inhibitors were observed,
including the TIMP (EW777598). This TIMP has been
extensively studied in the Pacific oyster and found to be
highly and rapidly upregulated following bacterial chal-
lenge or shell damage (Montagnani et al. 2001), and it was
also upregulated in the oysters challenged by bacteria in the
present study (Fig. 2). In addition, an EST (EW778389)
was observed for a protease inhibitor with highest sequence
identity to a novel serine protease inhibitor recently
described in the bay scallop (Argopecten irradians; Zhu et
al. 2006). In the bay scallop protein, the inhibitor exhibits
structural domains characteristic of Kazal-type serine
protease inhibitors, and the expression of the inhibitor is
upregulated by bacterial challenge and injury. Finally, an
EST (EW778247) for a cysteine protease inhibitor most
similar to cystatin B was observed. Cystatin B has been
observed previously in oyster (Jenny et al. 2002) and
Manila clam (Kang et al. 2006) hemocytes, and this gene
was significantly upregulated by bacterial challenge in the
oysters in the present study (Fig. 2).
When we aligned the ESTs for proteases and protease
inhibitors against the assembled C. virginica contigs, we
found homologs for thimet oligopeptidase, cathepsin Z,
cathepsin L, and cystatin B (see Table 4). However, the
most interesting observation was a C. virginica contig
(1081—Online Appendix) that showed high identity to the
C. gigas TIMP.

Cytokines/Lytic Proteins
While there are comparative immunohistochemical and
experimental data to suggest that cytokines are present in
invertebrates (Raftos and Nair 2004), several large-scale
genomic analyses of sequenced genomes (S. purpuratus, D.
melanogaster, C. intestinalis) have generally not observed
chemokines (Devries et al. 2006) or helical cytokines
(Huising et al. 2006). The exception is the presence of
tumor necrosis factor (TNF) homologs (Robertson et al.
2006) and a number of potential interleukin 17 (IL17)
homologs (Hibino et al. 2006). In the C. gigas hemocyte
library, we found two ESTs (EW779217; EW779442) that
aligned to vertebrate IL17. In mammals, six forms of IL17s,
labeled A–F, have been described (Moseley et al. 2003).
The C. gigas IL17 was most similar to the IL17D form and
was found to be upregulated in hemocytes rapidly follow-
ing exposure to bacteria (Roberts et al. 2008).
An EST (EW778608) was obtained for a cDNA with high
identity to the macrophage expressed gene (MEG), recently
identified in several species of abalone (Mah et al. 2004;
Wang et al. 2008). The proteins encoded by MEG in mam-
mals and in abalone have sequence similarity to perforin
(Spilsbury et al. 1995; Wang et al. 2008) and, therefore, may
be involved in direct cell killing. The possible involvement
of MEG in the immune response in invertebrates is further
supported by the observation that it is upregulated by
bacterial challenge in gastropods (Wang et al. 2008).
Receptors and Associated Proteins
TNF is a well-characterized proinflammatory cytokine in
vertebrates that has been demonstrated to affect the growth,
differentiation, and survival of immune and nonimmune
cells (Goetz et al. 2004b). It is a member of the “TNF ligand
superfamily” that includes a number of ligands in addition to
TNF. These ligands interact with specific receptors, for
example, TNF with TNF receptor 1 (TNFR1) and TNF
receptor 2. TNFR1 binds intracellularly with TNF receptor-
associated protein 1 (TRAP1; Song et al. 1995), and an EST
(EW778409) for TRAP1 was identified in the C. gigas
hemocyte library. Gene models for TNF and TNF receptors
have been identified in sequenced genomes of invertebrates
(Robertson et al. 2006).
Besides TNFR1 and 2, a large number of other receptors
have been characterized for the TNF ligand superfamily
members including, for example, the ectodysplasin receptor
(Ware 2003) for which an EST (EW778669) was observed
in the present library and was significantly upregulated in
oyster gills by bacterial stimulation (Fig. 2). TNF ligand
receptors contain one or more TNF-associated factor
(TRAF) motifs in their cytoplasmic domains that interact
with TRAF proteins in producing a cellular effect (Dempsey
Mar Biotechnol
et al. 2003). In mammals, there are six different TRAFs
(TRAF1–6), and some appear to be evolutionarily conserved
across vertebrates and invertebrates. In the hemocyte ESTs, a
cDNA (EW779535) was observed that was most similar to
TRAF3, and this gene was significantly elevated by bacterial
challenge (Fig. 2). TRAF3 is one of the evolutionary-
conserved TRAFs (Dempsey et al. 2003), and interestingly,
it has been demonstrated that TRAF3 is essential for the
stimulation of type I interferon by all viral cellular
recognition systems in mammals (Saha and Cheng 2006).
Perhaps one the most interesting ESTs observed in the
hemocyte library was a cDNA (EW777722) similar to the
EP4 subtype prostaglandin E2 receptor. Prostaglandin E2 is
both proinflammatory and anti-inflammatory in mammals,
and it is believed that the anti-inflammatory effects of
PGE2 are mediated by the EP4 receptor subtype (Minami et
al. 2008; Takayama et al. 2006). In mammalian macro-
phages, LPS upregulates the EP2 receptor subtype but
downregulates the EP4 PGE2 receptor (Ikegami et al.
2001). The C. gigas EP4 receptor mRNA was very strongly
upregulated in oyster gills by bacterial stimulation (Fig. 2).
The library contained an EST (EW777983) with simi-
larity to scavenger receptors and the Drosophila draper, a
gene believed to be involved in the phagocytosis of
apoptotic cells in hemocytes (Manaka et al. 2004). An
EST (EW777914) with identity to the vertebrate CD45
gene was observed. CD45 is expressed on all hematopoietic
cells in vertebrates and is a large protein of the “receptor-
type protein tyrosine phosphatase” family. While CD45 has
been observed in jawed and jawless vertebrates (Uinuk-Ool
et al. 2002), to our knowledge, this would be the first
occurrence in an invertebrate.
Lectins/Immunoglobulins
Several ESTs were observed that are similar to lectins.
Lectins are proteins that bind specific sugar moieties, and in
immune systems, they frequently bind carbohydrate moie-
ties on pathogens. For example, a lectin was recently
reported that was responsible for recognizing the parasite,
P. marinus, by the Eastern oyster hemocyte (Tasumi and
Vasta 2007). A cDNA (EW777685) for galectin 4 was
observed in the C. gigas hemocyte library. This EST was
most similar to an abalone galectin but also was very
similar to recently described galectins from the freshwater
snail, Biophalaria glabrata (Yoshino et al. 2008), and the
argasid tick, Ornithodoros moubata (Huang et al. 2007).
Both of those are tandem repeat galectins. The C. gigas
galectin 4 EST did not have similarity to the galectin
described by Tasumi and Vasta (2007); however, another
EST (EW779109) from the library did align at the amino
acid level to the C. virginica galectin and could be the C.
gigas homolog.
Mar Biotechnol
A cDNA (EW778094) was also observed for a ficolin
that most closely resembled the ficolin characterized from
the ascidian, Halocynthia roretzi (Kenjo et al. 2001).
Ficolins are lectin proteins that contain a collagen-like
domain and a fibrinogen-like domain and have been impli-
cated in pathogen recognition for phagocytosis (Matsushita
et al. 1996). An EST (EW778826) most similar to a
galactose-binding C-type lectin in the eel (Mistry et al.
2001) was also observed. Besides lectins, two different
lachesin-like cDNAs (EW778576, EW778214) were ob-
served in the library. Lachesins are interesting molecules
since they contain immunoglobulin-like domains. The
lachesin ESTs described here contained two conserved
immunoglobulin domains also found in neural cell adhesion
molecules, fasciclin II, and the insect immune protein
hemolin (Karlstrom et al. 1993).
Transcription/Translation/Cell Cycle
Several putative transcription factors and molecules involved
in regulating the cell cycle were identified in the ESTs. A
cDNA (EW779472) with sequence similarity to inhibitor of
growth 3 (ING3) was obtained. ING3 is a member of the ING
family of tumor suppressors that regulate the cell cycle,
apoptosis, and DNA repair. Two ESTs (EW777507,
EW777815) with homology to cyclic adenosine monophos-
phate (cAMP)-responsive element-binding (CREB) proteins
were identified. CREB proteins bind to the cAMP response
element and are involved in regulating transcription.
An EST (EW777674) for a transcription factor, erythroid
differentiation-related factor 1 (EDRF1), was identified in
the library. This gene was reported to be involved in
erythroid differentiation and the upregulation of the globin
gene in mammals (Wang et al. 2002). Interestingly,
respiratory proteins have recently been shown to be
involved in the antimicrobial defense in humans and
horseshoe crabs (Jiang et al. 2007). Jiang et al. (2007)
found that respiratory proteins were activated by microbial
proteases to produce ROS. Thus, a gene like EDRF1 could
be involved in regulating hemocyte numbers and/or
composition and, in the process, antimicrobial activity.
A cDNA (EW777688) for myocyte enhancer factor
(MEF2) was in the C. gigas library. MEF2 is well
conserved across vertebrates and invertebrates (Shiomi et
al. 2005), and while it has generally been associated with
the control of early muscle development (Black and Olson
1998), it is produced by other cells as well. For example,
LPS (Gram-negative bacterial LPS) increased the activation
of MEF2C and c-jun in mammalian monocytes, suggesting
that it may have an important roll in inflammation (Han
et al. 1997).
Finally, ESTs (EW778188, EW778687) with sequence
similarity to high-mobility group (HMG) proteins, were
obtained from the C. gigas library. One of the HMGs was
most similar to a previously submitted C. gigas HMG
sequence (accession no. Q70ML6); however, the EST
reported here is not the homolog since the two are only
79% identical at the nucleotide level. Proteins within this
family bind the minor groove of DNA and are involved in
responding to pathogens and removing damaged cells
(Dumitriu et al. 2005).
Signal Transduction
When macrophages encounter foreign molecules, extracel-
lular receptors are activated which initiate a highly
regulated signaling process involving an array of intracel-
lular proteins that are coordinated to transmit this informa-
tion to the nucleus resulting in a specific cellular response.
In phagocytosis, an assortment of signaling takes place to
coordinate membrane and cytoskeleton rearrangement. G-
protein-coupled receptors are activated which initiate the
phosphorylation of numerous proteins, including the Rab
family and focal adhesion kinase (FAK). The Rab family of
proteins plays key roles in regulating the reorganization of
membrane properties via lipid rafts (Hashim et al. 2000).
FAK, controlled by the Arp2/3, regulates actin assembly
during phagocytosis (Serrels et al. 2007). Additionally,
FAK has been shown to interact with Rho GTPases,
possibly activating these molecules (Zhai et al. 2003). Not
only did we find an EST for Arp2 (discussed above), we
also found two ESTs (EW777968 and EW777781) with
similarity to FAKs. One of these kinases was slightly
elevated upon bacterial challenge (Fig. 2). We also obtained
an EST (EW779284) for a Rho family small guanosine
triphosphate (GTP)-binding protein, and of the Rab family
of proteins, we found a cDNA (EW777589) for Rab18.
Rab18 is involved in reorganizing cell membranes in
Salmonella (Hashim et al. 2000).
The nuclear factor-kB (NF-kB) protein complex is
involved in cellular responses to stimuli such as stress,
cytokines, free radicals, and bacterial or viral antigens
(Gilmore 1999). These proteins are translocated from the
cytoplasm to the nucleus where they act as transcription
factors for a variety of genes involved in cell proliferation
and inflammation (Legarda-Addison and Ting 2007). In the
NF-kB family, we observed a cDNA (EW779317) of the
p100 subunit homolog that was significantly upregulated
upon bacterial challenge (Fig. 2).
The mitogen-activated protein kinase (MAPK) signaling
pathway is involved in phagocytosis and the prophenolox-
idase cascade in invertebrates (Lamprou et al. 2007). In the
oyster library, we identified ESTs for genes involved in the
MAPK signaling pathway including MAPK-activated pro-
tein kinase 2 (EW778383), MAPK-interacting serine/
threonine kinase 1 (EW778460), and dual specificity

protein phosphatase 10 (EW778617), a factor that acts on
p38, JNK, and ERK and appears to be involved in
enhancing the innate immune response (Pulido and Van
Huijsduijnen 2008). Finally, an EST (EW778398) was
found with homology to 3′,5′-cyclic nucleotide phosphodi-
esterase, a key enzyme that degrades cAMP and, thus,
regulates cAMP levels.
Apoptosis
Apoptosis or programmed cell death is important for the
homeostatic restoration of the number of immune cells at
the termination of an immune response (Droin et al. 2003).
In the sequencing of the C. gigas hemocyte cDNA
library, several homologs of genes involved in apoptosis
were identified. ESTs (EW778477) were observed for
seven in absentia (SIAH) that induces cell growth arrest.
In humans, SIAH is a downstream effector of p53 which
functions to suppress cell growth (Matsuzawa et al. 1998).
An EST (EW779007) for cytokine-induced apoptosis
inhibitor (also known as anamorsin) was also found in the
library. Anamorsin inhibits programmed cell death follow-
ing stimulation by cytokines such as IL3 (Shibayama et al.
2004). A Bcl-2/adenovirus E1B 19 kDa interacting protein
(BNIP) domain containing cDNA (EW779117) was se-
quenced. BNIPs are a proapoptotic subgroup of the Bcl-2
family and have previously been found in several taxa
including C. elegans (Zhang et al. 2003). Another Bcl-2
family member, BAD, interacts with the 14-3-3 proteins in
the regulation of apoptosis (Fu et al. 2000). 14-3-3 proteins
are highly conserved and comprise a complex family that
contains seven distinct isoforms in vertebrates (Aitken et al.
1995). An EST (EW778905) for the 14-3-3 protein gamma
was observed in the hemocyte library. Finally, a cDNA
(EW778895) for c-jun was observed, and it was signifi-
cantly upregulated by bacterial challenge (Fig. 2). C-jun is a
downstream target of the JNK signaling pathway activated
by mitogen-activated kinases (Weston and Davis 2002).
This pathway is stimulated by cytokines and exposure to
environmental stress, and JNK activation has been ob-
served, for example, in Mytilus galloprovincialis under
elevated holding temperatures (Anestis et al. 2007). A c-jun
EST was also reported in hemocytes of Manila clams (Kang
et al. 2006).
Steroidogenic/Eicosanoic/Metabolizing Enzymes
A large number of ESTs were observed in the C. gigas
library that had sequence similarity to cytochrome P450
enzymes. Cytochrome P450 is a large superfamily of
enzymes that catalyze many reactions involved in the
metabolism of xenobiotics and the synthesis of cholesterol,
steroids, and other lipids. Several P450 genes have been
Mar Biotechnol
previously observed in bivalve ESTs (Tanguy et al. 2004),
but as previously noted, these enzymes have not received
very much attention in invertebrate studies (Tanguy et al.
2008).
Following sequence assembly of the ESTs from C. gigas
hemocytes, there were at least nine unique cytochrome
P450 gene products shown in Table 4. The nomenclature
system for genes in the cytochrome P450 superfamily
involves the use of “CYP” followed by a number indicating
the gene family, a letter indicating the subfamily, and an
additional number indicating the individual gene. From the
first family, one cDNA (EW778340) was identified, as
being most similar to CYP1A1. CYP1A1 is also known as
aryl hydrocarbon hydroxylase and is involved in the
activation of aromatic hydrocarbons. CYP1A1 is regulated
in response to exposure to aromatic hydrocarbons and is
therefore often used as a biomarker in aquatic organisms
(Chaty et al. 2004; Mcclain et al. 2003). A second EST
(EW777670) was most similar to the CYP2C subfamily.
Proteins in this subfamily are primarily involved in
xenobiotic and steroid metabolism. The only EST
(EW779033) with significant homology to an existing C.
gigas P450 cDNA also belongs in the CYP2 family. There
was one EST (EW779213) that was most similar to the
CYP3 family and two ESTs (EW779105; EW777481) that
likely belong to family 4. Finally, another cytochrome P450
cDNA (EW778166) had high sequence similarity with both
the CYP7 and CYP8 families. Interestingly, members of
these families are involved in bile acid biosynthesis. While
there is limited information on a relationship between bile
acid and pathogens outside of nonmammalian systems, bile
is a primary stressor for pathogens and has been shown to
have antimicrobial activity (Begley et al. 2005).
CYP17A1 is an enzyme which acts on pregnenolone and
progesterone in mammalian systems to convert pregneno-
lone and progesterone to their 17α-hydroxylated products
and subsequently to dehydroepiandrosterone and androste-
nedione, catalyzing both the 17α-hydroxylation and the
17,20-lyase reaction. An EST (EW779361) for this gene
was observed in the library. Recently, a CYP17 homolog
was discovered in the amphioxus (Mizuta and Kubokawa
2007), and investigators have identified components of a
sex steroid pathway in C. gigas (Matsumoto et al. 2003,
2007). These data suggest CYP17A1 could have similar
steroidogenic function across taxa including oysters.
ESTs for several enzymes possibly involved in the
eicosanoid synthetic pathway were observed in the library.
These included three separate lipoxygenase cDNAs
(EW778068, EW779143, EW778932) that did not assem-
ble with CAP3, but all had similarity to several lip-
oxygenases depending on the species comparison,
including arachidonic 5, 8, and 15 lipoxygenases. Lip-
oxygenases are enzymes that catalyze the oxygenation of
Mar Biotechnol
polyunsaturated fatty acids to corresponding hydroperoxy
derivatives (Brash 1999). Depending on the particular
conditions and related enzymes in a cell, lipoxygenase
activity can result in the ultimate production of a diverse
number and type of molecules including leukotrienes,
lipoxins, hepoxilins, and hydroperoxy fatty acids (Kuhn
and O’Donnell 2006). Some of these mediators are
produced by mammalian leukocytes and play a role in
inflammation and other immune activities (Kuhn and
O’Donnell 2006). Another very interesting EST
(EW777901) observed was a cDNA with high similarity
to mammalian 15-hydroxyprostaglandin dehydrogenase.
This enzyme is key in the inactivation of prostaglandins
by oxidizing the 15-hydroxyl group to a corresponding 15-
keto-metabolite (Ensor and Tai 1995). The EST as
sequenced contained the complete open reading frame of
the enzyme (accession no. EU622636).
Others
A number of additional genes of interest were found that
did not fit easily into the other categories. A set of heat
shock proteins (Hsp), including a C. gigas homologue
(EW777988) of HspA12B, as well as the C. gigas Hsp70
(EW778010) and Hsp90 (EW777936), were all found in
the library. The Hsps70 and 90 are interesting because of
the shear number of cellular processes in which they are
involved. Most Hsp70s are constitutively expressed as they
are a primary component of folding newly assembled
proteins, and not surprisingly, we found a large number of
Hsp70 copies in the library (Table 4). Additionally, Hsp70
is involved in refolding denatured or damaged proteins,
transporting these proteins to organelles for degradation,
and in protection of cellular components in response to
varying types of stresses. Danio rerio Hsp12B is distantly
related to other Hsp70s. It is also constitutively expressed
and possesses a putative adenosine triphosphate (ATP)-
binding domain like other Hsp70s. However, unlike most
hsp70s, HspA12B is not ubiquitously expressed throughout
all cell types and is only expressed in endothelial cells
(Durr et al. 2004; Hu et al. 2006; Steagall et al. 2006). It
also plays a critical role in regulating angiogenesis in
zebrafish during development (Hu et al. 2006). Virtually, no
research has examined what effect various cellular stresses
may have on the expression of HSPA12B. A thorough
examination of the human hsp70 family and its evolution
was unable to find homologs of human Hsp12AB in any
invertebrate (Brocchieri et al. 2008). As such, the data
presented here provide the first evidence for the existence
of an invertebrate HspA12B homolog.
Another intriguing EST (EW778149) that was found in
the library was cavortin. Cavortin is interesting because it is
the major protein in oyster hemolymph, yet its function(s)
remains unknown. Early research describes it as a natural
hemmaglutinin (Acton et al. 1969). Further research
described it as a carbonic anhydrase and also a relative of
copper/zinc superoxide dismutases (Cu/Zn SOD; Gonzalez
et al. 2005). However, recent research by Scotti et al.
(2001) shows that cavortin cannot bind a sufficient number
of copper/zinc atoms to serve as a Cu/Zn SOD. Although
the actual function of cavortin in oysters is still unknown,
the expression of cavortin has been shown to increase
during infection and in oysters which exhibit resistance to
summer mortality (Huvet et al. 2004).
Conclusions
A number of genes that might be involved in the function
of the oyster hemocyte based on their annotation and, in
some cases, their expression following bacterial challenge
were observed in the current EST analysis. While some of
the genes have been reported in other hemocyte EST
studies, there were many that have not. Some of the new
genes (e.g., IL17) may have been expressed in the oyster
hemocytes as a result of their being incubated overnight on
poly-lysine plates. The physical process of plating and the
adhering of the cells could act as a stimulus for transcrip-
tion. We have been analyzing the genes expressed in fish
macrophages using similar plating and EST approaches
(Goetz et al. 2004a). There are some interesting similarities
between the genes observed in macrophages and hemocytes
that would support a role for some genes in innate
immunity extending across vertebrates and invertebrates.
For example, we found genes that are presumably involved
in cytoskeleton rearrangement including Arps and cofilin in
both hemocytes and macrophage cDNA libraries. We also
found many of the same proteases in macrophages and
hemocytes including matrix metalloproteinase, cathepsins
L, C, and Z (Y), and protease inhibitors such as cystatin and
the TIMP. While some of these proteases my be involved in
tissue reorganization at sites of inflammation, the relation-
ship of some of the cathepsins with the kinin–kininogen
pathway (Desmazes et al. 2003) is intriguing and may be
occurring in both vertebrates and invertebrates given the
apparent ubiquity of the kinin–kininogen system (Torfs et
al. 1999; Zhou et al. 2006).
It is well known that vertebrate macrophages can
produce a number of different eicosanoids (Sorrell et al.
1989), and ESTs for trout macrophages contained several
important genes involved in eicosanoid synthesis (Goetz et
al. 2004a). In the oyster hemocytes, we also found cDNAs
for several enzymes involved in eicosanoid synthesis and
prostaglandin recognition. Interestingly, we found the key
enzyme, 15-hydroxyprostaglandin dehydrogenase, that is
involved in the initial inactivation of prostaglandins like

PGE. This same conversion is accomplished by the dual
activity enzyme, LTB4 12-hydroxydehydrogenase/prosta-
glandin15-keto-reductase, found in trout macrophages
(Goetz et al. 2004a). Eicosanoid synthesis and the possible
effects of these mediators on immune function in hemo-
cytes have been explored in insect hemocytes (Gadelhak et
al. 1995; Stanley 2006). However, there is relatively little
information concerning the role of eicosanoids in bivalve
immunity and hemocyte function. Experiments using
prostaglandin endoperoxide synthase and lipoxygenase
inhibitors suggest that eicosanoids are involved in the
response to bacteria in Mytilus hemocytes (Canesi et al.
2002). In addition, arachidonic acid supplementation in the
Pacific oyster resulted in significant effects on hemocyte
numbers and cellular activity, again suggesting that an
eicosanoid may be involved in hemocyte function (Delaporte
et al. 2006). However, to our knowledge, the synthesis and
direct effects of eicosanoids have not been investigated in
bivalve hemocytes. Some of the ESTs and their expression
observed here would strongly suggest the involvement of a
PGE eicosanoid.
Of course, there are also major differences observed
between hemocytes and macrophages, particularly in the
occurrence in macrophages of many cytokines/chemokines
and their receptors and also the presence of specific cell
membrane antigens such as the major histocompatibility
complex class proteins and clusters of differentiation. It is
possible that many cytokines and chemokines evolved
within the vertebrate lineage and, therefore, are not present
in invertebrates. Further, some of the antigens present on
the trout macrophages are related to the adaptive immune
system that is not present in invertebrates.
Until recently, virtually no research had been done on
immune cell signaling in invertebrates aside from models
such as Drosophila. Recent work examined medfly hemo-
cytes and the signaling process involved during phagocy-
tosis (Lamprou et al. 2007). By looking at FAK activation
and FAK-interacting molecules, the basic signaling path-
ways that are activated during phagocytosis in medfly
hemocytes were found to be nearly identical to those in
vertebrates (Lamprou et al. 2007). Thus, some pathways
may have remained relatively unchanged from insects to
mammals. The cell-signaling genes uncovered in the
present EST analysis suggest that similar signal transduc-
tion pathways are present in C. gigas hemocytes.
Finally, there are currently 26,820 ESTs for C. gigas and
14,560 ESTs for C. virginica. While that is not necessarily a
large number relative to some vertebrate species, there are
already a number of genes present in those ESTs that could
be very useful in understanding the immune system in
bivalves. This became clear when we aligned the C. gigas
ESTs in the present study with the assembled ESTs from C.
virginica. A number of the homologs were already present,
Mar Biotechnol
and some of these may hopefully be used to design primers
for comparative studies between the species.
Acknowledgments This research was supported in part by the
Cooperative State Research Education and Extension Service, US
Department of Agriculture, under Agreement no. 2003-38500-13505
(SR).
References
Acton RT, Bennett JC, Evans EE, Schrohenloher RE (1969) Physical
and chemical characterization of an oyster hemagglutinin. J Biol
Chem 244:4128–4135
Adema CM, Van Deutekom-Mulder EC, Van Der Knaap WPW,
Meuleman EA, Sminia T (1991) Generation of oxygen radicals in
hemocytes of the snail Lymnaea stagnalis in relation to the rate
of phagocytosis. Dev Comp Immunol 15:17–26
Aitken A, Jones D, Soneji Y, Howell S (1995) 14-3-3 proteins:
biological function and domain structure. Biochem Soc Trans
23:605–611
Anderson RS (1999) Perkinsus marinus secretory products modulate
superoxide anion production by oyster (Crassostrea virginica)
haemocytes. Fish Shellfish Immunol 9:51–60
Anestis A, Lazou A, Portner HO, Michaelidis B (2007) Behavioral,
metabolic, and molecular stress responses of marine bivalve
Mytilus galloprovincialis during long-term acclimation at in-
creasing ambient temperature. Am J Physiol Regul Integr Comp
Physiol 293:R911–R921
Badariotti F, Lelong C, Dubos MP, Favrel P (2007) Characterization
of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in
immune defence of the mollusc Crassostrea gigas. FEBS J 274:
3646–3654
Begley M, Gahan CG, Hill C (2005) The interaction between bacteria
and bile. FEMS Microbiol Rev 29:625–651
Black BL, Olson EN (1998) Transcriptional control of muscle
development by myocyte enhancer factor-2 (MEF2) proteins.
Ann Rev Cell Dev Biol 14:167–196
Brash AR (1999) Lipoxygenases: occurrence, functions, catalysis, and
acquisition of substrate. J Biol Chem 274:23679–23682
Brocchieri L, Conway De Macario E, Macario AJ (2008) hsp70 genes
in the human genome: conservation and differentiation patterns
predict a wide array of overlapping and specialized functions.
BMC Evol Biol 8:19
Canesi L, Scarpato A, Betti M, Ciacci C, Pruzzo C, Gallo G (2002)
Bacterial killing by Mytilus hemocyte monolayers as a model for
investigating the signaling pathways involved in mussel immune
defence. Mar Environ Res 54:547–551
Chaty S, Rodius F, Vasseur P (2004) A comparative study of the
expression of CYP1A and CYP4 genes in aquatic invertebrate
(freshwater mussel, Unio tumidus) and vertebrate (rainbow trout,
Oncorhynchus mykiss). Aquat Toxicol 69:81–94
Cheng TC (1975) Functional morphology and biochemistry of
molluscan phagocytes. Ann NY Acad Sci 266:343–379
Cheng TC (1996) Hemocytes: forms and functions. In: Kennedy VS,
Newell RIE, Eble AF (eds) The eastern oyster, Crassostrea
virginica. Maryland Sea Grant College, College Park, MD
Cheng TC, Rodrick GE (1975) Lysosomal and other enzymes in the
hemolymph of Crassostrea virginica and Mercenaria mercena-
ria. Comp Biochem Physiol B 52:443–447
Chomcynski P (1993) A reagent for the single-step simultaneous
isolation of RNA, DNA and protein from cell and tissue samples.
Biotechniques 15:532–537
Mar Biotechnol
Chomcynski P, Sacchi N (1987) Single-step method of RNA isolation
by acid guanidinium thiocyanate–phenol extraction. Anal Biochem
162:156–159
Cristofoletti PT, Ribeiro AF, Terra WR (2005) The cathepsin L-like
proteinases from the midgut of Tenebrio molitor larvae:
sequence, properties, immunocytochemical localization and
function. Insect Biochem Mol Biol 35:883–901
Delaporte M, Soudant P, Moal J, Giudicelli E, Lamber C, Seguineau C,
Samain JF (2006) Impact of 20:4n-6 supplementation on the fatty
acid composition and hemocyte parameters of the Pacific oyster
Crassostreas gigas. Lipids 41:567–576
Dempsey PW, Doyle SE, He JQ, Cheng G (2003) The signaling
adaptors and pathways activated by TNF superfamily. Cytokine
Growth Factor Rev 14:193–209
Desmazes C, Galineau L, Gauthier F, Bromme D, Lalmanach G
(2003) Kininogen-derived peptides for investigating the putative
vasoactive properties of human cathepsins K and L. Eur J
Biochem 270:171–178
Devries ME, Kelvin AA, Xu L, Ran L, Robinson J, Kelvin DJ (2006)
Defining the origins and evolution of the chemokine/chemokine
receptor system. J Immunol 176:401–415
Donald KM, Day AJ, Smerdon GR, Cross LJ, Hawkins AJS (2003)
Quantification of gene transcription and enzyme activity for
functionally important proteolytic enzymes during early develop-
ment in the Pacific oyster Crassostrea gigas. Comp Biochem
Physiol Part B Biochem Mol Biol 136:383–392
Droin NM, Pinkoski MJ, Dejardin E, Green DR (2003) Egr family
members regulate nonlymphoid expression of Fas ligand,
TRAIL, and tumor necrosis factor during immune responses.
Mol Cell Biol 23:7638–7647
Dumitriu IE, Baruah P, Manfredi AA, Bianchi ME, Rovere-Querini P
(2005) HMGB1: guiding immunity from within. Trends Immunol
26:381–387
Durr E, Yu J, Krasinska KM, Carver LA, Yates III JR, Testa JE,
Oh P, Schnitzer JE (2004) Direct proteomic mapping of the lung
microvascular endothelial cell surface in vivo and in cell culture.
Nat Biotechnol 22:985–992
Ensor CM, Tai HH (1995) 15-Hydroxyprostaglandin dehydrogenase.
J Lipid Mediators Cell Signal 12:313–319
Fisher WS (1986) Structure and functions of oyster hemocytes. In:
Brehelin M (ed) Immunity in invertebrates. Springer, Berlin
Ford SE, Tripp MR (1996) Disease and defense mechanisms. In:
Kennedy VS, Newell RIE, Eble AF (eds) The eastern oyster,
Crassostrea virginica. Maryland Sea Grant College, College
Park, MD
Fu H, Subramanian RR, Masters SC (2000) 14-3-3 proteins: structure,
function, and regulation. Annu Rev Pharmacol Toxicol 40:617–
647
Gadelhak GG, Pedibhotla VK, Stanley-Samuelson DW (1995)
Eicosanoid biosynthesis by hemocytes from the tobacco horn-
worm, Manduca sexta. Insect Biochem and Mol Biol 25:
743–749
Ge G, Fernandez CA, Moses MA, Greenspan DS (2007) Bone
morphogenetic protein 1 processes prolactin to a 17-kDa
antiangiogenic factor. Proc Natl Acad Sci U S A 104:10010–
10015
Gestal C, Costa M, Figueras A, Novoa B (2007) Analysis of
differentially expressed genes in response to bacterial stimulation
in hemocytes of the carpet-shell clam Ruditapes decussatus:
identification of new antimicrobial peptides. Gene 406:134–143
Gilmore TD (1999) The Rel/NF-kappaB signal transduction pathway:
introduction. Oncogene 18:6842–6844
Goetz FW, Iliev DB, Mccauley LA, Liarte CQ, Tort LB, Planas JV,
Mackenzie S (2004a) Analysis of genes isolated from
lipopolysaccharide-stimulated rainbow trout (Oncorhynchus
mykiss) macrophages. Mol Immunol 41:1199–1210
Goetz FW, Planas JV, Mackenzie S (2004b) Tumor necrosis factors.
Dev Comp Immunol 28:487–497
Gonzalez M, Romestand B, Fievet J, Huvet A, Lebart MC, Gueguen Y,
Bachère E (2005) Evidence in oyster of a plasma extracellular
superoxide dismutase which binds LPS. Biochem Biophys Res
Commun 338:1089–1097
Gueguen Y, Cadoret J-P, Flament D, Barreau-Roumiguiere C, Girardot
A-L, Garnier J, Hoareau A, Bachere E, Escoubas J-M (2003)
Immune gene discovery by expressed sequence tags generated
from hemocytes of the bacteria-challenged oyster, Crassostrea
gigas. Gene 303:139–145
Han J, Jiang Y, Li Z, Kravchenko VV, Ulevitch RJ (1997) Activation
of the transcription factor MEF2C by the MAP kinase p38 in
inflammation. Nature 386:296–299
Hashim S, Mukherjee K, Raje M, Basu SK, Mukhopadhyay A (2000)
Live salmonella modulate expression of rab proteins to persist in
a specialized compartment and escape transport to lysosomes.
J Biol Chem 275:16281–16288
Hibino T, Loza-Coll M, Messier C, Majeske AJ, Cohen AH,
Terwilliger DP, Buckley KM, Brockton V, Nair SV, Berney K,
Fugmann SD, Anderson MK, Pancer Z, Cameron RA, Smith LC,
Rast JP (2006) The immune gene repertoire encoded in the
purple sea urchin genome. Dev Biol 300:349–365
Hu G, Tang J, Zhang B, Lin Y, Hanai J-I, Galloway J, Bedell V,
Bahary N, Han Z, Ramchandran R, Thisse B, Thisse C, Zon LI,
Sukhatme VP (2006) A novel endothelial-specific heat shock
protein HspA12B is required in both zebrafish development and
endothelial functions in vitro. J Cell Sci 119:4117–4126
Huang X, Madan A (1999) CAP3: a DNA sequence assembly
program. Genome Res 9:868–877
Huang X, Tsuji N, Miyoshi T, Nakamura-Tsuruta S, Hirabayashi J,
Fujisaki K (2007) Molecular characterization and oligosaccharide-
binding properties of a galectin from the argasid tick Ornithodoros
moubata. Glycobiology 17:313–323
Huising MO, Kruiswijk CP, Flik G (2006) Phylogeny and evolution of
class-I helical cytokines. J Endocrinol 189:1–25
Huovila AP, Turner AJ, Pelto-Huikko M, Karkkainen I, Ortiz RM
(2005) Shedding light on ADAM metalloproteinases. Trends
Biochem Sci 30:413–422
Huvet A, Herpin A, Dégremont L, Labreuche Y, Samain JF, Cunningham
C (2004) The identification of genes from the oyster Crassostrea
gigas that are differentially expressed in progeny exhibiting
opposed susceptibility to summer mortality. Gene 343:211–220
Ikegami R, Sugimoto Y, Segi E, Katsuyama M, Karahashi H, Amano F,
Maruyama T, Yamane H, Tsuchiya S, Ichikawa A (2001) The
expression of prostaglandin E receptors EP2 and EP4 and their
different regulation by lipopolysaccharide in C3H/HeN peritoneal
macrophages. J Immunol 166:4689–4696
Iliev DB, Liarte CQ, MacKenzie S, Goetz FW (2005) Activation of
rainbow trout (Oncorhynchus mykiss) mononuclear phagocytes
by different pathogen associated molecular pattern (PAMP)
bearing agents. Mol Immunol 42:1215–1223
Iliev DB, Goetz GW, MacKenzie S, Planas JV, Goetz FW (2006)
Pathogen-associated gene expression profiles in rainbow trout
macrophages. Comp Biochem Physiol D-Genomics & Proteo-
mics 1:416-422
Jenny MJ, Ringwood AH, Lacy ER, Lewitus AJ, Kempton JW, Gross PS,
Warr GW, Chapman RW (2002) Potential indicators of stress
response identified by expressed sequence tag analysis of hemocytes
and embryos from the American oyster, Crassostrea virginica. Mar
Biotechnol 4:81–93
Jiang N, Tan NS, Ho B, Ding JL (2007) Respiratory protein-generated
reactive oxygen species as an antimicrobial strategy. Nat
Immunol 8(10):1114–1122
Jones GE (2000) Cellular signaling in macrophage migration and
chemotaxis. J Leukoc Biol 68:593–602

Kang YS, Kim YM, Park KI, Kim Cho S, Choi KS, Cho M (2006)
Analysis of EST and lectin expressions in hemocytes of Manila
clams (Ruditapes philippinarum) (Bivalvia: Mollusca) infected
with Perkinsus olseni. Dev Comp Immunol 30:1119–1131
Karlstrom RO, Wilder LP, Bastiani MJ (1993) Lachesin: an
immunoglobulin superfamily protein whose expression correlates
with neurogenesis in grasshopper embryos. Development 118:
509–522
Kenjo A, Takahashi M, Matsushita M, Endo Y, Nakata M, Mizuochi T,
Fujita T (2001) Cloning and characterization of novel ficolins from
the solitary ascidian, Halocynthia roretzi. J Biol Chem 276:
19959–19965
Kuhn H, O’Donnell VB (2006) Inflammation and immune regulation
by 12/15-lipoxygenases. Prog Lipid Res 45:334–356
Lamprou I, Mamali I, Dallas K, Fertakis V, Lampropoulou M,
Marmaras VJ (2007) Distinct signalling pathways promote
phagocytosis of bacteria, latex beads and lipopolysaccharide in
medfly haemocytes. Immunology 121:314–327
Legarda-Addison D, Ting AT (2007) Negative regulation of TCR
signaling by NF-{kappa}B2/p100. J Immunol 178:7767–7778
Lelong C, Badariotti F, Le Quere H, Rodet F, Dubos MP, Favrel P
(2007) Cg-TGF-beta, a TGF-beta/activin homologue in the
Pacific Oyster Crassostrea gigas, is involved in immunity against
Gram-negative microbial infection. Dev Comp Immunol 31:30–
38
Liu L, Warner AH (2006) Further characterization of the cathepsin L-
associated protein and its gene in two species of the brine shrimp,
Artemia. Comp Biochem Physiol Part A Mol Integr Physiol
145:458–467
Mackenzie S, Planas JV, Goetz FW (2003) LPS-stimulated expression
of a tumor necrosis factor-alpha mRNA in primary trout
monocytes and in vitro differentiated macrophages. Dev Comp
Immunol 27:393–400
Mah SA, Moy GW, Swanson WJ, Vacquier VD (2004) A perforin-like
protein from a marine mollusk. Biochem Biophys Res Commun
316:468–475
Manaka J, Kuraishi T, Shiratsuchi A, Nakai Y, Higashida H, Henson P,
Nakanishi Y (2004) Draper-mediated and phosphatidylserine-
independent phagocytosis of apoptotic cells by Drosophila
hemocytes/macrophages. J Biol Chem 279:48466–48476
Matsumoto T, Nakamura AM, Mori K, Kayano T (2003) Molecular
characterization of a cDNA encoding putative vitellogenin from
the Pacific oyster Crassostrea gigas. Zoolog Sci 20:37–42
Matsumoto T, Nakamura AM, Mori K, Akiyama I, Hirose H,
Takahashi Y (2007) Oyster estrogen receptor: cDNA cloning
and immunolocalization. Gen Comp Endocrinol 151(2):195–201
Matsushita M, Endo Y, Taira S, Sato Y, Fujita T, Ichikawa N, Nakata M,
Mizuochi T (1996) A novel human serum lectin with collagen- and
fibrinogen-like domains that functions as an opsonin. J Biol Chem
271:2448–2454
Matsuzawa S, Takayama S, Froesch BA, Zapata JM, Reed JC (1998)
p53-inducible human homologue of Drosophila seven in absentia
(Siah) inhibits cell growth: suppression by BAG-1. EMBO J
17:2736–2747
Mcclain JS, Oris JT, Burton GAJ, Lattier D (2003) Laboratory and
field validation of multiple molecular biomarkers of contaminant
exposure in rainbow trout (Oncorhynchus mykiss). Environ
Toxicol Chem 22:361–370
Minami M, Shimizu K, Okamoto Y, Folco E, Ilasaca ML, Feinberg
MW, Aikawa M, Libby P (2008) Prostaglandin E Receptor Type
4-associated protein interacts directly with NF-[kappa]B1 and
attenuates macrophage activation. J Biol Chem 283:9692–9703
Mistry AC, Honda S, Hirose S (2001) Structure, properties and
enhanced expression of galactose-binding C-type lectins in
mucous cells of gills from freshwater Japanese eels (Anguilla
japonica). Biochem J 360:107–115
Mar Biotechnol
Mizuta T, Kubokawa K (2007) Presence of sex steroids and cytochrome
P450 genes in Amphioxus. Endocrinology 148:3554–3565
Montagnani C, Le Roux F, Berthe F, Escoubas J-M (2001) Cg-TIMP,
an inducible tissue inhibitor of metalloproteinase from the Pacific
oyster Crassostrea gigas with a potential role in wound healing
and defense mechanisms. FEBS Lett 500:64–70
Moseley TA, Haudenschild DR, Rose L, Reddi AH (2003) Interleukin-
17 family and IL-17 receptors. Cytokine Growth Factor Rev
14:155–174
Nakagawa T, Roth W, Wong P, Nelson A, Farr A, Deussing J,
Villadangos JA, Ploegh H, Peters C, Rudensky AY (1998)
Cathepsin L: critical role in Ii degradation and CD4 T cell
selection in the thymus. Science 280:450–453
Nakazono E, Kamata Y, Yamafuji K (2002) Determination of the
mRNA sequence of cathepsin Y, a cysteine endopeptidase from
rat spleen, 1 and confirmation of its ubiquitous expression. Biol
Chem 383:1971–1975
Owen CA, Campbell EJ (1999) The cell biology of leukocyte-
mediated proteolysis. J Leukoc Biol 65:137–150
Pallavicini A, Costa Mdel M, Gestal C, Dreos R, Figueras A, Venier P,
Novoa B (2008) High sequence variability of myticin transcripts
in hemocytes of immune-stimulated mussels suggests ancient
host-pathogen interactions. Dev Comp Immunol 32:213–226
Pulido R, Van Huijsduijnen RH (2008) Protein tyrosine phosphatases:
dual-specificity phosphatases in health and disease. FEBS J
275:848–866
Quilang J, Wang S, Li P, Abernathy J, Peatman E, Wang Y, Wang L,
Shi Y, Wallace R, Guo X, Liu Z (2007) Generation and analysis
of ESTs from the eastern oyster, Crassostrea virginica Gmelin
and identification of microsatellite and SNP markers. BMC
Genomics 8:157
Raftos D, Nair S (2004) Tunicate cytokine-like molecules and their
involvement in host defense responses. Prog Mol Subcell Biol
34:165–182
Roberts S, Gueguen Y, De Lorgeril J, Goetz F (2008) Rapid
accumulation of an interleukin 17 homolog transcript in
Crassostrea gigas hemocytes following bacterial exposure. Dev
Comp Immunol 32:1099–104
Robertson AJ, Croce J, Carbonneau S, Voronina E, Miranda E,
Mcclay DR, Coffman JA (2006) The genomic underpinnings of
apoptosis in Strongylocentrotus purpuratus. Dev Biol 300:321–
334
Saavedra C, Bachere E (2006) Bivalve genomics. Aquaculture 256:1–
14
Saha SK, Cheng G (2006) TRAF3: a new regulator of type I
interferons. Cell Cycles 5:804–807
Sakamoto E, Sakao Y, Taniguchi Y, Yamafuju K (1999) Cathepsin Y
(a novel thiol enzyme) produces kinin potentiating peptide from
the component protein of rat plasma. Immunopharmacology
45:207–214
Scotti PD, Dearing SC, Greenwood DR, Newcomb RD (2001) Pernin: a
novel, self-aggregating haemolymph protein from the New
Zealand green-lipped mussel, Perna canaliculus (Bivalvia: Myti-
lidae). Comp Biochem Physiol Part B: Biochem and Mol Biol
128:767–779
Serrels B, Serrels A, Brunton VG, Holt M, Mclean GW, Gray CH,
Jones GE, Frame MC (2007) Focal adhesion kinase controls
actin assembly via a FERM-mediated interaction with the Arp2/3
complex. Nat Cell Biol 9:1046–1056
Shibayama H, Takai E, Matsumura I, Kouno M, Morii E, Kitamura Y,
Takeda J, Kanakura Y (2004) Identification of a cytokine-
induced antiapoptotic molecule anamorsin essential for definitive
hematopoiesis. J Exp Med 199:581–592
Shiomi K, Fujiwara Y, Atsumi T, Kajiura Z, Nakagaki M, Tanaka Y,
Mizoguchi A, Yaginuma T, Yamashita O (2005) Myocyte
enhancer factor 2 (MEF2) is a key modulator of the expression
Mar Biotechnol
of the prothoracicotropic hormone gene in the silkworm, Bombyx
mori. FEBS J 272:3853–3862
Song HY, Dunbar JD, Zhang YX, Guo D, Donner DB (1995)
Identification of a protein with homology to hsp90 that binds the
type 1 tumor necrosis factor receptor. J Biol Chem 270:3574–3581
Sorrell TC, Rochester CP, Breen FN, Muller M (1989) Eicosanoids
produced during interactions between Pseudomonas aeruginosa
and alveolar macrophages are specie-dependent. Immunol Cell
Biol 67:169–176
Spilsbury K, O’Mara MA, Wu WM, Rowe PB, Symonds G,
Takayama Y (1995) Isolation of a novel macrophage-specific
gene by differential cDNA analysis. Blood 85:1620–1629
Stanley D (2006) Prostaglandins and other eicosanoids in insects:
biological significance. Annu Rev Entomol 51:25–44
Steagall RJ, Rusinol AE, Truong QA, Han Z (2006) HSPA12B Is
Predominantly Expressed in Endothelial Cells and Required for
Angiogenesis. Arterioscler Thromb Vasc Biol 26:2012–2018
Takayama K, Sukhova GK, Chin MT, Libby P (2006) A novel
prostaglandin E receptor 4-associated protein participates in
antiinflammatory signaling. Circ Res 98:499–504
Tanguy A, Guo X, Ford SE (2004) Discovery of genes expressed in
response to Perkinsus marinus challenge in Eastern (Crassostrea
virginica) and Pacific (C. gigas) oysters. Gene 338:121–131
Tanguy A, Bierne N, Saavedra C, Pina B, Bachere E, Kube M, Bazin
E, Bonhomme F, Boudry P, Boulo V, Boutet I, Cancela L, Dossat
C, Favrel P, Huvet A, Jarque S, Jollivet D, Klages S, Lapegue S,
Leite R, Moal J, Moraga D, Reinhardt R, Samain JF, Zouros E,
Canario A (2008) Increasing genomic information in bivalves
through new EST collections in four species: development of
new genetic markers for environmental studies and genome
evolution. Gene 408:27–36
Tasumi S, Vasta GR (2007) A galectin of unique domain organization
from hemocytes of the Easter oyster (Crassostrea virginica) is a
receptor for the protistan parasite Perkinsus marinus. J Immunol
179:3086–3089
Temnykh S, Declerck G, Lukashova A, Lipovich L, Cartinhour S,
Mccouch S (2001) Computational and experimental analysis of
microsatellites in rice (Oryza sativa L.): frequency, length
variation, transposon associations, and genetic marker potential.
Genome Res 11:1441–1452
Torfs P, Nieto J, Veelaert D, Boon D, Van De Water G, Waelkens E,
Derua R, Calderon J, De Loof A, Schoofs L (1999) The kinin
peptide family in invertebrates. Ann NY Acad Sci 897:361–373
Turk D, Janjić V, Stern I, Podobnik M, Lamba D, Dahl SW, Lauritzen
C, Pedersen J, Turk V, Turk B (2001) Structure of human
dipeptidyl peptidase I (cathepsin C): exclusion domain added to
an endopeptidase framework creates the machine for activation of
granular serine proteases. The EMBO journal 20:6570–6582
Uinuk-Ool T, Mayer WE, Sato A, Dongak R, Cooper MD, Klein J
(2002) Lamprey lymphocyte-like cells express homologs of
genes involved in immunologically relevant activities of mam-
malian lymphocytes. Proc Natl Acad Sci USA 99:14356–14361
Venier P, De Pitt C, Pallavicini A, Marsano F, Varotto L, Romualdi C,
Dondero F, Viarengo A, Lanfranchi G (2006) Development of
mussel mRNA profiling: can gene expression trends reveal
coastal water pollution? Mutat Res Fundam Mol Mech Mutagen
602:121–134
Wang D, Li Y, Shen B (2002) A novel erythroid differentiation related
gene EDRF1 upregulating globin gene expression in HEL cells.
Chin Med J (Engl) 115:1701–1705
Wang G-D, Zhang K-F, Zhang Z-P, Zou Z-H, Jia X-W, Wang S-H, Lin P,
Wang Y-L (2008) Molecular cloning and responsive expression of
macrophage expressed gene from small abalone Haliotis diversi-
color supertexta. Fish Shellfish Immunol 24:346–359
Ware CF (2003) The TNF superfamily. Cytokine Growth Factor Rev
14:181–184
Welch MD, Depace AH, Verma S, Iwamatsu A, Mitchison TJ (1997a)
The human Arp2/3 complex is composed of evolutionarily
conserved subunits and is localized to cellular regions of
dynamic actin filament assembly. J Cell Biol 138:375–384
Welch MD, Iwamatsu A, Mitchison TJ (1997b) Actin polymerization
is induced by Arp 2/3 protein complex at the surface of Listeria
monocytogenes. Nature 385:265–269
Weston CR, Davis RJ (2002) The JNK signal transduction pathway.
Curr Opin Genet Dev 12:14–21
Xiong X, Chen L, Li Y, Xie L, Zhang R (2006) Pf-ALMP, a novel
astacin-like metalloproteinase with cysteine arrays, is abundant in
hemocytes of pearl oyster Pinctada fucata. Biochim Biophys
Acta N Gene Struct Expr 1759:526–534
Yoshino TP, Cheng TC (1976) Experimentally induced elevation of
aminopeptidase activity in hemolymph cells of the American
oyster, Crassostrea virginica. J Invertebr Pathol 27:367–370
Yoshino TP, Dinguirard N, Kunert J, Hokke CH (2008) Molecular and
functional characterization of a tandem-repeat galectin from the
freshwater snail Biomphalaria glabrata, intermediate host of the
human blood fluke Schistosoma mansoni. Gene 411:46–58
Zhai J, Lin H, Nie Z, Wu J, Canete-Soler R, Schlaepfer WW,
Schlaepfer DD (2003) Direct interaction of focal adhesion kinase
with p190RhoGEF. J Biol Chem 278:24865–24873
Zhang HM, Cheung P, Yanagawa B, Mcmanus BM, Yang DC (2003)
BNips: a group of pro-apoptotic proteins in the Bcl-2 family.
Apoptosis 8:229–236
Zhao S, Fernald RD (2005) Comprehensive algorithm for quantita-
tive real-time polymerase chain reaction. J Comput Biol 12:
1045–1062
Zhou Q, Zhao J, Stout JG, Luhm RA, Wiedmer T, Sims PJ (1997)
Molecular cloning of human plasma membrane phospholipid
scramblase. a protein mediating transbilayer movement of
plasma membrane phospholipids. J Biol Chem 272:18240–
18244
Zhou Q, Zhao J, Wiedmer T, Sims PJ (2002) Normal hemostasis but
defective hematopoietic response to growth factors in mice
deficient in phospholipid scramblase 1. Blood 99:4030–4038
Zhou Z, Yang H, Xu X, Wang X, Lai R (2006) The first report of
kininogen from invertebrates. Biochem Biophys Res Commun 347:
1099–1102
Zhu L, Song L, Chang Y, Xu W, Wu L (2006) Molecular cloning,
characterization and expression of a novel serine proteinase
inhibitor gene in bay scallops (Argopecten irradians, Lamarck
1819). Fish Shellfish Immunol 20:320–331