Cloning

Cloning is a way to isolate and produce large quantities of specific genes without the need to cultivate the original organisms. In cloning, the desired gene is transferred to another organism which is easy to cultivate (usually Escherichia coli). Therefore, cloning can be used to study organisms which are difficult to cultivate or who's growth requirements are unknown. The ideal characteristics of a host are rapid growth, capable of growing in an inexpensive culture medium, not harmful or pathogenic, capable of taking up DNA, and stable in culture. The most useful hosts for cloning are microorganisms that grow well and about which a lot of genetic information is available, such as bacteria Escherichia coli and Bacillus subtilis and the yeast Saccharomyces cerevisiae. The basic strategy of cloning is to move the desired gene from a large, complex genome to a small, simple one. Various cloning strategies (Figure 1), some of which utilise polymerase chain reaction (PCR), have been used to allow the analysis of the nucleic acid fragments retrieved directly from the environment. In so called shotgun cloning, community DNA is fragmented with restriction enzymes, the fragments are cloned, and the resulting clones are screened for the presence of rRNA genes. This is a laborious procedure, as rRNA genes will only be in a small fraction of the total clones. However this approach probably provides the most unbiased estimate of community diversity.

Figure 1. Strategies and steps in cloning. The simplest way to obtain phylotypes from the environmental samples is to clone PCR-amplified rRNA gene fragments. The resulting 'snapshot' of community diversity will depend upon the specificity of the PCR primers and the efficiency with which the rRNA genes are amplified. Taking the advantage of the highly conserved nature of rRNA, 'universal' primers capable of annealing to rRNA genes from all three phylogenetic domains (Bacteria, Archaea and Eucarya) have been designed. Specific phylogenetic groups of interest in a total community also can be characterized or detected using group-specific primers for rRNA. Although the PCR approach provides a convenient and rapid alternative to shotgun cloning, selective amplification of rRNA genes may skew diversity estimates. A third alternative for obtaining rRNA gene clones is to clone complementary DNA obtained by reverse transcription (with or without PCR amplification). The resulting community profile will offer some reflection of the most metabolically active organisms, because cells that produce more RNA (i.e. those that are metabolically more active) will be represented to a greater extent than metabolically inactive cells.

Gene cloning can be divided into several steps:

1. 2.

Isolation and fragmentation/amplification of the nucleic acids. Joining the DNA fragments to a cloning vector with DNA ligase. Cloning vectors are small independently replicating genetic elements, such as plasmids or virus genome, used to replicate genes.

3.

Incorporation of the recombinant DNA into a host organism by DNA transformation or by infection with bacteriophage particles. Incorporation of the host usually yields a mixture of cells (clones), called a DNA library, a gene library or a clone library.

4.

Detection and purification of the clones that have the genes of interest. This can be done e.g. by diluting and inoculating the cells onto a selective and differentiating growth media. Also colony hybridization with sequence specific probes can be used to detect the desired clones.

5.

Production of large amounts of cells or bacteriophage containing the desired clone for isolation and study of the cloned DNA.

Biases in cloning-based microbial community analysis may arise from different cloning efficiencies and from variations in the gene copy number in different microorganisms.

Journal of Undergraduate Research Volume 2, Issue 6 - April 2001

Construction and Evaluation of Escherichia coli Strains Expressing Yeast Ketone Reductases for Utility in Organic Synthesis
Catherine Charron

ABSTRACT
Baker's Yeast (Saccharomyces cerevisiae) is a known source of enzymes capable of reducing organic compounds such as alpha- and beta-keto esters, and ketones. By using recombinant DNA techniques, it is possible to clone these enzymes into expression systems in foreign hosts such as Escherichia coli. Three genes were chosen to be cloned into pET26b plasmids and transformed into E. coli BL21(DE3): FDH1, Ydr541c and Ynl274c. The engineered strains are then used as a source of catalysts to carry out whole cell biotransformations which offer an inexpensive and environmentally friendly method for organic reduction reactions

INTRODUCTION
The Genetic engineering in molecular biology has made great progress in the past 30 years. Easier and less expensive cloning methods keep developing with the advent of

technology.1 Recombinant DNA technology has been used extensively as an efficient and controlled avenue for the production of eukaryotic proteins in foreign hosts like Escherichia coli.2 E. coli is a favored vehicle for the expression of foreign proteins since it is inexpensive and provides high yields in a short amount of time.1 These yields are controlled by the chosen cloning vector which usually contains an origin of replication under the control of a specific promoter, an antibiotic resistance gene, and a polylinker site to facilitate the insertion of the foreign DNA.3 Baker's yeast (Saccharomyces cerevisiae) has been recognized as a source of enzymes capable of reducing alpha- and beta-keto esters, and ketones. Six families of carbonyl reductases re known and a number of these reductases have been characterized by several individuals.4,5 However many more similar proteins are believed to exist and complete identification of these proteins will probably be based on sequence comparison to known reductases since the complete genome of baker's yeast is now available.6,7 Three genes were chosen to be subcloned into the pET26b plasmid vector: Ydr541c, Ynl274c, and FDH1. Ydr541c is a short-chain alcohol dehydrogenase similar to GRE2; and FDH1 and Ynl274c are part of the D-hydroxyacid dehydrogenase family.7 Each gene will be under the control of the T7lac promoter.8 Lac promoters allow for high levels of gene expression and are induced by isopropyl $-Dthiogalactopyranoside (IPTG). Once activated, the lac protein drives the T7RNA polymerase gene included in the host E. coli BL21(DE3), which in turn activates the T7 promoter on the pET vector and thus allows for gene transcription and protein translation.2 The protein is over expressed in its new host which facilitates analysis and organic reactions. Chiral alcohols are useful building blocks in the synthesis of enantiomerically pure pharmaceuticals and other chemicals.9 Whole cell biotransformations offer a clean and stable source of enzymes which are capable of carrying stereoselective and regioselective reactions under environmentally friendly conditions with high enantiomerically pure yields.10 Using the engineered E. coli strains, one can quickly test the specificity of each enzyme and determine the yields and purity of the products with chiral and non-chiral gas chromatography, infrared and nuclear magnetic resonance spectra, and optical rotations. Biocatalysis is an innovative new approach with an enormous amount of possible applications10, which when combined with genetic engineering will make the possibility of enzyme and chiral compound production a more stable and specific and less expensive process.1

GENERAL OVERVIEW OF PROCEDURE

Background The construction of overexpression plasmids requires many steps in order to ascertain the conservation of the DNA sequence of interest. The polymerase chain reaction (PCR) was used in order to amplify the chosen gene from yeast genomic DNA.11 Since the DNA Taq polymerase used in the PCR reaction adds the adenosyl (A) nucleotide to the 3' end of each strand, the PCR product was cloned into a plasmid vector (pCR2.1: from Invitrogen Topo T/A Cloning Kit) which contains overhanging thymidine (T) residues.12,13 These clones were then transformed into E. coli cells and grown on LB/Amp plates. The transformants were grown, the plasmids purified, and then analyzed by restriction digestion to determine the success of the ligation. A colony containing the correct plasmid was then grown on a large scale in order to purify the plasmid in milligram concentration by a CeCl gradient centrifugation3. This plasmid was sent for sequencing to determine if any errors were introduced to the gene during amplification. When the correct sequence was obtained, the gene was cut by the restriction enzymes introduced to its ends from the PCR primers, and will be ligated into the pET26b plasmid. This ligation product will be transformed into E. coliBL21(DE3), analyzed by alkaline lysis and restriction digestion, and will then be ready for use in whole cell biotransformations.

RESULTS AND DISCUSSION

FDH1

FDH1 was amplified by PCR then subcloned into the pCR2.1 vector. After performing a mini-prep and restriction digestion from the grown transformants, it was amplified and purified by CeCl gradient centrifugation. After the sequencing results were returned, they were compared to the known gene sequence and it was determined that two mutations were introduced in the DNA sequence. Since the active site of the protein is unknown, the mutations may not affect the activity of the enzyme and thus the cloning will not be repeated. This gene has been excised from the pCR2.1 vector and will soon be ligated into pET26b.

Figure 1. Construction of FDH1 Overexpression Plasmid. Ydr541c

Ydr541c was amplified by PCR and subcloned into pCR2.1. After the chemical transformation, one of the plated colonies was selected for a large-scale preparation and CeCl plasmid purification based on the positive results of the restriction digestion of the harvested plasmids in a mini-prep. After the sequence was obtained from the ICBR Core Laboratories, there was only one non silent mutation identified in the gene sequence. The cloning will not be repeated since the change in amino acid may not affect the enzyme activity. Ydr541c was also cut from the pCR2.1 plasmid and is now ready to be purified and ligated into pET26b.

Figure 2. Construction of Ydr541c Overexpression Plasmid.

Ynl274c

The sequence results of this gene reported a change in a codon to a stop signal at base pair 286. Thus the T/A cloning reaction with the original PCR product was repeated and the colonies obtained were grown and prepared by alkaline lysis to retrieve the plasmid. After restriction digestion, the results showed no sign of the desired gene. The best way to fix this problem will be to start the PCR amplification over again and repeat the cloning steps in order to hopefully acquire the correct sequence from a new large scale purification.

Figure 3. Construction of Yn1274c Overexpression Plasmid.

CONCLUSION AND FUTURE WORK

During the sequencing stage of the cloning, many setbacks were experienced. The sequencing results came back blank or incomplete many times for each gene. This was quite unusual, since the reaction is known to work very well and the reason for this anomaly is still unknown. Strict control of every step is thus necessary for successful quick cloning experiments. The errors found in the sequences of the plasmids are normal since the error rate of Taq polymerase is about 1 in every 4 base

pairs. Although a perfect sequence would be much more desirable, the cloning of the FDH1 and Ydr541c will continue as planed. Once the pET26b plasmid preparation will be completed, it will be cut and purified along with the two genes. The ligation reactions and transformations into E. coliBL21(DE3) should be accomplished very soon. The strains will then be ready for SDS-PAGE protein analysis and whole cell biotransformations.

EXPERIMENTAL
Polymerase Chain Reaction (PCR)

All reactions were carried at the following concentrations: 15C Yeast genomic DNA template 30ng, 1X Invitrogen PCR buffer, 10mM dNTPs, 200ng of each primer (ordered from Gemini), 2.5mM Mg (MgCl2), 1 unit of Taq Polymerase for a total volume of 100uL (fill with water if necessary). The PCR amplifications were performed on a Perkin-Elmer Geneamp PCR System 2400. The temperature settings were: 2 minutes at 94C for a hot start11; 25 cycles of 1 minute at 94C, 1 minute at 55C and 1 minute at 72C; 7 minutes at 72C for final annealing, and refrigeration at 4C. Table 1 Primers used for PCR Type FDH1 Ydr541c Yn1274 c Forward (3') CATATGTCGAAGGGAAAGGTTTTG Nde I Reverse (5') AAGCTTATTTCTTVTGTCCATAAGCTCTGG Hind III

CATATGTCTAATACAGTTCTAGTTTCTGGCG GAATTCATAATCTGTTCTCCTTCTTCAA Nde I Eco RI CATATGAGTAAGAAACCAATTGTTTTGA Nde I GAATTCAAACTAATGGCTTAGATTCATTGGG Eco RI Cloning/Transformation/Analysis of Transformants

The TOPO TA cloning kit provided by Invitrogen was used to clone the PCR products into the pCR2.1 TOPO plasmid vector. The procedure for cloning and transformation of the ligation product into the provided TOP10 E. coli cells were followed exactly.

The analysis of the transformants (mini-prep) was done by a small-scale preparation of plasmid DNA by lysis in alkali solution. The method was adapted from the protocol found in Sambrook (1989).14 Solutions I, II, and III were prepared as indicated. The entire cultures were centrifuged for harvesting of the cells. After the phenol: chloroform extraction, the water phases were ethanol precipitated (2.5V EtOH, 0.025V 4M NaCl) and iced for 30 minutes. The DNA was recovered by centrifugation, vacuum dried and resuspended in 45uL TE pH8.0 and 5uL RNAse A (20ug/mL). An appropriate amount of these solutions were then digested by restriction enzymes and visualized by gel electrophoresis.

Storing Transformants LB/Amp plates: per liter of LB solution add 15g Agar. Autoclave and add 4mL of 50mg/mL ampicillin when cooled down. Pour into sterile plates

Restriction Enzymes Obtained from New England Biolabs at 20,000 U/mL.

Agarose Gel Electrophoresis All gels were 0.8% agarose (Molecular Biology Certified) by volume. They were run at 86 volts for one hour on a BioRad Power Pac 300 in 0.5X TBE solution.

Large Scale Plasmid Preparation and Purification A 500mL culture of the cells was grown in LB overnight at 37C. The preparation of the plasmid DNA was done according to Protocol 6 in Sutton (1998)3, which is an alkaline lysis method. The purification of this DNA was done in a cesium chloride density gradient (protocol 8 in Sutton, 1998)3, and retrieved by dialysis. The ultracentrifuge used was a Beckman Ultracentrifuge Model L5-65 (75T rotor).

Sequencing All sequencing reactions were prepared according to the required parameters provided by the ICBR Core Laboratories at the University of Florida.

REFERENCES
1. Seo, J.-H.; et al. In Enzymes for Carbohydrate engineering, Park, K. H., Robyt, J .F., Choi, Y. D., Eds. Elsevier Science B.V.: Amsterdam, 1996; 12, p 201214. 2. Shin, C. S.; Hong, M.S.; Bae, C. S.; Lee, J. Biotechnology Progress. 1997, 13, 249-257. 3. Sutton, J. M. In Essential Techniques: Vectors Cloning Applications, Jones, P., Ed. John Wiley & Sons: Chichester, 1998; p 332. 4. Ishihara, K.; Kondo, S.; Nakamura, K.; Nakajima, N. Biosc. Biotech. Bioch. 1996, 60 (9), 1538-1539. 5. Rodriguez, S.; Schroeder, K.T.; Kayser, M.M.; Stewart, J.D. Journal of Organic Chemistry. 2000, 65, 2586-2587. 6. Sybesma, W. F. H.; et al. In Biocatalysis and Biotransformation, Leak, D., Ed. Harwood

academic publishers: Amsterdam, 1998. 7. Stewart, J.D.; Rodriguez, S.; Kayser, M. M. In Enzyme Technologies for Pharmaceutical and Biotechnological Applications, Zmijewski, M. H., Kirst, H. A., Yeh, W.-K., Eds. Marcel Dekker: New York, in press. 8. Sutton, J. M.; Richardson, D. R. In Essential Techniques: Vectors Expression Systems, Jones, P., Ed. John Wiley & Sons: Chichester, 1998; p 3-20. 9. Shimizu, S.; Kataoka, M.; Kita, K. Journal of Molecular Catalysis B: Enzymatic. 1998, 5, 321-325. 10. Patel, R. N., Ed. Stereoselective Biocatalysis. Marcel Dekker: New York, 2000. 11. Kolmodin, L. A.; Williams, J. F. In Methods in Molecular Biology: PCR Cloning Protocols: From Molecular Cloning to Genetic Engineering, White, B. A., Ed. Humana Press: New Jersey, 1997; 67, p 316. 12. Jones, P. In Essential Techniques: Vectors Cloning Applications, Jones, P. Ed. John Wiley & Sons: Chichester, 1998; p 106-118. 13. Ken, G.-F.; Shaw, J.-F.; Wu, J.-L.; Lin, C.T. Journal of Agricultural and Food Chemistry. 1998, 46, 2863-2867. 14. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning, a laboratory manual, 2nd Ed. Cold Spring Harbor Laboratory Press: 1989

Chapter 8 A. Recombinant DNA Technology Electrophoretic Analysis of DNA **Practice Plasmid.exe -- It will be on the Quiz** Cloning genes PCR Gene sequence analysis Complementarity and Hybridization Northern, Southern, and Western blots DNA Microarrays

KAP Biology Dept Kenyon College

Transgenics

What is gene technology?

All gene manipulation is based on microbial genetics--ways of doing in the test tube what bacteria and viruses do naturally. Several of this week's gene manipulations are exemplified by the article on overexpressed angiopoietin in a transgenic mouse.

Gel Electrophoresis Images and text based on MIT Hypertextbook

This technique separates molecules on the basis of their size.

Cast slab of gel material, usually agarose or polyacrylamide. The gel is a matrix of polymers forming sub-microscopic pores. The size of the pores can be controlled by varying the chemical composition of the gel.

The gel is set up for electrophoresis in a tank holding pH buffer. Electrodes apply an electric field:

MIT hypertextbook

The molecules to separate (DNA RNA) carry a net negative charge (why?) so they move along the electric field toward the positive cathode. (To separate proteins, a detergent would be included which coats the protein with negative charge.)

The larger molecules are held up as they try to pass through the pores of the gel, while the smaller molecules are impeded less and move faster. This results in separation by size, with the larger molecules nearer the well and the smaller molecules farther away.

Note that this separates on the basis of size (volume in solution), which is not necessarily molecular weight. For example:

Two DNA molecules of the same molecular weight will run differently if one is supercoiled, because the supercoils constrain the shape to be smaller. Two RNA molecules of the same molecular weight will run differently if one has much intramolecular base pairing, making it "smaller."

Aside from the above exceptions, the distance migrated is roughly proportional to the log of the inverse of the

molecular weight (the log of 1/MW). Gels are normally depicted as running vertically, with the wells at the top and the direction of migration downwards. This leaves the large molecules at the top and the smaller molecules at the bottom. Molecular weights are measured with different units for DNA, RNA, and protein:

DNA: Molecular weight is measured in base-pairs, or bp, and commonly in kilobase-pairs (1000bp), or kbp. RNA: Molecular weight is measured in nucleotides, or nt, and commonly in kilonucleotides (1000nt), or knt. [Sometimes, bases, or b and kb are used.] Protein: Molecular weight is measured in Daltons (grams per mole), or Da, and commonly in kiloDaltons (1000Da), or kDa.

Molecular weight standards run in one well of the gel are used to calibrate the molecular weights of sample molecules. Below is a gel stained with a dye: a colored molecule which binds to a specific class of macromolecules in a sequence-independent manner (probes bind in a sequence-dependent manner).

Sample 1 contains only one size class of macromolecule - it could be a plasmid, a pure mRNA transcript, or a purified protein. In this case, you would not have to use a probe to detect the molecule of interest since there is only one type of molecule present. Blotting is usually necessary for samples that are not complex mixtures. By interpolation, its molecular weight is roughly 3.

Sample 2 is what a sample of total DNA cut with a restriction enzyme, total cellular RNA, or total cellular protein would look like in a gel stained with a sequence-independent stain. There are so many bands that it is impossible to find the one we are interested in. Without a probe (which acts like a sequence-dependent stain) we cannot get very much information from a sample like this.

MIT hypertextbook

Different stains are used for different classes of macromolecules. DNA and RNA are generally stained with ethidium bromide (EtBr), an intercalating agent. The DNA-EtBr complex fluoresces under UV light. Protein is stained with Coomassie Blue or Silver Stain.

Cloning genes

In nature, DNA molecules recombine for various functions -- even DNA between different species. But twenty years ago, despite the work of Barbara McClintock and others, the extent of this recombination was not appreciated. DNA

was still thought to be the "master molecule," not to be violated by "unnatural" manipulation. When scientists began to manipulate DNA in the test tube, many scientists feared that disastrous monsters would result, with unspecified dangers to people. In 1977 scientists at the Asilomar Conference proposed sweeping regulation on socalled "recombinant DNA," technologies which recombine DNA from different species in the test tube.

Since then, the dangers have appeared to be little more than those of "natural" genetic mixing. But we remain concerned about issues such as:

Engineering food crops to resist pesticides. The pesticide resistance genes can escape into natural populations of weeds. Engineering a human symbiont microbe, such as E. coli, to produce a deadly toxin such as botulin. In theory this could be done, although it's not clear where such an organism would live, or how well it could "compete" with natural flora. Societal dilemmas of human cloning. How far shall we use reproductive technology to shape future humans?

Techniques of Recombinant DNA

How do we manipulate these natural processes for biotechnology; for instance, to make a bacterium that produces arge quantities of insulin?

One approach would be to cut the appropriate gene from human DNA and paste, or splice, it into a vector such as a plasmid or phage DNA. Our "scissors" are the class of enzymes called restriction endonucleases

Restriction Endonucleases

An "endonuclease" is an enzyme that cuts duplex DNA in the middle, not at an end (for exonuclease). Different species of bacteria have evolved different restriction endonucleases, each to cut foreign DNA that gets into their cells by mistake. To be cut, the DNA has to lack their own pattern of protective methylation. There are well over a hundred restriction enzymes, each cutting in a very precise way a specific base sequence of the DNA molecule.

A restriction endonuclease cuts DNA only at a specific site, usually containing 4-6 base pairs. The enzyme has to cut the DNA backbone twice, recognizing the same type of site; therefore, the site "reads" the same way backwards as forwards--a palindrome.

This "sticky ends" from two different DNA molecules can hybridize together; then the nicks are sealed using ligase. (Where does ligase come from? What is its natural function?) The result is recombinant DNA. When this recombinant vector is inserted into E. coli, the cell will be able to process the instructions to assemble the amino acids for insulin production. More importantly, the new instructions are passed along to the next generation of E. coli cells in the process known as gene cloning.

Restriction site Analysis

How can we use restriction sites to analyze the plasmid products of ligation, and tell whether we in fact have ligated the correct molecule: Problem: Suggest several "incorrect" ways the plasmid could recombine.

More Problems:

Use the PLASMID Program. You MUST practice restriction analysis with this program; it will be on the quiz and/or the test.

How do we get the recombinant molecule into a bacterial cell? Usually by transformation (for a plasmid) or by in vitro packaging into a phage head coat (for a phage vector such as lambda phage).

The above is a highly simplified description of recombinant DNA technology. How would we actually locate the appropriately cloned gene? There are many different ways, depending on the specific case. Here is one example, in which a partial sequence of the protein enables us to reverse the code and determine an approximate DNA sequence to use for a radiolabeled probe. The DNA probe will hybridize to clones containing the correct DNA, even if it is just one piece cut out of an entire genome.

Top