Journal of Biotechnology 121 (2006) 201212

Establishment of a real-time PCR protocol for expression studies of secondary metabolite biosynthetic gene clusters in the G/C-rich myxobacterium Sorangium cellulosum So ce56
Carsten Kegler a , Klaus Gerth b , Rolf M ller a, u
a b

Pharmaceutical Biotechnology, Saarland University, P.O. Box 151150, D-66041 Saarbr cken, Germany u Gesellschaft f r Biotechnologische Forschung mbH, Mascheroder Weg 1, 38124 Braunschweig, Germany u Received 1 July 2005; received in revised form 22 September 2005; accepted 10 October 2005

Abstract In the attempt to establish a reliable real-time PCR protocol for transcriptional analysis of secondary metabolism in Sorangium cellulosum strain So ce56, a RNA extraction method and a reverse transcription protocol was developed. In order to validate chivosazol or etnangien gene cluster transcripts as good candidates to develop the real-time PCR protocol, stability measurements of the transcripts were performed proving both transcripts to be very stable. The chivosazol biosynthetic gene cluster was taken as the test case to evaluate the special problems arising from the large size of the transcripts and the high G/C-content of the encoding DNA. A set of primer pairs targeting the presumed 90 kbp chivosazol transcript at different positions was employed. The production rate of chivosazol was compared to the transcription of the operon in time course experiments revealing that during the logarithmic growth phase transcription is maximally induced and levels out during the stationary phase. Some deviations in transcript numbers could be measured depending on the primer pair used, but cross-evaluation strengthened the notion that the measured numbers reect the whole transcript quantities and the in vivo level. Finally, a putative promoter located between chiA and chiB was examined by using the developed real-time PCR protocol. 2005 Elsevier B.V. All rights reserved.
Keywords: Sorangium cellulosum; Real-time PCR; Secondary metabolism; Chivosazol; Etnangien

1. Introduction
Abbreviations: kbp, kilobasepairs; RT, reverse transcription; So ce56, Sorangium cellulosum So ce56 Corresponding author. Tel.: +49 681 302 5474; fax: +49 681 302 5473. E-mail address: rom@mx.uni-saarland.de (R. M ller). u 0168-1656/$ see front matter 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2005.10.007

The genetic potential of myxobacteria to produce numerous secondary metabolites with various biological activities is well established (Gaitatzis et al., 2002; Gerth et al., 2003; Reichenbach and H e, 1993; o

202

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

Sandmann et al., 2004; Weinig et al., 2003; Wenzel and M ller, 2005). Interestingly, the myxobacterial model u organism to study development, Myxococcus xanthus (Cystobacterineae), has been shown to harbour numerous biosynthetic gene clusters although the rst secondary metabolite isolated from this strain still awaits its description (Bode and M ller, 2005). In a detailed u screening approach combining genetics and classical screening for novel metabolites we have recently isolated at least four different secondary metabolites from this strain (Meiser, P., Krug, D., Bode, H., M ller, R., u unpublished). On the other hand, Sorangium cellulosum So ce56 (So ce56), a member of the myxobacterial suborder Sorangineae, was chosen in a functional genome project for its property as a known proliferate producer of biologically active compounds (Gerth et al., 2003; Pradella et al., 2002). In addition to the biosynthetic gene clusters belonging to the compounds known from So ce56 (chivosazol (Perlova et al., 2005), etnangien (Pradella et al., 2002) and myxochelin (Gaitatzis et al., 2005)), the corresponding genome sequence is expected to reveal further biosynthetic gene clusters responsible for the formation of bioactive compounds. To our knowledge, very little is known about gene regulation in the genus Sorangium. The overwhelming part of transcriptional research in myxobacteria has been conducted with M. xanthus, the model organism for prokaryotic development (Kaiser, 2003; Kaiser, 2004). The analysis of the genome of M. xanthus (TIGR webpage, unpublished) as well as the work by Jakobsen et al. (2004) and Jelsbak et al. (2005) emphasise the indispensable role of 54 -factors in the regulation of genes and describe other unique features of prokaryotic transcriptional regulation in M. xanthus. To date very little is known about regulatory aspects of secondary metabolism in myxobacteria, which contrasts with the amount of published work related to the best-studied secondary metabolite producers found in actinomycetes (Bibb, 2005). The transcriptional activation pattern of secondary metabolite gene clusters in Streptomyces species generally coincides with, or slightly precedes, the development of aerial hyphae in surface grown cultures (Bibb, 2005). This transcriptional regulation pattern is interpreted to be linked to a reduction in growth rate (Bibb, 2005; Challis and Hopwood, 2003). In contrast to this, it was suspected as early as 1993 that myxobacterial

compounds are synthesised during any phases of growth (Reichenbach and H e, 1993) as has indeed o been demonstrated (Gerth et al., 1982; Kunze et al., 1984). For a number of reasons, new secondary metabolites have not been identied from So ce56 yet, although numerous gene clusters are assumed to be present in its genome (Gerth et al., 2003). The insight into the transcriptional regulation of those biosynthetic gene clusters could be of great benet. Information about elevated transcript levels could lead the way to isolate the respective compounds in a more target-orientated way. It is a general problem in the eld of secondary metabolite research that routine work at the protein level is not possible due to the immense size of the enzymes involved (polyketide synthases and nonribosomal peptide synthetases) which easily exceed 200 kDa in size. Northern blots as a reliable method to detect and semi-quantify RNA levels can hardly be adopted in the case of secondary metabolite biosynthetic gene clusters. This method is not the most suitable experimental approach for accurately quantifying RNA especially when very low concentrations are expected. Moreover, the sheer size of the transcripts of operons from secondary metabolism, which often exceeds 50 kbp, renders the RNA impossible to use for Northern blotting. Therefore, real-time PCR is the method of choice when exact quantication is sought, in conjunction with high sensitivity (Bustin, 2000; Bustin, 2002; Mackay, 2004). Transcript size problems are not encountered with this method. The use of real-time PCR has increased over the last couple of years as a fast and precise method of quantifying nucleic acids in nearly every area of biological research connected to all organism kingdoms (Brazeau, 2004; Bubner and Baldwin, 2004; Bustin and Nolan, 2004; Kurrasch et al., 2004; Mackay et al., 2002). Nevertheless, the combined features of a large transcript size and a high G/C-content found in So ce56 secondary metabolism genes demand an adjustment to the plethora of protocols published elsewhere. Chivosazol (Gerth and M ller, 2005; Perlova et al., u 2005) and etnangien (Pradella et al., 2002) are two bioactive compounds produced by So ce56. Deduced from in silico analysis of the So ce56 genome the etnangien biosynthetic gene cluster prediction was validated through inactivation experiments (Perlova and

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

203

M ller, unpublished). Both compounds are synthesised u in sufcient quantities to track production rates; the biosynthetic gene cluster sequence was revealed as part of the ongoing genome project (see accompanying papers). Therefore, these two biosynthetic gene clusters were ideal targets to develop a real-time PCR protocol, which might be applied to all other genes of interest in the future. Real-time PCR is a reliable method of quantifying transcripts. But, in order to achieve results which reect the in vivo state, a careful execution of the appropriate methodical steps is necessary (Bustin, 2000; Bustin and Nolan, 2004). Due to the size of the chivosazol and/or etnangien biosynthetic gene clusters, and the G/C-content of more than 70%, specic problems are imposed on the method. Nothing is known about the degradation of the huge transcripts and it is far from clear that data from a measured primer pair located somewhere within the cluster-transcript actually will reect the overall transcriptional state. Moreover, the RNA polymerase is totally processive (Landick, 2001), which means that once the process of transcription is aborted the RNA polymerase complex is not going to restart the elongation. For this reason, real-time PCR measurements based on the start of the biosynthetic gene cluster might result in measuring higher transcript levels than those targeting the 3 -region of the transcript. For the reasons mentioned above, the aim of this work was to develop a robust, cost-efcient and reliable real-time PCR method for So ce56 secondary metabolite biosynthetic gene clusters and to evaluate the changes of transcription occurring during growth within the chivosazol or etnangien biosynthetic genes by real-time PCR. 2. Material and methods 2.1. Strain, cultivation media and HPLC-analysis Strain: S. cellulosum So ce56 was isolated from a soil sample from Cipajung, Indonesia in 1985 (Pradella et al., 2002). The wild strain was adapted to growth in medium M with increased concentrations of glycine. After plating, a So ce56 variant was isolated in 2002 and used routinely for the experiments described in this paper (Gerth and M ller, 2005). u

Culture conditions: If not stated otherwise, the inoculated asks were incubated at 30 C on a rotary shaker in 250 ml Erlenmeyer asks containing 100 ml medium. This work was conducted exclusively using synthetic media as fully dened conditions could only be met in this way (see Gerth and M ller, 2005). u Media: The composition of all media is given in gram per litre in distilled water. The pH was adjusted to 7.2 and 2% of XAD 16 adsorber resin (Rohm and Haas, Frankfurt/M) was added routinely. Synthetic mineral medium S: l-Aspargine (Merck, Darmstadt) 5; CaCl2 2H2 O (Merck) 0.5; MgSO4 7H2 O (Merck) 0.5; K2 HPO4 (Merck) 0.06; ethylendiamine tetraacetic acid, iron(III)sodium salt (SigmaAldrich, Inc.) 0.008; HEPES (Carl Roth, Karlsruhe) 12. Medium SGz: Mineral medium S with glucose (Merck) 10 and zinc ions, ZnCl2 (Merck) 1 103 . Medium SMa: Mineral medium S with d-(+)-mannose (AppliChem, Darmstadt) 10. Fermentation: The fermentation was performed in a 15 l bioreactor with a working volume of 10 l. The reactor was inoculated with 1 l of preculture. A pO2 (dissolved oxygen concentration) of 40% was maintained by regulating the stirrer velocity. Samples of about 150 ml were taken at the time points given in Fig. 3. Growth was followed by measuring the optical density at 623 nm. Chivosazol was analysed after elution from the adsorber resin. The eluate was concentrated to dryness and dissolved in methanol. HPLC analysis was conducted as described (Gerth and M ller, 2005). u 2.2. RNA extraction and reverse transcription (RT) Whole cell RNA was extracted by the TRIzol (Invitrogen)/DNAzol (Qiagen) method. Deviations from the standard protocol according to the manufacturers recommendations were found to be necessary. Cell samples (minimum: 1 108 cells and maximum: 2 109 cells) were pelleted in a table top centrifuge at room temperature (12,000 g, 2 min), the supernatant was discharged and the cells were frozen in liquid nitrogen and stored at 80 C. Addition of 750 l of TRIzol/DNAzol (preheated to 50 C) was followed by an incubation step at 50 C carried out on a rotary shaker at 1050 rpm for 8 min. Addition of 150 l

204

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

chloroform and vigorous shaking for 1 min were followed by centrifugation at 4 C at 11,000 g for 12 min. Four hundred microlitres of the aqueous phase was taken to mix with 200 l isopropanol and 200 l high salt solution (1.2 M NaCl and 0.8 M sodium citrate). The RNA was pelleted (4 C, 12,000 g, 10 min), washed with 75% ethanol and resuspended in diethyl-pyrocarbonate (DEPC) treated water. RNA quality was analysed by formaldehydedenatured agarose gel electrophoresis. DNase I digestion of all RNA samples was executed as follows: 2 g RNA was digested with 2 U of DNase I (SigmaAldrich) for 15 min at 25 C using the supplied buffer. Following the DNase I digest, 1 l of 50 mM EDTA was added and heat inactivation was performed for 10 min at 65 C. The lack of DNA traces in the RNA sample was checked by using 0.4 l of the DNase I digest as template in a PCR reaction, in comparison to a positive control PCR. For a reverse transcription reaction in a nal volume of 20 l, 6 l of the above mentioned digest (0.6 g of RNA), 150 ng of random hexamers (Invitrogen) and 1 l of a dNTP mixture (10 mM each dNTPs, pH 7.0) was heated in a volume of 12 l for 5 min to 65 C in a PCR machine (Eppendorf, epgradient S and gradient), before the reaction was chilled to 4 C. One microlitre 0.1 M DTT, 4 l 5 rst strand buffer, 2 l of H2 O and 1 l SuperScriptTM III (Invitrogen) was added (nal volume 20 l). The PCR cycler was programmed as follows: 5 min at 25 C, then 50 min at 52 C and nally 15 min at 75 C. Each RT reaction was adjusted to a nal volume of 60 l by adding 40 l TE buffer. 2.3. SYBR Green I real-time PCR All real-time PCR measurements were run on a Rotor-Gene 3000 machine (Corbett Research, Australia) and data analysis was conducted with the RotorGene software 6.0.23 in the dynamic tube normalisation mode. Real-time PCR efciency: in the case of 100% efciency during the PCR reaction, there will be a doubling of the amount of DNA at each cycle corresponding to 1.0 (or 100%). Ninety percent efciency equals 0.9 and corresponds to a successful amplication of 90% of the template. As a normalising signal for real-time PCR measurements, 16S RNA representing a housekeeping gene

was used (Tolic-Norrelykke et al., 2004; Yarwood et al., 2002). For the corresponding measurement, part of the above mentioned 60 l RT reaction was further diluted (1000 times in TE), from which 1 l was used for every single real-time PCR run. This dilution proved absolutely necessary for precise normalisation. Each standard curve was made in, at least, duplicates, using 10-fold serial dilutions of puried plasmids over four orders of magnitude. The Ct -values (Ginzinger, 2002) of the standard curve and the specic signals were always chosen to be located within the same range. In cases of very little transcript being measured, the observed values were below those of the highest dilution of the standard curve. The slope for the standard curves was calculated for all generated data. For every single run each raw copy number per reaction was normalised against the 16S signals. The mean relative value of the 16S copy number was calculated for each growth kinetic experiment, and each single 16S copy number was divided by the mean value. The resulting relative number was then taken to divide the raw copy number of each run, which led to the ltered or nal results shown in the graphs and tables. The BrilliantTM SYBR Green QPCR Core Reagent Kit (Stratagene) was employed, unless stated otherwise, for real-time PCR as follows: 1.5 mM MgCl2 , 3% DMSO, 8% glycerol, 1 supplied buffer, SYBR Green I diluted 1:4 104 , 1 l of the diluted RT reaction (described above), 200 M dNTPs (each), 0.5 U SureStart Taq (Stratagene) or HotStartTaq (Qiagen) plus oligonucleotides in the concentration determined as ideal (see below) in an 12.5 l reaction volume. The melting curves of the gained real-time PCR data were analysed for each run to omit false results. Cycling was performed as follows: 10 min denaturation at 95 C for SureStart Taq and 15 min for HotStartTaq ; 15 s annealing at the given temperatures; 20 s extension at 72 C. Each primer pair was tested before being used in a real-time measurement for ideal molar concentration of forward and reverse primers to each other. The test parameters were dened as the inuence of the primer concentration on the reaction efciency given that by-products did not occur. Used primers are listed in Table 1.

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212 Table 1 List of primers Primer name 16s2 For 16s2 Rev chivo156 For chivo156 Rev ko 2 For ko 2 Rev 3797 For 3797 Rev polyA502 For polyA502 Rev polyA1602 For polyA1602 Rev mtahom For mtahom Rev TE372 For TE372 Rev TE378 2 For TE378 2 Rev TE423 For TE423 Rev TE475 For TE475 Rev TE483 For TE483 Rev 3797 8945 For 3797 8945 Rev 8945 For 8945 Rev Primer sequence 5 3 TGGACGGTGACTGACGCTGAGA CATCGTTTACGGCGTGGACTACC GGAGACCCGATCGAGGTGGA GCGTGCCCGATGTTGGTCTTC GAGCTGGAGGCCCGGATCTA GGTCAGCGCGTTCACCTCGAT GGAAGAGTTCGCCGCCTACA GCTCGTGATCTGCTCGGTGA AGGTCTCGGCGCTGCTCTAC CATCGGCTCGAGGAGCAAGAG CGCTCTCCGCCAAGGATCTC GTGTTCGCCTCGGGCTCTTC CGCGCACCTCTGGTACGTCTT GCAGGTACTCGTGCCGGTTCT CGCGCAGCTCTTGAACGTAC GCGCCGAGCTGTCCATCTAC GCCCTATCGACGCCATTGAC CACGTCCTCCAGCGACACAT CCCTGCTCGCGAAGGATCTG GGTGATCGCCGGGAAGAATC GGGTGGTCGAGGGACGAAAT GGACGTCCGATGCGTTGTAG TTGCTGCTGCTGCTGGACAC CACGAAGCCGCGGTATCTCT ACCCGTACGCAGCCATGAAC GCCGTCCATCACGACCTTTC CTCGACTCGGTCGGCGCTAT GCTCTCGAGCGTGGGATACG Concentration ( M) 0.6 0.6 0.2 0.2 0.6 0.8 0.8 0.8 0.2 0.6 0.6 0.6 0.8 0.4 0.8 0.8 0.8 0.8 0.2 0.8 0.2 0.8 0.8 0.8 0.8 0.8 0.4 0.1

205

Optimal annealing temperature ( C) 63 63 63 63 63 63 60 60 63 63 63 63 63 63 60 60 60 60 60 60 60 60 60 60 60 60 63 63

2.4. Half-life time determination of transcripts by real-time PCR So ce56 cells were grown to an OD600 of 1.0 in SGz media at 30 C. The cell concentration was raised to 2.5 prior to the experiment by centrifugation and resuspension in a smaller volume of medium. The RNA decay experiment was started by adding rifamycin SC (Sigma, Taufkirchen), dissolved in methanol, to a concentration of 500 g/ml. RNA samples were then collected after 2, 4, 6, 9, 14, 21 and 30 min intervals. One-third of each sample was immediately mixed with two-thirds of RNAprotectTM (Qiagen) and processed further according to manufacturers guidelines. The regression of the RNA decay data was calculated by using linear ts to a semi-logarithmic plot (Bernstein et al., 2004).

3. Results 3.1. RNA extraction and RT In a rst step in developing a real-time PCR protocol for So ce56, the problem of a reliable RNA isolation method arose due to strong polysaccharide production. Therefore, column based purication methods could not be employed. Thus, a phenol/guandiniumthiocyanate method was chosen which reliably produced RNA in acceptable quality and quantity. Nevertheless, the TRIzol /DNAzol method had to be modied to gain enough RNA when working in 2 ml reaction tube sample size. As described in Section 2, a heating step was introduced which enhanced the net RNA yield, and it deemed necessary to precipitate the RNA with a high salt solution to discriminate against polysaccharides. For the reverse transcription

206

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

Table 2 Real-time PCR efciency on G/C-rich templates Primer pair chivo156 ko 2 16s2 TE378 2 TE423 TE483 3797 3797 8945 Amplicon length (bp) 104 117 82 125 156 123 130 116 G/C-contenta 0.73 0.72 0.54 0.60 0.75 0.72 0.71 0.83 Efciencyb 0.74 0.88 n.d. n.d. n.d. n.d. n.d. n.d. Efciencyc 0.87 (0.01) 1.00 (0.038) 0.98 (0.01) 0.95d (0.012) 0.60e 1.00 (0.042) 0.95 (0.042) <0.62d,e

The optimal reaction conditions for the BrilliantTM SYBR Green QPCR Core Reagent Kit were determined in relation to the G/C-content of the template and the length of the DNA fragment amplied. The average efciency of at least two runs is shown. Given in bold are cases of very low PCR efciency. The standard deviation is shown in brackets. n.d.: not determined. a Region between primers. b SYBR Green I nal concentration 1:20,000. c SYBR Green I nal concentration 1:40,000. d Two runs out of three were performed with QuantiTM Tect SYBR Green PCR Kit (data not shown). e Based on one real-time measurement.

reaction, SuperScriptTM III (Invitrogen) was chosen as it allowed the reaction to be carried out at high temperatures in order to forestall problems arising from strong secondary structures of the high-G/C RNA. In the preparatory work for the real-time PCR, the optimal SYBR Green I concentration for the G/Crich template was determined. As shown in Table 2, two SYBR Green I concentrations were tested for two primer pairs. For primer pair chivo156 and ko 2, the supplier recommended SYBR Green I dilution of 1:20,000 resulted in lower efciencies than the higher dilution of 1:40,000, which was therefore used for all other real-time PCR runs. For a number of primer pairs, the efciency of the PCR was then correlated to the length of the amplicon in conjunction with its G/C-content. Two primer pairs failed to produce reaction efciencies above 0.75 (Table 2). In the case of TE423, the G/C-content in connection with the relatively large amplicon of 156 bp resulted in one successful run with a poor PCR efciency, while other runs failed completely. Although no absolute rule can be inferred, it seems advisable to omit a G/C-content of any amplicon of more than 0.74, when possible, particularly in conjunction with amplicons larger than 150 bp. The reverse transcription protocol (see Section 2) was tested for its robustness depending on the reaction tube size (0.2 and 0.5 ml) and for PCR machines with different ramping capabilities. No signicant differences could be recorded (data not shown).

3.2. Transcript stability In general, the half-life times of prokaryotic transcripts are regarded as very short (Carpousis, 2002). Moreover, mRNA levels can rapidly shift as a result of small changes during the handling and processing of samples, so that the measured transcription prole can deviate considerably from the in vivo expression pattern. Thus, a transcript with a long half-life time was sought after as an ideal target for working out the real-time PCR protocol. In this way, external factors inuencing the transcript level are kept to a minimum. Therefore, the transcript stability of the etnangien and the chivosazol biosynthetic gene clusters were examined. Transcription initiation can be stopped by the addition of the antibiotic rifamycin SV, an inhibitor of the DNA dependent RNA polymerase (Campbell et al., 2001; Knight et al., 2005). As transcription is stopped, the half-life time and the mRNA stability can be determined by rst collecting samples at different time points during the experiment and by then measuring the level of the target RNA by real-time PCR. Results of transcript stability measurements are shown in Fig. 1. The randomly chosen transcripts of polyA502, polyA1602 (genes encoding polyA polymerase/CCA-adding enzyme from So ce56) and mtahom (a phosphopantetheinyl transferase encoded in the So ce56 genome) are degraded to very small numbers within 1520 min (t1/2 approximately

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

207

the end or even to the middle of the transcript will not detect sudden changes in transcriptional activity due to the time lag. The chivosazol biosynthetic gene cluster was targeted in further experiments because the secondary metabolite is more abundant than etnangien, making it easier to correlate transcript levels to production levels. Fluctuations caused by sample withdrawal up to the point of sample freezing or RNA extraction should not be problematic with this mRNA. 3.3. Development of a reliable real-time PCR method for the detection of chivosazol transcripts To gain insight into the actual size of the chivosazol transcript and its copy numbers, three primer pairs for real-time PCR were designed (see Fig. 2a). No experimental data was available about the size of the chi transcript(s) but in situ analysis suggested that chiB to chiF consist as one transcript which, most likely, also includes chiA. Nevertheless, a 79 bp gap is found between the coding region of chiA and chiB which could accommodate a promoter region responsible for the transcription of chiB to chiF alone. The size of the assumed transcript and the distances between the primer pair targets are shown in Fig. 2a. The production of chivosazol was monitored by a kinetic growth experiment of So ce56 in a bioreactor using the synthetic medium SGz (Gerth and M ller, 2005). Production of u chivosazol (see Fig. 3a) is rst detectable after more than 100 h and the compound accumulates for further 200 h before the degradation rate is higher than the production. The transcript pattern compared to the chivosazol production is shown in Fig. 3b. At the end of the logarithmic growth phase, the transcript level increases strongly to drop back to a lower level after 220 h in the early stationary phase. The calculated transcript numbers derived from the three primer pairs shown in Fig. 3b point to similar transcript numbers for most of the time of the experiment. To further study observed deviations of transcript numbers within the 140220 h time frame, further growth kinetic experiments were conducted with all three primer pairs starting from independent biological samples which were grown in shake asks. Besides SGz, the medium SMa (Gerth and M ller, 2005) with u mannose as carbon source was used. As seen in Fig. 4a, all three primer pairs resulted in transcript numbers which are mostly in accordance with each other, even

Fig. 1. Semi-logarithmic plot of RNA decay from So ce56 grown at 30 C in SGz medium after addition of rifamycin SV. The mRNA transcript level was determined as described in Section 2. For every single measured transcript: (a) polyA502 [] and chivosazol (primer TE475 [ ]) and (b) polyA1602 [ ], mtahom [ ] and etnangien (primer TE378 2 [ ]) the regression coefcient was calculated (lines, see Section 2).

12 min). The large transcripts involved in secondary metabolism (corresponding to the chivosazol and etnangien biosynthetic genes) are signicantly more stable (half-life time of approximately 30 min). Thus, both secondary metabolite transcripts could be identied as good candidates for this study. Nevertheless, this experiment can only track RNA degradation. Should the expression level change dramatically as a result of sample withdrawal, only real-time PCR targets close to the promoter region would be affected. This is because initiated transcription in the case of chivosazol would presumably take the RNA polymerase at least 15 min to synthesise the whole transcript (Mooney et al., 1998; King et al., 1996; Skinner et al., 2004). Therefore, primers binding to

208

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

Fig. 2. Schematic representation of the chivosazol biosynthetic gene cluster. (a) chiAchiF indicate the six genes (open arrows) of the core biosynthetic gene cluster (which do not include modifying enzymes). Above the genes the overall size of the gene cluster is indicated. Arrows pointing downwards indicate the region of primer pair binding and the names of the primer pairs. Below the genes the distances between the used primer pairs to each other is shown. (b) The region of the rst two ORFs is enlarged and two further primer pairs are depicted which are located between primer pair 3797 and chivo156. P1 and P2 in (b) indicate the positions of possible promoter regions (see text).

though some differences occur. In Fig. 4a, the overall rise and fall of the chivosazol transcript is the same, regardless of the primer pair used for quantication, with TE475 located at the end of the transcript recording slightly less transcripts than the other two primer pairs. Therefore, all of the recorded signals seem to reect the actual in vivo state of this transcript, because the cross-evaluations by three primer pairs clearly support each other. In the experiment shown in Fig. 4b, the 3797 signal results in signicantly lower transcript numbers within the rst 100 h. As shown in Fig. 2b, independent regulation of chiA and chiBchiF by different promoters seems possible due to a second putative promoter in addition to promoter P1 which is located right in front of chiA. This might be an explanation for the 15-fold difference of the recorded signals (Fig. 4b within the rst 100 h). To test if a second promoter can indeed explain these different transcriptional rates shown in Fig. 4b, a new set of realtime PCR primers were devised (Fig. 2b). 3797 8945 bridges the putative second promoter region, while 8945 is located at the start of chiB. If a second promoter plays a role in this system, it would be expected that transcript numbers of 8945 equal the real-time

PCR targets located downstream. If there is no second promoter and the different transcript levels could be a consequence of differential degradation of the mRNA, a close correlation between the primer pairs 3797 8945 and 8945 is likely since they are in close proximity. As can be seen in Table 3 the three primer pairs targeting the 3 -end of the gene cluster result in similar transcript numbers at time point 72 h while the two primer pairs chivo156 and TE475, which are located further downstream, also result in similar transcript numbers at 72 h. The transcript numbers measured by these two groups of primer pairs differ signicantly from each other.
Table 3 Transcript numbers of measured chivosazol transcripts from growth kinetics in Erlenmeyer asks with SGz medium of different primer pairs at time points 72 and 143 h Primer pair 3797 3797 8945 8945 chivo156 TE475 t = 72 h 985 1307 435 15526 18763 t = 143 h 45128 35487 32374 70026 73957

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

209

Fig. 3. Chivosazol production and chivosazol transcript numbers in a kinetic growth experiment in a bioreactor in SGz medium (see Section 2). (a) The total production of chivosazoles ( ; with axis to the left; mAU corresponds to milli-absorption units as a standard for the peak area in the HPLC chromatogram) and the growth of So ce56 ( ; with axis to the right) over time is shown. The corresponding transcript levels measured by different primer pairs targeting the chivosazol transcript of the above growth kinetic experiment can be seen in (b) (primer pairs: 3797 [ ], chivo156 [ ] and TE475 [ ]).

Fig. 4. Chivosazol transcript levels during growth kinetic experiments in Erlenmeyer asks. The OD value of So ce56 ( ) refers to the axis to the right. (a) So ce56 was grown in SMa medium and three different primer pairs were used for the chivosazol transcript number determination (primer pairs: chivo156 [ ], 3797 [ ] and TE475 [ ]; axis to the left). (b) The transcript levels of chivosazol of So ce56 grown in SGz medium (primer pairs as in (a)).

4. Discussion In the quest for biologically active substances correlated to silent biosynthetic gene clusters, the potential to trace transcriptional levels of secondary metabolic genes is a promising approach that might help identify so far undetected compounds. The aim of this work was to establish a real-time PCR method for the genus Sorangium, the most procient group of secondary metabolite producers among the myxobacteria (Gerth et al., 2003). As a model So ce56 was chosen because this strain is currently completely being sequenced (see Section 1). The reliability and applicability of real-time PCR for this G/C-rich organism in general, and for the secondary metabolite biosynthetic gene clusters in par-

ticular was to be evaluated. As well-suited test case the chivosazol biosynthetic gene cluster with an average G/C-content of 72% and a transcript length of more than 90 kbp was chosen. Real-time PCR has been carried out successfully in M. xanthus (Lu et al., 2005). Nevertheless, the used standard procedures starting from RNA extraction did fail in the strong polysaccharide producer So ce56. To our knowledge this is the rst protocol for quantitative PCR in the myxobacterial suborder Sorangineae which, moreover, addresses the methodical obstacles encountered with G/C-rich templates and large secondary metabolic transcripts. SYBR Green I has been proven to be as accurate in quantifying nucleic acids as specic probes (Bustin and Nolan, 2004; Lekanne Deprez et al., 2002; Schmittgen et al., 2000; Wilhelm and Pingoud, 2003) if the use is

210

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

exercised with the utmost care. In this paper, a series of steps were carried out to verify the data with respect to their signicance. First, each primer pair was tested for its optimal concentration and the molar ratio was optimised to prevent primer dimer build-up. Second, the melting curve analysis was performed and primer pairs were excluded which did not pass this test. Finally, in the case of chivosazol, the possibility to cross-evaluate different real-time PCR targets within an mRNA was a chance to reassess the produced data. The developed method was veried and the differences observed in transcript numbers derived from chivosazol biosynthetic gene cluster transcription should thus truly reect the in vivo state. SYBR Green I can be used without problems if the preconditions for specicity are met. It has been argued that the priming of the reversetranscription reaction by random hexamers overestimates the true transcript number (Zhang and Byrne, 1999) or is described as less effective than specic priming (Lekanne Deprez et al., 2002). Moreover, the reproducibility of this method has been called into doubt (Lekanne Deprez et al., 2002; Zhang and Byrne, 1999). At the same time other authors stress the advantages of random priming for reverse transcription (Bustin, 2000; Bustin and Nolan, 2004; Ginzinger, 2002). The data represented here support the notion that hexamer-priming is indeed a reliable priming method. It allows measuring any target in time-consuming experiments out of one RT reaction, which is inexpensive and versatile in practise. The steadiness of the growth kinetic signals indicating a lack of uctuations comparing the neighbouring transcript levels are in favour of the interpretation of a reproducible priming efciency. If absolute transcript numbers are of importance, a comparison of specic priming to random primers for the RT reaction should be conducted. Our focus was to detect relative changes, which can be executed by the presented approach in the transcriptional prole. The chivosazol biosynthetic gene cluster transcription is strongly induced during the logarithmic growth phase and varies in the stationary phase depending on the growth media and the cultivation conditions: it can decrease signicantly in the stationary phase (Fig. 3b), the transcript levels can be reduced (Fig. 4) and in one case high transcription levels were regained in the late stationary phase (Fig. 4b). Thus the induction of the chivosazol transcript during the logarithmic growth

phase could be observed in all experiments. In this respect the myxobacterium So ce56 differs from Streptomyces species and their typical transcriptional pattern (Bibb, 2005; Challis and Hopwood, 2003). The differences of the transcriptional pattern during the stationary phase, is interpreted as a result of different growth conditions and different growth media analysed. The comparison of production rates of chivosazol to the transcript abundance of the corresponding biosynthetic gene cluster demonstrates that the real-time PCR analysis provides the required complementing information. In the endeavour to dene growth conditions in which the production of a biologically active compound is turned on, the transcriptional information describes the activity of a gene cluster far more point specic than the production of the metabolite, which is a cumulativeover-time result (if degradation is not the main factor). An online detection of secondary metabolite formation is often not feasible due to detection limits. Additionally, compounds might be degraded if no absorber resin is added to the growth medium (Gerth et al., 2003). From the data shown in Fig. 3, it would have been impossible to deduce the time-frame of transcriptional activity, and hence, the probable point in time of translational synthesis of the chivosazol biosynthetic proteins. On top of the different information given by real-time PCR in comparison to data from metabolite production, the transcript measurement is planned to be used for gene clusters for which a compound has not been identied yet. The large size of the secondary metabolite biosynthetic gene clusters is the motive for employing a whole set of primer pairs for the real-time PCR rather than just one. Apart from means to cross-evaluate the produced data, it seemed advisable to work with more than one target in case of such a large biosynthetic gene cluster. Experimental proof of one transcriptional unit did not exist and the analysis regarding the transcript itself was derived from in situ studies only. All the presented data from three independent kinetic growth studies point towards the presence of one transcriptional unit encoding ChiAF. The measured transcript copies that are based on the different primer pairs targeting ve positions within the transcript result in similar numbers. The half-life times of the two biosynthetic gene cluster transcripts for chivosazol and etnangien can be described as very stable for prokaryotes (Bernstein et al., 2004; Romeo and Zusman, 1992). The size of the

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212

211

transcript leads to a presumed time of at least 15 min that is necessary to synthesise the 90 kbp transcript (Mooney et al., 1998; King et al., 1996; Skinner et al., 2004). Taken the metabolic cost to synthesise such large transcripts, high turn-over rates and thus, short half-life times would be energetically expensive for the cell. It will be of general interest to identify the elements required for the stabilisation of the mRNA at the 3 - and 5 -ends, which can possibly be used to stabilise other mRNAs of interest. In cases of calculated transcript number deviations (see Fig. 4b and Table 3) existence of a second promoter, which might be located between chiA and chiB, and its possible role could not be substantiated. In situ analysis of the alleged chiA promoter region shows similarities to the 70 family of promoters (Perlova et al., 2005). No promoter elements could be identied by similarity searches based on the 79 bp located between chiA and chiB. Nevertheless, promoter predictions in Sorangium lack accuracy of forecast. To clarify the reason for the observed deviations in transcript numbers in the described cases was of pivotal importance for the method itself. If a second promoter would drive the transcription from chiB onwards, a correlation between the results of the primer pairs 3797 and chivo156 would have been the result. Differential mRNA degradation can be seen as an explanation for the deduced differences in transcript copy numbers based on the measurement of primer pairs binding to the 5 -end of the gene cluster (primer pairs 8945, 8945 3797 and 3797) in comparison to the primer pairs binding further downstream (chivo156 and TE475). Differential stability of an operon transcript, which in turn accounts for the manifold higher expression of a single protein encoded by this operon, has been experimentally proven (Newbury et al., 1987; Regnier and Arraiano, 2000). The example of a 5 -truncated RNA has already been described for the polycistronic transcript of the f1-phage (Goodrich and Steege, 1999; Kokoska et al., 1990). The f1-transcript is processed differentially, as the half-life time of the 5 -end is much shorter than that of the 3 -end. All our data point towards one large transcript being driven by a promoter upstream of chiA. The approach taken to probe for a possible second promoter also demonstrates the overall versatility of the method. Moreover, the cross-evaluation, by using different real-time PCR targets/primer pairs binding

within an mRNA, conrms the notion of a robust and reliable real-time PCR protocol.

References
Bernstein, J.A., Lin, P.-H., Cohen, S.N., Lin-Chao, S., 2004. Global analysis of Escherichia coli RNA degradosome function using DNA microarrays. PNAS 101, 27582763. Bibb, M.J., 2005. Regulation of secondary metabolism in streptomycetes. Curr. Opin. Microbiol. 8, 208215. Bode, H.B., M ller, R., 2005. The impact of bacterial genomics u on natural product research. Angew. Chem. Int. Ed. 44, 6828 6846. Brazeau, D.A., 2004. Combining genome-wide and targeted gene expression proling in drug discovery: microarrays and real-time PCR. Drug Discov. Today 9, 838845. Bubner, B., Baldwin, I.T., 2004. Use of real-time PCR for determining copy number and zygosity in transgenic plants. Plant Cell Rep. 23, 263271. Bustin, S.A., 2000. Absolute quantication of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169193. Bustin, S.A., 2002. Quantication of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29, 2339. Bustin, S.A., Nolan, T., 2004. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J. Biomol. Technol. 15, 155166. Campbell, E.A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A., Darst, S.A., 2001. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 104, 901912. Carpousis, A.J., 2002. The Escherichia coli RNA degradosome: structure, function and relationship in other ribonucleolytic multienzyme complexes. Biochem. Soc. Trans. 30, 150155. Challis, G.L., Hopwood, D.A., 2003. Synergy and contingency as driving forces for the evolution of multiple secondary metabolite production by Streptomyces species. PNAS 100, 1455514561. Gaitatzis, N., Kunze, B., M ller, R., 2005. Novel insights into u siderophore formation in myxobacteria. ChemBioChem 6, 365374. Gaitatzis, N., Silakowski, B., Kunze, B., Nordsiek, G., Bl cker, H., o H e, G., M ller, R., 2002. The biosynthesis of the aromatic o u myxobacterial electron transport inhibitor stigmatellin is directed by a novel type of modular polyketide synthase. J. Biol. Chem. 277, 1308213090. Gerth, K., M ller, R., 2005. Development of simple media u which allow investigations into the global regulation of chivosazol biosynthesis with Sorangium cellulosum So ce56, doi:10.1016/j.jbiotec.2005.10.012. Gerth, K., Pradella, S., Perlova, O., Beyer, S., M ller, R., 2003. u Myxobacteria: procient producers of novel natural products with various biological activitiespast and future biotechnological aspects with the focus on the genus Sorangium. J. Biotechnol. 106, 233253.

212

C. Kegler et al. / Journal of Biotechnology 121 (2006) 201212 Mooney, R.A., Artsimovitch, I., Landick, R., 1998. Information processing by RNA polymerase: recognition of regulatory signals during RNA chain elongation. J. Bacteriol. 98, 32653275. Newbury, S.F., Smith, N.H., Higgins, C.F., 1987. Differential mRNA stability controls relative gene expression within a polycistronic operon. Cell 51, 11311143. Perlova, O., Gerth, K., Kaiser, O., Hans, A., M ller, R., 2005. Identiu cation and Analysis of the Chivosazol Biosynthetic Gene Cluster from the Myxobacterial Model Strain Sorangium cellulosum So ce56. J. Biotechnol. 121, 174191. Pradella, S., Hans, A., Sproer, C., Reichenbach, H., Gerth, K., Beyer, S., 2002. Characterisation, genome size and genetic manipulation of the myxobacterium Sorangium cellulosum So ce56. Arch. Microbiol. 178, 484492. Regnier, P., Arraiano, C.M., 2000. Degradation of mRNA in bacteria: emergence of ubiquitous features. Bioessays 22, 235244. Reichenbach, H., H e, G., 1993. Biologically active secondary o metabolites from myxobacteria. Biotechnol. Adv. 11, 219277. Romeo, J.M., Zusman, D.R., 1992. Determinants of an unusually stable mRNA in the bacterium Myxococcus xanthus. Mol. Microbiol. 6, 29752988. Sandmann, A., Sasse, F., M ller, R., 2004. Identication and analu ysis of the core biosynthetic machinery of tubulysin, a potent cytotoxin with potential anticancer activity. Chem. Biol. 11, 10711079. Schmittgen, T.D., Zakrajsek, B.A., Mills, A.G., Gorn, V., Singer, M.J., Reed, M.W., 2000. Quantitative reverse transcriptionpolymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal. Biochem. 285, 194 204. Skinner, G.M., Baumann, C.G., Quinn, D.M., Molloy, J.E., Hoggett, J.G., 2004. Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase: a single-molecule view of the transcription cycle. J. Biol. Chem. 279, 32393244. Tolic-Norrelykke, S.F., Engh, A.M., Landick, R., Gelles, J., 2004. Diversity in the rates of transcript elongation by single RNA polymerase molecules. J. Biol. Chem. 279, 32923299. Weinig, S., Hecht, H.J., Mahmud, T., M ller, R., 2003. Melithiau zol biosynthesis: further insights into myxobacterial PKS/NRPS systems and evidence for a new subclass of methyl transferases. Chem. Biol. 10, 939952. Wenzel, S.C., M ller, R., 2005. Formation of novel secondary u metabolites by bacterial multimodular assembly lines: deviations from text book biosynthetic logic. Curr. Opin. Chem. Biol. 9, 447458. Wilhelm, J., Pingoud, A., 2003. Real-time polymerase chain reaction. ChemBioChem 4, 11201128. Yarwood, J.M., McCormick, J.K., Paustian, M.L., Kapur, V., Schlievert, P.M., 2002. Repression of the Staphylococcus aureus accessory gene regulator in serum and in vivo. J. Bacteriol. 184, 10951101. Zhang, J., Byrne, C.D., 1999. Differential priming of RNA templates during cDNA synthesis markedly affects both accuracy and reproducibility of quantitative competitive reverse-transcriptase PCR. Biochem. J. 337, 231241.

Gerth, K., Trowitzsch, W., Wray, V., H e, G., Irschik, H., Reicheno bach, H., 1982. Pyrrolnitrin from Myxococcus fulvus (Myxobacterales). J. Antibiot. (Tokyo) 35, 11011103. Ginzinger, D.G., 2002. Gene quantication using real-time quantitative PCR: an emerging technology hits the mainstream. Exp. Hematol. 30, 503512. Goodrich, A.F., Steege, D.A., 1999. Roles of polyadenylation and nucleolytic cleavage in the lamentous phage mRNA processing and decay pathways in Escherichia coli. RNA 5, 972985. Jakobsen, J.S., Jelsbak, L., Welch, R.D., Cummings, C., Goldman, B., Stark, E., Slater, S., Kaiser, D., 2004. Sigma54 enhancer binding proteins and Myxococcus xanthus fruiting body development. J. Bacteriol. 186, 43614368. Jelsbak, L., Givskov, M., Kaiser, D., 2005. Enhancer-binding proteins with a forkhead-associated domain and the sigma54 regulon in Myxococcus xanthus fruiting body development. Proc. Natl. Acad. Sci. U.S.A. 102, 30103015. Kaiser, D., 2003. Coupling cell movement to multicellular development in myxobacteria. Nat. Rev. Microbiol. 1, 4554. Kaiser, D., 2004. Signaling in myxobacteria. Annu. Rev. Microbiol. 58, 7598. King, R.A., Banik-Maiti, S., Jin, D.J., Weisberg, R.A., 1996. Transcripts that increase the processivity and elongation rate of RNA polymerase. Cell 87, 893903. Knight, J.L., Mekler, V., Mukhopadhyay, J., Ebright, R.H., Levy, R.M., 2005. Distance-restrained docking of rifampicin and rifamycin SV to RNA polymerase using systematic FRET measurements: developing benchmarks of model quality and reliability. Biophys. J. 88, 925938. Kokoska, R.J., Blumer, K.J., Steege, D.A., 1990. Phage mRNA processing in Escherichia coli: search for the upstream products of endonuclease cleavage, requirement for the product of the altered mRNA stability (ams) locus. Biochimie 72, 803811. Kunze, B., Kemmer, T., H e, G., Reichenbach, H., 1984. o Stigmatellin, a new antibiotic from Stigmatella aurantiaca (Myxobacterales). I. Production, physico-chemical and biological properties. J. Antibiot. (Tokyo) 37, 454461. Kurrasch, D.M., Huang, J., Wilkie, T.M., Repa, J.J., 2004. Quantitative real-time polymerase chain reaction measurement of regulators of G-protein signaling mRNA levels in mouse tissues. Methods Enzymol. 389, 315. Landick, R., 2001. RNA polymerase clamps down. Cell 105, 567570. Lekanne Deprez, R.H., Fijnvandraat, A.C., Ruijter, J.M., Moorman, A.F., 2002. Sensitivity and accuracy of quantitative real-time polymerase chain reaction using SYBR Green I depends on cDNA synthesis conditions. Anal. Biochem. 307, 6369. Lu, A., Cho, K., Black, W.P., Duan, X.Y., Lux, R., Yang, Z., Kaplan, H.B., Zusman, D.R., Shi, W., 2005. Exopolysaccharide biosynthesis genes required for social motility in Myxococcus xanthus. Mol. Microbiol. 55, 206220. Mackay, I.M., 2004. Real-time PCR in the microbiology laboratory. Clin. Microbiol. Infect. 10, 190212. Mackay, I.M., Arden, K.E., Nitsche, A., 2002. Real-time PCR in virology. Nucleic Acids Res. 30, 12921305.