Atopic Dermatitis in Dogs

Novel insights into mechanisms of disease

Yvette Mariska Schlotter

All rights reserved. No part of this publication may be reproduced or transmitted in any form by any means without prior permission of the author. ISBN: 978-94-90122-93-5 Cover: Joost de Bree Lay-out: Frans Derksen Printed by: Gildeprint Drukkerijen, Enschede

Correspondence and reprint requests: Y.M.Schlotter Universiteit Utrecht, Faculteit Diergeneeskunde Y.M.Schlotter@uu.nl

Atopic Dermatitis in Dogs

Novel insights into mechanisms of disease

Nieuwe inzichten in werkingsmechanismen

(met een samenvatting in het Nederlands)

Atopische dermatitis bij de hond

Proefschrift
ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnicus, prof.dr. J.C. Stoof, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op woensdag 9 december 2009 des middags te 12.45 uur.

door

Yvette Mariska Schlotter

geboren op 28 maart 1971, te Amsterdam

Promotiecommissie Promotoren: Prof.dr. T. Willemse Prof.dr. C.A.F.M. Bruijnzeel-Koomen Prof.dr. V.P.M.G. Rutten Co-promotor: Dr. E.F. Knol

The studies described in this thesis were conducted at the Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands and were fully funded by Procter and Gamble Petcare, Lewisburg, Ohio, USA Publication of this thesis was made possible by the generous support of: Artu Biologicals Boehringer Ingelheim B.V. Janssen Animal Health LEO Pharma B.V. Merial B.V. Novartis Animal Health Pzer Animal Health B.V. Royal Canin TROVET Virbac Nederland B.V.

To my parents

CONTENTS
CHAPTER 1 General introduction and scope of the thesis CHAPTER 2 Polyunsaturated fatty acids and immune functions in chronic inammatory disorders CHAPTER 3 A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis CHAPTER 4 Successful alteration of dietary n-6:n-3 fatty acid ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs CHAPTER 5 Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis CHAPTER 6 Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis CHAPTER 7 Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response CHAPTER 8 General discussion CHAPTER 9 Nederlandse samenvatting voor niet-ingewijden CHAPTER 10 Dankwoord Curriculum vitae Abbreviations page 181 page 169 page 153 page 135 page 117 page 101 page 75 page 65 page 27 page 9

CHAPTER 1

General Introduction

General Introduction 9

Introduction Allergic rhinitis and allergic conjunctivitis were rst reported in dogs in the fourties and sixties [1, 2], whereas the rst paper describing clinical symptoms of canine atopic dermatitis (cAD), one of the most important canine pruritic disorders, appeared in 1971 [3]. Since that time, numerous reports have mainly focused on clinical and laboratory observations and only to a minor extend on the pathogenesis of the disease. In 2001 the American College of Veterinary Dermatology Task Force on Canine Atopic Dermatitis critically reviewed the literature about canine AD [4]. Its conclusions acted as a new starting point for further clinical as well as fundamental research regarding AD. This thesis focuses on immunological mechanisms underlying skin inammation, with special emphasis on the role of polyunsaturated fatty acids (PUFA) in the regulation of the inammatory and immune response and their potential therapeutic value. In human the knowledge regarding the possible mechanisms underlying atopic dermatitis is more detailed than in canine AD. For this reason the current view on the pathogenesis of human AD is described rst.

Pathogenesis of human AD The hallmarks of atopic dermatitis are a chronic, relapsing form of skin inammation, a disturbed epidermal barrier function that culminates in dry skin, and Immunoglobulin E (IgE) -mediated sensitization to food and environmental allergens [5, 6]. In human, AD is many times the rst step in an atopic march resulting in asthma or allergic rhinitis. The disease onset is during early infancy and childhood and occasionally persists into adulthood, with 15-30% of the children and 2-10 % of the adults affected [7]. In industrialized countries its prevalence has increased two- to threefold during the past three decades. However it remains much lower in developing countries correlated with their rural or agricultural areas. The lower prevalence in rural areas suggests a link to the hygiene hypothesis, postulating that the absence of exposure to infectious agents in early childhood increases the susceptibility to allergic diseases [8, 9]. This concept is not that clear with regard to AD though [7, 10, 11]. For the development of more effective management strategies a precise understanding of mechanisms underlying AD is critical. AD has a complex etiology with activation of multiple
Chapter 1

immunologic and inammatory pathways [12]. The clinical phenotype is the product of interactions between susceptibility genes, the environment, defective skin barrier function, and immunologic responses [13]. Two major groups of genes are implicated in the context of this disease: genes encoding major elements of the immune system, including atopy,

10

and genes encoding epidermal or other epithelial structural proteins [6]. Several candidate genes have been identied encoding cytokines involved in the regulation of IgE synthesis, interleukin-4 (IL-4), IL-5, IL-12, IL-13 [14, 15]. These cytokines are produced by T helper 1 (Th1) (IL-12) and Th2 (IL-4, IL-5, IL-13) cells. IL-4 and IL-13 stimulate IgE production by B cells, whereas IL-5 is a selective eosinophil differentiation factor. Polymorphisms in the promoter region of RANTES (regulated on activation, normal T cell expressed and secreted), in the -subunit of the IL-4 receptor and in the gene encoding IL-18 (contributes to Th1 polarization) have been identied in AD [6, 16]. A region of high linkage with AD was identied on chromosome 1q21, which harbors a family of epithelium-related genes called the epidermal differentiation complex [17]. The laggrin-gene, which encodes a key protein in epidermal differentiation, was identied to be involved in ichtyosis vulgaris, a disorder of keratinization, resulting in severe dry skin [18-20]. Patients suffering from this disease have the dry and scaly skin in common with AD patients. Indeed, also AD has been associated with mutations in the gene encoding laggrin [19-21]. In about 30% of AD patients several mutations rendering this gene improductive have been reported [6]. Until quite recently, the pathogenesis of AD has been attributed to primary abnormalities of the immune system. This hypothesis holds that the primary defect resides in an immunological disturbance that causes IgE-mediated sensitization and the impaired epithelial barrier is regarded as a consequence of the local inammation. However, others propose that the permeability barrier abnormality in AD is not an epiphenomenon but rather the driver of disease activity [22-25]. The initial mechanisms that induce skin inammation in patients with AD are unknown. Early onset of AD usually appears in the absence of IgE-mediated allergic sensitization [26]. It could be irritation-induced or pruritus-induced scratching, which releases pro-inammatory cytokines from keratinocytes, or it could be T-cell mediated, but IgE independent reactions to allergens present in the impaired epidermal barrier. IgE-mediated sensitization occurs several weeks or months after the lesions appear, suggesting that the skin is the site of the sensitization [26], although in human an intrinsic form of AD without IgE-mediated sensitization exists in about 20-30% of the patients [27]. Epidermal barrier dysfunction is a prerequisite for the penetration of high molecular weight allergens in e.g. house dust mites and pollens [6]. One way or another both an epithelial-barrier dysfunction together with an immunologic disturbance leads to disease at a specic site, e.g. atopic dermatitis or An intact epidermal barrier is a prerequisite for the skin to function as a physical and chemical barrier. The permeability barrier resides in the stratum corneum (SC), a multilayered tissue composed of attened, anucleate corneocytes surrounded by multiple planer lamellae sheets enriched in ceramides, cholesterol and free fatty acids (FA) [24, 28, 29]. The localization of these highly hydrophobic lipids within the extracellular domains of the SC inhibits the
11 General Introduction

asthma.

outward movement of water [23]. These lipids are provided by lamellar bodies, produced by exocytosis from upper keratinocytes [24]. An alteration of the barrier causing increased transepidermal water loss is a hallmark of AD [30, 31]. Moreover, a defective permeability function enables penetration of environmental allergens and microbes into the skin and might thereby initiate immunological reactions and inammation [32, 33]. Suggestion for a primary role of the barrier abnormality are e.g. the nding that a genetically impaired skin barrier function is already present in non-lesional skin and is more pronounced in lesional skin of AD patients e.g. laggrin mutations. In this respect it has been shown that laggrin gene defects increase the risk of developing allergic sensitization, atopic eczema and allergic rhinitis [34]. Evidence of the relation between laggrin gene mutations and atopic eczema was strong, with people manifesting increased severity and persistence of disease [34]. However, it is clear that other factors must be involved in order to develop disease as not all patients suffering form AD show laggrin abnormalities [19, 35]. Other genetically determined alterations of the epidermis (such as changes in the cornied envelope proteins involucrin and loricrin) or lipid composition are likely to contribute to barrier dysfunction [17]. As has been mentioned, also fatty acids do play an important role in skin barrier function [28, 36]. Essential fatty acid (EFA) deciency results in abnormalities of stratum corneum structure function [37, 38]. However, in human AD it is well established that in AD patients LA concentrations are not decreased in blood and adipose tissue which implies that they do not suffer from a deciency in LA [39]. Several studies though reported that the levels of downstream metabolites of LA and also of ALA were found to be reduced [40-46]. Both delta-5-desaturase (FADS1) and delta-6-desaturase (FADS2) are responsible for the synthesis of highly unsaturated n-3- and n-6 FA from LA and ALA. Thus decit amounts of LA and ALA metabolites have been attributed to reduced -6- and -5-desaturase activity [40, 41, 47, 48]. Essential fatty acids exhibit multiple (anti-)inammatory and immunomodulating properties. The proposed mechanism of action is the modulation of the cutaneous production of (PGs) and leukotrienes (LTs) (reviewed in chapter 2). For this reason the use of EFA in the treatment of AD has been intensively investigated. In human, clinically unaffected skin is already in a preactivated state. Unlike healthy skin it contains a sparse T cell inltrate consisting of an increased number of Th2 cells expressing IL-4, Il-13 but not Interferon-gamma (IFN-) messenger ribonucleic acid (mRNA) and IgEChapter 1

bearing Langerhans cells (LC) [49]. Acute eczematous skin lesions show a marked inltration of CD4+ activated memory T cells in the dermis. Signicantly greater numbers of IL-4, IL-5 and IL-13 mRNA-expressing cells are observed but few IFN- or IL-12 mRNA expressing cells [13]. Antigen-presenting cells (APC) e.g. LC, inammatory dendritic epidermal cells (IDEC)

12

and macrophages in lesional skin bearing IgE are increased [13]. In chronic eczematous skin signicantly fewer IL-4 and IL-13 mRNA expressing cells, but greater numbers of IL-12, IFN- mRNA expressing cells, are observed. Besides Th1 and Th2 cells regulatory T cells (Treg) might play a role in AD. Although there is some controversy about the presence of FOXP-3 natural Treg cells in the skin [50] most recent studies have identied these cells in the skin [51, 52] but it remains to be determined whether differences in functional activity of Treg cells shown in vitro are relevant for the course of AD in vivo [53]. LC and IDEC bearing FcRI, play an important role in allergen presentation to Th2 and Th1 cells respectively [12]. Allergen-specic IgE on LC facilitates the capture and internalization of allergens prior to their processing and antigen presentation to T cells. These IgE+ LC also migrate to lymph nodes where they can stimulate nave T cells to expand the pool of Th2 cells [13]. Lesional skin also inhabits higher amounts of myeloid cells as eosinophils, macrophages and mast cells (MC). These cells are important producers of lipid mediators such as leukotriene B 4 (LTB 4), and prostaglandin E2 (PGE2). Among the roles of LTB 4 is directing Tcell migration into the skin [54]. Epidermal keratinocytes of atopic patients produce different cytokines and chemokines upon mechanical stimulation, e.g. scratching. Keratinocytes also are an important source of thymic stromal lymphopoietin (TSLP) which activates dendrtitic cells (DC) to prime nave T cells to produce IL-4 and Il-13, which might be an explanation for the link between scratching and the triggering of Th2-mediated skin inammation. The local tissue expression of pro-inammatory cytokines and chemokines such as IL-1, thymus and activation regulated chemokines (TARC; CCL17) and tumor necrosis factor-alpha (TNF) attributes to the development of inammation of skin lesions whereby inammatory cells are attracted and inltrate the lesional sites from the periphery. Besides the involvement of T cells in the inammatory reaction in the skin they also inuence barrier function [55]. IL-4, IL-13 and IFN- have been shown to contribute to regulation of laggrin, but also of loricrin and involucrin expression [56, 57]. IL-4 is further known to reduce the recovery of barrier function after disruption [58, 59]. Furthermore, Th2 cytokines are known to reduce the expression of antimicrobial peptides in the skin which may predispose to a compromised antimicrobial barrier function and further epithelial damage [60, 61]. Also T cells may be able to inuence barrier function independent of Th2 cytokines. Human leukocyte antigen (HLA)expressing keratinocytes may become targets for T-cell mediated lysis. This can be via HLA class I- and II-mediated T cell activation as well as via the release of IFN- and FASStaphylococcal superantigen can facilitate keratinocyte presentation of allergen to CD4+ T cells [65]. It might thus be possible that keratinocytes represent a target for inltrating T cells, potentially leading to keratinocytes death and further barrier dysfunction. It can thus be concluded that in human AD both the epidermal barrier and the immune system play an important role in the cutaneous inammation that characterizes AD. One
13 General Introduction

FAS ligand interaction [62-64] This is thought to contribute to the spongiosis seen in AD.

unifying hypothesis proposes that non-atopic dermatitis as a result of environmental factors and a genetically-determined epidermal barrier dysfunction is the rst manifestation of AD. Subsequently genetic factors inuence the IgE- sensitization to allergens which is the transition to true AD. Finally, scratching leads to tissue damage and the release of structural proteins triggering IgE synthesis in a substantial amount of AD patients (Figure 1).

Figure 1 Immunologic pathways in AD. Th2 cells circulating in the peripheral blood of AD patients result in elevated serum IgE and eosinophils. These T cells express the cutaneous lymphocyte associated antigen (CLA) skin homing receptor, and recirculate through unaffected AD skin, where they can engage allergentriggered IgE+LCs and MCs that contribute to Th2 cell development. Skin injury by environmental allergens, scratching or microbial toxins activates keratinocytes to release proinammatory cytokines and chemokines that induce the expression of adhesion molecules on vascular endothelium and facilitate the extravasation of inammatory cells into the skin. Keratinocyte-derived TSLP and DCderived IL-10 also enhance Th2 cell differentiation. AD inammation is associated with increased Th2 cells in acute skin lesions, but chronic AD results in the inltration of IDECs, macrophages, and
Chapter 1

eosinophils. IL-12 production by these various cell types results in the switch to a Th1-type cytokine milieu associated with increased IFN- expression. Reproduced with permission from the American Society for Clinical Investigation, Leung, DY et al. New insights into atopic dermatitis, J Clin Invest 2004, Vol. 113, number 5.

14

Atopic dermatitis in dogs Atopic dermatitis in dogs is dened as: a genetically-predisposed inammatory and pruritic allergic skin disease with characteristic clinical features (see below). It is associated most commonly with IgE antibodies specic for environmental allergens such as house dust mites and grass pollen [66]. Diagnosis of cAD is based on clinical signs observed, as well as exclusion of other pruritic diseases such as ea bite hypersensitivity, food hypersensitivity and parasitic disorders, combined with the results of intradermal allergy tests and assessment of allergenspecic IgE levels. Atopic dogs do not present with one distinct clinical phenotype, however typical clinical manifestations have been described. The onset of disease is most often at young age (between 6 months and 3 years). Anatomical sites showing pruritus include the face, ears, axillae, paws and extremities. Breed predispositions (e.g. the Labrador Retriever) and seasonal dependencies have been described [67]. The exact incidence of cAD remains unknown, most estimates are around 10% [68], but this may be much higher in specic breeds [5]. Presumably, like in human AD, the background of the disease is multifactorial in origin including factors such as a changing environment with increased exposure to allergens, less exposure to pathogens at young age through more wide-spread vaccination, the role of the adaptive immune system, the epidermal skin barrier and a genetic predisposition [68, 69].

Histopathology of skin lesions in cAD Numerous cells have been reported to play a role in the pathogenesis of cAD including mast cells, dendritic cells, lymphocytes, eosinophils, neutrophils and cells of the monocytes/ macrophage lineage [70]. An important antigen presenting cells (APC) in the skin immune system in AD is the Langerhans cell (LC). In lesional atopic skin in comparison with nonlesional and healthy skin epidermal LC are increased in numbers [13]. In addition canine LC (MHCII + CD1a+ IgE+ ) express the - and -chain of the high afnity IgE receptor (FcRI), and not the -chain, indicating that canine LC have a receptor-mediated function which is similar to that in human [71]. Limited information is available regarding the role of T cells, being a major component of the mononuclear cell inltrate. Increased presence of CD4+ and CD8 + T cells in lesional atopic skin is reported but the ratio of CD4+/CD8+ cells measured in the epidermis is debated. Sinke et al. [72] observed a predominance of CD4+ T cells whereas Olivry et al. [73] found the and T cell receptor chains. Both types of T cells are found in more or less equal amounts in the epidermis, in the dermis however the T cells are dominant [73]. Two studies in the skin of dogs with naturally occurring AD show primarily a Th2 polarized response [74, 75]. The cutaneous inammation was characterized by expression of mRNA of IL-4 and IL-5. In contrast in healthy skin presence of IL-2 and IL-12 was more commonly
15 General Introduction

a preferential presence of CD8 + T cells in epidermis. The T cells in cAD skin express both

indicated using polymerase chain reaction (PCR) [74]. The other study was associated with overexpression of IL-4 mRNA and reduced expression of transforming growth factor beta (TGF). In addition, high levels of IFN-, TNF- and IL-2 were observed in lesional skin compared to non-lesional or healthy skin [75]. No differences were found for IL-12, IL-10 and IL-6. In contrast to studies in dogs with spontaneous AD, in experimentally-sensitized Beagles mRNA expression of IL-13, IL-6, IL-12p35, IL-18 and TARC was found after patch testing with house dust mites, whereas IL-4 was only present at low levels [76]. This study emphasized a role for IL-6 in the early stage of the disease, followed by an increase of IL-13 and TARC, whereas IL-18 would become more important after chronic exposure. Also in spontaneous AD, CCR4 (a transmembrane chemokine receptor) and TARC (being a ligand for CCR4) are exclusively expressed in keratinocytes of lesional skin [77-79]. It is thus hypothesized that TARC might play a role in the recruitment of Th2 lymphocytes into lesional skin [80]. The role of regulatory T cells has not been studied in cAD yet. Studies investigating the functional aspects of macrophages, neutrophils or eosinophils have, in contrast to human AD [13, 81-83], not been reported in canine AD [70]. Most studies in dogs found no signicant differences in the numbers of mast cells between normal and atopic skin [73, 84]. In addition, data provide evidence that there is mast cell granule heterogeneity and suggests that degranulation occurs selectively [84]. The interaction between allergens and allergen-specic IgE bound to the high FcRI receptors expressed on the mast cell surface [85, 86], results in local edema 15-20 min following the intradermal injection of allergen [87]. Activation of these receptors results in mediator release (including histamine and leukotrienes), and the interplay between proteolytic enzymes, the microvasculature and other inammatory cells results in signs compatible with an immediate-type inammation [70]. In studies following intradermal injection of anti-IgE or house dust mite-specic antigens, it is suggested that IgE-mediated late-phase reactions also occur in dogs with AD and are the trigger for subsequent cellular inltration [88-90]. Whereas the majority of cells early emigrating to the dermis are neutrophilic and activated eosinophilic granulocytes, there is an inux of T cells and CD1a+ dermal dendritic cells from 6h post-challenge, which continues to rise in numbers until 24 h [71, 88]. The signicance of these different cell types in the inammation process has not been elucidated yet.

Epidermal barrier in cAD There is increasing evidence for a disturbed epidermal barrier function in dogs with AD.
Chapter 1

By means of immunouorescence studies in experimentally-sensitized dogs, Der f 1 (Dermatophagoides farinae major allergen) could be detected in the subepidermal layer after epicutaneous challenge with house dust mite allergen [91] indicating that this barrier dysfunction leads to increased epicutaneous penetration of allergens. Inman et al. [92]

16

showed disruption of the epidermal lipid barrier in non-lesional atopic skin by means of transmission electron microscopy: the length and thickness of stratum corneum lipid deposits were reduced in non-lesional atopic skin compared to normal canine skin. In addition intercellular lipid lamellae exhibited structural defects in the stratum corneum of AD dogs [92]. Very recently Marsella et al. [80, 93] have documented defects in the stratum corneum and at the junction with the stratum granulosum. These abnormalities were present before allergen exposure but were exacerbated upon allergen challenge. The changes they found included a widening of the intercellular spaces, abnormal release of lamellar bodies and disorganization of lipid lamellae. The same group also noted that this group of experimental atopic Beagles has signicantly less epidermal laggrin expression than normal controls before allergen challenge and in the absence of clinical lesions [93]. It is currently unknown if these dogs (and spontaneous dogs in general) have any mutations in the laggrin gene. One study measured genes potentially involved in the pathogenesis of cAD using gene expression microarrays [94]. The most dysregulated gene in lesional skin was S100A8, which showed an almost 23-fold increase in expression. This is a pro-inammatory cytokine located in the epidermal differentiation complex and this is in agreement with human studies [17]. Ceramides are the largest group of stratum corneum lipids, apart from cholesterol and free fatty acids, and are together the basis for the intercellular lipid lamellae [28, 95]. Hence, it is interesting that the percentage of ceramides 1 and 9 were signicantly lower in nonlesional skin of AD dogs, whereas the cholesterol percentage was signicantly higher in AD dogs than in healthy control dogs [95]. Ceramide deciency has been specically linked to increased transepidermal water loss (TEWL) and, consequently, dry skin. This is supported by the preliminary ndings of Hightower et al. [96], where increased TEWL was observed in sensitized Beagle dogs in atopic predilection sites. The increase was evident even when no lesions were present and before allergen challenge [96]. In contrast, Chesney et al. measured skin moisture, hygroscopicity and water-holding capacity of canine atopic skin and did not nd differences with healthy dogs [97]. Like in human the role of essential FA (EFA) in proper functioning of the epidermal barrier has been acknowledged. Some studies in atopic dogs or canine mast cell lines suggested possible lower or decient activities of -6 desaturase, -5 desaturase or both as established by FA measurement [98-102]. Also the immunomodulating properties of EFA e.g. the modulation of the cutaneous production of prostaglandins (PG) and leukotrienes (LT), haven been evaluated by using EFA as an
General Introduction 17

alternative to anti-inammatory drugs for the control of clinical signs of cAD [103].

Therapeutic options for cAD As, like in human AD, the primary defect(s) underlying atopic disease have not yet been identied denitely, current therapies are focused on factors of which it is indicated that

they may mediate or modulate the inammatory response in AD [104]. To help control the clinical signs of cAD different treatment options or combinations of these are being used: the avoidance of allergens, the use of anti-inammatory drugs, allergen-specic immunotherapy and antimicrobial therapy [104]. In addition, dietary supplementation of lipids and vitamins supposed to contribute to altered inammatory responses and increased barrier function of the skin are used [103]. In most cases the prevention of contact with allergens is difcult to achieve, realizing that the most common causal allergens are house dust mites (Dermatophagoides spp.) or aeroallergens such as pollens and molds [105]. Anti-allergic drugs can be categorized into inhibitors of the allergic immediate phase reaction, e.g. drugs that prevent mast cell degranulation and those that prevent the vasoactive and pruritogenic effects of histamine, and drugs which affect multiple cell types involved in the inammatory cutaneous response and are more often used in the treatment of human AD, e.g. pentoxifylline, zileuton, tacrolimus, misoprostol [106]. In cAD drugs with the best clinical efcacy are corticosteroids and cyclosporin A inhibiting both immediate and delayed type hypersensitivity reactions. These drugs, though effective in the majority of dogs with AD, may exhibit adverse side effects when used long term [106, 107]. Another therapy modulating the immunological response to allergens, is allergen-specic immunotherapy (ASIT). In a recent study improvement upon ASIT paralleled a decrease of allergen-specic IgE in serum and an increase of IL-10 and CD4+ FoxP3 + T cells in blood [108]. Of all treatment options ASIT is the only one available that has the potential to result in partial or complete remission of cAD without further need of additional anti-inammatory drugs. Its success rate is around 60 to 70 percent.

Chapter 1 18

Scope of the thesis Atopic dermatitis in human has been viewed largely as a disease of immunologic etiology. Key roles are played by dendritic cell signaling, the Th1/Th2 cell dysregulation, IgE production, and mast cell hyperactivity in the development of the pruritic inammatory dermatosis which characterizes AD. More recently it has been proposed that an intrinsic defect in the epithelial cell leads to a dysfunction in the epidermal barrier followed by immune system activation. In canine AD most of the research has focused on possible deviations of the immune system with emphasis on T cell function. Moreover, there is increasing evidence for an impaired epidermal barrier function in dogs as well. The major research questions addressed in this thesis concern the role of fatty acids and their metabolic enzymes in the inammation observed in canine atopic dermatitis and their possible modulatory effect. In addition, we have characterized the immunologic phenotype of atopic skin, particularly at the level of mRNA expression. CHAPTER 2 CHAPTER 3 CHAPTER 4 CHAPTER 5 CHAPTER 6 reviews the role of polyunsaturated fatty acids (PUFA) in the regulation of the inammatory and immune response in humans and dogs. describes the most stable reference genes in skin tissue to be used in realtime quantitative PCR. describes the results of a double blind, controlled clinical trial on the effect of a diet high in linoleic acid. investigates differential expression of -5 desaturase and -6 desaturase in canine atopic dermatitis as compared to healthy skin. describes the expression of several enzymes involved in the metabolism of arachidonic acid to eicosanoids with respect to possible future therapeutic measures. CHAPTER 7 CHAPTER 8 focuses on the role of Th1, Th2 and regulatory T cells in canine AD in comparison to their role in AD of humans. summarizes and discusses the studies described in this thesis in the context of our current understanding of the position of fatty acids in the inammatory response in canine AD.
General Introduction 19

References
1. Wittich FW. Spontaneous allergy (atopy) in the lower animal-seasonal hay fever (fall type) in a dog. J. Allergy 1941: 12: p. 247-251. Patterson R. Investigations of spontaneous hypersensitivity of the dog. J Allergy 1960: 31: p. 351-63. Halliwell RE. Atopic disease in the dog. Vet Rec 1971: 89(8): p. 209-14. Olivry TE. Special Issue on canine Atopic Dermatitis by The American College of Veterinary Dermatology Task Force on Canine Atopic Dermatitis. Veterinary Immunology and Immunopathology 2001: 81(3-4): p. 143-387. Leung DY and Bieber T. Atopic dermatitis. Lancet 2003: 361(9352): p. 151-60. Bieber T. Atopic dermatitis. N Engl J Med 2008: 358(14): p. 1483-94. Williams H and Flohr C. How epidemiology has challenged 3 prevailing concepts about atopic dermatitis. J Allergy Clin Immunol 2006: 118(1): p. 209-13. Strachan DP. Hay fever, hygiene, and household size. Bmj 1989: 299(6710): p. 1259-60. Wills-Karp M, Santeliz J, and Karp CL. The germless theory of allergic disease: revisiting the hygiene hypothesis. Nat Rev Immunol 2001: 1(1): p. 69-75. Zutavern A, Hirsch T, Leupold W, Weiland S, Keil U, and von Mutius E. Atopic dermatitis, extrinsic atopic dermatitis and the hygiene hypothesis: results from a cross-sectional study. Clin Exp Allergy 2005: 35(10): p. 1301-8. von Mutius E. Allergies, infections and the hygiene hypothesis--the epidemiological evidence. Immunobiology 2007: 212(6): p. 433-9. Novak N, Bieber T, and Leung DY. Immune mechanisms leading to atopic dermatitis. J Allergy Clin Immunol 2003: 112(6 Suppl): p. S128-39. Leung DY, Boguniewicz M, Howell MD, Nomura I, and Hamid QA. New insights into atopic dermatitis. J Clin Invest 2004: 113(5): p. 651-7. Morar N, Willis-Owen SA, Moffatt MF, and Cookson WO. The genetics of atopic dermatitis. J Allergy Clin Immunol 2006: 118(1): p. 24-34; quiz 35-6. Hoffjan S and Epplen JT. The genetics of atopic dermatitis: recent ndings and future options. J Mol Med 2005: 83(9): p. 682-92. Novak N, Kruse S, Potreck J, Maintz L, Jenneck C, Weidinger S et al. Single nucleotide polymorphisms of the IL18 gene are associated with atopic eczema. J Allergy Clin Immunol 2005: 115(4): p. 828-33. Cookson W. The immunogenetics of asthma and eczema: a new focus on the epithelium. Nat Rev Immunol 2004: 4(12): p. 978-88.

2. 3. 4.

5. 6. 7.

8. 9.

10.

11.

12.

13.

14.

15.

16.
Chapter 1

17.

20

18.

Smith FJ, Irvine AD, Terron-Kwiatkowski A, Sandilands A, Campbell LE, Zhao Y et al. Loss-of-function mutations in the gene encoding laggrin cause ichthyosis vulgaris. Nat Genet 2006: 38(3): p. 337-42. Palmer CN, Irvine AD, Terron-Kwiatkowski A, Zhao Y, Liao H, Lee SP et al. Common loss-of-function variants of the epidermal barrier protein laggrin are a major predisposing factor for atopic dermatitis. Nat Genet 2006: 38(4): p. 441-6. Sandilands A, Terron-Kwiatkowski A, Hull PR, ORegan GM, Clayton TH, Watson RM et al. Comprehensive analysis of the gene encoding laggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema. Nat Genet 2007: 39(5): p. 650-4. Morar N, Cookson WO, Harper JI, and Moffatt MF. Filaggrin mutations in children with severe atopic dermatitis. J Invest Dermatol 2007: 127(7): p. 1667-72. Elias PM and Steinhoff M. Outside-to-inside (and now back to outside) pathogenic mechanisms in atopic dermatitis. J Invest Dermatol 2008: 128(5): p. 1067-70. Elias PM, Hatano Y, and Williams ML. Basis for the barrier abnormality in atopic dermatitis: outside-inside-outside pathogenic mechanisms. J Allergy Clin Immunol 2008: 121(6): p. 1337-43. Proksch E, Brandner JM, and Jensen JM. The skin: an indispensable barrier. Exp Dermatol 2008: 17(12): p. 1063-72. Elias PM and Feingold KR. Does the tail wag the dog? Role of the barrier in the pathogenesis of inammatory dermatoses and therapeutic implications. Arch Dermatol 2001: 137(8): p. 1079-81. Illi S, von Mutius E, Lau S, Nickel R, Gruber C, Niggemann B et al. The natural course of atopic dermatitis from birth to age 7 years and the association with asthma. J Allergy Clin Immunol 2004: 113(5): p. 92531. Novak N and Bieber T. Allergic and nonallergic forms of atopic diseases. J Allergy Clin Immunol 2003: 112(2): p. 252-62. Feingold KR. Thematic review series: Skin Lipids. The role of epidermal lipids in cutaneous permeability barrier homeostasis. J Lipid Res 2007: 48(12): p. 2531-46. Sugarman JL. The epidermal barrier in atopic dermatitis. Semin Cutan Med Surg 2008: 27(2): p. 108-14. Boralevi F, Hubiche T, Leaute-Labreze C, Saubusse E, Fayon M, Roul S et al. Epicutaneous aeroallergen sensitization in atopic dermatitis infants - determining the role of epidermal barrier impairment. Allergy 2008: 63(2): p. 205-10. Hon KL, Wong KY, Leung TF, Chow CM, and Ng PC. Comparison of skin hydration evaluation sites and correlations among skin hydration, transepidermal water loss, SCORAD index, Nottingham Eczema Severity Score, and quality of life in patients with atopic dermatitis. Am J Clin Dermatol 2008: 9(1): p. 4550. Hudson TJ. Skin barrier function and allergic risk. Nat Genet 2006: 38(4): p. 399-400. Proksch E, Folster-Holst R, and Jensen JM. Skin barrier function, epidermal proliferation and differentiation in eczema. J Dermatol Sci 2006: 43(3): p. 159-69.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29. 30.

31.

32. 33.

General Introduction 21

34.

van den Oord RA and Sheikh A. Filaggrin gene defects and risk of developing allergic sensitisation and allergic disorders: systematic review and meta-analysis. Bmj 2009: 339: p. b2433. Brown SJ, Relton CL, Liao H, Zhao Y, Sandilands A, Wilson IJ et al. Filaggrin null mutations and childhood atopic eczema: a population-based case-control study. J Allergy Clin Immunol 2008: 121(4): p. 940-46 e3. Feingold KR. The importance of lipids in cutaneous function. J Lipid Res 2007: 48(12): p. 2529-30. Hansen AE, Haggard ME, Boelsche AN, Adam DJ, and Wiese HF. Essential fatty acids in infant nutrition. III. Clinical manifestations of linoleic acid deciency. J Nutr 1958: 66(4): p. 565-76. Proksch E, Feingold KR, and Elias PM. Epidermal HMG CoA reductase activity in essential fatty acid deciency: barrier requirements rather than eicosanoid generation regulate cholesterol synthesis. J Invest Dermatol 1992: 99(2): p. 216-20. Horrobin DF. Essential fatty acid metabolism and its modication in atopic eczema. Am J Clin Nutr 2000: 71(1 Suppl): p. 367S-72S. Manku MS, Horrobin DF, Morse N, Kyte V, Jenkins K, Wright S et al. Reduced levels of prostaglandin precursors in the blood of atopic patients: defective delta-6-desaturase function as a biochemical basis for atopy. Prostaglandins Leukot Med 1982: 9(6): p. 615-28. Manku MS, Horrobin DF, Morse NL, Wright S, and Burton JL. Essential fatty acids in the plasma phospholipids of patients with atopic eczema. Br J Dermatol 1984: 110(6): p. 643-8. Laitinen K, Sallinen J, Linderborg K, and Isolauri E. Serum, cheek cell and breast milk fatty acid compositions in infants with atopic and non-atopic eczema. Clin Exp Allergy 2006: 36(2): p. 166-73. Strannegard IL, Svennerholm L, and Strannegard O. Essential fatty acids in serum lecithin of children with atopic dermatitis and in umbilical cord serum of infants with high or low IgE levels. Int Arch Allergy Appl Immunol 1987: 82(3-4): p. 422-3. Wright S and Bolton C. Breast milk fatty acids in mothers of children with atopic eczema. Br J Nutr 1989: 62(3): p. 693-7. Wright S and Sanders TA. Adipose tissue essential fatty acid composition in patients with atopic eczema. Eur J Clin Nutr 1991: 45(10): p. 501-5. Yu G, Kjellman NI, and Bjorksten B. Phospholipid fatty acids in cord blood: family history and development of allergy. Acta Paediatr 1996: 85(6): p. 679-83. Calder PC and Miles EA. Fatty acids and atopic disease. Pediatr Allergy Immunol 2000: 11 Suppl 13: p. 29-36. Calder PC. Abnormal fatty acid proles occur in atopic dermatitis but what do they mean? Clin Exp Allergy 2006: 36(2): p. 138-41. Hamid Q, Boguniewicz M, and Leung DY. Differential in situ cytokine gene expression in acute versus chronic atopic dermatitis. J Clin Invest 1994: 94(2): p. 870-6.

35.

36. 37.

38.

39.

40.

41.

42.

43.

44.

45.

46. 47.

48.
Chapter 1

49.

22

50.

Verhagen J, Akdis M, Traidl-Hoffmann C, Schmid-Grendelmeier P, Hijnen D, Knol EF et al. Absence of Tregulatory cell expression and function in atopic dermatitis skin. J Allergy Clin Immunol 2006: 117(1): p. 176-83. Schnopp C, Rad R, Weidinger A, Weidinger S, Ring J, Eberlein B et al. Fox-P3-positive regulatory T cells are present in the skin of generalized atopic eczema patients and are not particularly affected by mediumdose UVA1 therapy. Photodermatol Photoimmunol Photomed 2007: 23(2-3): p. 81-5. Szegedi A, Barath S, Nagy G, Szodoray P, Gal M, Sipka S et al. Regulatory T cells in atopic dermatitis: epidermal dendritic cell clusters may contribute to their local expansion. Br J Dermatol 2009: 160(5): p. 984-93. Werfel T. The role of leukocytes, keratinocytes, and allergen-specic IgE in the development of atopic dermatitis. J Invest Dermatol 2009: 129(8): p. 1878-91. Luster AD and Tager AM. T-cell trafcking in asthma: lipid mediators grease the way. Nat Rev Immunol 2004: 4(9): p. 711-24. Ogg G. Role of T cells in the pathogenesis of atopic dermatitis. Clin Exp Allergy 2009: 39(3): p. 310-6. Howell MD, Kim BE, Gao P, Grant AV, Boguniewicz M, Debenedetto A et al. Cytokine modulation of atopic dermatitis laggrin skin expression. J Allergy Clin Immunol 2007: 120(1): p. 150-5. Kim BE, Leung DY, Boguniewicz M, and Howell MD. Loricrin and involucrin expression is down-regulated by Th2 cytokines through STAT-6. Clin Immunol 2008: 126(3): p. 332-7. Kurahashi R, Hatano Y, and Katagiri K. IL-4 suppresses the recovery of cutaneous permeability barrier functions in vivo. J Invest Dermatol 2008: 128(5): p. 1329-31. Hatano Y, Terashi H, Arakawa S, and Katagiri K. Interleukin-4 suppresses the enhancement of ceramide synthesis and cutaneous permeability barrier functions induced by tumor necrosis factor-alpha and interferon-gamma in human epidermis. J Invest Dermatol 2005: 124(4): p. 786-92. Howell MD, Boguniewicz M, Pastore S, Novak N, Bieber T, Girolomoni G et al. Mechanism of HBD-3 deciency in atopic dermatitis. Clin Immunol 2006: 121(3): p. 332-8. Nomura I, Goleva E, Howell MD, Hamid QA, Ong PY, Hall CF et al. Cytokine milieu of atopic dermatitis, as compared to psoriasis, skin prevents induction of innate immune response genes. J Immunol 2003: 171(6): p. 3262-9. Trautmann A, Akdis M, Kleemann D, Altznauer F, Simon HU, Graeve T et al. T cell-mediated Fas-induced keratinocyte apoptosis plays a key pathogenetic role in eczematous dermatitis. J Clin Invest 2000: 106(1): p. 25-35. Barker JN, Allen MH, and MacDonald DM. Alterations induced in normal human skin by in vivo interferongamma. Br J Dermatol 1990: 122(4): p. 451-8. Trautmann A, Akdis M, Schmid-Grendelmeier P, Disch R, Brocker EB, Blaser K et al. Targeting keratinocyte apoptosis in the treatment of atopic dermatitis and allergic contact dermatitis. J Allergy Clin Immunol 2001: 108(5): p. 839-46.
General Introduction 23

51.

52.

53.

54.

55. 56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

Ardern-Jones MR, Black AP, Bateman EA, and Ogg GS. Bacterial superantigen facilitates epithelial presentation of allergen to T helper 2 cells. Proc Natl Acad Sci U S A 2007: 104(13): p. 5557-62. Olivry T, DeBoer DJ, Grifn CE, Halliwell RE, Hill PB, Hillier A et al. The ACVD task force on canine atopic dermatitis: forewords and lexicon. Vet Immunol Immunopathol 2001: 81(3-4): p. 143-6. Grifn CE and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis. Vet Immunol Immunopathol 2001: 81(3-4): p. 255-69. Hillier A and Grifn CE. The ACVD task force on canine atopic dermatitis (I): incidence and prevalence. Vet Immunol Immunopathol 2001: 81(3-4): p. 147-51. Sousa CA and Marsella R. The ACVD task force on canine atopic dermatitis (II): genetic factors. Vet Immunol Immunopathol 2001: 81(3-4): p. 153-7. Hill PB and Olivry T. The ACVD task force on canine atopic dermatitis (V): biology and role of inammatory cells in cutaneous allergic reactions. Vet Immunol Immunopathol 2001: 81(3-4): p. 187-98. Looringh van Beeck FA, Zajonc DM, Moore PF, Schlotter YM, Broere F, Rutten VP et al. Two canine CD1a proteins are differentially expressed in skin. Immunogenetics 2008: 60(6): p. 315-24. Sinke JD, Thepen T, Bihari IC, Rutten VP, and Willemse T. Immunophenotyping of skin-inltrating T-cell subsets in dogs with atopic dermatitis. Vet Immunol Immunopathol 1997: 57(1-2): p. 13-23. Olivry T, Naydan DK, and Moore PF. Characterization of the cutaneous inammatory inltrate in canine atopic dermatitis. Am J Dermatopathol 1997: 19(5): p. 477-86. Olivry T, Dean GA, Tompkins MB, Dow JL, and Moore PF. Toward a canine model of atopic dermatitis: amplication of cytokine-gene transcripts in the skin of atopic dogs. Exp Dermatol 1999: 8(3): p. 204-11. Nuttall TJ, Knight PA, McAleese SM, Lamb JR, and Hill PB. Expression of Th1, Th2 and immunosuppressive cytokine gene transcripts in canine atopic dermatitis. Clin Exp Allergy 2002: 32(5): p. 789-95. Marsella R, Olivry T, and Maeda S. Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet Dermatol 2006: 17(2): p. 111-20. Maeda S, Fujiwara S, Omori K, Kawano K, Kurata K, Masuda K et al. Lesional expression of thymus and activation-regulated chemokine in canine atopic dermatitis. Vet Immunol Immunopathol 2002: 88(1-2): p. 79-87. Maeda S, Okayama T, Omori K, Masuda K, Sakaguchi M, Ohno K et al. Expression of CC chemokine receptor 4 (CCR4) mRNA in canine atopic skin lesion. Vet Immunol Immunopathol 2002: 90(3-4): p. 14554. Maeda S, Maeda S, Shibata S, Chimura N, and Fukata T. House dust mite major allergen Der f 1 enhances proinammatory cytokine and chemokine gene expression in a cell line of canine epidermal keratinocytes. Vet Immunol Immunopathol 2009. Marsella R and Girolomoni G. Canine Models of Atopic Dermatitis: A Useful Tool with Untapped Potential. J Invest Dermatol 2009.

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.
Chapter 1

80.

24

81.

Thepen T, van Vuuren AJ, Kiekens RC, Damen CA, Vooijs WC, and van De Winkel JG. Resolution of cutaneous inammation after local elimination of macrophages. Nat Biotechnol 2000: 18(1): p. 48-51. Simon D, Braathen LR, and Simon HU. Eosinophils and atopic dermatitis. Allergy 2004: 59(6): p. 561-70. Ou LS and Huang JL. Cellular aspects of atopic dermatitis. Clin Rev Allergy Immunol 2007: 33(3): p. 191-8. Welle MM, Olivry T, Grimm S, and Suter M. Mast cell density and subtypes in the skin of dogs with atopic dermatitis. J Comp Pathol 1999: 120(2): p. 187-97. Halliwell RE. The localization of IgE in canine skin: an immunouorescent study. J Immunol 1973: 110(2): p. 422-30. Olivry T, Moore PF, Affolter VK, and Naydan DK. Langerhans cell hyperplasia and IgE expression in canine atopic dermatitis. Arch Dermatol Res 1996: 288(10): p. 579-85. Hillier A and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XVII): intradermal testing. Vet Immunol Immunopathol 2001: 81(3-4): p. 289-304. Olivry T, Dunston SM, Murphy KM, and Moore PF. Characterization of the inammatory inltrate during IgE-mediated late phase reactions in the skin of normal and atopic dogs. Vet Dermatol 2001: 12(1): p. 4958. Becker AB, Chung F, McDonald DM, Frick OL, and Gold WM. Cutaneous allergic response in atopic dogs: relationship of cellular and histamine responses. J Allergy Clin Immunol 1988: 81(2): p. 441-8. Thomsen M, Kristensen F, and Elling F. Species specicity in the generation of eicosanoids. Emphasis on leukocyte-activating factors in the skin of allergic dogs and humans. 1993: 2: p. 63-78. Pucheu-Haston CM, Jackson HA, Olivry T, Dunston SM, and Hammerberg B. Epicutaneous sensitization with Dermatophagoides farinae induces generalized allergic dermatitis and elevated mite-specic immunoglobulin E levels in a canine model of atopic dermatitis. Clin Exp Allergy 2008: 38(4): p. 667-79. Inman AO, Olivry T, Dunston SM, Monteiro-Riviere NA, and Gatto H. Electron microscopic observations of stratum corneum intercellular lipids in normal and atopic dogs. Vet Pathol 2001: 38(6): p. 720-3. Marsella R, Samuelson D, Doerr K, K. H, and Harrington L. Defective barrier function in an experimental model of atopic dermatitis in high IgE producing Beagles. In the Proceedings of the 5th George Rajka International Symposium on Atopic Dermatitis, Kyoto, Japan, 18 2008. Merryman-Simpson AE, Wood SH, Fretwell N, Jones PG, McLaren WM, McEwan NA et al. Gene (mRNA) expression in canine atopic dermatitis: microarray analysis. Vet Dermatol 2008: 19(2): p. 59-66. Reiter LV, Torres SM, and Wertz PW. Characterization and quantication of ceramides in the nonlesional skin of canine patients with atopic dermatitis compared with controls. Vet Dermatol 2009: 20(4): p. 260-6. Hightower K, Marsella R, Creary E, and Dutcher P. Evaluation of transepidermal water loss in canine atopic dermatitis: a pilot study in Beagle dogs sensitized to house dust mites. 2008. Chesney CJ. Measurement of skin hydration in normal dogs and in dogs with atopy or a scaling dermatosis. J Small Anim Pract 1995: 36(7): p. 305-9.

82. 83. 84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

General Introduction 25

98.

Seidel A, Gueck T, and Fuhrmann H. The Inuence of long-chain polyunsaturated fatty acids on total lipid fatty acid composition of a canine mastocytoma cell line. J Vet Med A Physiol Pathol Clin Med 2005: 52(5): p. 219-24. Gueck T, Seidel A, Baumann D, Meister A, and Fuhrmann H. Alterations of mast cell mediator production and release by gamma-linolenic and docosahexaenoic acid. Vet Dermatol 2004: 15(5): p. 309-14.

99.

100. Scott DW, Miller WH, Jr., Reinhart GA, Mohammed HO, and Bagladi MS. Effect of an omega-3/omega-6 fatty acid-containing commercial lamb and rice diet on pruritus in atopic dogs: results of a single-blinded study. Can J Vet Res 1997: 61(2): p. 145-53. 101. Campbell K. Clinical use of fatty acid supplements in dogs. Vet Dermatol 1993: 4: p. 167-173. 102. Taugbol O, Baddaky-Taugbol B, and Saarem K. The fatty acid prole of subcutaneous fat and blood plasma in pruritic dogs and dogs without skin problems. Can J Vet Res 1998: 62(4): p. 275-8. 103. Olivry T, Marsella R, and Hillier A. The ACVD task force on canine atopic dermatitis (XXIII): are essential fatty acids effective? Vet Immunol Immunopathol 2001: 81(3-4): p. 347-62. 104. Olivry T and Sousa CA. The ACVD task force on canine atopic dermatitis (XIX): general principles of therapy. Vet Immunol Immunopathol 2001: 81(3-4): p. 311-6. 105. Hill PB and DeBoer DJ. The ACVD task force on canine atopic dermatitis (IV): environmental allergens. Vet Immunol Immunopathol 2001: 81(3-4): p. 169-86. 106. Marsella R and Olivry T. The ACVD task force on canine atopic dermatitis (XXII): nonsteroidal antiinammatory pharmacotherapy. Vet Immunol Immunopathol 2001: 81(3-4): p. 331-45. 107. Olivry T and Sousa CA. The ACVD task force on canine atopic dermatitis (XX): glucocorticoid pharmacotherapy. Vet Immunol Immunopathol 2001: 81(3-4): p. 317-22. 108. Keppel KE, Campbell KL, Zuckermann FA, Greeley EA, Schaeffer DJ, and Husmann RJ. Quantitation of canine regulatory T cell populations, serum interleukin-10 and allergen-specic IgE concentrations in healthy control dogs and canine atopic dermatitis patients receiving allergen-specic immunotherapy. Vet Immunol Immunopathol 2008: 123(3-4): p. 337-44.

Chapter 1 26

CHAPTER 2

Review Article

Polyunsaturated fatty acids and immune functions in chronic inammatory disorders

Yvette Schlottera, Victor Ruttenb, c, Edward Knold, Ton Willemsea, b

Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, the Netherlands Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, the Netherlands Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Republic of South Africa University Medical Center Utrecht, Department of Dermatology/Allergology, Utrecht, the Netherlands

Submitted for publication

Abstract Nutritional constituents like fatty acids (FA) have recently gained interest as modulators of inammation and immune responses. Most studies have focused on the use of a particular group of FA, the omega-3 (n-3) FA. These have been shown to possess anti-inammatory and immunomodulatory activities in a wide array of inammatory diseases, like rheumatoid arthritis, inammatory bowel disease, asthma and atopic dermatitis. The production of inammatory cytokines and eicosanoids (e.g. prostaglandins, leukotrienes, thromboxanes), other inammatory agents (e.g. nitric oxide), and increased expression of adhesion molecules are key factors in the pathogenesis of these diseases. N-3 polyunsaturated fatty acids (PUFA) may reduce the production of these metabolites in the rst place by replacing arachidonic acid, as the main substrate for eicosanoids, in inammatory cell membrane phospholipids and by inhibiting AA metabolism due to the fact that both n-3 and n-6 PUFA compete for the same set of enzymes. Secondly, n-3 FA supplementation will alter the uidity of the cell membrane and thus affect membrane-associated events like intercellular interactions, receptor expression and signal transduction. Finally, PUFA and their derivatives are ligands for nuclear factors, hence affect gene expression. Based on the metabolism of PUFA and a comprehensive analysis of the possible mechanisms by which they might exert their positive effects, the use of n-3 FA as a therapeutic modality in human and canine inammatory diseases will be reviewed.

Chapter 2 28

Table of contents 1. 2. Introduction Fatty acids

2.1. Chemical structure and nomenclature 2.2. Synthesis and sources of long chain polyunsaturated fatty acids (PUFA) 3. Anti-inammatory effects of PUFA

3.1. PUFA and eicosanoids 3.2. PUFA and cytokine production 3.3. PUFA and cell adhesion molecules
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 29

3.4. PUFA and gene expression 4. PUFA and chronic diseases

4.1. Arthritis 4.2. Inammatory bowel disease 4.3. Asthma and atopic dermatitis

1.

Introduction

Dietary fatty acids (FA) have become a focus of interest for the nutritional industry and science due to the potential health benets of these nutrients. The impact of FA on the immune system has been addressed increasingly during the last four decades [1, 2]. In the 1970s research focussed on the importance of linoleic acid (LA; n-6 FA) for development and function of the immune system [3]. In the same period it was shown that diets high in fat have immunosuppressive effects and it was postulated [2, 4] that changes in membranedependent functions, induced by certain dietary FA, are a direct consequence of alterations in membrane composition and uidity. This theory regained interest since the beginning of this century because of the discovery of lipid rafts and the possibility of remodelling these rafts by PUFA [5, 6]. Lipid rafts are discrete lipid domains that are present in the cell membrane and are supposed to play a role in intracellular signalling pathways as many proteins involved in signal transduction are mainly found in these lipid rafts [6, 7]. In the 1980s focus switched to the role of the eicosanoids, biologically active fatty acid metabolites that act as mediators of inammation and immune cell function [8, 9]. In the 1990s much attention was paid to the modulation of cytokine responses by PUFA during an inammatory response [10-12]. Another important research focus was the modulation of the immune responsiveness by the inuence of PUFA on gene expression [13-16]. PUFA are divided into omega-6 (n-6) or omega-3 (n-3) FA. Both groups of FA share the same metabolic pathway creating competition between the two classes of FA for metabolism. Since the amount of n-6 FA, mainly LA, is greater than that of the n-3 FA, metabolism of n-6 FA prevails, thereby promoting arachidonic acid (AA) synthesis. In Western diets n6 FA are predominant and the ratio of n-6 to n-3 FA changed considerable over the last 100 years in favour of the n-6 FA [17]. It is suggested that the change in ratio negatively affects health [18-20] and might play a role in the onset of several disorders [19]. This might be due to the loss of the anti-inammatory and immunosuppressive activities of the n-3 FA. The latter became an important research focus as preventive or therapeutic modality for a variety of inammatory and autoimmune diseases in humans and animals. Although inammation belongs to the normal protective response to infection or injury, exaggerated immune responses resulting in long-term damage to the host tissues result in chronic diseases such as rheumatoid arthritis, inammatory bowel disease, Crohns disease, type-1 diabetes, multiple sclerosis, psoriasis, atopic dermatitis and allergic asthma. In the veterinary eld dietary modication with FA has also been associated with the
Chapter 2

prevention and potential alleviation of several (inammatory) diseases. In the dog research mainly focussed on the use of PUFA in the treatment of atopic dermatitis, and in addition on the management of osteoarthritis and gastrointestinal diseases. In cats and horses, literature about the use of PUFA is scarce, but the research focus resembles that in the dog. Although

30

pigs and ruminants might benet from PUFA, associated research is still in its infancy [21, 22]. In cattle most studies concentrated on the impact of dietary manipulation on milk and meat PUFA composition to the benet of human health rather than that of animals. The potential mechanisms by which n-3 PUFA may exert their anti-inammatory effect in prevention and therapy of chronic inammatory diseases in humans and dogs will be the focus of this review.

2.

Fatty acids

2.1. Chemical structure and nomenclature Dietary FA are important sources of energy for biological activities in human beings and mammals. FA are the components from which fats are made and they consist of the elements carbon (C), hydrogen (H) and oxygen (O). They are made up of a backbone of carbon atoms with a methyl group (CH3) at one end, the so-called omega () or n-end and a carboxyl group (COOH) at the other, the delta () end. FA can be divided into saturated and unsaturated FA. In contrast to saturated FA, unsaturated FA have one or more double bonds that allow further division into mono- and polyunsaturated FA, respectively. nomenclature [17, 23-25]. For instance 9, 12- octadecadienoic acid is the systemic name for linoleic acid (common name). The numbers at the beginning of the systematic name indicate the locations of the double bonds. By convention, in the systematic nomenclature, the carbon of the carboxyl group is carbon number one. The Greek numeric prexes are used as multipliers and to describe the length of the carbon chains. In the case of LA, octadeca indicates that the carbon chain consists of 18-carbon elements, di en means with two double bonds at carbons 9 and 12 and with carbon 1 constituting a carboxyl group (oic). The shorthand nomenclature for LA is 18:2 n-6, which indicates the number of carbon atoms in the chain, the number of double bonds in the chain and the position of the double bond nearest the methyl end (-end) of the chain, respectively (Figure 1)[25]. In contrast to the systemic nomenclature, the shorthand notation denes the carbon of the methyl group as carbon number one. As stated before, PUFA can be classied into two main families: the n-6 (or -6) and the n-3 (or -3) families, based on the position of the rst double bond counted from the methyl end i.e between the sixth and seventh carbon atoms and between the third and the fourth carbon atoms, respectively. (Figure 1) [17, 25, 26].
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 31

FA have systematic names, common or trivial names and are often represented by a shorthand

Figure 1. Structure of a-linolenic acid (n-3 FA) and linoleic acid (n-6 FA)

2.2. Sources and synthesis of long chain PUFA FA vary in length from 2 to 80 carbons. Long chain PUFA may be obtained either through the diet or by elongation and desaturation of 18 carbon FA. All mammals can synthesize FA de novo from acetyl coenzyme A. The end product of this synthesis is palmitic acid (16: 0) which can be elongated to stearic acid (18:0). Stearic acid can easily be converted to oleic acid (18:1 n-9) by -9 desaturase, universally present in cells of both plants and animals. In contrast to plants, mammalian cells lack -12 desaturase, making them unable to insert double bonds between the methyl end and the ninth carbon in oleic acid. Thus, mammals cannot convert oleic acid to LA (LA; 18:2 n-6). Besides -12 desaturase mammals also lack -15 desaturase, the enzyme responsible for the synthesis of -linolenic acid (ALA; 18:3 n-3) out of LA. To obtain these two essential FA (EFA) needed for proper physiological functioning [17, 23, 25, 26], mammals are completely dependent on their diet. Once consumed, these EFA can be metabolised to other FA (Figure 2). Thus, LA, the parent precursor for the n6 pathway, can be converted via -linolenic acid (GLA; 18:3 n-6) and dihomo--linolenic acid (DGLA; 20:3 n-6) to arachidonic acid (AA; 20:4 n-6). For the n-3 pathway the same enzymes are used and the parent precursor of this pathway, -linolenic acid (ALA; 18:3 n-3) can be metabolised via stearidonic acid (SDA; 18:4 n-3) and eicosatetraenoic acid (20:4 n-3) to eicosapentaenoic acid (EPA; 20:5 n-3) [23, 25-28]. Both AA and EPA can serve as substrates for the synthesis of eicosanoids. The conversion of LA to AA and ALA to EPA and DHA occurs in the endoplasmatic reticulum. Only the nal step before synthesis of DHA takes place in the peroxisomes [17, 29-31].

Chapter 2 32

Figure 2. Metabolic pathway of essential fatty acids

As LA and ALA are both metabolised by the same set of enzymes, but as the amount of LA in the diet is larger, LA (n-6) metabolism prevails that of ALA (n-3), resulting in more AA synthesis and incorporation into cell membranes as compared to that of the long chain n-3 FA, EPA and DHA [17, 18, 20, 32, 33] Plant tissues and plant oils are rich sources of LA and ALA. LA is the main fatty acid (5080%) found in corn, sunower, safower and soybean oils, whereas green leafy vegetables, nuts, rapeseed, soybean and canola oils are sources of ALA (5-15%) next to green leafy vegetables and nuts [25-27, 34]. Flaxseed oil (syn. linseed oil) is the richest source of ALA (60%) [35]. Together, LA and ALA contribute to more than 95% of the dietary PUFA intake,

Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 33

even more if only western diets are considered. Since the early 70s the ratio of the n-6 to n3 PUFA in diet increased signicantly due to the introduction of cooking oils and margarines. In contrast the dietary intake of ALA did not change remarkably. At present the dietary ratio of n-6 to n-3 is around 15 in western populations, though there is a marked variation (5-20) between nations [36]. Epidemiological and anthropological studies indicated that the traditional range of n-6: n-3 FA in human diet was around 1-2:1 [17, 20]. The dietary intake of LA metabolites (n-6) GLA, a constituent of borage- and primrose oil, from habitual diet is very low as it is for DGLA and for the linolenic acid metabolite SDA [27]. The main dietary sources of AA are meat and offal. Algae are the primary producers of EPA, DPA and DHA [33]. Hence, these long chain FA are found in relatively high proportions in the tissues of oily sh like tuna, salmon, herring, mackerel, sardines and in the commercial sh oil products [37]. In western countries nowadays there are also products (e.g. eggs, milk) commercially fortied with these n-3 FA [27, 38].

3.

Anti-inammotory effects of PUFA

Eicosanoids are oxygenated hydrophobic molecules that function mainly as autocrine and paracrine molecules [29, 39]. PUFA with a 20-carbon chain (eicosa), such as AA, DGLA and EPA are precursors for the formation of the eicosanoids. Prostanoids, including the prostaglandins (PG) and tromboxanes (TX), and leukotrienes (LT) are the most important classes of eicosanoids. Besides these, also lipoxins LX), resolvins, isoprostanes, isofurans and epoxyeicosatrienoic acids (EET) are part of the eicosanoid family. The eicosanoid family is very diverse and as a result they are involved in the regulation of a broad range of cell and tissue responses e.g. the modulation of immune responses, inammation [39, 40], regulation of blood pressure and blood clotting [41], but also for instance in reproductive processes and tissue growth and repair [42, 43]. The rst step in eicosanoid biosynthesis is the mobilisation of AA, DGLA or EPA from phospholipids or diacylglycerol in the cell membrane (Figure 3). Most eicosanoids in mammals derive from AA as the membranes of most cells contain large amounts of AA as compared to the other eicosanoid precursors. Phospholipases, in particular phospholipase A2, cleave and release the eicosanoid precursors from the cell membrane as free FA. These serve as substrates for the synthesis of eicosanoids via two major enzymatic pathways: the cyclooxygenase (COX) pathway and the lipoxygenase (LOX) pathway (Figure 3). The enzyme cyclooxygenase has three isoenzymes, COX-1, COX-2 and COX-3, the last
Chapter 2

being a splice variant of COX-1. COX-1 is a constitutively expressed enzyme found in most mammalian cells where COX-2 is an inducible enzyme, that is rapidly produced especially in immune cells, at sites of inammation. Oxygenation of the eicosanoid precursors by the COX enzymes leads to prostaglandins

34

(PG) and thromboxanes (TX). The LOX pathway involves three types of lipoxygenase enzymes: 5-, 12- and 15-lipoxygenase (5-LO, 12-LO, 15-LO) and yields the LT, the hydroperoxy-eicosatetraenoic acids (HPETE), the hydroxyeicosatetraenoic acids (HETE) and LX. AA is the principal compound for the 2-series PG and TX and the 4-series LT and LX, whereas DGLA may be metabolised along various enzymatic paths: COX activity resulting in the 1-series PG, 5-LO activity giving rise to the 3-series LT and 15-LO activity leading to production of 15-hydroxy-DGLA (15-OH-DGLA). Metabolism of EPA, being the n-3 counterpart of AA results in the synthesis of the 3-series PG and the 5-series LT via the COX and 5-LO pathway respectively, next to 12-HEPE and 15-HEPE via the 12-LO and 15LO pathways (Figure 3). Recent research has identied a novel group of mediators generated from EPA and DHA by COX-2: the E-series resolvins. Metabolism of DHA by the COX-2 pathway results in the Dseries resolvins, docosatrienes and neuroprotectins.

Figure 3. Pathway for the conversion of arachidonic acid and eicosapentaenoic acid to eicosanoids

Eicosanoids are the key link between PUFA and inammation, playing important roles in the regulation of an inammatory response. Biosynthesis is initiated at sites of acute inammation, the earliest response to tissue injury, infection or immunological challenge [40]. For instance, an exogenous trigger like bacterial endotoxin can directly activate monocytes and macrophages to produce eicosanoids like PG. Eicosanoids modulate the intensity and duration of inammatory responses since they act both as mediators in their own right (PGE2 increases vascular permeability) and modify responses to other mediators (PGE2 potentiates pain caused by bradykinin), besides acting as regulators of other processes

Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 35

like leukocyte chemotaxis and inammatory cytokine production. The overall physiologic effect depends on the cells present at the site of inammation, the nature of the stimulus, the timing and concentration of eicosanoid production, the balance between the different eicosanoids generated and the sensitivity of the target cells and tissues for the different eicosanoids [9]. Two potent inammatory eicosanoids are prostaglandin E2 (PGE2) and leukotriene B 4 (LTB 4), both synthesized from AA. The pro-inammatory effects of PGE2 include the induction of fever, increasing vascular permeability, and vasodilatation, enhancing pain and oedema caused by bradykinin and histamine, and increasing the production of IL-6. On the other hand, PGE2 suppresses lymphocyte proliferation and natural killer cell activity, and inhibits the production of TNF-, IFN-, IL-1 and IL-2. It stimulates the production of IgE by B cells, but does not inuence the production of Th2 cytokines. It has been shown that PGE2 induces COX-2 expression in broblasts and upregulates its own production as such [44]. Alternatively it inhibits 5-LO production and so decreases the production of the 4-series of LT and it induces 15-LO, thereby promoting the production of lipoxin A 4 (LXA4) [45, 46] . Lipoxins, also derivatives of AA, possess both potent anti-inammatory and pro-resolution actions, in that they play an important role in termination of inammation [47]. Thus, PGE2 is a good example of an eicosanoid having inammatory as well as immunosuppressive and anti-inammatory effects [40]. In contrast, LTB 4 has only inammatory characteristics as it increases vascular permeability, enhances local blood ow and is a potent chemotactic agent for leukocytes. It induces the release of lysosomal enzymes, enhances the generation of reactive oxygen species by granulocytes, promotes natural killer cell activity and regulates the production of proinammatory cytokines like TNF-, IL-1, IL-6, IL-2 and IFN- [40, 48]. Eicosanoids derived from the long chain n-3 fatty acid EPA are mainly the 3-series PG and the 5-series LT, which are less potent than their counterparts formed from AA. For instance LTB5 is 10- to 100-fold less potent as a neutrophil chemotactic agent compared to LTB 4 [9, 49, 50]. The E-series resolvins, D-series resolvins, docosatrienes and neuroprotectins, like the lipoxins, can be generated in the presence of aspirin. For instance, human endothelial cells expressing COX-2 and treated with aspirin transform EPA to 18R-HEPE, which is further metabolised by 5-LO of leukocytes to resolvin E1. The D-resolvins seem to be of specic importance as they have proven to regulate particularly T cell trafcking and can play a role in the protection of lung-associated tissue damage in murine models of asthma [47, 51, 52].
Chapter 2

For example trout sh synthesize resolvin D as well as docosatrienes from endogenous DHA. In the future it may well be that these protective and anti-inammatory compounds are included as supplements rather then or in combination with their precursors EPA or DHA [53].

36

By partly replacing the n-6 PUFA-rich oil in diets with for instance sh oil, which contains long chain n-3 PUFA, EPA is incorporated into cell membranes of most cells of the body, including inammatory and immune cells, at the expense of AA. Consequently, less AA is available for eicosanoid synthesis. In addition EPA and DHA competitively inhibit the oxygenation of AA by COX and, even more important, EPA itself is able to act as a substrate for both the COX- and LOX pathways. As such it results in the n-3 series of eicosanoids which are biologically less potent than analogues synthesized from AA. This reduction in generation of AA-derived mediators, together with the production of less potent and even anti-inammatory mediators, has led to the idea that sh oil is anti-inammatory in general.

3.1. PUFA and cytokine production Until now many studies investigated the effects of EPA and DHA on several immune markers in animal models but also in healthy individuals and humans suffering from a chronic inammatory disease like arthritis or inammatory bowel disease (see chapter PUFA and chronic diseases) in which inammatory responses occur in an uncontrolled manner leading to severe damage to the host tissues [19]. Increased concentrations of cytokines produced by monocytes, macrophages and T cells, like IL-1, IL-6 and TNF-, give rise derived from the n-6 path: PGE2 and LTB 4. LTB 4 is chemotactic for leukocytes and induces the release of TNF-, IL-1 and IL-6 by macrophages [40, 48] and the production of IL2 and IFN- by T cells. PGE2 inhibits the production of Th1 type cytokines (IL-2 and IFN) by T cells and of TNF- [19] by macrophages but induces production of IL-6 [9, 54]. Based on this regulation of inammatory cytokine production by AA-derived eicosanoids, it is expected that substitution of n-6 by n-3 PUFA affects cytokine production due to altered eicosanoid synthesis [54, 55]. A very recent review thoroughly discussed all relevant trials on this subject by considering the inuence of n-3 PUFA on cytokine production in healthy individuals related to the effects seen in patients suffering from a chronic inammatory disorder [19]. They summarized the results of the studies investigating the effects of EPA and DHA on ex vivo cytokine production by T cells and monocytes. With respect to the effect of n-3 PUFA on lymphocyte function, their conclusion is short but clear: results from these studies are highly inconsistent and therefore no conclusion can be drawn. In any case no evidence was found that EPA inuences the Th1 versus Th2 balance in favour of the Th1 phenotype. Also with respect to the effect of EPA and DHA on the production of inammatory cytokines by monocytes they concluded that the number of studies that do not nd any signicant effects outnumber the studies showing opposite effects. In none of the studies an increase in inammatory cytokine production was found after supplementation with long-chain PUFA [19].
37 Polyunsaturated fatty acids and immune functions in chronic inammatory disorders

to tissue damage. The production of these cytokines is partly regulated by eicosanoids

3.2. PUFA and cell adhesion molecules During the subsequent phases of an immune response changes in cellular trafcking patterns take place due to altered expression of cell adhesion molecules (CAM) and activation of vascular endothelium. CAM are cell surface proteins responsible for interaction with other cells or with the extracellular matrix and may be involved in inter- and intracellular signaling [56-60]. Adhesion molecules belong to one of four protein families: the integrin (e.g. VLA-4, LFA1, Mac-1), the selectin (E-, L- and P-selectin) or cadherin family (E-, P- and N-cadherin), or to the immunoglobulin super(gene)family (e.g. intercellular cell adhesion molecules (ICAM), vascular CAM (VCAM), neuronal CAM (NCAM). The leukocyte adhesion cascade is a sequence of adhesion and activation events that ends with extravasation of leukocytes and migration to the site of inammation where they can exert their effects. Recently the knowledge of the different steps in the leukocyte adhesion cascade was reviewed, e.g. capture, rolling, slow rolling, arrest, adhesion strengthening and spreading, intravascular crawling and para- and transcellular transmigration to the site of inammation where cells can exert their effects, events that occur subsequent to endothelial activation [61]. In several acute and chronic inammatory diseases expression of adhesion molecules appears to play a role in the pathogenesis of the disease [62]. PUFA might inuence expression of these molecules by exerting effects on inammatory gene expression through direct actions on the intracellular signaling pathways and the subsequent activation of transcription factors [54, 63]. A decreased expression of adhesion molecules on the surface of monocytes, macrophages or endothelial cells after exposure to long chain n-3 PUFA is reported in various studies [64-69]. The group of Caterina et al. (1994) were the rst to show that culture of human saphenous venous endothelial cells (HSVEC) with DHA decreased cytokine-induced surface expression of E-selectin, ICAM-1 and VCAM-1 [64]. Also DHA pretreatment reduced the IL-1 induced production of IL-6 and IL-8 by HSVEC. They also studied the functional consequences of this nding by investigating the adherence of human monocytic cells to the HSVEC which depends on VCAM-1 expression [70]. HSVEC need cytokine stimulation to induce expression of adhesion molecules and the IL-4- and IL-1- induced adhesion of monocytes to HSVEC was signicantly reduced after DHA treatment. The extent of the inhibitory effect on VCAM-1 paralleled the incorporation of DHA into cellular phospholipids and the overall incorporation of n-3 PUFA and was inversely related to the amounts of n-6 FA [71]. Kim et al. [72] showed that besides DHA also EPA inhibited LPS- induced expression
Chapter 2

of VCAM-1, ICAM-1 and E-selectin on HSVEC and Khalfoun et al. [69] reported a reduced expression of only VCAM-1 after treatment of endothelial cells with EPA and DHA. Cell culture experiments indicated a decreased surface expression of ICAM-1 on monocytes stimulated with IFN- after supplementation with both EPA and DHA [66]. In another study on EPA and

38

DHA supplementation in healthy humans the same group showed a lower level of ICAM-1 expression on the surface of blood monocytes stimulated with IFN- ex vivo [73, 74].

3.3. PUFA and gene expression Many effects of dietary FA are related to changes in lipid composition of the cell membranes that subsequently affected membrane uidity or eicosanoid production. In the past it was believed that these mechanisms were primarily responsible for the effects of FA on gene expression, but this idea changed when it became evident that FA are capable of binding directly to nuclear receptors thereby affecting gene transcription [75]. Several metabolic pathways in the liver may be regulated by PUFA through interaction with at least three nuclear receptors: peroxisome proliferator-activated receptor (PPAR), liver X receptors (LXR) and hepatic nuclear factor-4 (HNF-4) and by regulating at least two transcription factors: e.g. sterol regulatory element binding proteins (SREBP) [76] and nuclear factor B (NFB). This paragraph will mainly focus on both the nuclear receptor PPAR and the transcription factors SREBP-1c and NFB as their regulation by PUFA is well established. The family of PPAR consists of PPAR, mainly expressed in T and B cells and of PPAR and PPAR, dominating in cells of the myeloid lineage [2, 77]. Both n-3- and respect to chain length and number of double bonds [77-81]. Binding of PUFA to PPAR in general results in the induction of genes involved in fatty acid -oxidation, like acyl-CoA oxidase [76, 82, 83], but have also shown to inuence genes involved in cell proliferation, cell differentiation and inammation [84, 85]. The PPAR-mediated regulation of the inammatory response is largely a result of their transrepression abilities. Most of their anti-inammatory properties depend on their ability to antagonize NF-B and AP-1 signalling pathways. By inhibiting these transcription factors the PPARs repress the expression of several genes involved in inammatory reponses like inammatory cytokines (TNF-, IL-1 and IL-6), celladhesion molecules (VCAM-1) and other pro-inammatory signal mediators like the inducible production nitric oxide (iNOS) and matrix metalloproteinase 9 (MMP9) [86]. Moreover PPAR are reported to play a role in the control and duration of the inammatory response by inducing genes encoding proteins involved in the catabolism of pro-inammatory lipid mediators [86]. NF-B, involved in inducing a range of inammatory genes including COX2, IL-1 and IL-6 also regulates the expression of adhesion molecules like ICAM-1, VCAM1 and E-selectin [87]. N-3 FA have been shown to decrease the transcriptional activation through a decreased activation of the NF-B system of transcription factors, secondary to decreased generation of reactive oxygen species like intracellular hydrogen peroxide (H2O2) and iNOS. In experimental systems, De Caterina et al. [13] could document a decrease in baseline production of H2O2 (or some of its downstream products) after cell membrane
39 Polyunsaturated fatty acids and immune functions in chronic inammatory disorders

n-6 PUFA share binding afnities for PPAR and no relationship has been found yet with

enrichment with DHA. Other studies conrmed a down-regulatory effect of n-3 PUFA on the activity of NFB ([88-90]. Some NF-B-regulated genes like TNF- are also inducers of NF-B and in this way increase the inammatory response [91, 92]. A very recent study reported suppression by n-3 PUFA of TNF- induced expression of the adhesion molecules ICAM-1 and VCAM, but not selectin-E on human umbilical vein endothelial cells dependent on the concentration and type of n-3 fatty acid. However, they could not prove that the decreased expression of these adhesion molecules was related to an attenuated activity of the NF-B as was shown for conjugated LA. The authors suggest involvement of other transcription factors, like AP-1, in the FA regulation of adhesion molecule expression [93]. SREBP-1c plays a key role, together with PPAR, in the regulation of desaturases by PUFA. Both -5-, -6-desaturase and stearoyl-CoA desaturase (SCD which catalyses the synthesis of oleic acid) are suppressed by dietary PUFA [29]. Horrobin proposed a relation between altered desaturase activity and atopic diseases [94, 95]. The SREBP are membrane-bound transcription factors that initiate the transcription of genes involved in cholesterol and FA synthesis. SREBPs have two isoforms, SREBP-1 and SREBP-2, whereas SREBP-1 exists in two subforms, SREBP-1a and SREBP1c [96-98]. SREBP1c is the predominant isoform in rodent and human liver and mainly involved in activating genes for fatty acid synhesis [99]. PUFA suppress the transcription of these genes by reducing the active form of SREBP-1c [100, 101]. Effects from PUFA on gene expression are not only observed in the liver, but also on cells of the small intestine, pancreas, brain and the immune system [76, 102-105].

4.

PUFA and chronic diseases

4.1. Arthritis More than 200 different types of arthritis have been described but osteoarthritis (OA; degenerative arthritis) and rheumatoid arthritis (RA) are the most common forms of arthritis recognized in people [17]. Osteoarthritis in general is a disease affecting the eldery and represents a heterogeneous group of joint disorders in patients presenting with joint pain and stiffness [106, 107]. In human as well as dogs the OA process involves the entire synovial joint, encompassing the synovium, cartilage and underlying bone [106, 108]. The inammation is likely to start with a degeneration of articular cartilage and subsequent loss of proteoglycan and collagen, followed by the formation of new bone at joint surfaces and margins [107, 109]. In patients suffering from RA, although clinical signs are comparable,
Chapter 2

destruction of the integrity of the joint is the result of the activity of the immune system [110]. The inltrate characterizing the joint lesions in RA consists of activated macrophages, T lymphocytes and plasma cells [9, 19]. Numerous trials have been conducted to investigate the inuence of long chain n-3 FA,

40

mainly EPA and DHA on several laboratory and clinical parameters of RA, such as production of the inammatory cytokines and eicosanoids, morning stiffness, joint pain and -swelling, global patients assessment, but also e.g. the reduction in the amounts of non-steroidal anti-inammatory drugs used to control disease. A recent review of Calder [9] summarized these different trials and came to the conclusion that reasonably strong evidence suggests that long chain n-3 PUFA have some clinical benet in RA. However, an earlier report of the Agency for Healthcare Research and Quality (AHRQ) that primarily focused on data achieved from randomized controlled trials and a meta-analysis of a selection of nine of these studies, reported the opposite [111], as did others [112-117]. The disagreement might be based on a difference in the denition of benet [2]. In the dog OA may be differentiated in primary OA (most often associated with age) and secondary OA which has a primary cause like developmental disorders (e.g. hip dysplasia, fragmented coronoid process), a history of joint trauma (e.g. fracture, luxation), septic or nonseptic arthritis. An important risk factor to develop OA is obesity and a genetic factor seems to play a role as some dog breeds, like Labrador Retrievers, are more prone to develop OA [118]. Cartilage damage causes synovitis accompanied by the release of inammatory mediators like IL-1, IL-6, IL-8, GM-CSF and TNF- and subsequently of metalloproteinases which causes further degeneration of cartilage. This results in the liberation of mainly AA like PGE2 and LTB 4, responsible for the clinical signs of osteoarthritis e.g. painful, warm and swollen joints. The classical treatment of OA in the dog comprises the use of nonsteroid anti-inammatory drugs which inhibit the COX enzymes or corticosteroids which suppress phospholipase activity. To alleviate or reduce the need for these conventional drugs a variety of dietary supplements, also called neutraceuticals, like glucosamines, chondroitine sulfate, antioxidants, collagen hydrolysates, and PUFA are used in the treatment of OA in dogs. Green lipped mussel (Perna caniculus; GLM) powder contains a PUFA quantity of about 47% of which more than 80% are n-3 FA (mainly EPA and DHA) [119]. Its anti-inammatory activity may be attributed to unique n-3 FA present in the mussel like eicosatetraenoic acid (ETA), that inhibits the action of both COX and LOX [120-123]. Together with anti-oxidant micronutrients, the use of both the PUFA supplements and GLM is based on diverting the production of prostaglandins and leukotrienes from the inammatory 2- and 4-series to the less inammatory PGE1, PGE3 and LT5 series [124]. In contrast to human studies, in dogs most of these products lack well-designed controlled clinical trials to show their efcacy in the treatment of OA. The effect of a diet high in n-3 FA (4%) versus a diet high in n-6 FA (38%) was investigated in a double-blind study of 36 dogs with OA of the elbow joint [239]. Although the diet high in n-3 FA gave rise to a signicant increase in plasma LTB5, one of the less potent inammatory eicosanoids, no clinical effect was observed . A double blind, randomized, controlled trial performed to test the efcacy of GLM powder in OA showed that
41 Polyunsaturated fatty acids and immune functions in chronic inammatory disorders

from the destructed cell walls, which is further metabolized into inammatory eicosanoids

GLM powder was effective in reducing the arthritic symptoms like total arthritic scores and scores for joint pain and swelling that were signicantly reduced following 6 weeks of GLM supplementation [120]. A GLM-supplemented commercial diet showed an overall positive impact on all the arthritis scores, pain and mobility [125]. These effects were conrmed in another study following dogs for 112 days [126]. No studies investigated the effect of n-3 PUFA on different parameters in canine RA. With respect to the cytokine proles and types of cells inltrating the joints, canine RA shows similarities with human RA [127, 128]. Based on these similarities n-3 PUFA also might be of benet in canine RA.

4.2. Inammatory bowel disease In human, chronic inammatory gastrointestinal disorders, including Crohns disease and ulcerative colitis, are collectively referred to as Inammatory Bowel Disease (IBD). They are multifactorial in origin and polygenic in nature and their precise etiology has not been determined [129, 130]. Crohns disease can affect any part of the digestive tract but primarily the small intestine along with the colon and other organs, whereas ulcerative colitis affects the colon and rectum with inammation restricted to the mucosa [131]. In the intestinal mucosa of patients with IBD and in animals suffering from experimental dextran sodium sulfate-induced colitis elevated levels of (pro)inammatory cytokines, like TNF-, IL-1, IL12 and IFN-, and eicosanoids such as LTB 4 [132-136] are present in the mucosa. AAderived eicosanoids and inammatory cytokines play a role in the pathogenesis of IBD. An increase in n-3 PUFA intake might diminish production of AA-derived eicosanoids, thereby reducing the requirement for immunosuppressive agents. Likewise, an association between an increase in the incidence of Crohns disease in Japan and an increase in the FA ratio of n-6 to n-3 in the diet was reported [137]. In addition, various studies investigated the effect of n-3 PUFA supplementation on several clinical parameters related to IBD, rates of induced remission, relapse episodes and requirements for steroids and other immunosuppressive agents used to control disease severity. However, conclusions drawn from these studies are of limited value because of the scarcity of random-controlled, clinical trials describing the effect of n-3 supplementation on IBD. It was concluded from a meta-analysis which assessed the combined effect of a number of intervention studies, that n-3 PUFA did not have an effect on the relative risk of relapse in ulcerative colitis patients [138]. Hence, it can be concluded at this point that more valid studies are needed to warrant a dietary recommendation in the management of IBD. Future studies should precisely mention
Chapter 2

the dose, source and type of n-3 FA used, as this may be of signicance to the clinical outcome. In addition, studies should include an assessment of total dietary n-6 and n-3 FA intake as baseline consumption of these FA may inuence the effects of supplementation with n-3 FA.

42

Animal models of colitis have shown benecial effects of dietary FA [139-146]. A recent study in transgenic mice that endogenously biosynthesize n-3 PUFA from n-6 PUFA, showed that a higher n-3 PUFA tissue status (a ratio of long-chain n-6 PUFA: long-chain n-3 PUFA of 1.7 in transgenic mice versus 30.1 in wild type mice) did result in a signicantly increased synthesis of anti-inammatory resolvins, protectins and n-3 PUFA-derived eicosanoids [147]. Simultaneously a decrease in the amount of inammatory cytokines like TNF- and IL-1 was found, which has earlier been reported to be the consequence of the actions of n3-derived resolvins and protectins [148-150], probably by inhibition of NF-B. A decrease in NF-B protein activity in the transgenic mice was conrmed in this study. Moreover, an enhanced mucoprotection was shown as higher levels of mucoprotective factors like Tollip, TFF3 and ZO-1 were measured in the colon of the transgenic mice, which might be based on an upregulation or maintenance of these protective factors by n-3 PUFA-derived lipid mediators. No signicant differences were found in the amounts of AA, PGE2 and LTB 4 between the transgenic and wild type mice. In a study using a scid mouse model of colitis, mice were fed a n-3 FA enriched diet or control diet for three weeks before induction of colitis [151]. These mice had signicantly reduced numbers of T cells and myeloid cells inltrating the colon mucosa together with decreased expression of TNF-, IL-12 and IL-1 compared with the mice fed the control explained by the decreased synthesis of these proinammatory cytokines. Also in dogs and cats IBD refers to a group of chronic, idiopathic gastrointestinal disorders and is probably the most common cause of chronic diarrhea and vomiting [152-154]. Lymphoplasmacytic enteritis is the most common type of IBD. In cats the stomach and small bowel are affected most often, whereas in dogs IBD is commonly associated with small and large bowel inammation. Apart from IBD caused by Trichuris and Giardia infection, dietary allergy and intolerance, in a substantial proportion of animals disease may be controlled by long term glucocorticoids or combinations with cytostatic drugs, sulfasalazine, and diets. As nutritional intervention plays a key role in the successful management of many gastrointestinal diseases in dogs and cats [155, 156], more specically n-3 FA more specically might be useful in decreasing intestinal inammation in IBD as an alternative for immunosuppressive agents, especially since these drugs may even increase the risk of complications due to infections [157].
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 43

diet. The clinically improved colitis and the altered colonic immunopathology were in part

4.3. Asthma and atopic dermatitis Asthma is a chronic inammatory disorder of the lower respiratory tract characterized by airway inammation and obstruction, due to hyperresponsiveness,to a variety of stimuli that lead to recurrent episodes of wheezing, breathlessness, chest tightness, excessive mucus production and cough. Genetic factors, exemplied by a history of asthma or atopic dermatitis (AD) in the family, environmental factors (e.g. differences in allergen exposure, occupational exposure, air pollution, viral infections, allergen exposure, lack of exposure to environmental bacteria at young age) and life style factors (e.g. smoking habits, food) determine onset and development of the disease [158-161]. The development of allergic asthma consists of three phases, the induction phase, the early-phase asthmatic reaction and the late-phase asthmatic reaction. Each phase is characterized by the production and interplay of various cell-derived mediators [162]. Atopic dermatitis is a chronic inammatory skin disease associated with cutaneous hyperreactivity to environmental triggers which are harmless to normal nonatopic individuals [163, 164]. In AD the antigen presenting cells, like Langerhans cells and inammatory dendritic epidermal cells are important in subsequent activation of allergen-specic T cells following the extravasation and activation of macrophages and eosinophils that is orchestrated by the local tissue expression of proinammatory cytokines and chemokines. During recent years the potential therapeutic and protective effect of dietary supplementation with n-3 FA in asthma and AD gained interest. As mentioned before, the production of anti-inammatory eicosanoids and lipid mediators (resolvins and protectins) might decrease inammation through effects on membrane uidity and consequent cell signaling and gene transcription [9, 28, 32, 165, 166]. NF-B activity is upregulated in bronchial epithelial cells and macrophages of asthmatic individuals which results in a higher production of inammatory cytokines, nitric oxide and eicosanoids [167-170]. In addition, various experiments supplementing n-3 PUFA indicated an inhibition of proinammatory cytokine and nitric oxide production by inactivation of the NF-B pathway [171-174]. Horrobin (1987) [175] was the rst to link the consumption of n-3 FA to the reduced incidence and severity of asthma and other chronic inammatory diseases in Eskimos [176]. The AHRQ published a review with the following purpose: to systematically review the scientic-medical literature in order to identify, appraise, and synthesize the evidence for possible treatment effects of n-3 FA in asthma [177]. Eleven randomized controlled trials were selected but no denite conclusions could be drawn regarding the efcacy of n-3 fatty acid diet supplementation in the treatment of asthma in children and adults. Likewise,
Chapter 2

these studies were inconclusive regarding the inuence of these FA on the mediators of inammation probably involved in the pathogenesis of asthma. In fact, many studies had no control of background diets, inadequate blinding of the subjects to treatment, were statistically underpowered or had inproper controls to allow interpretation of the results. No improvement

44

in lung function, symptoms of asthma, clinical scores and rescue inhaler use was found [178, 179]. Finally, a meta-analysis was not possible due to missing data (e.g., sample sizes; type and dose of n-3 FA; type and dose of concurrent asthma medication), poorly or heterogeneously dened populations (e.g. age; diagnosis) and interventions (e.g. sources, doses and dosing method of the n-3 FA). Another important factor to consider in future studies is the possible genetic variation in individual inammatory and immune responses to dietary changes. In this respect it might be an important investment to investigate the existence of genotype-PUFA response interaction at the level of the immune system [2]. The number of studies reporting the health effects of n-3 FA on AD is limited [95]. Knowledge regarding the potential relationship between AD and EFA metabolism stems from research in the beginning of the last century. A rst indication was found when rats, fed a diet deprived of unsaturated FA, developed a scaly dermatitis [180, 181]. The skin abnormalities of these EFA-decient rats were found similar to skin lesions of human patients suffering from AD. Hence, it was indicated that atopic eczema relate to abnormalities in EFA metabolism, in particular a decit in dietary LA and ALA [182-184]. Some studies conrmed the hypothesis that the enzyme 6-desaturase, which converts linoleic and ALA to their further metabolites, has a reduced activity in AD patients [185-191], whereas others did not [187-190, 192]. The question whether the FA changes were a consequence or a cause of atopic dermatitis was decrease for DGLA and AA preceded the development of skin lesions and might play a role in the initiation of AD. During the rst 3 months of life babies were all free of eczema and so differences in FA could not have been caused by the eczema that occurred subsequently. In summary, at this moment two hypotheses have been proposed linking PUFA to atopic disease [36]. The rst hypothesis suggests that abnormalities in fatty acid metabolism are due to an impaired activity of -6 desaturase resulting in lower amounts of both long chain n-6 and n-3 PUFA. The possible causal relation of a lower amount of n-6 FA and an atopic state is in obvious contrast with the hypothesis that metabolites of n-6 FA are responsible for pro-inammatory metabolites causing chronic inammatory diseases like AD. However, the possible impairment in the function of -6 desaturase also results in lower amounts of n-3 FA as both LA and ALA are metabolized by the same set of enzymes. A lack of these long chain n-3 FA might contribute to the atopic state, as these FA have proven to possess anti-inammatory characteristics, not only because they compete with AA metabolism, but also because their metabolites are far less inammatory than their n-6 counterparts but also in addition give rise to anti-inammatory mediators like resolvins, docosatrienes and neuroprotectins. In conclusion, many studies described changes in the amounts of n-6 and n-3 metabolites in atopic disease, possibly related to changed activity of -6 desaturase. In that case relative deciencies of the n-3 or the n-6 FA may not equally contribute to the atopic state.
45 Polyunsaturated fatty acids and immune functions in chronic inammatory disorders

addressed by Galli et al [193]. They showed that a signicant increase of LA and a signicant

The second hypothesis is based on the link between an increased consumption of LA and the epidemic rise in allergic diseases over the last decades [20, 114]. A higher consumption of LA results in higher amounts of its metabolite AA [194] in cell membranes and subsequently of PGE2 production. PGE2 has been shown to favour T cell differentiation towards the Th2 phenotype [166, 195-197] and to switch antibody production towards IgE antibodies [198], both being characteristics of atopic disease and thus this theory might in part explain the increase of allergic diseases. However, unexpectedly, most studies nd lower amounts of both n-6 and n-3 metabolites [185-187, 190, 191]. Lower amounts of AA do not t with the increased intake of LA over the last decades and should be explained. It has been suggested that in AD the lower levels of AA might result from an increased depletion of this metabolite by the inammatory process in AD [36]. A combination of both hypotheses might also be true: a higher intake of LA results in a higher production of AA and its metabolites, but if in atopic subjects an impairment of -6 desaturase is present, this might still result in lower amounts of n-6 and n-3 metabolites. Future research in human and animals focusing on these hypotheses shed more light on the potential of PUFA modulation by dietary supplementation. From the late eighties until 2001 about thirty studies investigated the effect of EFA on canine AD [199]. Until the early 1990s all studies had an open experimental design, diets were not standardized, the study duration was two weeks at maximum, or the included cases were not exclusively AD patients [200-206]. Besides, all studies focussed on n-6 EFA supplements, which varied enormously in amount between these studies. It may be obvious that because of these failures in study design the results were often conicting and inconsistent, even if exactly the same EFA supplement was used. These open studies were followed by randomised, blinded, placebo-controlled trials (19921999) [207-214]. However, only two out of eight studies lasted longer than 9 weeks [208, 211]. In seven trials only the effects of n-6 supplementation was investigated, but in none of these the diets were standardized, which could account for a substantial variability in total EFA intake [207, 208, 210-214]. Consequently, this may explain the signicant variability in the reduction of pruritus or overall clinical improvement. In none of the studies sofar fatty acid proles of the skin were investigated. It would be interesting to nd support for the hypothesis that in dogs, like in human, fatty acid metabolism differs between atopic and healthy individuals. More specically, an impaired activity of -6 desaturase, -5 desaturase or both has been proposed in this species [215-218]. Secondly, with respect to the diet trials it is of importance to assess if and how adjustment of the n-3
Chapter 2

and n-6 FA in the diet is reected in the fat proles of the skin [199]. An in vitro study which evaluated the production of LTB 4 in LPS-stimulated normal canine skin and in activated neutrophils from normal healthy dogs, suggested that dietary n-6 to n-3 ratios of 5-10:1 were optimal in reducing LTB 4 production [219, 220]. Clinical effect of dietary

46

PUFA was reported in several open, uncontrolled studies in dogs with AD [217, 221, 222], but only after the year 2001 few double-blinded, randomised trials were performed [223225]. However, diets were not standardized in these trials [223, 224] and none of the studies did nd a relation between the total n-3 FA, total n-6 FA intake or the n-6: n-3 FA ratio and the clinical outcome. Most studies reported that supplementation with ALA, EPA and DHA resulted in signicant higher concentrations of these FA in plasma and skin together with a decrease in AA or total n-6 amount [223, 225]. One study measured a signicant decrease in serum PGE2 only in the diet high in EPA and DHA (n-6: n-3 FA ratio of 1:1). The study of Baddaky-Taugbl et al. [240] reported a signicant reduction in the pruritus and erythema scores after 10 weeks of treatment with a test diet rich in EPA and DHA, which might be explained by the signicant higher amounts of n-3 FA in plasma and skin of these dogs. These observations were supported by the study of Saevik et al [226], that showed that AD dogs receiving a diet high in borage and sh oil, needed lower amounts of prednisolone after 8 weeks on the test diet. This might imply that after this time the n-3 FA concentration in the skin reached a level sufcient to suppress clinical signs. A key question following from many studies is whether the absolute concentration of n-3 PUFA or the ratio of n-6: n-3 PUFA in the diet is most relevant for the n-3 composition of plasma (and skin) and its impact on immune parameters [194, 227-229]. In a study in healthy is more important than the n-6 to n-3 FA ratio [227]. However, the authors state that further studies should determine the minimum and maximum intake of n-3 FA necessary to exert favourable effects relevant to specic diseases. In other studies of the same group in healthy aged dogs, effects of different ratios of n-6 to n-3 FA in the diet were assessed [228, 229]. When dogs were fed a sh oil-enriched diet (n-6: n-3 ratio of 1.4:1) cell mediated immunity was depressed and PGE2 production by stimulated mononuclear cells was decreased [229]. Moreover, after immunization with keyhole limpet hemocyanin, dogs fed this high n-3 diet diet showed an increased total number of T lymphocytes and a reduced number of CD4+ T cells with a subsequent decrease in the ratio of CD4+/CD8+ T cells [228]. Enrichment of the food with sh oil resulted in an increased production of LTB5 and the ratio of LTB5 -LTB 4 correlated with the ratio of plasma EPA-AA, the latter ratio being consistent with the dietary ratio of n-6: n-3 FA [194]. These studies support the hypothesis that feeding diets high in n-3 FA result in the replacement of AA in cell membranes by EPA which in turn leads to increased production of eicosanoids derived from n-3 PUFA. As mast cells are also important immune effector cells in the pathogenesis of AD [230232], it is of interest to investigate the inuence of EFA on mast cell and the production and release of mediators. Gueck et al. used a canine mastocytoma cell line (C2) as a model for canine AD to study these effects [233-236]. In a rst study in which the cell line was supplemented with either LA or ALA, both FA were incorporated in the cell membranes of
47 Polyunsaturated fatty acids and immune functions in chronic inammatory disorders

dogs which directly addressed this question, it was shown that the absolute dose of n-3 FA

the C2 cells [234]. After supplementation with ALA increased levels of ETA and EPA were measured together with a decreased production of PGE2 after stimulation. Supplementation of the C2 cells with AA resulted in increased release and activity of mast cell mediators. When these cells were supplemented with EPA these effects were also observed but were signicantly lower. The authors assumed that elevated lipid hydroperoxides produced from supplemented AA and EPA are related to the degranulation process, with stronger pro-oxidative effects of AA versus EPA. Supplementation with GLA resulted in increased levels of GLA and DGLA, but not of AA, which implies that conversion of DGLA to AA is impaired [233]. The enzyme -5 desaturase is responsible for this step and a decient or lower activity could be the explanation. Another potential reason for the unchanged AA content is a preferential metabolism of AA versus DGLA by PGHS1, ie rapid metabolism of AA. Moreover, GLA supplementation resulted in a reduced histamine release, which was explained by the assumption that the increased levels of DGLA parallel higher amounts of PGE1 and thereby inhibit histamine release [237, 238]. Finally, supplementation with DHA resulted in an increase of DHA and EPA together with a decreased production of PGE2, indicating competition between AA and EPA. In addition, the concentrations of each of the individual FA in C2 cells increased, after supplementation of these cells with LA, GLA, AA, ALA, EPA and DHA [236]. Also the elongated and -6 desaturated products of these FA showed signicantly elevated levels, but products resulting from -5-desaturation were not measurable. Based on these results the authors assumed that C2 do not have measurable activity of the -5 desaturase and if deciency of this enzyme might be a factor related to the pathogenesis of canine AD, this cell line could be used as a model for further investigation in AD.

Chapter 2 48

REFERENCES
1. Connor WE. Importance of n-3 fatty acids in health and disease. Am J Clin Nutr 2000: 71(1 Suppl): p. 171S-5S. Fritsche K. Fatty acids as modulators of the immune response. Annu Rev Nutr 2006: 26: p. 45-73. Harbige LS. Fatty acids, the immune response, and autoimmunity: a question of n-6 essentiality and the balance between n-6 and n-3. Lipids 2003: 38(4): p. 323-41. Peck M. Interaction of lipids with immune function I: biochemical effects of dietary lipids on plasma membranes. J Nutr Biochem 1995: 5: p. 466-78. Alonso MA and Millan J. The role of lipid rafts in signalling and membrane trafcking in T lymphocytes. J Cell Sci 2001: 114(Pt 22): p. 3957-65. Simons K and Toomre D. Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 2000: 1(1): p. 31-9. Calder PC and Yaqoob P. Lipid rafts--composition, characterization, and controversies. J Nutr 2007: 137(3): p. 545-7. Kinsella JE, Broughton KS, and Whelan JW. Dietary unsaturated fatty acids: interactions and possible needs in relation to eicosanoid synthesis. J Nutr Biochem 1990: 1(3): p. 123-41.
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 49

2. 3.

4.

5.

6. 7.

8.

9.

Calder PC. n-3 polyunsaturated fatty acids, inammation, and inammatory diseases. Am J Clin Nutr 2006: 83(6 Suppl): p. 1505S-1519S. Calder PC. n-3 polyunsaturated fatty acids and cytokine production in health and disease. Ann Nutr Metab 1997: 41(4): p. 203-34. Blok WL, Katan MB, and van der Meer JW. Modulation of inammation and cytokine production by dietary (n-3) fatty acids. J Nutr 1996: 126(6): p. 1515-33. Meydani SN. Effect of (n-3) polyunsaturated fatty acids on cytokine production and their biologic function. Nutrition 1996: 12(1 Suppl): p. S8-14. De Caterina R and Massaro M. Omega-3 fatty acids and the regulation of expression of endothelial proatherogenic and pro-inammatory genes. J Membr Biol 2005: 206(2): p. 103-16. Deckelbaum RJ, Worgall TS, and Seo T. n-3 fatty acids and gene expression. Am J Clin Nutr 2006: 83(6 Suppl): p. 1520S-1525S. Pegorier JP, Le May C, and Girard J. Control of gene expression by fatty acids. J Nutr 2004: 134(9): p. 2444S-2449S. Baillie RA, Jump DB, and Clarke SD. Specic effects of polyunsaturated fatty acids on gene expression. Curr Opin Lipidol 1996: 7(1): p. 53-5. Lunn J and Theobald H. The health effects of dietary unsaturated fatty acids. Nutr Bulletin 2006: 31: p. 178224.

10.

11.

12.

13.

14.

15.

16.

17.

18.

Simopoulos AP. Essential fatty acids in health and chronic disease. Am J Clin Nutr 1999: 70(3 Suppl): p. 560S-569S. Sijben JW and Calder PC. Differential immunomodulation with long-chain n-3 PUFA in health and chronic disease. Proc Nutr Soc 2007: 66(2): p. 237-59. Simopoulos AP. Evolutionary aspects of diet, the omega-6/omega-3 ratio and genetic variation: nutritional implications for chronic diseases. Biomed Pharmacother 2006: 60(9): p. 502-7. Thanasak J, Muller KE, Dieleman SJ, Hoek A, Noordhuizen JP, and Rutten VP. Effects of polyunsaturated fatty acids on the proliferation of mitogen stimulated bovine peripheral blood mononuclear cells. Vet Immunol Immunopathol 2005: 104(3-4): p. 289-95. Thanasak J, Rutten VP, Schonewille JT, Hoek A, Beynen AC, Noordhuizen JP et al. Effect of a dietary n-6 polyunsaturated fatty acid supplement on distinct immune functions of goats. J Vet Med A Physiol Pathol Clin Med 2004: 51(1): p. 1-9. Calder PC. Long-chain n-3 fatty acids and inammation: potential application in surgical and trauma patients. Braz J Med Biol Res 2003: 36(4): p. 433-46. Roche HM. Unsaturated fatty acids. Proc Nutr Soc 1999: 58(2): p. 397-401. Das UN. Essential fatty acids: biochemistry, physiology and pathology. Biotechnol J 2006: 1(4): p. 42039. Calder PC and Grimble RF. Polyunsaturated fatty acids, inammation and immunity. Eur J Clin Nutr 2002: 56 Suppl 3: p. S14-9. Whelan J and Rust C. Innovative dietary sources of n-3 fatty acids. Annu Rev Nutr 2006: 26: p. 75-103. Calder PC. Immunoregulatory and anti-inammatory effects of n-3 polyunsaturated fatty acids. Braz J Med Biol Res 1998: 31(4): p. 467-90. Nakamura MT and Nara TY. Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr 2004: 24: p. 345-76. Voss A, Reinhart M, Sankarappa S, and Sprecher H. The metabolism of 7,10,13,16,19-docosapentaenoic acid to 4,7,10,13,16,19-docosahexaenoic acid in rat liver is independent of a 4-desaturase. J Biol Chem 1991: 266(30): p. 19995-20000. Reddy JK and Mannaerts GP. Peroxisomal lipid metabolism. Annu Rev Nutr 1994: 14: p. 343-70. Calder PC. Polyunsaturated fatty acids and inammation. Prostaglandins Leukot Essent Fatty Acids 2006: 75(3): p. 197-202. Arterburn LM, Hall EB, and Oken H. Distribution, interconversion, and dose response of n-3 fatty acids in humans. Am J Clin Nutr 2006: 83(6 Suppl): p. 1467S-1476S. James MJ, Gibson RA, and Cleland LG. Dietary polyunsaturated fatty acids and inammatory mediator production. Am J Clin Nutr 2000: 71(1 Suppl): p. 343S-8S.

19.

20.

21.

22.

23.

24. 25.

26.

27. 28.

29.

30.

31. 32.

33.
Chapter 2

34.

50

35.

Burdge G and Calder PC. Dietary alpha-linolenic acid and health-related outcomes: a metabolic perspective. Nutrition Research reviews 2006: 19: p. 26-52. Calder PC. Abnormal fatty acid proles occur in atopic dermatitis but what do they mean? Clin Exp Allergy 2006: 36(2): p. 138-41. Bentley G. The health effects of dietary unsaturated fatty acids. Nutr Bulletin 2007: 32: p. 82-84. Givens D and Gibbs R. Very long chain n-3 polyunsaturated fatty acids in the food chain in the UK and the potential of animal-derived foods to increase intake. Nutr Bull 2006: 31: p. 104-10. Funk CD. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 2001: 294(5548): p. 1871-5. Tilley SL, Coffman TM, and Koller BH. Mixed messages: modulation of inammation and immune responses by prostaglandins and thromboxanes. J Clin Invest 2001: 108(1): p. 15-23. Calder PC. N-3 polyunsaturated fatty acids and inammation: from molecular biology to the clinic. Lipids 2003: 38(4): p. 343-52. Peskar BM, Sawka N, Ehrlich K, and Peskar BA. Role of cyclooxygenase-1 and -2, phospholipase C, and protein kinase C in prostaglandin-mediated gastroprotection. J Pharmacol Exp Ther 2003: 305(3): p. 1233-8.
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 51

36.

37. 38.

39.

40.

41.

42.

43.

Wallace JL. Nonsteroidal anti-inammatory drugs and the gastrointestinal tract. Mechanisms of protection and healing: current knowledge and future research. Am J Med 2001: 110(1A): p. 19S-23S. Bagga D, Wang L, Farias-Eisner R, Glaspy JA, and Reddy ST. Differential effects of prostaglandin derived from omega-6 and omega-3 polyunsaturated fatty acids on COX-2 expression and IL-6 secretion. Proc Natl Acad Sci U S A 2003: 100(4): p. 1751-6. Bonnans C, Vachier I, Chavis C, Godard P, Bousquet J, and Chanez P. Lipoxins are potential endogenous antiinammatory mediators in asthma. Am J Respir Crit Care Med 2002: 165(11): p. 1531-5. Levy BD, Clish CB, Schmidt B, Gronert K, and Serhan CN. Lipid mediator class switching during acute inammation: signals in resolution. Nat Immunol 2001: 2(7): p. 612-9. Serhan CN. Resolution phase of inammation: novel endogenous anti-inammatory and proresolving lipid mediators and pathways. Annu Rev Immunol 2007: 25: p. 101-37. Lewis RA, Austen KF, and Soberman RJ. Leukotrienes and other products of the 5-lipoxygenase pathway. Biochemistry and relation to pathobiology in human diseases. N Engl J Med 1990: 323(10): p. 645-55. Goldman DW, Pickett WC, and Goetzl EJ. Human neutrophil chemotactic and degranulating activities of leukotriene B5 (LTB5) derived from eicosapentaenoic acid. Biochem Biophys Res Commun 1983: 117(1): p. 282-8. Lee TH, Menica-Huerta JM, Shih C, Corey EJ, Lewis RA, and Austen KF. Characterization and biologic properties of 5,12-dihydroxy derivatives of eicosapentaenoic acid, including leukotriene B5 and the double lipoxygenase product. J Biol Chem 1984: 259(4): p. 2383-9.

44.

45.

46.

47. 48.

49.

50.

51.

Levy BD, Kohli P, Gotlinger K, Haworth O, Hong S, Kazani S et al. Protectin D1 is generated in asthma and dampens airway inammation and hyperresponsiveness. J Immunol 2007: 178(1): p. 496-502. Serhan CN, Gotlinger K, Hong S, Lu Y, Siegelman J, Baer T et al. Anti-inammatory actions of neuroprotectin D1/protectin D1 and its natural stereoisomers: assignments of dihydroxy-containing docosatrienes. J Immunol 2006: 176(3): p. 1848-59. Serhan CN. Novel eicosanoid and docosanoid mediators: resolvins, docosatrienes, and neuroprotectins. Curr Opin Clin Nutr Metab Care 2005: 8(2): p. 115-21. Calder PC. Dietary modication of inammation with lipids. Proc Nutr Soc 2002: 61(3): p. 345-58. Grimble RF. Dietary lipids and the inammatory response. Proc Nutr Soc 1998: 57(4): p. 535-42. Luo BH, Carman CV, and Springer TA. Structural basis of integrin regulation and signaling. Annu Rev Immunol 2007: 25: p. 619-47. Hemler ME. VLA proteins in the integrin family: structures, functions, and their role on leukocytes. Annu Rev Immunol 1990: 8: p. 365-400. Humphries MJ. Integrin structure. Biochem Soc Trans 2000: 28(4): p. 311-39. Ivetic A and Ridley AJ. The telling tail of L-selectin. Biochem Soc Trans 2004: 32(Pt 6): p. 1118-21. Takada Y, Ye X, and Simon S. The integrins. Genome Biol 2007: 8(5): p. 215. Ley K, Laudanna C, Cybulsky MI, and Nourshargh S. Getting to the site of inammation: the leukocyte adhesion cascade updated. Nat Rev Immunol 2007: 7(9): p. 678-89. Faull RJ. Adhesion molecules in health and disease. Aust N Z J Med 1995: 25(6): p. 720-30. Lu L, Okada N, Nakatani S, and Yoshikawa K. Eicosapentaenoic acid-induced changes in membrane uidity and cell adhesion molecules in cultured human keratinocytes. Br J Dermatol 1995: 133(2): p. 21722. De Caterina R, Cybulsky MI, Clinton SK, Gimbrone MA, Jr., and Libby P. The omega-3 fatty acid docosahexaenoate reduces cytokine-induced expression of proatherogenic and proinammatory proteins in human endothelial cells. Arterioscler Thromb 1994: 14(11): p. 1829-36. De Caterina R and Libby P. Control of endothelial leukocyte adhesion molecules by fatty acids. Lipids 1996: 31 Suppl: p. S57-63. Hughes DA, Southon S, and Pinder AC. (n-3) Polyunsaturated fatty acids modulate the expression of functionally associated molecules on human monocytes in vitro. J Nutr 1996: 126(3): p. 603-10. Collie-Duguid ES and Wahle KW. Inhibitory effect of sh oil N-3 polyunsaturated fatty acids on the expression of endothelial cell adhesion molecules. Biochem Biophys Res Commun 1996: 220(3): p. 96974. Miles EA, Wallace FA, and Calder PC. Dietary sh oil reduces intercellular adhesion molecule 1 and scavenger receptor expression on murine macrophages. Atherosclerosis 2000: 152(1): p. 43-50.

52.

53.

54. 55. 56.

57.

58. 59. 60. 61.

62. 63.

64.

65.

66.

67.
Chapter 2

68.

52

69.

Khalfoun B, Thibault G, Bardos P, and Lebranchu Y. Docosahexaenoic and eicosapentaenoic acids inhibit in vitro human lymphocyte-endothelial cell adhesion. Transplantation 1996: 62(11): p. 1649-57. Spertini O, Luscinskas FW, Gimbrone MA, Jr., and Tedder TF. Monocyte attachment to activated human vascular endothelium in vitro is mediated by leukocyte adhesion molecule-1 (L-selectin) under nonstatic conditions. J Exp Med 1992: 175(6): p. 1789-92. De Caterina R, Liao JK, and Libby P. Fatty acid modulation of endothelial activation. Am J Clin Nutr 2000: 71(1 Suppl): p. 213S-23S. Kim DN, Schmee J, and Thomas WA. Dietary sh oil added to a hyperlipidemic diet for swine results in reduction in the excessive number of monocytes attached to arterial endothelium. Atherosclerosis 1990: 81(3): p. 209-16. Hughes DA, Pinder AC, Piper Z, Johnson IT, and Lund EK. Fish oil supplementation inhibits the expression of major histocompatibility complex class II molecules and adhesion molecules on human monocytes. Am J Clin Nutr 1996: 63(2): p. 267-72. Hughes DA. In vitro and in vivo effects of n-3 polyunsaturated fatty acids on human monocyte function. Proc Nutr Soc 1998: 57(4): p. 521-5. Sampath H and Ntambi JM. Polyunsaturated fatty acid regulation of genes of lipid metabolism. Annu Rev Nutr 2005: 25: p. 317-40.
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 53

70.

71.

72.

73.

74.

75.

76.

Sampath H and Ntambi JM. Polyunsaturated fatty acid regulation of gene expression. Nutr Rev 2004: 62(9): p. 333-9. Yaqoob P. Fatty acids and the immune system: from basic science to clinical applications. Proc Nutr Soc 2004: 63(1): p. 89-104. Wolfrum C, Borrmann CM, Borchers T, and Spener F. Fatty acids and hypolipidemic drugs regulate peroxisome proliferator-activated receptors alpha - and gamma-mediated gene expression via liver fatty acid binding protein: a signaling path to the nucleus. Proc Natl Acad Sci U S A 2001: 98(5): p. 2323-8. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS et al. Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors alpha and gamma. Proc Natl Acad Sci U S A 1997: 94(9): p. 4318-23. Krey G, Braissant O, LHorset F, Kalkhoven E, Perroud M, Parker MG et al. Fatty acids, eicosanoids, and hypolipidemic agents identied as ligands of peroxisome proliferator-activated receptors by coactivatordependent receptor ligand assay. Mol Endocrinol 1997: 11(6): p. 779-91. Xu HE, Lambert MH, Montana VG, Plunket KD, Moore LB, Collins JL et al. Structural determinants of ligand binding selectivity between the peroxisome proliferator-activated receptors. Proc Natl Acad Sci U S A 2001: 98(24): p. 13919-24. Jump DB, Clarke SD, Thelen A, and Liimatta M. Coordinate regulation of glycolytic and lipogenic gene expression by polyunsaturated fatty acids. J Lipid Res 1994: 35(6): p. 1076-84. Nakamura MT and Nara TY. Gene regulation of mammalian desaturases. Biochem Soc Trans 2002: 30(Pt 6): p. 1076-9.

77.

78.

79.

80.

81.

82.

83.

84. 85.

Grimaldi PA. Fatty acid regulation of gene expression. Curr Opin Clin Nutr Metab Care 2001: 4(5): p. 433-7. Vamecq J and Latruffe N. Medical signicance of peroxisome proliferator-activated receptors. Lancet 1999: 354(9173): p. 141-8. Daynes RA and Jones DC. Emerging roles of PPARs in inammation and immunity. Nat Rev Immunol 2002: 2(10): p. 748-59. Kopp EB and Ghosh S. NF-kappa B and rel proteins in innate immunity. Adv Immunol 1995: 58: p. 1-27. Xi S, Cohen D, Barve S, and Chen LH. Fish oil suppressed cytokines and nuclear factor kappa B induced by murine AIDS virus infection. Nutrition research 2001: 21: p. 865-878. Zhao Y, Joshi-Barve S, Barve S, and Chen LH. Eicosapentaenoic acid prevents LPS-induced TNF-alpha expression by preventing NF-kappaB activation. J Am Coll Nutr 2004: 23(1): p. 71-8. Ross JA, Moses AG, and Fearon KC. The anti-catabolic effects of n-3 fatty acids. Curr Opin Clin Nutr Metab Care 1999: 2(3): p. 219-26. Jimi E and Ghosh S. Role of nuclear factor-kappaB in the immune system and bone. Immunol Rev 2005: 208: p. 80-7. Hayden MS, West AP, and Ghosh S. NF-kappaB and the immune response. Oncogene 2006: 25(51): p. 6758-80. Goua M, Mulgrew S, Frank J, Rees D, Sneddon AA, and Wahle KW. Regulation of adhesion molecule expression in human endothelial and smooth muscle cells by omega-3 fatty acids and conjugated linoleic acids: Involvement of the transcription factor NF-kappaB? Prostaglandins Leukot Essent Fatty Acids 2007. Horrobin DF. Fatty acid metabolism in health and disease: the role of delta-6-desaturase. Am J Clin Nutr 1993: 57(5 Suppl): p. 732S-736S; discussion 736S-737S. Horrobin DF. Essential fatty acid metabolism and its modication in atopic eczema. Am J Clin Nutr 2000: 71(1 Suppl): p. 367S-72S. Brown MS and Goldstein JL. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci U S A 1999: 96(20): p. 11041-8. Osborne TF. Sterol regulatory element-binding proteins (SREBPs): key regulators of nutritional homeostasis and insulin action. J Biol Chem 2000: 275(42): p. 32379-82. Shimomura I, Shimano H, Horton JD, Goldstein JL, and Brown MS. Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 1997: 99(5): p. 838-45. Brown MS and Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 1997: 89(3): p. 331-40.

86.

87. 88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

Chapter 2

99.

54

100. Xu J, Nakamura MT, Cho HP, and Clarke SD. Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats. J Biol Chem 1999: 274(33): p. 23577-83. 101. Yoshikawa T, Shimano H, Yahagi N, Ide T, Amemiya-Kudo M, Matsuzaka T et al. Polyunsaturated fatty acids suppress sterol regulatory element-binding protein 1c promoter activity by inhibition of liver X receptor (LXR) binding to LXR response elements. J Biol Chem 2002: 277(3): p. 1705-11. 102. Brun T, Assimacopoulos-Jeannet F, Corkey BE, and Prentki M. Long-chain fatty acids inhibit acetyl-CoA carboxylase gene expression in the pancreatic beta-cell line INS-1. Diabetes 1997: 46(3): p. 393-400. 103. Jones DC, Manning BM, and Daynes RA. A role for the peroxisome proliferator-activated receptor alpha in T-cell physiology and ageing immunobiology. Proc Nutr Soc 2002: 61(3): p. 363-9. 104. Niot I, Poirier H, and Besnard P. Regulation of gene expression by fatty acids: special reference to fatty acid-binding protein (FABP). Biochimie 1997: 79(2-3): p. 129-33. 105. DeWille JW and Farmer SJ. Linoleic acid controls neonatal tissue-specic stearoyl-CoA desaturase mRNA levels. Biochim Biophys Acta 1993: 1170(3): p. 291-5. 106. Ameye LG and Chee WS. Osteoarthritis and nutrition. From nutraceuticals to functional foods: a systematic review of the scientic evidence. Arthritis Res Ther 2006: 8(4): p. R127. 107. Lane NE. Clinical practice. Osteoarthritis of the hip. N Engl J Med 2007: 357(14): p. 1413-21. 108. Sandell LJ and Aigner T. Articular cartilage and changes in arthritis. An introduction: cell biology of osteoarthritis. Arthritis Res 2001: 3(2): p. 107-13. 109. Renberg WC. Pathophysiology and management of arthritis. Vet Clin North Am Small Anim Pract 2005: 35(5): p. 1073-91, v. 110. Pattison DJ, Symmons DP, and Young A. Does diet have a role in the aetiology of rheumatoid arthritis? Proc Nutr Soc 2004: 63(1): p. 137-43. 111. MacLean CH, Mojica WA, Morton SC, Pencharz J, Hasenfeld Garland R, Tu W et al. Effects of omega-3 fatty acids on lipids and glycemic control in type II diabetes and the metabolic syndrome and on inammatory bowel disease, rheumatoid arthritis, renal disease, systemic lupus erythematosus, and osteoporosis. Evid Rep Technol Assess (Summ) 2004: (89): p. 1-4. 112. Calder PC. Polyunsaturated fatty acids, inammation, and immunity. Lipids 2001: 36(9): p. 1007-24. 113. Calder PC and Zurier RB. Polyunsaturated fatty acids and rheumatoid arthritis. Curr Opin Clin Nutr Metab Care 2001: 4(2): p. 115-21. 114. Simopoulos AP. Omega-3 fatty acids in inammation and autoimmune diseases. J Am Coll Nutr 2002: 21(6): p. 495-505. 115. Adam O. Dietary fatty acids and immune reactions in synovial tissue. Eur J Med Res 2003: 8(8): p. 381-7.
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 55

116. Kremer JM. n-3 fatty acid supplements in rheumatoid arthritis. Am J Clin Nutr 2000: 71(1 Suppl): p. 349S51S. 117. Stamp LK, James MJ, and Cleland LG. Diet and rheumatoid arthritis: a review of the literature. Semin Arthritis Rheum 2005: 35(2): p. 77-94. 118. Hazewinkel H and Mott J. Main nutritional imbalances implicated in osteoarticular diseases. In: Encyclopedia of Clinical Nutrition 2006: p. 372-386. 119. Cobb CS and Ernst E. Systematic review of a marine nutriceutical supplement in clinical trials for arthritis: the effectiveness of the New Zealand green-lipped mussel Perna canaliculus. Clin Rheumatol 2006: 25(3): p. 275-84. 120. Bierer TL and Bui LM. Improvement of arthritic signs in dogs fed green-lipped mussel (Perna canaliculus). J Nutr 2002: 132(6 Suppl 2): p. 1634S-6S. 121. Whitehouse MW, Macrides TA, Kalafatis N, Betts WH, Haynes DR, and Broadbent J. Anti-inammatory activity of a lipid fraction (lyprinol) from the NZ green-lipped mussel. Inammopharmacology 1997: 5(3): p. 237-46. 122. Gibson RG, Gibson SL, Conway V, and Chappell D. Perna canaliculus in the treatment of arthritis. Practitioner 1980: 224(1347): p. 955-60. 123. Budsberg SC and Bartges JW. Nutrition and osteoarthritis in dogs: does it help? Vet Clin North Am Small Anim Pract 2006: 36(6): p. 1307-23, vii. 124. Hand M, Thatcher C, Remillard R, and Roudebush P. Small Animal Clinical Nutrition; 4th Edition. 2000: p. 914-920. 125. Servet E, Biourge V, and Marniquet P. Dietary intervention can improve clinical signs in osteoarthritic dogs. J Nutr 2006: 136(7 Suppl): p. 1995S-1997S. 126. Pollard B, Guilford WG, Ankenbauer-Perkins KL, and Hedderley D. Clinical efcacy and tolerance of an extract of green-lipped mussel (Perna canaliculus) in dogs presumptively diagnosed with degenerative joint disease. N Z Vet J 2006: 54(3): p. 114-8. 127. Carter SD, Barnes A, and Gilmore WH. Canine rheumatoid arthritis and inammatory cytokines. Vet Immunol Immunopathol 1999: 69(2-4): p. 201-14. 128. Hegemann N, Wondimu A, Kohn B, Brunnberg L, and Schmidt MF. Cytokine prole in canine immunemediated polyarthritis and osteoarthritis. Vet Comp Orthop Traumatol 2005: 18(2): p. 67-72. 129. Torrence AE, Brabb T, Viney JL, Bielefeldt-Ohmann H, Treuting P, Seamons A et al. Serum biomarkers in a mouse model of bacterial-induced inammatory bowel disease. Inamm Bowel Dis 2007. 130. Figler M, Gasztonyi B, Cseh J, Horvath G, Kisbenedek AG, Bokor S et al. Association of n-3 and n-6 longchain polyunsaturated fatty acids in plasma lipid classes with inammatory bowel diseases. Br J Nutr 2007: 97(6): p. 1154-61. 131. Chapkin RS, Davidson LA, Ly L, Weeks BR, Lupton JR, and McMurray DN. Immunomodulatory effects of (n-3) fatty acids: putative link to inammation and colon cancer. J Nutr 2007: 137(1 Suppl): p. 200S-204S.

Chapter 2 56

132. Sharon P and Stenson WF. Enhanced synthesis of leukotriene B4 by colonic mucosa in inammatory bowel disease. Gastroenterology 1984: 86(3): p. 453-60. 133. Teitelbaum JE and Allan Walker W. Review: the role of omega 3 fatty acids in intestinal inammation. J Nutr Biochem 2001: 12(1): p. 21-32. 134. Dieleman LA, Palmen MJ, Akol H, Bloemena E, Pena AS, Meuwissen SG et al. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Exp Immunol 1998: 114(3): p. 385-91. 135. Pullman WE, Elsbury S, Kobayashi M, Hapel AJ, and Doe WF. Enhanced mucosal cytokine production in inammatory bowel disease. Gastroenterology 1992: 102(2): p. 529-37. 136. Siegmund B, Fantuzzi G, Rieder F, Gamboni-Robertson F, Lehr HA, Hartmann G et al. Neutralization of interleukin-18 reduces severity in murine colitis and intestinal IFN-gamma and TNF-alpha production. Am J Physiol Regul Integr Comp Physiol 2001: 281(4): p. R1264-73. 137. Shoda R, Matsueda K, Yamato S, and Umeda N. Epidemiologic analysis of Crohn disease in Japan: increased dietary intake of n-6 polyunsaturated fatty acids and animal protein relates to the increased incidence of Crohn disease in Japan. Am J Clin Nutr 1996: 63(5): p. 741-5. 138. MacLean CH, Mojica WA, Newberry SJ, Pencharz J, Garland RH, Tu W et al. Systematic review of the effects of n-3 fatty acids in inammatory bowel disease. Am J Clin Nutr 2005: 82(3): p. 611-9.
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 57

139. Camuesco D, Comalada M, Concha A, Nieto A, Sierra S, Xaus J et al. Intestinal anti-inammatory activity of combined quercitrin and dietary olive oil supplemented with sh oil, rich in EPA and DHA (n-3) polyunsaturated fatty acids, in rats with DSS-induced colitis. Clin Nutr 2006: 25(3): p. 466-76. 140. Empey LR, Jewell LD, Garg ML, Thomson AB, Clandinin MT, and Fedorak RN. Fish oil-enriched diet is mucosal protective against acetic acid-induced colitis in rats. Can J Physiol Pharmacol 1991: 69(4): p. 4807. 141. Guarner F, Vilaseca J, and Malagelada JR. Dietary manipulation in experimental inammatory bowel disease. Agents Actions 1992: Spec No: p. C10-4. 142. Lugea A, Videla S, Vilaseca J, and Guarner F. Antiulcerogenic and antiinammatory actions of fatty acids on the gastrointestinal tract. Prostaglandins Leukot Essent Fatty Acids 1991: 43(3): p. 135-40. 143. Nieto N, Fernandez MI, Torres MI, Rios A, Suarez MD, and Gil A. Dietary monounsaturated n-3 and n-6 long-chain polyunsaturated fatty acids affect cellular antioxidant defense system in rats with experimental ulcerative colitis induced by trinitrobenzene sulfonic acid. Dig Dis Sci 1998: 43(12): p. 2676-87. 144. Nieto N, Torres MI, Rios A, and Gil A. Dietary polyunsaturated fatty acids improve histological and biochemical alterations in rats with experimental ulcerative colitis. J Nutr 2002: 132(1): p. 11-9. 145. Vilaseca J, Salas A, Guarner F, Rodriguez R, Martinez M, and Malagelada JR. Dietary sh oil reduces progression of chronic inammatory lesions in a rat model of granulomatous colitis. Gut 1990: 31(5): p. 539-44. 146. Arita M, Yoshida M, Hong S, Tjonahen E, Glickman JN, Petasis NA et al. Resolvin E1, an endogenous lipid mediator derived from omega-3 eicosapentaenoic acid, protects against 2,4,6-trinitrobenzene sulfonic acid-induced colitis. Proc Natl Acad Sci U S A 2005: 102(21): p. 7671-6.

147. Hudert CA, Weylandt KH, Lu Y, Wang J, Hong S, Dignass A et al. Transgenic mice rich in endogenous omega-3 fatty acids are protected from colitis. Proc Natl Acad Sci U S A 2006: 103(30): p. 11276-81. 148. Ariel A, Li PL, Wang W, Tang WX, Fredman G, Hong S et al. The docosatriene protectin D1 is produced by TH2 skewing and promotes human T cell apoptosis via lipid raft clustering. J Biol Chem 2005: 280(52): p. 43079-86. 149. Bannenberg GL, Chiang N, Ariel A, Arita M, Tjonahen E, Gotlinger KH et al. Molecular circuits of resolution: formation and actions of resolvins and protectins. J Immunol 2005: 174(7): p. 4345-55. 150. Arita M, Bianchini F, Aliberti J, Sher A, Chiang N, Hong S et al. Stereochemical assignment, antiinammatory properties, and receptor for the omega-3 lipid mediator resolvin E1. J Exp Med 2005: 201(5): p. 713-22. 151. Whiting CV, Bland PW, and Tarlton JF. Dietary n-3 polyunsaturated fatty acids reduce disease and colonic proinammatory cytokines in a mouse model of colitis. Inamm Bowel Dis 2005: 11(4): p. 340-9. 152. Jergens AE. Feline inammatory bowel disease--current perspectives on etiopathogenesis and therapy. J Feline Med Surg 2002: 4(3): p. 175-8. 153. Cave NJ. Chronic inammatory disorders of the gastrointestinal tract of companion animals. N Z Vet J 2003: 51(6): p. 262-74. 154. Willard MD. Feline inammatory bowel disease: a review. J Feline Med Surg 1999: 1(3): p. 155-64. 155. Hickman MA. Interventional nutrition for gastrointestinal disease. Clin Tech Small Anim Pract 1998: 13(4): p. 211-6. 156. Guilford WG and Matz ME. The nutritional management of gastrointestinal tract disorders in companion animals. N Z Vet J 2003: 51(6): p. 284-91. 157. Irving PM and Gibson PR. Infections and IBD. Nat Clin Pract Gastroenterol Hepatol 2008: 5(1): p. 18-27. 158. Barbato A, Turato G, Baraldo S, Bazzan E, Calabrese F, Tura M et al. Airway inammation in childhood asthma. Am J Respir Crit Care Med 2003: 168(7): p. 798-803. 159. Mickleborough TD. Dietary omega-3 polyunsaturated fatty acid supplementation and airway hyperresponsiveness in asthma. J Asthma 2005: 42(5): p. 305-14. 160. Mickleborough TD and Rundell KW. Dietary polyunsaturated fatty acids in asthma- and exercise-induced bronchoconstriction. Eur J Clin Nutr 2005: 59(12): p. 1335-46. 161. Bharadwaj A and Agrawal DK. Immunomodulation in asthma: a distant dream or a close reality? Int Immunopharmacol 2004: 4(4): p. 495-511. 162. Bloemen K, Verstraelen S, Van Den Heuvel R, Witters H, Nelissen I, and Schoeters G. The allergic cascade: review of the most important molecules in the asthmatic lung. Immunol Lett 2007: 113(1): p. 6-18.
Chapter 2

163. Leung DY and Bieber T. Atopic dermatitis. Lancet 2003: 361(9352): p. 151-60. 164. Leung DY, Boguniewicz M, Howell MD, Nomura I, and Hamid QA. New insights into atopic dermatitis. J Clin Invest 2004: 113(5): p. 651-7.

58

165. Calder PC, Yaqoob P, Thies F, Wallace FA, and Miles EA. Fatty acids and lymphocyte functions. Br J Nutr 2002: 87 Suppl 1: p. S31-48. 166. Prescott SL and Calder PC. N-3 polyunsaturated fatty acids and allergic disease. Curr Opin Clin Nutr Metab Care 2004: 7(2): p. 123-9. 167. Hart LA, Krishnan VL, Adcock IM, Barnes PJ, and Chung KF. Activation and localization of transcription factor, nuclear factor-kappaB, in asthma. Am J Respir Crit Care Med 1998: 158(5 Pt 1): p. 1585-92. 168. Zhao S, Qi Y, Liu X, Jiang Q, Liu S, Jiang Y et al. Activation of NF-kappa B in bronchial epithelial cells from children with asthma. Chin Med J (Engl) 2001: 114(9): p. 909-11. 169. Bureau F, Delhalle S, Bonizzi G, Fievez L, Dogne S, Kirschvink N et al. Mechanisms of persistent NFkappa B activity in the bronchi of an animal model of asthma. J Immunol 2000: 165(10): p. 5822-30. 170. Gagliardo R, Chanez P, Mathieu M, Bruno A, Costanzo G, Gougat C et al. Persistent activation of nuclear factor-kappaB signaling pathway in severe uncontrolled asthma. Am J Respir Crit Care Med 2003: 168(10): p. 1190-8. 171. Ren J and Chung SH. Anti-inammatory effect of alpha-linolenic acid and its mode of action through the inhibition of nitric oxide production and inducible nitric oxide synthase gene expression via NF-kappaB and mitogen-activated protein kinase pathways. J Agric Food Chem 2007: 55(13): p. 5073-80. 172. Lo CJ, Chiu KC, Fu M, Lo R, and Helton S. Fish oil decreases macrophage tumor necrosis factor gene transcription by altering the NF kappa B activity. J Surg Res 1999: 82(2): p. 216-21. 173. Novak TE, Babcock TA, Jho DH, Helton WS, and Espat NJ. NF-kappa B inhibition by omega -3 fatty acids modulates LPS-stimulated macrophage TNF-alpha transcription. Am J Physiol Lung Cell Mol Physiol 2003: 284(1): p. L84-9. 174. Weldon SM, Mullen AC, Loscher CE, Hurley LA, and Roche HM. Docosahexaenoic acid induces an antiinammatory prole in lipopolysaccharide-stimulated human THP-1 macrophages more effectively than eicosapentaenoic acid. J Nutr Biochem 2007: 18(4): p. 250-8. 175. Horrobin DF. Low prevalences of coronary heart disease (CHD), psoriasis, asthma and rheumatoid arthritis in Eskimos: are they caused by high dietary intake of eicosapentaenoic acid (EPA), a genetic variation of essential fatty acid (EFA) metabolism or a combination of both? Med Hypotheses 1987: 22(4): p. 421-8. 176. Kromann N and Green A. Epidemiological studies in the Upernavik district, Greenland. Incidence of some chronic diseases 1950-1974. Acta Med Scand 1980: 208(5): p. 401-6. 177. Schachter HM, Reisman J, Tran K, Dales B, Kourad K, Barnes D et al. Health effects of omega-3 fatty acids on asthma. Evid Rep Technol Assess (Summ) 2004: (91): p. 1-7. 178. Reisman J, Schachter HM, Dales RE, Tran K, Kourad K, Barnes D et al. Treating asthma with omega-3 fatty acids: where is the evidence? A systematic review. BMC Complement Altern Med 2006: 6: p. 26. 179. Wong KW. Clinical efcacy of n-3 fatty acid supplementation in patients with asthma. J Am Diet Assoc 2005: 105(1): p. 98-105.

Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 59

180. Burr GO and Burr MM. A new deciency disease produced by the rigid exclusion of fat from the diet. J Biol Chem 1929: (82): p. 345-67. 181. Burr GO and Burr MM. On the nature and role of the fatty acids essential in nutrition. J Biol Chem 1930: (86): p. 587-621. 182. Hansen AE. Study of iodine number of serum fatty acids in infantile eczema. Proc Soc Exp Biol Med 1933: (30): p. 1198-9. 183. Hansen AE, Haggard ME, Boelsche AN, Adam DJ, and Wiese HF. Essential fatty acids in infant nutrition. III. Clinical manifestations of linoleic acid deciency. J Nutr 1958: 66(4): p. 565-76. 184. Hansen AE and Wiese HF. Essential fatty acids and human nutrition. II. Serum level for unsaturated fatty acids in poorly-nourished infants and children. J Nutr 1954: 52(3): p. 367-74. 185. Manku MS, Horrobin DF, Morse N, Kyte V, Jenkins K, Wright S et al. Reduced levels of prostaglandin precursors in the blood of atopic patients: defective delta-6-desaturase function as a biochemical basis for atopy. Prostaglandins Leukot Med 1982: 9(6): p. 615-28. 186. Manku MS, Horrobin DF, Morse NL, Wright S, and Burton JL. Essential fatty acids in the plasma phospholipids of patients with atopic eczema. Br J Dermatol 1984: 110(6): p. 643-8. 187. Strannegard IL, Svennerholm L, and Strannegard O. Essential fatty acids in serum lecithin of children with atopic dermatitis and in umbilical cord serum of infants with high or low IgE levels. Int Arch Allergy Appl Immunol 1987: 82(3-4): p. 422-3. 188. Wright S and Bolton C. Breast milk fatty acids in mothers of children with atopic eczema. Br J Nutr 1989: 62(3): p. 693-7. 189. Wright S and Sanders TA. Adipose tissue essential fatty acid composition in patients with atopic eczema. Eur J Clin Nutr 1991: 45(10): p. 501-5. 190. Yu G, Kjellman NI, and Bjorksten B. Phospholipid fatty acids in cord blood: family history and development of allergy. Acta Paediatr 1996: 85(6): p. 679-83. 191. Laitinen K, Sallinen J, Linderborg K, and Isolauri E. Serum, cheek cell and breast milk fatty acid compositions in infants with atopic and non-atopic eczema. Clin Exp Allergy 2006: 36(2): p. 166-73. 192. Oliwiecki S, Burton JL, Elles K, and Horrobin DF. Levels of essential and other fatty acids in plasma and red cell phospholipids from normal controls and patients with atopic eczema. Acta Derm Venereol 1991: 71(3): p. 224-8. 193. Galli E, Picardo M, Chini L, Passi S, Moschese V, Terminali O et al. Analysis of polyunsaturated fatty acids in newborn sera: a screening tool for atopic disease? Br J Dermatol 1994: 130(6): p. 752-6. 194. Hall JA, Henry LR, Jha S, Skinner MM, Jewell DE, and Wander RC. Dietary (n-3) fatty acids alter plasma fatty acids and leukotriene B synthesis by stimulated neutrophils from healthy geriatric Beagles. Prostaglandins Leukot Essent Fatty Acids 2005: 73(5): p. 335-41. 195. Black PN and Sharpe S. Dietary fat and asthma: is there a connection? Eur Respir J 1997: 10(1): p. 6-12.

Chapter 2 60

196. Kalinski P, Hilkens CM, Snijders A, Snijdewint FG, and Kapsenberg ML. Dendritic cells, obtained from peripheral blood precursors in the presence of PGE2, promote Th2 responses. Adv Exp Med Biol 1997: 417: p. 363-7. 197. Kalinski P, Hilkens CM, Snijders A, Snijdewint FG, and Kapsenberg ML. IL-12-decient dendritic cells, generated in the presence of prostaglandin E2, promote type 2 cytokine production in maturing human naive T helper cells. J Immunol 1997: 159(1): p. 28-35. 198. Roper RL, Brown DM, and Phipps RP. Prostaglandin E2 promotes B lymphocyte Ig isotype switching to IgE. J Immunol 1995: 154(1): p. 162-70. 199. Olivry T, Marsella R, and Hillier A. The ACVD task force on canine atopic dermatitis (XXIII): are essential fatty acids effective? Vet Immunol Immunopathol 2001: 81(3-4): p. 347-62. 200. LLoyd DH, Thomsett, L. R. Essential fatty acid supplementation in the treatment of canine atopy. Vet Dermatol 1989: 1: p. 41-44. 201. Pukey B. A clinical evaluation of the efcacy of omega 3 fatty acids in the treatment of pruritus in canine atopy. CAVD Bull. 1987: (4): p. 2-4. 202. Scott DW, Buerger, R. G. Nonsteroidal antiinammatory agents in the management of canine pruritus. J Am Anim Hosp Assn 1988: 24: p. 425-428. 203. Scott DW and Miller WH, Jr. Nonsteroidal management of canine pruritus: chlorpheniramine and a fatty acid supplement (DVM Derm Caps) in combination, and the fatty acid supplement at twice the manufacturers recommended dosage. Cornell Vet 1990: 80(4): p. 381-7. 204. Miller WH, Grifn, C. E., Scott, D. W., Angarano, D. K., Norton, A. L. Clinical trial of DVM Derm Caps in the treatment of allergic disease in dogs: a non-blinded study. J Am Anim Hosp Assn 1989: 25: p. 163-168. 205. Paradis M, Lemay, S., Scott, D. W. The efcacy of clemastine (Tavist), a fatty acid-containing product (Derm Caps), and the combination of both products in the management of canine pruritus. Vet Dermatol 1991: 2: p. 17-20. 206. Miller WH, Scott, D. W., Wellington, J. R. Investigation on the antipruritic effects of ascorbic acid given alone and in combination with a fatty acid supplement to dogs with allergic skin disease. Canine Practice 1992: 17: p. 11-13. 207. Bond R and Lloyd DH. A double-blind comparison of olive oil and a combination of evening primrose oil and sh oil in the management of canine atopy. Vet Rec 1992A: 131(24): p. 558-60. 208. Bond R and Lloyd DH. Randomized single-blinded parallel comparison of an evening primrose oil and sh oil combination and concentrates of these oils in the management of canine atopy. Vet Dermatol 1992B: 3: p. 215-219. 209. Scott DW, Miller WH, Jr., Decker GA, and Wellington JR. Comparison of the clinical efcacy of two commercial fatty acid supplements (EfaVet and DVM Derm Caps), evening primrose oil, and cold water marine sh oil in the management of allergic pruritus in dogs: a double-blinded study. Cornell Vet 1992: 82(3): p. 319-29.

Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 61

210. Scarff DH and Lloyd DH. Double blind, placebo-controlled, crossover study of evening primrose oil in the treatment of canine atopy. Vet Rec 1992: 131(5): p. 97-9. 211. Bond R and Lloyd DH. Double blind comparison of three concentrated essential fatty acid supplements in the management of canine atopy. Vet Dermatol 1993: 4: p. 185-189. 212. Logas D and Kunkle GA. Double-blinded crossover study with marine oil supplementation containing highdose eicosapentaenoic acid for the treatment of canine pruritic skin disease. Vet Dermatol 1994: 5: p. 99104. 213. Sture GH and Lloyd DH. Canine atopic disease: therapeutic use of an evening primrose oil and sh oil combination. Vet Rec 1995: 137(7): p. 169-70. 214. Harvey RG. A blinded, placebo-controlled study of the efcacy of borage seed oil and sh oil in the management of canine atopy. Vet Rec 1999: 144(15): p. 405-7. 215. White PD. Esential fatty acids: Use in management of canine atopy. Comp Cont Ed 1993: 15: p. 451-458. 216. Campbell K. Clinical use of fatty acid supplements in dogs. Vet Dermatol 1993: 4: p. 167-173. 217. Scott DW, Miller WH, Jr., Reinhart GA, Mohammed HO, and Bagladi MS. Effect of an omega-3/omega-6 fatty acid-containing commercial lamb and rice diet on pruritus in atopic dogs: results of a single-blinded study. Can J Vet Res 1997: 61(2): p. 145-53. 218. Chapkin RS and Ziboh VA. Inability of skin enzyme preparations to biosynthesize arachidonic acid from linoleic acid. Biochem Biophys Res Commun 1984: 124(3): p. 784-92. 219. Amalsadvala TM and Vaughn DM. Characterization of leukotriene B4 synthesis in canine polymorphonuclear leukocytes. Prostaglandins Leukot Essent Fatty Acids 1992: 45(4): p. 283-8. 220. Vaughn DM. Evaluation of dietary n-6 to n-3 fatty acid ratios on leukotriene B synthesis in dog skin and neutrophils. Veterinary Dermatology 1994: 5: p. 163-173. 221. Rosychuk RAW and Scott-Fieseler K. Nutritional management of canine atopy in 47 dogs: a retrospective study. In: Reinhart, G. A., Carey, D. P. (Eds.), Recent Advances in Canine and Feline Nutrition 2000: Vol. III: p. 287-291. 222. Schick MP, Schick RO, and Reinhart GA. The role of polyunsaturated fatty acids in the canine epidermis: normal structural and functional components, inammatory disease state components, ad as therapeutic dietary components. Carey, D. P., Norton, S. A., Bolser, S. M. (Eds), Recent Advances in Canine and Feline Nutritional Research 1996: Vol. II: p. 267-275. 223. Mueller RS, Fettman MJ, Richardson K, Hansen RA, Miller A, Magowitz J et al. Plasma and skin concentrations of polyunsaturated fatty acids before and after supplementation with n-3 fatty acids in dogs with atopic dermatitis. Am J Vet Res 2005: 66(5): p. 868-73.
Chapter 2

224. Mueller RS, Fieseler KV, Fettman MJ, Zabel S, Rosychuk RA, Ogilvie GK et al. Effect of omega-3 fatty acids on canine atopic dermatitis. J Small Anim Pract 2004: 45(6): p. 293-7. 225. Nesbitt GH, Freeman LM, and Hannah SS. Effect of n-3 fatty acid ratio and dose on clinical manifestations, plasma fatty acids and inammatory mediators in dogs with pruritus. Vet Dermatol 2003: 14(2): p. 67-74.

62

226. Saevik BK, Bergvall K, Holm BR, Saijonmaa-Koulumies LE, Hedhammar A, Larsen S et al. A randomized, controlled study to evaluate the steroid sparing effect of essential fatty acid supplementation in the treatment of canine atopic dermatitis. Vet Dermatol 2004: 15(3): p. 137-45. 227. Hall JA, Picton RA, Skinner MM, Jewell DE, and Wander RC. The (n-3) fatty acid dose, independent of the (n-6) to (n-3) fatty acid ratio, affects the plasma fatty acid prole of normal dogs. J Nutr 2006: 136(9): p. 2338-44. 228. Hall JA, Wander RC, Gradin JL, Du SH, and Jewell DE. Effect of dietary n-6-to-n-3 fatty acid ratio on complete blood and total white blood cell counts, and T-cell subpopulations in aged dogs. Am J Vet Res 1999: 60(3): p. 319-27. 229. Wander RC, Hall JA, Gradin JL, Du SH, and Jewell DE. The ratio of dietary (n-6) to (n-3) fatty acids inuences immune system function, eicosanoid metabolism, lipid peroxidation and vitamin E status in aged dogs. J Nutr 1997: 127(6): p. 1198-205. 230. DeMora F, Garcia G, Puigdemont A, Arboix M, and Ferrer L. Skin mast cell releasability in dogs with atopic dermatitis. Inamm Res 1996: 45(8): p. 424-7. 231. Welle MM, Olivry T, Grimm S, and Suter M. Mast cell density and subtypes in the skin of dogs with atopic dermatitis. J Comp Pathol 1999: 120(2): p. 187-97. 232. Hill PB and Olivry T. The ACVD task force on canine atopic dermatitis (V): biology and role of inammatory cells in cutaneous allergic reactions. Vet Immunol Immunopathol 2001: 81(3-4): p. 187-98. 233. Gueck T, Seidel A, Baumann D, Meister A, and Fuhrmann H. Alterations of mast cell mediator production and release by gamma-linolenic and docosahexaenoic acid. Vet Dermatol 2004: 15(5): p. 309-14. 234. Gueck T, Seidel A, and Fuhrmann H. Effects of essential fatty acids on mediators of mast cells in culture. Prostaglandins Leukot Essent Fatty Acids 2003: 68(5): p. 317-22. 235. Gueck T, Seidel A, and Fuhrmann H. Consequences of eicosapentaenoic acid (n-3) and arachidonic acid (n-6) supplementation on mast cell mediators. J Anim Physiol Anim Nutr (Berl) 2004: 88(7-8): p. 259-65. 236. Seidel A, Gueck T, and Fuhrmann H. The Inuence of long-chain polyunsaturated fatty acids on total lipid fatty acid composition of a canine mastocytoma cell line. J Vet Med A Physiol Pathol Clin Med 2005: 52(5): p. 219-24. 237. Schmitz FJ, Eichelberg D, and Schmutzler W. The effects of prostaglandins of the E and I type on histamine release from human adenoidal mast cells. Agents Actions 1986: 18(1-2): p. 113-4. 238. Babakhin AA, Nolte H, and DuBuske LM. Effect of misoprostol on the secretion of histamine from basophils of whole blood. Ann Allergy Asthma Immunol 2000: 84(3): p. 361-5. 239. Hazewinkel H, Theyse L, Wolvekamp W et al. The inuence of dietary omega-6: omega-3 ratio on lameness in dogs with osteoarthritis of the elbow joint, in: Reinhart GA & Carey DP (Ed.), 1998 Iams Nutr Symp Proc., Recent Advances in Canine and Feline Nutrition vol II, Wilmington, OH, 1998. 240. Baddaky-Taugbol B, Vroom M, Nordberg L, Leistra M, Sinke J, Hovenier R, Beynen A, Pastoor F. A randomised, controlled, double-blinded, multicentre study on the efcacy of a diet rich in sh oil and borage oil in the control of canine atopic dermatitis, in: Hillier A, Foster A, Kwochka K (Eds.), Advances in Veterinary Dermatology, Proc. 5th world congress of veterinary dermatology, Vienna, 2004, pp. 173-178.
Polyunsaturated fatty acids and immune functions in chronic inammatory disorders 63

Chapter 2

64

CHAPTER 3

A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis
Yvette M. Schlottera, Eveline Z. Veenhof a, Bas Brinkhof a, Victor P .M. G. Ruttenb, c, Bart Speea,d, Ton Willemsea, b, Louis C. Penninga

Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 108, PO Box 80154, 3508 TD, Utrecht, the Netherlands Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1, PO Box 80165 3584 CL, Utrecht, the Netherlands Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Private Bag X04, Onderste Poort 0110, Republic of South Africa Department of Morphology and Molecular Pathology, University Hospitals Leuven, Leuven, Belgium

Veterinary Immunology and Immunopathology 2009; 15;129 (1-2):115-8

Abstract Quantitative real-time PCR (qPCR) is the method of choice to study mRNA expression levels. Since qPCR is very sensitive, normalisation of the data with stably expressed reference genes is of utmost importance. The stability of reference genes depends on the tissue and the species of interest. Therefore, evaluation of the stability of reference genes must be performed for each new tissue and species under study. The stability of B2M, GAPDH, HPRT, SRPR, hnRNPH, GUSB, RPL8, RPS5, and RPS19 was analyzed with the GeNorm software in snap frozen canine skin biopsies. Healthy dogs (n=7) and dogs with conrmed atopic dermatitis (n=28) were included. Lesional and non-lesional skin was analyzed. The study indicated that the most appropriate reference genes in canine skin are the ribosomal gene products RPL8, RPS5 and RPS19 besides GUSB and HPRT. As little as three reference genes will reveal highly reliable qPCR calculations.

Chapter 3 66

Introduction Molecular genetic tools are more and more advanced and their applications in the veterinary eld are rapidly increasing. This has, amongst others, been greatly improved by the in-depth data base, which contains 2.5 million SNPs [3]. Even commercial, dog-specic micro-arrays are available to perform functional genomic studies in order to dissect affected signalling pathways in diseases or to predict the clinical outcomes of a therapy. This kind of highthroughput gene expression proling requires the use of high quality mRNA and high quality internal controls. Quantitative real-time PCR (qPCR) is the method to verify independently the differential expressions as measured with micro-array studies. Moreover, qPCR has been used in most of the mRNA expression studies done in veterinary research the last ve to ten years. Since qPCR is an extremely delicate and sensitive technique, numerous variables (e.g. RNA integrity, enzymatic efciency) need to be controlled in such a gene expression analysis. Evaluation of internal controls that take into account all the variabilitys, has been limited to internal organs mainly [4-9]. However, no validation of reference genes in canine skin is available. Therefore, we evaluated nine well-known reference genes in healthy skin, non-lesional and lesional skin of dogs suffering from atopic dermatitis (AD). The stability of B2M, GAPDH, HPRT, SRPR, hnRNPH, GUSB, RPL8, RPS5, and RPS19 was analyzed with the GeNorm software as done previously for companion animal reference genes [4, 8, 9]. This selection was based on reference genes already described and evaluated in companion animals such as dogs and cats [8, 10], horse skin [11], dolphin skin [12] and human skin samples [13]. This low number of papers on this specic subject further shows that the evaluation of reference genes for skin specimen is at its infancy.
A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis 67

sequencing of the complete dog genome [1, 2] and a single-nucleotide polymorphism (SNP)

Materials and Methods Dogs All privately-owned atopic dogs (n=28) presented to the Department of Clinical Sciences of Companion Animals, Utrecht University, fullled the diagnostic criteria for atopic dermatitis [14, 15]. This group included 19 Labradors Retrievers and one of each of the following breeds: Flatcoated Retriever, Gordon Setter, Boxer, Vizsla, French Bulldog, Jack Russell Terrier, Podenco Canario, Dachshund and German Shepherd. Female and male dogs were equally represented. Five healthy male Beagle dogs and two healthy female mongrel dogs were included as control animals. Punch biopsies (6 mm) were obtained under general anesthesia (medetomidine: 20 g/kg body weight and propofol: 1-2 mg/kg body weight). Healthy control and non-lesional skin specimens were all taken from the lateral thorax, whereas the lesional biopsies were obtained from affected predilection sites. After collection, the skin biopsies were immediately snap-frozen in liquid nitrogen and stored at -70 C until used for RNA isolation. All samples were obtained after written consent of the dog owner. The procedures were approved by the Utrecht University Animal Experiments Committee as required under Dutch legislation.

RNA isolation, cDNA synthesis and qPCR. Total RNA was isolated using a combination of the TRIzol reagent (Invitrogen, Breda, the Netherlands) and the RNeasy Mini Kit (Qiagen, Leusden, the Netherlands) according to the manufacturers instructions. In short, the skin tissue was disrupted and homogenized in TRIzol reagent using a Biopulverizer (Biospec #59013, Biospec Inc., Bartlesville, OK) and Ultra-turrax (T8, IKA Labortechnik GmBH, Staufen, Germany). The TRIzol manufacturers instructions were followed until the water-phase was obtained after the chloroform step. Subsequently, the procedure continued with RNeasy columns for clean-up of the RNA including the optional on-column DNase digestion (Qiagen Rnase-free DNase kit). RNA was dissolved in 30 l of RNase free water and was quantied spectrophotometrically using Nanodrop ND-1000 (Isogen Life Sciences, IJsselstein, the Netherlands). cDNA synthesis and qPCR conditions were as described previously [8]. Information about the primers used is depicted in Table 1. To reduce chances to amplify traces of genomic DNA, the primers were positioned in different exons. Calculations to estimate the expression stability and the pair wise variation were performed with the freely available GeNorm program (http://
Chapter 3

medgen.ugent.be/~jvdsomp/genorm; [16].

68

Gene

Accession number NM_001003191 XM_533568 XM_533657 AY_283372 XM_538576 XM_532360 NM_001003142 XM_535458 X_03184

Forward primer 5 3 AGACGCTTCCAA/GTACCCC TCACTGGTGAG/AACCCCCT CCTTCCTCAAAAA/GTCTGGG AG/CTTGCTGGTGAAAAGGAC CTCACTATGATCCACCACG CCATGAAT/CCTGTGGAGC TGTCCCCACCCCCAATGTATC TCCTCATCCTCCTCGCT GCTTCAGGATCTGGACTGC

Reverse primer 5 3 AGGTGTGGTGTAGAGGAGCAC CCTGATTCACACGGCGTAG GTTCTCATCGTAGGGAGCAAG TTATAGTCAAGGGCATATCC TAGCCTCCATAAC/CTCCAC GTAGAGGGTTTGCCGATG CTCCGATGCCTGCTTCACTACCTT TTCTCTGCTGGGTGTCG GTTCCCTTGGTAGCACTGG

Product length (bp) 103 141 95 114 151 64 100 85 81

Ta (C) 62.0 62.5 61.0 56.0 61.2 55.0 58.0 61.2 61.2

-Glucuronidase (BGLR) Ribosomal protein S5 (RPS5) Ribosomal protein S19 (RPS19) Hypoxanthine phosphoribosyltransferase (HPRT) Heterogeneous nuclear ribonucleoprotein H (hnRNPH) Ribosomal protein L8 (RPL8) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) b-2-Microglobulin (B2M) SRPR

Table 1. Details of primers and reaction conditions used.

Results and Discussion Samples were screened for contamination with genomic DNA by qPCR of non-reversetranscribed RNA templates. No-template controls were included to test for other contaminations. All controls were negative. GeNorm-based evaluation of canine reference genes revealed a stable expression of ribosomal gene products (RPS5, RPS19 and RPL8) and HPRT and GUSB as most stably expressed non-ribosomal gene products. B2M and GAPDH turned out to be rather unstably expressed reference genes (Figure 1). Consequently, conclusions in scientic papers based on only one reference gene, especially if it concerns GAPDH, must be read with caution. In contrast, a combination of one or two ribosomal with one or two non-ribosomal gene products will result in highly accurate normalisations. Moreover, determination of the lowest number of reference genes needed for reliable data indicated that little improvement will be obtained with more than four independent reference genes (Figure 2). Furthermore comparing dolphin, horse and human studies on skin reference genes showed conicting data about the stability of B2M (good in horses, poor in dolphins) and HPRT (poor in dolphins and horses, the best in people). This clearly consolidates our opinion that the use of one single reference gene without prior evaluation of its stability for the tissue/species of interest, can result in misinterpretation of the data.

A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis 69

Figure 1. Average expression stability values of remaining reference genes. The geNorm program (http://medgen.ugent.be/jvdesomp/genorm) calculates the gene expression stability (M) of one gene based on the average pair wise variation between all studied reference genes. The highest M values characterize genes with the least stable expression, indicative for a less optimal reference gene. Stepby-step elimination of the least stable gene generates a ranking of reference genes according to their M values and nally results in the identication of the two most stable genes [16].

Figure 2. Determination of the optimal number of reference genes for normalization. The geNorm program
Chapter 3

(http://medgen.ugent.be/jvdesomp/genorm) calculates the normalization factor assessing the optimal number of reference genes for generating the M factor by calculating the pair wise variation V. The pair wise variation between these genes denes the variable V (Ohl et al., 2005). The lower the variable V is, the less variation. V3/4 indicates the variation in normalization factor with 3 vs. 4 reference genes.

70

This manuscript is the rst, to our knowledge, that describes the evaluation of a large number of well-known canine reference genes in skin tissues. The most appropriate reference genes in canine skin are ribosomal gene products and GUSB and HPRT. As little as three reference genes will reveal highly reliable qPCR calculations. In this respect canine skin
A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis 71

tissue is comparable to other canine tissues studied in reference gene evaluations.

References
1. Parker HG, Kim LV, Sutter NB, Carlson S, Lorentzen TD, Malek TB et al. Genetic structure of the purebred domestic dog. Science 2004: 304(5674): p. 1160-4. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal M et al. Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 2005: 438(7069): p. 803-19. Sargan DR, Aguirre-Hernandez J, Galibert F, and Ostrander EA. An extended microsatellite set for linkage mapping in the domestic dog. J Hered 2007: 98(3): p. 221-31. Peters IR, Peeters D, Helps CR, and Day MJ. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies. Vet Immunol Immunopathol 2007: 117(1-2): p. 55-66. Brinkhof B SB, Rothuizen J, Penning LC. Development and evaluation of canine reference genes for accurate quantication of gene expression. Anal Biochem 2006: 356: p. 36-43. Etschmann B WB, Stoevesand K, von der Schulenburg A, Sterner-Kock A. Selection of reference genes for quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithm. Vet Pathol 2006: 43: p. 934-942. Peters IR PD, Helps CR, Day MJ. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies. Vet Immunol Immunopathol 2007: 117: p. 55-66. Brinkhof B, Spee B, Rothuizen J, and Penning LC. Development and evaluation of canine reference genes for accurate quantication of gene expression. Anal Biochem 2006: 356(1): p. 36-43. Etschmann B, Wilcken B, Stoevesand K, von der Schulenburg A, and Sterner-Kock A. Selection of reference genes for quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithm. Vet Pathol 2006: 43(6): p. 934-42. Penning LC, Vrieling HE, Brinkhof B, Riemers FM, Rothuizen J, Rutteman GR et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues. Vet Immunol Immunopathol 2007: 120(3-4): p. 212-22. Bogaert L, Van Poucke M, De Baere C, Peelman L, Gasthuys F, and Martens A. Selection of a set of reliable reference genes for quantitative real-time PCR in normal equine skin and in equine sarcoids. BMC Biotechnol 2006: 6: p. 24. Spinsanti G, Panti C, Lazzeri E, Marsili L, Casini S, Frati F et al. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies. BMC Mol Biol 2006: 7: p. 32. de Kok JB, Roelofs RW, Giesendorf BA, Pennings JL, Waas ET, Feuth T et al. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Lab Invest 2005: 85(1): p. 154-9. Willemse A. Atopic skin disease: a review and a reconsideration of diagnostic criteria. J Small Anim. Pract. 1986: (27): p. 771-778.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.
Chapter 3

14.

72

15.

Prelaud P, Guagure E, and Alhaidari Z. Re-evaluation of diagnostic criteria of canine atopic dermatitis. Revue Med. Vet. 1998: 149: p. 1057-1064. Ohl F, Jung M, Xu C, Stephan C, Rabien A, Burkhardt M et al. Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization? J Mol Med 2005: 83(12): p. 1014-24.
A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis 73

16.

Chapter 3

74

CHAPTER 4

Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs
Yvette M. Schlottera, Victor P.M.G. Ruttenb, c, Mike Hayekd, Stefan Massiminod, Gary Davenportd, Edward F. Knole, Ton Willemsea, b

Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, the Netherlands Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, the Netherlands; Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Republic of South Africa P&G Pet Care, Lewisburg Technical Center, Lewisburg, Ohio, USA and University Medical Center Utrecht, Department of Dermatology/Allergology, Utrecht, the Netherlands

d e

Manuscript in preparation

Abstract In canine atopic dermatitis (AD), like in human, the mechanisms underlying the disease have not yet been identied denitely. Current therapies focus on mediating or modulating the inammatory response in AD. Polyunsaturated fatty acids have the potential to affect allergic inammation through modulation of prostaglandin and leukotriene production, but also by alteration of the composition and function of the epidermal lipid barrier. The objective of our study was to evaluate the effect of two customized diets fed for 12 weeks with omega-6 to omega-3 fatty acid (FA) ratios of approximately 21:1 and 5:1 on the fatty acid proles in non-lesional skin (NLS), lesional skin (LS), plasma, and PBMC of 27 atopic dogs. Moreover, its potential consequence on clinical signs and inammatory cell inltrates of AD was investigated. The major difference between both diets was the amount of linoleic acid, which was 3-fold higher in the high n-6:n-3 FA diet. Fatty acid composition of plasma, PBMC and NLS and LS was analysed by gas chromatography of fatty acid methyl esters. In addition, the amount of CD3+ cells was counted and the inammatory cytokines IL-1 and IL-6 mRNA were measured by quantitative real-time PCR. Clinical scores as assessed by both owners and clinicians were signicantly reduced after 12 weeks for both diet groups. Plasma FA changes mirrored the dietary FA contents. However, this was not reected in peripheral blood mononuclear cells (PBMC) and skin tissue. Independent of the diet lesional skin contains signicantly more arachidonic acid (AA) than non-lesional skin. In conclusion, both groups of AD dogs fed a diet with either a high n-6:n-3 ratio (20:1) or a low n-6:n-3 ratio (5:1) improved signicantly. This effect could not be explained by the increased amount of LA. Irrespective of the diet, we found lower AA percentages in nonlesional skin in dogs with clinical improvement of more than 50 per cent. Together with the nding of signicant higher amounts of AA in lesional skin compared to non-lesional skin, this suggests that AA may play a role in modulating the clinical response.

Chapter 4 76

Introduction Canine atopic dermatitis (AD) is a genetically-predisposed inammatory and pruritic skin disease with characteristic clinical features[1]. A hallmark of this disorder is the elevated level of IgE antibodies to specic environmental allergens. The incidence has been estimated to be around 10-15 % of the canine population [2]. The age of onset is reported to be between 6 months and three years and one of the primary clinical signs of canine AD is pruritus of the face, ears, paws, extremities, axillae and groin [3, 4]. Like in human AD, despite intensive research, the underlying defect(s) are not yet identied leaving human physicians and veterinarians with the difcult task of treating their patients symptomatically. To treat canine AD a number of therapies are available. Corticosteroids or cyclosporine-A, drugs often used and effective in most atopic dogs, have signicant long-term side effects which is a problem since most dogs are relatively young when treated [3]. Thus there is a constant urge to search for alternative therapies. Human studies reporting a benecial effect of dietary supplementation with polyunsaturated fatty acids (PUFA) for several inammatory diseases such as rheumatoid arthritis, inammatory bowel disease, asthma and atopic dermatitis, has led to an increasing interest in fatty acids supplements as an alternative therapy for canine AD [5]. The benet of n-3 PUFA, such as -linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) is attributed to a potential modication of immune reactivity. The n-6 PUFA arachidonic acid (AA) is the main precursor of eicosanoids in cells and present in larger amounts in the membranes of most cells compared to the other eicosanoid precursors, such as EPA [5, 6]. Eicosanoids derived from AA are mainly the 2series prostaglandins (PG) and the 4-series leukotrienes (LT) which are biologically more potent than their counterparts formed from EPA, the 3-series PG and 5-series LT. It was hypothesized that by partly replacing the n-6 PUFA-rich oil in diets with long chain n-3 PUFA-containing sh oil, more EPA will be incorporated into cell membranes, including inammatory and immune cells, at the expense of AA. Consequently, less AA is available for eicosanoid synthesis. EPA by itself is able to act as a substrate for both the COX- and LOX pathways resulting in the production of less inammatory metabolites which might have an inhibitory effect on (skin) inammation [6]. Numerous studies on the efcacy of fatty acid supplements in canine AD conducted from the late eighties onwards showed conicting results. The rst studies had an open experimental design, diets were not standardized, the study duration was two weeks at maximum, or the included cases were not exclusively AD patients [7-13]. Besides, all studies focussed on n-6 EFA supplements, which varied widely in amount between these studies. These open studies were followed by randomised, blinded, placebo-controlled trials (1992-1999) [1421]. However, only two out of eight studies lasted longer than 9 weeks [15, 18]. In seven trials only the effects of n-6 supplementation was investigated, but in none of these the
77 Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs

diets were standardized, which could account for a substantial variability in total EFA intake [14, 15, 17-21]. Consequently, this may explain the signicant variability in the reduction of pruritus or overall clinical improvement. A key question arising from many studies is whether the absolute concentration of n-3 PUFA or the ratio of n-6:n-3 PUFA in the diet is most relevant for the n-3 composition of plasma, different cell types and its impact on immune parameters [22-25]. Several studies addressed this question, but these were conducted in healthy dogs and results were conicting [22-25]. The objective of the present randomized, double-blinded study was to evaluate the effect of two customized diets with omega-6 to omega-3 fatty acid ratios of approximately 21:1 and 5:1 on the fatty acid proles in non-lesional skin (NLS), lesional skin (LS), plasma, and white blood cells. Moreover, its potential consequence on the control of clinical signs and inammatory cell inltrates was investigated.

Chapter 4 78

Materials and methods Animals Thirty dogs with non-seasonal atopic dermatitis were included in this double-blind randomized study. All dogs met the diagnostic criteria for AD [4] and other causes of pruritus, including food allergy, were ruled out. Concurrent treatments to reduce the itch were not allowed during the study. The procedures were approved by the Utrecht University Animal Ethical Committee, as required under Dutch legislation and informed consent of the owners was obtained.
Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 79

Study protocol The dogs were randomly assigned to either of the diet groups A or B by an independent pharmacist using a randomization table. The study was blinded to both the investigators and the dog owners. Dogs were evaluated both by their owners and a clinician, each time by the same person. Evaluation consisted of scoring of the cutaneous lesions at the start (T= 0) and at 12 weeks, the end of the trial, (T =1) using an established clinical scoring system similar to that used in humans with AD [26], the six area six sign atopic dermatitis (SASSAD) severity score. Erythema, excoriation, scaling, hyperkeratosis and lichenication were scored on a scale of 0-3 (0: none, 1: mild, 2: moderate, 3: severe) on six different body sites (front legs, front feet, hind feet, head and neck, inguinal region, abdomen and anks). Dog owners were asked to evaluate the dogs pruritus intensity at the start and end of the trial using a linear scoring scale from 0 to 50 (0: none; 10: minimal; 20: mild; 30: moderate; 40: severe; 50: extremely severe). For each diet group the post-treatment scores were expressed as percentage of the baseline scores (T=0). PBMC were isolated from Na-heparinized blood using Ficoll-Paque (Amersham Biosciences) for fatty acid analysis. From all dogs 6 mm punch skin biopsies were obtained under general anaesthesia. Non-lesional skin biopsies were all taken from the lateral thorax, whereas the lesional biopsies were obtained from affected predilection sites. After collection, the skin biopsies were immediately snap-frozen in liquid nitrogen and stored at -70 C until used for fatty acid analysis, immunohistochemistry and real time qPCR.

Diets Group A dogs received a diet with a high n-6:n-3 FA ratio of 21.8: 1 and group B received a diet with an intermediate ratio of n-6:n-3 FA of 5.6:1 (Table 1). The major difference between both diets was that diet A contained a much higher amount of linoleic acid (LA) as compared to diet B (Table 1). During the trial, dogs were only allowed to eat their test diets, no treats, snacks or other food.
Table 1. Dietary Fatty Acid Prole Analysis

Fatty acid analysis Fatty acid compositions of plasma, PBMC and the skin biopsies (Table 3, 4 and 5 respectively) were determined by gas chromatography of FA methyl esters by a commercial laboratory (IAMS Petfood Company, Lewisburg, USA). Representation of the different fatty acids was expressed as percentages of the total FA amount. For statistical analyses the LOG normalized values were used.

Immunohistochemistry Biopsies were mounted in Tissue-Tek (Sakura Finetek Europe BV, Zoeterwoude, The Netherlands) and 6 mm cryostat sections were placed on Superfrost Plus slides (MenzelChapter 4

Glaser, Braunschweig, Germany), dried and stored at -70 C until use. After thawing, the tissue sections were xed in 100% acetone for 10 minutes at room temperature (RT). Endogenous peroxidase was eliminated by incubation in Tris-buffered saline (TBS; 0.05 M Tris-HCl, 0.15 M NaCl, pH 7.5) supplemented with 0.3% hydrogenperoxidase during 20 min, followed by

80

washing in TBS. Sections were incubated for 25 min in blocking reagent (TBS with 10% inactivated normal dog and normal goat serum) and subsequently incubated for 1 hour at RT with a 1:200 dilution of anti-CD3 antibodies (CA17.2A12; Serotec Ltd., Kidlington, Oxford, United Kingdom) diluted in 1% blocking reagent. Secondary incubation was performed with biotin-conjugated horse anti-mouse antibodies (BA-2000; Vector, Burlingame CA), diluted 1:800, in PBS with 1% normal dog/normal horse serum (NDS/NhoS) for 30 min. After this, the sections were incubated for 30 min with alkaline-phosphatase labelled streptavidine (D0396; Dakopatt a/s Denmark), diluted 1:300 in PBS with 1% NDS/NHoS. Between incubations, the sections were washed three times (each time 3 min) in PBS containing 0.05% Tween 20 (P-1379; Sigma, St-Louis MO) and prior to substrate incubation slides were washed three times (each time 3 min) in 0.1 M Tris-HCl pH 8.5. Alkaline phosphatase activity was demonstrated using naphtol AS MX phosphate (N-4875; Sigma) as the substrate and fast blue BB base (F-0125; Sigma) as the chromogen, resulting in blue staining. Averages of positive cells per square mm were used for statistical analysis.
Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 81

RNA isolation and cDNA synthesis Total RNA was isolated using a combination of the TRIzol reagent (Invitrogen, Breda, the Netherlands) and the RNeasy Mini Kit (Qiagen, Leusden, the Netherlands) according to the manufacturers instructions. In short, the skin tissue was disrupted and homogenized in TRIzol reagent using a Biopulverizer (Biospec #59013, Biospec Inc., Bartlesville, OK, USA) and Ultra-turrax (T8, IKA Labortechnik GmBH, Staufen, Germany). The TRIzol manufacturers instructions were followed until the water-phase was obtained after the chloroform step. Subsequently, the procedure continued with RNeasy columns for clean-up of the RNA including the optional on-column DNase digestion (Qiagen Rnasefree DNase kit). RNA was dissolved in 30 l of RNase free water and was quantied spectrophotometrically using Nanodrop ND-1000 (Isogen Life Sciences, IJsselstein, the Netherlands). In total 1.5 g of RNA was reversed transcribed into a total volume of 60 l using oligo(dT) primers combined with random hexamer primers and an MMLV-derived reverse transcriptase according to the manufacturers instructions (iScript cDNA Synthesis Kit, Bio-Rad, Veenendaal, the Netherlands). After synthesis cDNA samples were diluted ve times. Samples were screened for contamination with genomic DNA by qPCR of nonreverse-transcribed RNA templates.

Primer design and testing Primer sets for enzymes involved in fatty acid synthesis (Table 1) were developed using known dog sequences available from Ensembl (www.ensembl.org) or NCBI (www.ncbi.nih.

gov/genbank/index.html). Primer design was performed with Oligo Explorer 1.1.0 software (www.genelink.com/tools/gl-downloads.asp). To reduce chances of amplifying traces of genomic DNA, the primers were positioned in different exons. Uniqueness and specicity of each primer were veried using the Basic Local Alignment Search Tool (www.ncbi.nlm.nih. gov/blast) returning GenBank accession numbers. Final primers were selected based on the specicity and efciency by measuring a temperature gradient of a 16-fold dilution series of pooled cDNA by real-time quantitative PCR (qPCR) including melting curve analysis. In addition the amplied products were veried by sequencing using BigDye Terminator Cycle Sequencing Ready reaction (Applied Biosystems, Foster City, CA), according to the standard protocol. The Tercycle product was puried and analyzed on an ABI3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Gene specic primers for the canine endogenous reference genes, -glucuronidase (BGLR/ GUSB), ribosomal protein S5 (RPS5) and ribosomal protein 19 (RPS 19) have been previously described [27] (Table 2).
Table 2. Nucleotide sequences of canine specic primers for quantitative PCR analysis
Gene -Glucuronidase (BGLR) Ribosomal protein S5 (RPS5) Ribosomal protein S19 (RPS19) IL-1 IL-6 Accession number NM_001003191 XM_533568 XM_533657 NM_001003301 NM_001037971 Forward primer 5 3 AGACGCTTCCAA/GTACCCC TCACTGGTGAG/AACCCCCT CCTTCCTCAAAAA/GTCTGGG TGCTGCCAAGACCTGAACCA GAGCCCACCAGGAACGAAAGAGA Reverse primer 5 3 AGGTGTGGTGTAGAGGAGCAC CCTGATTCACACGGCGTAG GTTCTCATCGTAGGGAGCAAG TCCAAAGCTACAATGACTGACACG CCGGGGTAGGGAAAGCAGTAGC Product length (bp) 103 141 95 115 123 Ta (C) 62.0 62.5 61.0 68.0 65.0

Quantitative PCR Real-time qPCR, based on the high afnity, double-stranded DNA-binding dye SYBR Green using a Bio-Rad My-IQ detection system (IQ SYBR Green Supermix and My-IQ, Bio-Rad, Veenendaal, the Netherlands) according to the manufacturers instructions, was performed in duplicate. Primers (Eurogentec, Maastricht, the Netherlands) had a nal concentration of 400 nM each and 1.0 l of cDNA template was used in a reaction volume of 25 l on 96-well iCycler iQ plates (Bio-Rad). All PCR reactions were performed using a two-step program, starting with a 2 or 5 min polymerase activation step at 95 C followed by 45 cycles of 20 s denaturation at 95 C and 30 s at Tm. The reaction was continued by 30 s at 60 C followed by a melting curve being the resultant of the stepwise increase in temperature of 1.5 C each 15 s, ranging from 60 C to 99C. A non-template control in duplicate was included on each
Chapter 4

plate. Standard curves constructed by plotting the relative starting amount versus threshold cycles were generated using serial 4-fold dilutions of pooled cDNA fractions from control skin, non-lesional and lesional AD skin, Con-A-stimulated PBMC and liver. The amplication efciency, E = (10 (1/-slope) -1) x 100%, of all standard lines was > 95 % and < 105% and all

82

melting curves described a single distinctive peak. For each experimental sample the mRNA expression of the gene of interest and of the endogenous reference genes GUSB, RPS19 and RPS5 were determined from the appropriate standard curve. The expression of the genes of interest was normalized to the average amount of the endogenous references. The normalized values were divided by the normalized values of the calibrator (control group) to generate relative expression levels. Data analysis was performed with My-IQ software (BioRAd, Veenendaal, the Netherlands).
Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 83

Statistical analysis Percentual representation of the fatty acids of interest was reported as mean percentages of total fatty acids SEM. All statistical analyses were performed with SPSS 12.0.1 for Windows (SPSS Benelux BV, Gorinchem, the Netherlands). Normal distribution of all groups was conrmed by performing a Shapiro-Wilk test and homogeneity of variances across groups by use of the Levenes test. Group means of SASSAD scores, pruritus intensity scores, non-lesional atopic skin, lesional atopic skin, plasma and PBMC were compared by using a paired (T= 0 versus T= 1 within a diet group) or independent Students t-test (T= 0 versus T= 1 between both diet groups at the same timepoint) or when data were not normally distributed by using the Wilcoxon or the Mann-Whitney U test respectively. The two-sided level of signicance was set at p 0.05.

Results Characteristics of dogs Thirty dogs were included in the trial. Three dogs dropped out during the study; one dog was withdrawn due to severe clinical signs and two dogs did not strictly follow the diet during the trial. For the per protocol statistical analysis Group A (on diet A with n-6:n-3 ratio 21.8) consisted of fourteen dogs and group B (on diet B with n-6:n-3 ratio 5.6) of thirteen dogs. Mean age and weight of diet group A and B (mean SEM) were 3.0 0.6 and 4.2 0.5 years respectively and 28.3 2.3 and 29.3 2.6 kg respectively. No signicant differences in age and weight existed between the two groups. Group A consisted of 64% male and 36% female dogs whereas group B consisted of 38% male and 62% female dogs.

Clinical scores The entry scores for clinical signs, divided in the clinical severity scores as assessed by the SASSAD score system and the pruritus intensity scores as assessed by the dog owners, did not differ signicantly between the two diet groups. Both the SASSAD scores and pruritus intensity scores were signicantly reduced at T=1 in group A as well as in group B (Figure 1). Dogs which showed an improvement of more than 50% have signicant lower amounts of AA in non-lesional skin compared to dogs which showed less than 50% improvement (Figure 2, 3, 4).

Figure 1. SASSAD score and pruritus intensity score of dogs on diet A and B at the start (T=0) and after 12 weeks of trial (T =1).
Chapter 4 84

Figure 2. Percentage of improvement (0-50% or 51-100%) in both diet groups for the pruritus score and SASSAD score.

Figure 3. The amount of AA and EPA in non-lesional skin in dogs that responded less than 50% compared to dogs that responded more than 50% for the pruritus score and the SASSAD score irrespective of the diet.

Figure 4. The amount of AA and EPA in lesional skin in dogs that responded less than 50% compared to dogs that responded more than 50% for the pruritus score and the SASSAD score irrespective of the diet.

Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 85

Fatty acid composition of plasma, PBMC and skin The baseline and post-treatment plasma, PBMC and skin fatty acid levels are shown in Table 3, 4 and 5, respectively. At the start of the trial plasma and skin fatty acid compositions of both groups were identical. PBMC of group B showed signicantly lower levels of arachidonic acid (AA), of the n-6:n-3 FA ratios and signicantly higher levels of n-3 FA as compared to group A at the start of the trial.

Table 3. Fatty acid composition (%) in plasma in the high n-6:n-3 ratio group (diet A) and the low n-6:n-3 ratio group (diet B) at entry (T=0) and after 12 weeks (T=1). Values are means SEM

1 2

Signicant difference within group between T=0 and T=1; a: p < 0.05; b: p < 0.01; c: p < 0.001 Signicant difference at same timepoint between diet A and diet B; d: p < 0.05; e: p <0.01; f: p < 0.001

Chapter 4 86

Table 4. Fatty acid composition (%) in PBMC in the high n-6:n-3 ratio group (diet A) and the low n-6:n-3 ratio group (diet B) at entry (T=0) and after 12 weeks (T=1). Values are means SEM

1 2

Signicant difference within group between T=0 and T=1; a: p < 0.05 Signicant difference at same timepoint between diet A and diet B; d: p < 0.05; e: p <0.01

Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 87

Table 5. Fatty acid composition (%) in non-lesional skin (NLS) and lesional skin (LS) in the high n-6:n3 ratio group (diet A) and the low n-6:n-3 ratio group (diet B) at entry (T=0) and after 12 weeks (T=1). Values are means SEM

1 2

Signicant difference within group between T=0 and T=1; a: p < 0.05; b: p < 0.01 Signicant difference at same timepoint between diet A and diet B; d: p < 0.05

In the dogs fed the high ratio diet (A) plasma FA composition changed considerably over
Chapter 4

time (Table 3). There was a signicant increase in linoleic acid (LA) (p 0.01) and a signicant decrease in AA (p 0.05) at the end of the trial (T=1) compared to baseline levels (T=0). Furthermore, ALA, EPA and DHA percentages in plasma showed a signicant decrease post-treatment as compared to T=0 resulting in signicantly decreased total n-3

88

levels at T=1. The n-6:n-3 FA ratio increased signicantly. When FA values at T=1 of both groups were compared a signicant lower plasma amount of total n-6 FA and LA, signicant higher amounts of EPA and total n-3 FA, and a signicant lower n-6:n-3 ratio (Table 3) was demonstrated in group B. In PBMC of dogs in group A a signicant decrease is observed at T =1 for AA and the total amount of n-6 FA (Table 4). The levels of DHA and total n-3 FA in PBMC are signicantly higher in post-treatment samples of dogs in group B compared to group A, however this difference was already noticed for total n-3 FA at the start of the trial. Remarkably, the T=1 AA level in group A is signicant lower than that in group B, while the opposite was observed at T=0. Comparison of n-6:n-3 ratios between group A and Group B showed signicant higher values for the latter both at T=0 (also mentioned above) and T=1. Regarding FA values in skin, dogs fed diet A do not show signicant differences in their FA composition of non-lesional and lesional skin after 12 weeks (Table 5). Dogs of Group B showed a signicant decrease in LA after twelve weeks in both non-lesional and lesional skin, which is reected in the total amount of n-6 FA and the total PUFA in non-lesional skin and in the n-6:n-3 ratio in lesional skin. Signicant higher post-treatment levels for EPA and DHA are found in non-lesional skin of dogs in group B compared to dogs in group A.
Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 89

Immunohistochemistry No signicant differences in the amount of CD3 cells/ mm2 before and after the trial were found for both diet groups. A trend to lower post-treatment amounts of CD3 cells was seen in LS (Figure 5), which was stronger when all dogs together were analysed before and after the trial. Numbers of CD3 positive cells in LS were far higher than those in NLS.

Figure 5. Baseline and post-treatment number of CD3+ T cells in non-lesional skin (NLS) and lesional skin (LS) for diet groups A and B and for all dogs irrespective of the diet.

Gene-expression measurements of IL-1 and IL-6 No signicant differences in IL-1 and IL-6 mRNA expression levels before and after the trial were found for both diet groups (A and B) and for all dogs (diet A and B) irrespective of the diet (Figure 6 and 7). Also no differences in IL-1 and IL-6 mRNA levels were observed between dogs that responded less than 50 % compared to dogs that improved more than 50% for both the pruritus and SASSAD score (Figure 8 and 9).

Figure 6. IL-1 mRNA expression levels in non-lesional skin (NLS) and lesional skin (LS) for diet groups A and B and for all dogs irrespective of the diet.

Figure 7. IL-6 mRNA expression levels in non-lesional skin (NLS) and lesional skin (LS) for diet groups A and B and for all dogs irrespective of the diet.
Chapter 4 90

Figure 8. IL-1 mRNA expression levels in non-lesional skin (NLS) and lesional skin (LS) in dogs that responded less than 50% compared to dogs that responded more than 50% for the pruritus score and the SASSAD score irrespective of the diet.

Figure 9. IL-6 mRNA expression levels in non-lesional skin (NLS) and lesional skin (LS) in dogs that responded less than 50% compared to dogs that responded more than 50% for the pruritus score and the SASSAD score irrespective of the diet.

Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 91

Discussion This is the rst study, to our knowledge, to investigate the effect of two customized diets with omega-6 to omega-3 fatty acid ratios of approximately 21:1 and 5:1 on the fatty acid proles in non-lesional skin (NLS), lesional skin (LS), plasma, and white blood cells. In this randomised double-blinded study in atopic dogs two customized diets, containing high and intermediate n-6:n-3 ratios were evaluated for potential efcacy in modulation of AD. The switch from the dogs habitual diets to a diet with a high n-6:n-3 ratio (21.8:1; diet A) as well as to a diet with an intermediate ratio (5.6:1; diet B) resulted already in a signicant reduction of clinical lesion scores (SASSAD) as well as pruritus scores (Figure 1) when assessed as diet groups. Of dogs fed diet A or B, 57% respectively 30% showed a clinical improvement of more than 50% (Figure 2). This partial response is in agreement with other trials investigating the effect of PUFA in the control of atopic dermatitis [28-30]. It was chosen to feed the dogs the diets for 12 weeks since the time required to alter the fatty acid composition of the skin, was previously shown to be more than 6 weeks [31]. Although it has been shown that signicant differences in EFA plasma levels may be obtained shortly after dietary change [30, 32, 33], permanent EFA plasma alteration may take as long as 12 weeks after dietary conversion [34, 35]. The major difference in n-6:n-3 ratio between both diets A and B is the percentage of linoleic acid (LA), the parent FA of the omega-6 pathway, which is present in 34.63% in diet A, whereas it is present in 12.94% in diet B (Table 1). Furthermore diet B contains higher amounts of ALA, EPA and DHA resulting in a 1.5-fold increase of the total omega3 FA as compared to diet A. The proposed mechanism of action of variation in types and concentrations of EFA in the treatment of AD in humans and dogs is the modulation of the cutaneous production of different types of prostaglandins and leukotrienes. Under normal conditions the main FA precursor of eicosanoids is the n-6 PUFA arachidonic acid (AA) of which, as compared to other long-chain PUFA, cell membranes of inammatory cells usually contain a high proportion (Table 4). In skin, composed of different cell types including residing and inltrating inammatory cells, the amount of AA was far less compared to that in PBMC (Table 5). Potential contribution of inammatory cell AA to the AA skin content may also be reected in lesional skin containing signicantly more inltrated inammatory cells and more AA than non-lesional skin. Eicosanoids such as PGs, LTs and TXs are generated from AA by the action of the cyclooxygenase (COX) and lipoxygenase (LOX) enzymes. AA is released from the cell membrane by phospholipase A 2, of which several subtypes exist
Chapter 4

and which is e.g. expressed by mature keratinocytes in the epidermis [36, 37]. Another important enzyme in LT synthesis is 5-lipoxygenase (5-LO), of which Langerhans cells in the skin are important producers [38-40]. The production of a mix of these eicosanoids (e.g. PGE2 and LTB 4) by epithelial and inammatory cells is believed to play a role in the

92

initial phase of sensitization to allergens and in allergic inammation. Long chain n-3 PUFA inhibit incorporation of AA into cell membranes and inhibit AA metabolism into inammatory eicosanoids and give rise to less potent inammatory eicosanoids. EPA, for example, will compete with AA as a substrate for the 5-LO and COX enzymes, thereby favouring the production of the less inammatory 3-series PGs and the 5-series LTs. Modulation of LT production with diets high in omega-3 and omega-6 FA has also been reported in normal and atopic dogs [33, 41]. Studies in healthy dogs fed low ratio n-6:n-3 diets showed decreased production of LTB 4 by neutrophils and in skin [41, 42] and another study showed decreased production of PGE2 when dogs were fed a n-6:n-3 diet with a ratio of 1 and a high EPA and DHA dose [33]. It was unclear whether these alterations in LTs were due to the different ratios or to the dietary supplementation with high amounts of total n-3 FA [33]. In most studies performed in dogs plasma FA changes mirrored the FA content of the test diets [29, 33, 43]. This was also true for our study (Table 3). Dogs fed diet A showed signicant higher percentages of LA in plasma after 12 weeks than those fed diet B. Together with signicant lower percentages for ALA, EPA and DHA this results in a signicant higher ratio of n-6:n3 plasma FA (Table 3). The percentage of plasma AA is signicantly decreased at T=1 in the group fed diet A, which might indicate that the habitual diets of these dogs contained more AA. Compared to the start of the study dogs fed diet B only show signicant lower amounts of total n-6 FA and PUFA and increased amounts of monounsaturated (MFA) FA which t their diet (Table 1). Although diet B contains a higher percentage of total n-3 FA compared to diet A, plasma of the dogs on this diet show a trend to a lower percentage of total n-3 FA compared to their baseline amounts. Probably the test diet did contain less n-3 FA than their habitual diets did. The situation with FA amounts is somewhat different in the skin compartment: no signicant changes are found for the different FA of the dogs fed diet A in non-lesional and lesional skin after 12 weeks (Table 5). In dogs fed the low n-6:n-3 FA diet (B) both non-lesional and lesional skin demonstrate signicant decreased amounts of LA. This is also true for the total amount of n-6 FA in non-lesional skin and the ratio of n6:n-3 FA in lesional skin (Table 5). As most standard canine diets contain larger amounts of LA than diet B our results t with what had to be expected. However in dogs fed diet A we expected to nd a signicant higher percentage of LA in skin, like we did observe in plasma. Potentially in skin, based on skin homeostatic processes, the maximum amount of incorporation of individual FA is limited and this level had already been reached for LA. In this study the dogs had been fed a random diet before entering the study, theoretically with varying dietary n-6 and n-3 FA contents. The impact of these small variations is probably limited as no signicant differences were found for the amounts of FA in non-lesional skin, lesional skin and plasma between the groups at the start of the trial. Although plasma LA levels increased after 12 weeks on the high ratio diet A this was also not reected in the PBMC FA content. Similarly AA contents were comparable in plasma at T=0 and T=1 when
93 Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs

comparing diet A and B, but decreased in PBMC after 12 weeks of the high ratio diet A. In human this was also observed after examining the impact of LA intake on AA formation [44]; an increase in dietary LA neither resulted in an increase in AA plasma lipids. A high intake of LA even resulted in a decrease of AA. The authors of this study state that the high tissue levels of AA are derived from dietary AA intake and not from endogenous biosynthesis of LA. This is in agreement with studies in vegans having higher percentages of LA in plasma lipids but lower AA levels [45] probably based on the inhibition of delta-6-desaturase by LA [44, 46]. This might be the explanation for the signicant lower percentage of AA in PBMC of dogs that we demonstrated after diet A. The amount of plasma ALA, EPA and DHA, reected in total n-3 FA, was signicantly decreased at T=1 after the high ratio diet, whereas on the low ratio diet these concentrations in plasma were maintained. A likely explanation could be replacement of n-3 FA by n-6 FA as a substrate for the enzyme. In spite of the fact that it is known that plasma FA levels, and skin FA levels to a lesser extent, respond to dietary FA alterations [29, 33, 43], it is unknown so far whether this is reected in clinical improvement. In the present study a signicant clinical improvement was noticed in both the high and low n-6:n-3 ratio diet groups based on owner scores for pruritus and overall SASSAD scores which correlated extremely well at the start of the trial and after 12 weeks (Figure 1). However, in skin tissue no signicant differences were observed in the AA levels between T=0 and T=1, despite decreased amounts of LA, being the main precursor of AA, after diet B. These results alone cannot explain the signicant clinical improvement in both trial groups. Interestingly, responder dogs with an improvement of more than 50 per cent (Figure 2) had signicantly lower percentages of AA (Figure 3) in non-lesional skin than the animals with less than 50 per cent improvement, which may be reected in less inammatory signals. For lesional skin this difference between high and low responders was not found (Figure 4). However, although dogs showed an overall signicant clinical improvement, lesional skin was still present. From these lesional sites, biopsies were taken and this might explain why unchanged amounts of AA were found. Although we did not nd signicant differences in the amount of cutaneous CD3+ T cells, a trend to lower amounts at T=1 was observed in both groups of dogs (Figure 5). Moreover, non-lesional skin contains a signicant lower amount of AA compared to lesional skin (Table 4) and also a signicant lower amount of CD3+ T cells. These observations may in part explain the clinical improvement seen in these dogs. Another explanation for clinical improvement may be that both diets, for different reasons, have a positive effect on skin inammation. This ts with a recent review examining the existing evidence that a diet rich
Chapter 4

in LA leads to excessive inammatory responses and contributes to the increase of various chronic diseases, such as AD [47]. The review concludes that the data they examined do not support this hypothesis; in humans a high intake of LA does not promote inammation. Most studies tried to nd associations with plasma LA amount and the production of various

94

inammatory markers, such as IL-1, IL-6 and TNF- [48-51]. However, plasma LA by itself was neither positively nor negatively related with any of the inammatory markers measured. A very recent study in healthy man conrms these results because it was shown that LA intake does not modify the production of pro-inammatory cytokines in PBMC cultures [52]. A study in young and aged dogs fed a diet with a n-6:n-3 FA ratio of 5:1 did not show signicant changes in IL-6 and IL-1 production by PBMC and peritoneal macrophages [53]. Our study is in agreement with these studies as it is remarkable that lesional skin of dogs fed diet B, the low n-6:n-3 ratio diet, showed a trend to higher amounts of both IL-1 and IL-6 at T=1 (Figures 6 and 7). Some studies though have shown a role for both these cytokines in regulating permeability barrier homeostasis [54, 55]. However, responder dogs (diet A and B together) with a clinical improvement of more than 50 per cent show a trend to lower levels of these cytokines (Figures 8 and 9) at lesional sites. It is becoming more evident that the n-6 pathway is not strictly a pathway leading to only strong inammation promoting metabolites. Besides DGLA, being substrate for enzymes leading to anti-inammatory 1-series PG, the last decade accumulating data indicate that AA-derived lipid mediators play an essential role in resolving inammatory responses in vivo [56]. Importantly, n-6 PUFA can also play an important role in maintaining an effective cutaneous barrier [57]. In dogs only few studies focussed on the epidermal lipid barrier. Inman et al. [58] showed a disrupted epidermal barrier in non-lesional skin of atopic dogs. It is known that LA plays an important role in maintaining a normal functional epidermal barrier as part of the phospholipid ceramides, independent of its role in prostaglandin metabolism [59, 60]. The signicant higher amount of LA after 12 weeks in the skin of dogs fed the high ratio diet may have exerted a positive effect on the disrupted barrier and in this way contributed to diminished inammation. In conclusion both groups of AD dogs fed a diet with either a high n-6:n-3 ratio (20:1) or a low n-6:n-3 ratio (5:1) improved signicantly. Alterations in n-6 fatty acids do not explain this effect. Irrespective of the diet, we found lower AA percentages in non-lesional skin in dogs with improvement in the clinical responses of more than 50 per cent. Together with the nding of signicant higher amounts of AA in lesional skin compared to non-lesional skin, this suggests that AA may play a role in modulating the clinical response.
Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 95

Acknowledgements The authors are greatly indebted to Ilse Bihari for the performance of the immunohistochemistry and cell counting. We wish to thank Sietske Mesu for carefully taking care of the randomisation and further distribution of the diets for the dog owners. We thank Noortje Jansen for her assistance with the statistical analysis.

References
1. Olivry T, DeBoer DJ, Grifn CE, Halliwell RE, Hill PB, Hillier A et al. The ACVD task force on canine atopic dermatitis: forewords and lexicon. Vet Immunol Immunopathol 2001: 81(3-4): p. 143-6. Hillier A and Grifn CE. The ACVD task force on canine atopic dermatitis (I): incidence and prevalence. Vet Immunol Immunopathol 2001: 81(3-4): p. 147-51. Grifn CE and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis. Vet Immunol Immunopathol 2001: 81(3-4): p. 255-69. Willemse A. Atopic skin disease: a review and a reconsideration of diagnostic criteria. J Small Anim. Pract. 1986: (27): p. 771-778. Calder PC. n-3 polyunsaturated fatty acids, inammation, and inammatory diseases. Am J Clin Nutr 2006: 83(6 Suppl): p. 1505S-1519S. Sala-Vila A, Miles EA, and Calder PC. Fatty acid composition abnormalities in atopic disease: evidence explored and role in the disease process examined. Clin Exp Allergy 2008: 38(9): p. 1432-50. LLoyd DH, Thomsett, L. R. Essential fatty acid supplementation in the treatment of canine atopy. Vet Dermatol 1989: 1: p. 41-44. Pukey B. A clinical evaluation of the efcacy of omega 3 fatty acids in the treatment of pruritus in canine atopy. CAVD Bull. 1987: (4): p. 2-4. Scott DW, Buerger, R. G. Nonsteroidal antiinammatory agents in the management of canine pruritus. J Am Anim Hosp Assn 1988: 24: p. 425-428. Scott DW and Miller WH, Jr. Nonsteroidal management of canine pruritus: chlorpheniramine and a fatty acid supplement (DVM Derm Caps) in combination, and the fatty acid supplement at twice the manufacturers recommended dosage. Cornell Vet 1990: 80(4): p. 381-7. Miller WH, Grifn, C. E., Scott, D. W., Angarano, D. K., Norton, A. L. Clinical trial of DVM Derm Caps in the treatment of allergic disease in dogs: a non-blinded study. J Am Anim Hosp Assn 1989: 25: p. 163-168. Paradis M, Lemay, S., Scott, D. W. The efcacy of clemastine (Tavist), a fatty acid-containing product (Derm Caps), and the combination of both products in the management of canine pruritus. Vet Dermatol 1991: 2: p. 17-20. Miller WH, Scott, D. W., Wellington, J. R. Investigation on the antipruritic effects of ascorbic acid given alone and in combination with a fatty acid supplement to dogs with allergic skin disease. Canine Practice 1992: 17: p. 11-13. Bond R and Lloyd DH. A double-blind comparison of olive oil and a combination of evening primrose oil and sh oil in the management of canine atopy. Vet Rec 1992A: 131(24): p. 558-60. Bond R and Lloyd DH. Randomized single-blinded parallel comparison of an evening primrose oil and sh oil combination and concentrates of these oils in the management of canine atopy. Vet Dermatol 1992B: 3: p. 215-219.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.
Chapter 4

15.

96

16.

Scott DW, Miller WH, Jr., Decker GA, and Wellington JR. Comparison of the clinical efcacy of two commercial fatty acid supplements (EfaVet and DVM Derm Caps), evening primrose oil, and cold water marine sh oil in the management of allergic pruritus in dogs: a double-blinded study. Cornell Vet 1992: 82(3): p. 319-29. Scarff DH and Lloyd DH. Double blind, placebo-controlled, crossover study of evening primrose oil in the treatment of canine atopy. Vet Rec 1992: 131(5): p. 97-9. Bond R and Lloyd DH. Double blind comparison of three concentrated essential fatty acid supplements in the management of canine atopy. Vet Dermatol 1993: 4: p. 185-189. Logas D and Kunkle GA. Double-blinded crossover study with marine oil supplementation containing highdose eicosapentaenoic acid for the treatment of canine pruritic skin disease. Vet Dermatol 1994: 5: p. 99104. Sture GH and Lloyd DH. Canine atopic disease: therapeutic use of an evening primrose oil and sh oil combination. Vet Rec 1995: 137(7): p. 169-70. Harvey RG. A blinded, placebo-controlled study of the efcacy of borage seed oil and sh oil in the management of canine atopy. Vet Rec 1999: 144(15): p. 405-7. Hall JA, Henry LR, Jha S, Skinner MM, Jewell DE, and Wander RC. Dietary (n-3) fatty acids alter plasma fatty acids and leukotriene B synthesis by stimulated neutrophils from healthy geriatric Beagles. Prostaglandins Leukot Essent Fatty Acids 2005: 73(5): p. 335-41. Hall JA, Picton RA, Skinner MM, Jewell DE, and Wander RC. The (n-3) fatty acid dose, independent of the (n-6) to (n-3) fatty acid ratio, affects the plasma fatty acid prole of normal dogs. J Nutr 2006: 136(9): p. 2338-44. Hall JA, Wander RC, Gradin JL, Du SH, and Jewell DE. Effect of dietary n-6-to-n-3 fatty acid ratio on complete blood and total white blood cell counts, and T-cell subpopulations in aged dogs. Am J Vet Res 1999: 60(3): p. 319-27. Wander RC, Hall JA, Gradin JL, Du SH, and Jewell DE. The ratio of dietary (n-6) to (n-3) fatty acids inuences immune system function, eicosanoid metabolism, lipid peroxidation and vitamin E status in aged dogs. J Nutr 1997: 127(6): p. 1198-205. Berth-Jones J. Six area, six sign atopic dermatitis (SASSAD) severity score: a simple system for monitoring disease activity in atopic dermatitis. Br J Dermatol 1996: 135 Suppl 48: p. 25-30. Brinkhof B, Spee B, Rothuizen J, and Penning LC. Development and evaluation of canine reference genes for accurate quantication of gene expression. Anal Biochem 2006: 356(1): p. 36-43. Glos K, Linek M, Loewenstein C, Mayer U, and Mueller RS. The efcacy of commercially available veterinary diets recommended for dogs with atopic dermatitis. Vet Dermatol 2008: 19(5): p. 280-7. Baddaky-Taugbol B, Vroom M, Nordberg L, Leistra M, Sinke J, Hovenier R et al. A randomised, controlled, double-blinded, multicentre study on the efcacy of a diet rich in sh oil and borage oil in the control of canine atopic dermatitis. Advances in Veterinary Dermatology, eds. A.Hillier, A.Foster, K.Kwochka., Proceedings of fth world congress of veterinary dermatology, Vienna (25-28 August 2004) 2005: 5: p. 173-178.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 97

30.

Bensignor E, Morgan DM, and Nuttall T. Efcacy of an essential fatty acid-enriched diet in managing canine atopic dermatitis: a randomized, single-blinded, cross-over study. Vet Dermatol 2008: 19(3): p. 15662. Remillard R. Omega 3 fatty acids in canine and feline diets: a clinical success or failure? Veterinary clinical nutrition 1998: 5: p. 6-11. Hansen RA, Ogilvie GK, Davenport DJ, Gross KL, Walton JA, Richardson KL et al. Duration of effects of dietary sh oil supplementation on serum eicosapentaenoic acid and docosahexaenoic acid concentrations in dogs. Am J Vet Res 1998: 59(7): p. 864-8. Nesbitt GH, Freeman LM, and Hannah SS. Effect of n-3 fatty acid ratio and dose on clinical manifestations, plasma fatty acids and inammatory mediators in dogs with pruritus. Vet Dermatol 2003: 14(2): p. 67-74. Campbell KL, Czarnecki-Maulden GL, and Schaeffer DJ. Effects of animal and soy fats and proteins in the diet on fatty acid concentrations in the serum and skin of dogs. Am J Vet Res 1995: 56(11): p. 1465-9. Campbell KL and Dorn GP. Effects of oral sunower oil and olive oil on serum and cutaneous fatty acid concentrations in dogs. Res Vet Sci 1992: 53(2): p. 172-8. Bergers M, Verhagen DR, Jongerius M, van de Kerkhof PC, and Mier PD. A unique phospholipase A2 in human epidermis: its physiologic function and its level in certain dermatoses. J Invest Dermatol 1988: 90(1): p. 23-5. Marsella R. Update on the role of leukotrienes in the pathogenesis of atopy: a comparative review. Vet Dermatol 2001: 12(2): p. 63-74. Spanbroek R, Stark HJ, Janssen-Timmen U, Kraft S, Hildner M, Andl T et al. 5-Lipoxygenase expression in Langerhans cells of normal human epidermis. Proc Natl Acad Sci U S A 1998: 95(2): p. 663-8. Radmark O, Werz O, Steinhilber D, and Samuelsson B. 5-Lipoxygenase: regulation of expression and enzyme activity. Trends Biochem Sci 2007: 32(7): p. 332-41. Doepping S, Funk CD, Habenicht AJ, and Spanbroek R. Selective 5-lipoxygenase expression in Langerhans cells and impaired dendritic cell migration in 5-LO-decient mice reveal leukotriene action in skin. J Invest Dermatol 2007: 127(7): p. 1692-700. Vaughn DM. Evaluation of dietary n-6 to n-3 fatty acid ratios on leukotriene B synthesis in dog skin and neutrophils. Veterinary Dermatology 1994: 5: p. 163-173. Byrne KP, Campbell KL, Davis CA, Schaeffer DJ, and Troutt HF. The effects of dietary n-3 vs. n-6 fatty acids on ex-vivo LTB4 generation by canine neutrophils. Vet Dermatol 2000: 11: p. 123-131. Taugbol O, Baddaky-Taugbol B, and Saarem K. The fatty acid prole of subcutaneous fat and blood plasma in pruritic dogs and dogs without skin problems. Can J Vet Res 1998: 62(4): p. 275-8. Adam O, Tesche A, and Wolfram G. Impact of linoleic acid intake on arachidonic acid formation and eicosanoid biosynthesis in humans. Prostaglandins Leukot Essent Fatty Acids 2008: 79(3-5): p. 177-81. Woodside JV and Kromhout D. Fatty acids and CHD. Proc Nutr Soc 2005: 64(4): p. 554-64.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

Chapter 4

44.

45.

98

46.

Sanders TA and Roshanai F. Platelet phospholipid fatty acid composition and function in vegans compared with age- and sex-matched omnivore controls. Eur J Clin Nutr 1992: 46(11): p. 823-31. Fritsche KL. Too much linoleic acid promotes inammation-doesnt it? Prostaglandins Leukot Essent Fatty Acids 2008: 79(3-5): p. 173-5. Ferrucci L, Cherubini A, Bandinelli S, Bartali B, Corsi A, Lauretani F et al. Relationship of plasma polyunsaturated fatty acids to circulating inammatory markers. J Clin Endocrinol Metab 2006: 91(2): p. 439-46. Pischon T, Hankinson SE, Hotamisligil GS, Rifai N, Willett WC, and Rimm EB. Habitual dietary intake of n-3 and n-6 fatty acids in relation to inammatory markers among US men and women. Circulation 2003: 108(2): p. 155-60. Liou YA, King DJ, Zibrik D, and Innis SM. Decreasing linoleic acid with constant alpha-linolenic acid in dietary fats increases (n-3) eicosapentaenoic acid in plasma phospholipids in healthy men. J Nutr 2007: 137(4): p. 945-52. Kelley DS, Taylor PC, Nelson GJ, and Mackey BE. Arachidonic acid supplementation enhances synthesis of eicosanoids without suppressing immune functions in young healthy men. Lipids 1998: 33(2): p. 12530. Damsgaard CT, Lauritzen L, Calder PC, Kjaer TR, and Frokiaer H. Reduced ex vivo interleukin-6 production by dietary sh oil is not modied by linoleic acid intake in healthy men. J Nutr 2009: 139(7): p. 1410-4. Kearns RJ, Hayek MG, Turek JJ, Meydani M, Burr JR, Greene RJ et al. Effect of age, breed and dietary omega-6 (n-6): omega-3 (n-3) fatty acid ratio on immune function, eicosanoid production, and lipid peroxidation in young and aged dogs. Vet Immunol Immunopathol 1999: 69(2-4): p. 165-83. Man MQ, Wood L, Elias PM, and Feingold KR. Cutaneous barrier repair and pathophysiology following barrier disruption in IL-1 and TNF type I receptor decient mice. Exp Dermatol 1999: 8(4): p. 261-6. Wang XP, Schunck M, Kallen KJ, Neumann C, Trautwein C, Rose-John S et al. The interleukin-6 cytokine system regulates epidermal permeability barrier homeostasis. J Invest Dermatol 2004: 123(1): p. 124-31. Serhan CN. Resolution phase of inammation: novel endogenous anti-inammatory and proresolving lipid mediators and pathways. Annu Rev Immunol 2007: 25: p. 101-37. Proksch E, Folster-Holst R, and Jensen JM. Skin barrier function, epidermal proliferation and differentiation in eczema. J Dermatol Sci 2006: 43(3): p. 159-69. Inman AO, Olivry T, Dunston SM, Monteiro-Riviere NA, and Gatto H. Electron microscopic observations of stratum corneum intercellular lipids in normal and atopic dogs. Vet Pathol 2001: 38(6): p. 720-3. Elias PM, Brown BE, and Ziboh VA. The permeability barrier in essential fatty acid deciency: evidence for a direct role for linoleic acid in barrier function. J Invest Dermatol 1980: 74(4): p. 230-3. Bauer JE. Facilitative and functional fats in diets of cats and dogs. J Am Vet Med Assoc 2006: 229(5): p. 680-4.

47.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

Successful alteration of dietary n-6:n-3 fatty acids ratios by means of linoleic acid does not correlate to clinical effect on atopic dermatitis in dogs 99

48.

Chapter 4

100

CHAPTER 5

Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis
Yvette M. Schlottera, Victor P.M.G. Ruttenb, c, Frank M. Riemersa, Gary Davenportd, Edward F. Knole, Ton Willemsea, b

Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, the Netherlands Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, the Netherlands; Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Republic of South Africa and P&G Pet Care, Lewisburg Technical Center, Lewisburg, Ohio, USA University Medical Center Utrecht, Department of Dermatology/Allergology, Utrecht, the Netherlands

d e

Journal of Dermatological Science 2009; 54(1):49-52

Summary Background -5 (FADS1) and -6 desaturase (FADS2) are key enzymes in the biosynthesis of polyunsaturated fatty acids. It is hypothesized that an impaired function of either one or both of these enzymes results in an altered lipid metabolism systemically as well as locally in the skin that is implicated in the pathogenesis of atopic dermatitis. Objectives To assess differential availability or function of one or both desaturases in lesional versus non-lesional atopic- and healthy skin potentially resulting in altered fatty acid composition and its possible association with the pathogenesis of AD. Methods In non-lesional and lesional skin of atopic dogs and control skin from healthy dogs mRNA expression levels of both desaturase enzymes were measured by quantitative realtime PCR. In addition fatty acid composition was measured by gas chromatography of fatty acid methyl esters. Results Expression of both -5 and -6 desaturase mRNA in lesional atopic skin was signicant lower compared to that in non-lesional atopic skin. In addition, -5 desaturase expression in lesional skin was signicant lower compared to control skin. In lesional atopic skin signicant higher amounts of dihomo--linolenic (DGLA) acid, arachidonic acid (AA) and eicosapentaenoic acid (EPA) were found compared to non-lesional atopic skin. Conclusion The data obtained support the hypothesis that impaired activity of -5 and -6 desaturases might play a role in the pathogenesis of atopic dermatitis, i.e. signicant lower amounts of -5 and -6 desaturase mRNA in lesional skin are paralleled by differences in fatty acid composition of non-lesional and lesional skin. This highlights the importance of further research into the regulation of these desaturases in the skin.

Chapter 5 102

Introduction Canine atopic dermatitis (AD) is a chronic inammatory (skin) disease which shares several characteristics with its human counterpart e.g. the genetic predisposition to develop the disease, the early age of onset, the predilection sites of the affected skin and similarities in immunopathogenic mechanisms [1, 2]. Sinke et al. [2] reviewed the immune dysregulation of canine AD and stated that, similar to human AD, it is probably the resultant of a systemic component, the atopic constitution, and a tissue-specic component, i.c. altered reactivity of the skin [3, 4]. The atopic constitution implies an imbalance in lymphocyte populations and their subsequent cytokine production based on genetic and environmental factors. With respect to altered skin reactivity both allergen-specic cellular mechanisms, in which allergen-specic T-helper cells play a key role [5, 6], and an impaired epidermal barrier in atopic subjects likely contribute to the onset and perpetuation of AD in man [7, 8]. In human, the outer layer of the epidermal barrier (stratum corneum) is composed of 50% ceramides, 25 % cholesterol and 15 % free fatty acids [9]. Active de-novo synthesis of fatty acids occurs in the epidermis employing the enzymes: acetyl-CoA carboxylase and fatty acid synthase. Disruption of the permeability barrier results in a marked increase in fatty acid (FA) synthesis by these enzymes. Extracutaneously-derived fatty acids also seem to contribute signicantly to maintenance of this epidermal barrier homeostasis [9]. In the beginning of the last century it was proposed that AD is related to abnormal FA metabolism since linoleic acid (LA) deciency in human and rodents leads to marked abnormalities of the skin of AD patients [10-14] e.g. abnormalities observed in stratum corneum function resulting in increased transepidermal water loss and clinically a dry skin. More recent studies conrm changes in the lipid organization of the stratum corneum of AD patients [15-17]. It has been well established that in AD patients LA concentrations tend to be elevated in blood and adipose tissue which implies that they do not suffer from a deciency in LA [18]. However, several studies reported that the levels of downstream metabolites of LA and also of ALA were found to be reduced [19-25]. Both -5-desaturase (FADS1) and -6desaturase (FADS2) are responsible for the synthesis of highly unsaturated n-3- and n6 FA from LA and ALA (Figure 1). Thus decit amounts of LA and ALA metabolites have been attributed to reduced -6- and -5-desaturase activity [19, 20, 26, 27]. Based on these ndings and supported by a study which demonstrated that in atopic babies signicant higher amounts of LA and signicant lower amounts of its metabolites DGLA and AA are present at birth and precede the development of skin lesions [28] Horrobin suggested AD to be a disease of inherited and thus of systemic inadequate -6-desaturation [29]. Analyses of mRNA of both desaturases showed that their mRNA was found to be expressed in many human tissues, however its presence in skin was not investigated [30, 31]. Based on earlier studies of Chapkin et al. [32, 33] which showed that human, rat and guinea pig epidermis
103 Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis

lack enzymatic activity of both desaturases, this is now generally accepted and implies that several important members of epidermal fatty acids, e.g. arachidonic acid (AA), are derived from extra-epidermal sites. Some studies in atopic dogs or canine mast cell lines suggested lower or decient activities of -6 desaturase, -5 desaturase or both as established by FA measurement [34-38]. To date very few studies focused on the characteristics and metabolism of skin lipids in dogs with respect to a possible epidermal lipid barrier defect in canine AD. We hypothesize that an abnormal lipid metabolism contributes to the pathogenesis of canine AD, potentially as a result of a defect in the epidermal lipid barrier. The aim of the present study was to nd evidence for this association in dogs by analysis of the mRNA expression of these enzymes and the PUFA composition in non-lesional and lesional skin of atopic dogs in comparison to healthy controls.

Chapter 5

Figure 1. Metabolic pathway of essential fatty acids

104

Materials and Methods Dogs Two groups of dogs were used in this study. Group I consisted of privately-owned atopic dogs (n=28) presented to the Department of Clinical Sciences of Companion Animals, Utrecht University with respect to their skin disease. All dogs fullled the diagnostic criteria for atopic dermatitis [39]. This group consisted of 19 Labradors Retrievers and one of each of the following breeds: Flatcoated Retriever, Gordon Setter, Boxer, Viszla, French Bulldog, Jack Russell Terrier, Podenco Canario, Dachshund and German Shepherd; male and female dogs were equally represented. Their age ranged between 1 and 8 years (median 3.6 years) and they weighted between between 8.0 and 44.0 kg (median 28.9 kg). Group II included seven healthy control dogs owned by the Department and comprised of ve male Beagle dogs and two female mongrel dogs with their age and weight ranging between 411 years (median 8 years) and 14.0-18.0 kg (median 16.0 kg), respectively. From all dogs 6 mm punch biopsies were obtained under general anesthesia. From the AD dogs lesional and non-lesional skin was collected. Healthy control and non-lesional skin specimens were all taken from the lateral thorax, whereas the lesional biopsies were obtained from affected predilection sites. After collection the skin biopsies were immediately snap-frozen in liquid nitrogen and stored at -70 C until used for RNA isolation. All samples were obtained after written consent of the owner. The procedures were approved by the Utrecht University Animals Ethical Committee, as required under Dutch legislation.
Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis 105

RNA isolation and cDNA synthesis Total RNA was isolated using a combination of the TRizol reagent (Invitrogen, Breda, the Netherlands) and the RNeasy Mini Kit (Qiagen, Leusden, the Netherlands) according to the manufacturers instructions. In short, the skin tissue was disrupted and homogenized in Trizol reagent using a Biopulverizer (Biospec #59013, Biospec Inc., Bartlesville, OK, USA) and Ultra-turrax (T8, IKA Labortechnik GmBH, Staufen, Germany). The TRIzol manufacturers instructions were followed until the water-phase was obtained after the chloroform step. Subsequently, the procedure continued with RNeasy colums for cleanup of the RNA including the optional on-column DNase digestion (Qiagen Rnasefree DNase kit). RNA was dissolved in 30 l of RNase free water and was quantied spectrophotometrically using Nanodrop ND-1000 (Isogen Life Sciences, IJsselstein, the Netherlands). In total 1.5 g of RNA was reversed transcribed into a total volume of 60 l using oligo(dT) primers combined with random hexamer primers and an MMLV-derived reverse transcriptase according to the manufacturers instructions (iScript cDNA Synthesis Kit, Bio-Rad, Veenendaal, the Netherlands). After synthesis cDNA samples were diluted

ve times. Samples were screened for contamination with genomic DNA by qPCR of nonreverse-transcribed RNA templates.

Primer design and testing Primer sets for enzymes involved in fatty acid synthesis (Table 1) were developed using known dog sequences available from Ensembl (www.ensembl.org) or NCBI (www.ncbi.nih. gov/genbank/index.html). Primer design was performed with Oligo Explorer 1.1.0 software (www.genelink.com/tools/gl-downloads.asp). To reduce chances of amplifying traces of genomic DNA, the primers were positioned in different exons. Uniqueness and specicity of each primer were veried using the Basic Local Alignment Search Tool (www.ncbi.nlm.nih. gov/blast) returning GenBank accession numbers. Final primers were selected based on the specicity and efciency by measuring a temperature gradient of a 16-fold dilution series of pooled cDNA by real-time quantitative PCR including melting curve analysis. In addition the amplied products were veried by sequencing using BigDye Terminator Cycle Sequencing Ready reaction (Applied Biosystems, Foster City, CA), according to the standard protocol. The Tercycle product was puried and analyzed on an ABI3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Gene specic primers for the canine endogenous reference genes, -glucuronidase (BGLR/ GUSB), ribosomal protein S5 (RPS5) and ribosomal protein 19 (RPS 19) have been previously described (Table 1)
Table 1. Nucleotide sequences of canine specic primers for quantitative PCR analysis
Gene -Glucuronidase (BGLR) Ribosomal protein S5 (RPS5) Ribosomal protein S19 (RPS19) Fatty acid desaturase1 (FADS1) Fatty acid desaturase2 (FADS2) Accession number NM_001003191 XM_533568 XM_533657 XM_540914 XM_540913 Forward primer 5 3 AGACGCTTCCAA/GTACCCC TCACTGGTGAG/AACCCCCT CCTTCCTCAAAAA/GTCTGGG GAGAACTGTCTCCAGAGCAGCC CCTGCCTTACAACCACCAGC Reverse primer 5 3 AGGTGTGGTGTAGAGGAGCAC CCTGATTCACACGGCGTAG GTTCTCATCGTAGGGAGCAAG CCAAAGAGTGAGCCAGGCAG AAGTCCACCCAGTCTCTGCG Product length (bp) 103 141 95 182 120 Ta (C) 62.0 62.5 61.0 65.0 62.0

Quantitative PCR Real-time qPCR, based on the high afnity, double-stranded DNA-binding dye SYBR Green using a Bio-Rad My-IQ detection system (IQ SYBR Green Supermix and My-IQ, Bio-Rad,
Chapter 5

Veenendaal, the Netherlands) according to the manufacturers instructions, was performed in duplo. Primers (Eurogentec, Maastricht, the Netherlands) had a nal concentration of 400 nM each and 1.0 l of cDNA template was used in a reaction volume of 25 l on 96-well iCycler iQ plates (Bio-Rad). All PCR reactions were performed using a two-step program,

106

starting with a 2 or 5 min polymerase activation step at 95 C followed by 45 cycles of 20 s denaturation at 95 C and 30 s at Tm. The reaction was continued by 30 s at 60 C followed by a melting curve being the resultant of the stepwise increase in temperature of 1.5 C each 15 s, ranging from 60 C to 99C. A non-template control in duplicate was included on each plate. Standard curves constructed by plotting the relative starting amount versus threshold cycles were generated using serial 4-fold dilutions of pooled cDNA fractions from control skin, non-lesional and lesional AD skin, Con-A stimulated PBMC and liver. The amplication efciency, E = (10 (1/-slope) -1) x 100%, of all standard lines was > 95 % and < 105% and all melting curves described a single distinctive peak. For each experimental sample the mRNA expression of the gene of interest and of the endogenous reference genes GUSB, RPS19 and RPS5 were determined from the appropriate standard curve. The expression of the genes of interest was normalized to the mean expression of the endogenous references. The normalized values were divided by the normalized values of the calibrator (control group) to generate relative expression levels. Data analysis was performed with My-IQ software (Bio-RAd, Veenendaal, the Netherlands).

Fatty acid analyses Fatty acid compositions of the skin biopsies were determined by a commercial laboratory (IAMS Petfood Company, Lewisburg, Ohio, USA) by gas chromatography of FA methyl esters. Fatty acid concentration is expressed as a percentage of total fatty acids. For statistical analyses the LOG normalized values were used.
Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis 107

Statistical analysis The relative expression levels of the genes of interest are reported as mean SEM. All statistical analyses were performed with SPSS 12.0.1 for Windows (SPSS Benelux BV, Gorinchem, the Netherlands). The two-sided level of signicance was set at p 0.05. Group means of non-lesional and lesional atopic skin versus healthy control skin were compared by using the multivariate ANOVA (MANOVA) of the general linear model (GLM). Differences between the group means of non-lesional skin versus lesional skin were compared using repeated measures analysis of the GLM. Relationships between variables were evaluated by calculation of Pearsons correlation coefcient.

Results Gene expression levels of -5 desaturase (FADS1) and -6 desaturase (FADS2) were measured by quantitative PCR in biopsies from non-lesional and lesional skin of canine AD patients (n=28) and from control skin of healthy dogs (n=7). In these samples FADS1 and FADS2 show comparable expression proles (amplication after 26-28 cycles). The mRNA expression level of FADS1 was signicantly lower in lesional skin compared to healthy control skin and non-lesional atopic skin. The FADS1 mRNA expression was 5.5fold lower in lesional atopic skin compared to healthy control skin. A 4-fold decrease was found for FADS1 mRNA expression when compared to non-lesional atopic skin (Figure 2A). With respect to FADS2 mRNA expression a signicant decrease (1.5-fold) was found in lesional AD skin when compared to non-lesional AD skin (Figure 2B). Possible interactions between the expressions of both measured genes in all the tissue groups were examined by calculation of Pearsons correlation coefcient. Some signicant positive relations were found. The highest correlation was found in non-lesional skin between the levels of FADS1 and FADS2 expression (r = 0.57; p < 0.01). A further positive correlation was shown in lesional skin between the expression levels for FADS1 en FADS2 (r = 0.47; p < 0.05). Fatty acid analysis of non-lesional and lesional skin showed signicant higher levels of DGLA, AA and EPA in lesional skin compared to non-lesional skin in AD dogs (Figure 2C). For LA, GLA and ALA no signicant differences were found.

Figure 2A. Relative mRNA levels of -5 desaturase (FADS1) in healthy skin,

Chapter 5

non-lesional AD skin (NLS) and lesional AD skin (LS). Data represent mean SEM. p < 0.0001 compared to healthy control skin *** p < 0.0001 compared to non-lesional skin

108

Figure 2B. Relative mRNA levels of -6 desaturase (FADS2) in healthy skin, nonlesional AD skin (NLS) and lesional AD skin (LS). Data represent mean SEM. ** p < 0.001 compared to non-lesional skin

Figure 2C. Fatty acid composition (mean of percentage SEM) of skin lipids in non-lesional (NLS) and lesional skin (LS) * P 0.05 when non-lesional and lesional skin are compared

Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis 109

Discussion In human evidence exists that levels of FA metabolites derived from LA in atopic patients differ from those measured in healthy control subjects. It is assumed that an impaired epidermal barrier plays a role in the pathogenesis of AD in human and this might relate to local changes in the composition of polyunsaturated fatty acids (PUFA) and their metabolites. Like in human AD it is supposed that in canine AD a defective epidermal barrier partly results from aberrant systemic or local fatty acid metabolism. To nd further evidence for this hypothesis we analyzed the expression of the two key enzymes in the omega-6 and omega-3 FA pathway leading to the synthesis of the highly unsaturated FA: -5 (FADS1) and -6 desaturase (FADS2) (Figure 1). Our study group included 28 atopic dogs and the group comprised of about 66% Labrador Retrievers and 33 % dogs of other breeds which reects the extent of the problem of atopic disease in the rst mentioned breed. We hypothesized that if the skin of atopic dogs lacks presence or activity of these enzymes we might nd either no mRNA expression in skin of the different groups or lower mRNA expression levels for these enzymes in non-lesional or lesional AD skin versus healthy control skin. Since we were able to measure mRNA expression for both enzymes in all skin types complete absence from skin is not likely. However, signicant differences between the groups became obvious. An interesting nding was the signicant lower expression of FADS1 in lesional skin when compared to non-lesional skin and normal control skin (Figure 2). Although due to high sequence homology both FA desaturases might be subject to the same regulatory mechanisms resulting in similar expression proles [30], this was not found. FADS2 expression was signicantly lower in lesional skin compared to non-lesional skin but has the same expression prole as seen in healthy control skin (Figure 3). Suppression of human -5 and -6 desaturase activities was shown to be associated with decreased -5 and -6 desaturase mRNA levels [30, 31], thus we assume that the low mRNA levels found for FADS1 and FADS2 in lesional skin coincide with a lower enzymatic activity. Decreased activity of the enzyme in AD [18] might be due to mutation of the enzyme, change in cofactors required for the enzyme and the presence of enzyme inhibitors. Our study however implies that suppression already takes place at the mRNA level. It is plausible that the decreased mRNA expression of -5 desaturase in atopic skin results from changed regulation by SREBP1c and PPAR-. These transcription factors play important roles in the regulation of both -5 and -6 desaturases. Based on the pathway of PUFA biosynthesis it was expected that a decrease in -5-desaturase activity would lead to reduced production of AA from DGLA
Chapter 5

and of EPA from eicosatetraenoic acid (ETA) (Figure 1). In contrast our FA analysis showed signicant increased levels of AA, but also of EPA in lesional skin when compared to nonlesional skin (Figure 3). From the literature it is known that besides the transcription factors mentioned, (dietary) PUFA are major regulators of the expression levels of both -5- and

110

-6 desaturase indicating that these enzymes are involved in feedback regulation with respect to the production of e.g. AA, EPA and DHA [40, 41]. This PUFA inhibition of desaturases is mediated by SREBP-1c whereby PUFA suppress the target gene transcription (e.g. of desaturases) by reducing the active form of SREBP-1c [10, 42]. The decreased expression of -5 desaturase mRNA observed in our study might be explained by the high amounts of AA and EPA found in lesional skin. In this respect also a decreased mRNA expression level for -6 desaturase in lesional skin would be expected. Although a signicant lower expression was found for -6 desaturase mRNA in lesional compared to non-lesional skin this is not comparable to the suppression seen for -5 desaturase mRNA expression in lesional skin. An explanation might be that the nal enzymatic step in the synthesis of AA and EPA is the direct result of -5 desaturase activity and thus these products might be more important in negative feedback regulation of -5 than of -6 desaturase. GLA and stearidonic acid (SDA) are the direct metabolites of -6 desaturase metabolism and as FA analysis did not reveal a signicant higher amount of GLA in lesional versus non-lesional skin this might explain why -6 desaturase was not suppressed by GLA to the same extent as -5 desaturase by AA and EPA. SDA amounts are negligible as this FA metabolite is immediately metabolized further. It is generally accepted that human, rat and guinea pig epidermis lack activity of both these enzymes [32, 33] and that exogenously derived lipids are important for homeostasis of the epidermal lipid barrier. We neither exclude nor conrm that the same is true for canine epidermis since we measured total skin mRNA which includes the dermis and epidermis. In that case mRNA expression might be of dermal origin. Indeed in human skin it is reported that FADS2 mRNA and protein expression is restricted to differentiating sebocytes located in the suprabasal layers of the sebaceous gland [43]. If, however, mRNA expression in the skin is not translated into activity of the enzymes at protein level it would mean that synthesis of PUFA like AA and EPA is not possible and that these dermal PUFA are derived from exogenous sources as is assumed for epidermis. However, this assumption would imply that the signicant differences in PUFA composition of non-lesional versus lesional skin result from transport of PUFA from other endogenous sources, like the liver, to these specic skin localizations, which supposes a very complicated regulation with respect to the routing of PUFA. In conclusion: we assume the presence and activities of both these enzymes in the skin which results in the synthesis of PUFA in the skin itself based on the local differences in skin PUFA composition together with different expression of both desaturases in non-lesional versus lesional skin. It is likely that both transcription factors SREBP-1c and PPAR- play important roles in mediating the (feedback) regulation of -5 and -6 desaturase by PUFA in the skin. The importance of both desaturases is supported by a recent review which suggests that a defect in their activity, leading to diminished production of the benecial
111 Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis

anti-inammatory metabolites from PUFA, might be a factor in the initiation and progression of atherosclerosis, another chronic inammatory disease [45]. Since the desaturases play a role in production of an effective epidermal lipid barrier their dysfunction in the skin may result in a defective epidermal lipid barrier in atopic dermatitis and emphasizes the need for further research into the lipid metabolism in the skin of atopic human and dogs.

Acknowledgements We thank Noortje Jansen for her assistence with the statistical analyses.

Chapter 5 112

References
1 Grifn, C.E. and D.J. DeBoer, The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis. Vet Immunol Immunopathol, 2001. 81(3-4): p. 255-69. Sinke, J.D., V.P. Rutten, and T. Willemse, Immune dysregulation in atopic dermatitis. Vet Immunol Immunopathol, 2002. 87(3-4): p. 351-6. Inman, A.O., et al., Electron microscopic observations of stratum corneum intercellular lipids in normal and atopic dogs. Vet Pathol, 2001. 38(6): p. 720-3. Marsella, R., T. Olivry, and S. Maeda, Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet Dermatol, 2006. 17(2): p. 111-20. Grewe, M., et al., A role for Th1 and Th2 cells in the immunopathogenesis of atopic dermatitis. Immunol Today, 1998. 19(8): p. 359-61. Langeveld-Wildschut, E.G., et al., Evaluation of the atopy patch test and the cutaneous late-phase reaction as relevant models for the study of allergic inammation in patients with atopic eczema. J Allergy Clin Immunol, 1996. 98(6 Pt 1): p. 1019-27. Proksch, E., R. Folster-Holst, and J.M. Jensen, Skin barrier function, epidermal proliferation and differentiation in eczema. J Dermatol Sci, 2006. 43(3): p. 159-69. Segre, J.A., Epidermal barrier formation and recovery in skin disorders. J Clin Invest, 2006. 116(5): p. 1150-8. Feingold, K.R., Thematic review series: Skin Lipids. The role of epidermal lipids in cutaneous permeability barrier homeostasis. J Lipid Res, 2007. 48(12): p. 2531-46. Nakamura, M.T. and T.Y. Nara, Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr, 2004. 24: p. 345-76. Burr, G.O. and M.M. Burr, On the nature and role of the fatty acids essential in nutrition. J Biol Chem, 1930(86): p. 587-621. Hansen, A.E., et al., Essential fatty acids in infant nutrition. III. Clinical manifestations of linoleic acid deciency. J Nutr, 1958. 66(4): p. 565-76. Wright, S., Essential fatty acids and the skin. Br J Dermatol, 1991. 125(6): p. 503-15. Holman, R., Essential fatty acid deciency. Prog Chem Fats Other Lipids, 1971. 9: p. 275-348. Pilgram, G.S., et al., Aberrant lipid organization in stratum corneum of patients with atopic dermatitis and lamellar ichthyosis. J Invest Dermatol, 2001. 117(3): p. 710-7. Yamamoto, A., et al., Stratum corneum lipid abnormalities in atopic dermatitis. Arch Dermatol Res, 1991. 283(4): p. 219-23. Imokawa, G., et al., Decreased level of ceramides in stratum corneum of atopic dermatitis: an etiologic factor in atopic dry skin? J Invest Dermatol, 1991. 96(4): p. 523-6.
Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis 113

8 9

10

11

12

13 14 15

16

17

18

Horrobin, D.F., Essential fatty acid metabolism and its modication in atopic eczema. Am J Clin Nutr, 2000. 71(1 Suppl): p. 367S-72S. Manku, M.S., et al., Reduced levels of prostaglandin precursors in the blood of atopic patients: defective delta-6-desaturase function as a biochemical basis for atopy. Prostaglandins Leukot Med, 1982. 9(6): p. 615-28. Manku, M.S., et al., Essential fatty acids in the plasma phospholipids of patients with atopic eczema. Br J Dermatol, 1984. 110(6): p. 643-8. Laitinen, K., et al., Serum, cheek cell and breast milk fatty acid compositions in infants with atopic and nonatopic eczema. Clin Exp Allergy, 2006. 36(2): p. 166-73. Strannegard, I.L., L. Svennerholm, and O. Strannegard, Essential fatty acids in serum lecithin of children with atopic dermatitis and in umbilical cord serum of infants with high or low IgE levels. Int Arch Allergy Appl Immunol, 1987. 82(3-4): p. 422-3. Wright, S. and C. Bolton, Breast milk fatty acids in mothers of children with atopic eczema. Br J Nutr, 1989. 62(3): p. 693-7. Wright, S. and T.A. Sanders, Adipose tissue essential fatty acid composition in patients with atopic eczema. Eur J Clin Nutr, 1991. 45(10): p. 501-5. Yu, G., N.I. Kjellman, and B. Bjorksten, Phospholipid fatty acids in cord blood: family history and development of allergy. Acta Paediatr, 1996. 85(6): p. 679-83. Calder, P.C. and E.A. Miles, Fatty acids and atopic disease. Pediatr Allergy Immunol, 2000. 11 Suppl 13: p. 29-36. Calder, P.C., Abnormal fatty acid proles occur in atopic dermatitis but what do they mean? Clin Exp Allergy, 2006. 36(2): p. 138-41. Galli, E., et al., Analysis of polyunsaturated fatty acids in newborn sera: a screening tool for atopic disease? Br J Dermatol, 1994. 130(6): p. 752-6. Horrobin, D.F., Fatty acid metabolism in health and disease: the role of delta-6-desaturase. Am J Clin Nutr, 1993. 57(5 Suppl): p. 732S-736S; discussion 736S-737S. Cho, H.P., M. Nakamura, and S.D. Clarke, Cloning, expression, and fatty acid regulation of the human delta-5 desaturase. J Biol Chem, 1999. 274(52): p. 37335-9. Cho, H.P., M.T. Nakamura, and S.D. Clarke, Cloning, expression, and nutritional regulation of the mammalian Delta-6 desaturase. J Biol Chem, 1999. 274(1): p. 471-7. Chapkin, R.S. and V.A. Ziboh, Inability of skin enzyme preparations to biosynthesize arachidonic acid from linoleic acid. Biochem Biophys Res Commun, 1984. 124(3): p. 784-92. Chapkin, R.S., et al., Metabolism of essential fatty acids by human epidermal enzyme preparations: evidence of chain elongation. J Lipid Res, 1986. 27(9): p. 945-54.

19

20

21

22

23

24

25

26

27

28

29

30

31

32
Chapter 5

33

114

34

Seidel, A., T. Gueck, and H. Fuhrmann, The Inuence of long-chain polyunsaturated fatty acids on total lipid fatty acid composition of a canine mastocytoma cell line. J Vet Med A Physiol Pathol Clin Med, 2005. 52(5): p. 219-24. Gueck, T., et al., Alterations of mast cell mediator production and release by gamma-linolenic and docosahexaenoic acid. Vet Dermatol, 2004. 15(5): p. 309-14. Scott, D.W., et al., Effect of an omega-3/omega-6 fatty acid-containing commercial lamb and rice diet on pruritus in atopic dogs: results of a single-blinded study. Can J Vet Res, 1997. 61(2): p. 145-53. Campbell, K., Clinical use of fatty acid supplements in dogs. Vet Dermatol, 1993. 4: p. 167-173. Taugbol, O., B. Baddaky-Taugbol, and K. Saarem, The fatty acid prole of subcutaneous fat and blood plasma in pruritic dogs and dogs without skin problems. Can J Vet Res, 1998. 62(4): p. 275-8. Willemse, A., Atopic skin disease: a review and a reconsideration of diagnostic criteria. J Small Anim. Pract., 1986(27): p. 771-778. Matsuzaka, T., et al., Dual regulation of mouse Delta(5)- and Delta(6)-desaturase gene expression by SREBP-1 and PPARalpha. J Lipid Res, 2002. 43(1): p. 107-14. Nakamura, M.T. and T.Y. Nara, Essential fatty acid synthesis and its regulation in mammals. Prostaglandins Leukot Essent Fatty Acids, 2003. 68(2): p. 145-50.
Altered expression of fatty acid desaturases in the skin of dogs with atopic dermatitis 115

35

36

37 38

39

40

41

42

Xu, J., et al., Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats. J Biol Chem, 1999. 274(33): p. 23577-83. Ge, L., et al., Identication of the delta-6 desaturase of human sebaceous glands: expression and enzyme activity. J Invest Dermatol, 2003. 120(5): p. 707-14. Schaeffer, L., et al., Common genetic variants of the FADS1 FADS2 gene cluster and their reconstructed haplotypes are associated with the fatty acid composition in phospholipids. Hum Mol Genet, 2006. 15(11): p. 1745-56. Das, U.N., A defect in the activity of Delta6 and Delta5 desaturases may be a factor in the initiation and progression of atherosclerosis. Prostaglandins Leukot Essent Fatty Acids, 2007. 76(5): p. 251-68.

43

44

45

Chapter 5

116

CHAPTER 6

Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis
Yvette M. Schlottera, Frank M. Riemersa, Victor P.M.G. Ruttenb, c, Edward F. Knold, Ton Willemsea, b

Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, the Netherlands; Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, the Netherlands; Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Republic of South Africa and University Medical Center Utrecht, Department of Dermatology/Allergology, Utrecht, the Netherlands.

Accepted for publication in Experimental Dermatology

Abstract Canine atopic dermatitis (AD) is a chronic inammatory and pruritic skin disease which shares several characteristics with its human counterpart. Long-chain polyunsaturated fatty acids (PUFA) have the potential to modulate inammatory responses by regulating the metabolism of lipids in the cyclooxygenase (COX) and lipoxygenase (LOX) pathways starting from membrane-derived arachidonic acid (AA). In canine AD there is no insight in expression proles of enzymes involved in these pathways resulting in inammatory mediators. To get insight into the roles of enzymes involved in prostaglandin E 2 (PGE2) and leukotriene B 4 (LTB 4) production gene expression of these enzymes and receptors was quantied by qPCR in non-lesional and lesional skin from atopic dogs and control skin from healthy dogs. Signicant differences in mRNA expression levels of several key enzymes (e.g. 5lipoxygenase (5-LO), 5-LO activating protein (FLAP), leukotriene A4 hydrolase (LTA4H), prostaglandin E synthase 1 (mPGES-1)) and their receptors (prostaglandin E receptors 2 and 3) were found when non-lesional and lesional atopic skin were compared to healthy control skin. Also signicant correlations were found between several of the enzymes, receptors and cytokines within the COX and the LOX pathway. Based on the prole of signicant higher mRNA expressions of important enzymes in the COX and LOX pathways, higher amounts of the inammatory metabolites of the 3-series prostaglandins and 5-series leukotrienes are envisaged. Thus these enzymes might be considered as interesting targets for therapy because their suppression may lead to lower amounts of inammatory mediators and thereby to amelioration of clinical signs in canine atopic dermatitis.

118

Chapter 6

Introduction The recognition that long-chain polyunsaturated fatty acids (PUFA) have the potential to modulate inammatory responses has led to a large number of clinical investigations in various human diseases such as inammatory bowel disease, rheumatoid arthritis, asthma and atopic dermatitis (AD). Also in the dog the interest in the potential benet of n-3 PUFA in modulating inammatory conditions rapidly increases. Canine AD, a chronic inammatory skin disease, shares several characteristics with its human counterpart e.g. the genetic predisposition to develop the disease, the early age of onset, the similarity in predilection sites of the skin lesions and similarities in immunopathogenic mechanisms [1, 2]. In canine and human AD it is currently accepted that imbalances in lymphocyte populations and cytokines production play an important role in the pathogenesis of the disease. Acute skin lesions are e.g. interleukin-4 (IL-4), IL-5, and IL-13. Chronic lesions show a predominance of Th1 lymphocytes, macrophages, and Th1-type cytokines such as interferon-gamma (IFN-) and IL18 [2-7]. Moreover, lipid mediators such as leukotrienes and prostaglandins synthesized from substrate arachidonic acid (AA) and released from e.g. leukocyte membranes, are thought to play a role in the inammation of AD. Leukotrienes, mainly leukotriene B4 (LTB4), are a class of potent inammatory mediators that promote the accumulation and function of leukocytes, e.g. expression of adhesion molecules, transmigration into inamed tissue and the survival and activation at sites of inammation. Of the prostaglandins, prostaglandin E2 (PGE2) is a principal mediator of inammation and involved in several inammatory diseases. The amounts and types of PUFA, e.g. AA or eicosapentaenoic acid (EPA) released in response to inammatory stimuli, and the production of subsequent derivatives depend mainly on the cell membrane FA content [8]. After the release of AA or EPA from the cell membrane by phospholipase A 2 (PLA 2), free AA and EPA become involved in the eicosanoid synthesis via the cyclooxygenase (COX) and lipoxygenase (LOX) pathways (Figure 1). AA is converted to leukotriene A4 (LTA4) by 5-lipoxygenase (5-LO) together with 5-LO activating protein (FLAP). LTA 4 hydrolase (LTA4H) furthermore hydrolyses LTA4 into LTB 4 which mediates its biological activities via a specic, high-afnity, G-protein-coupled receptor, B leukotriene receptor 1 (BLT1) [9]. Through this receptor LTB 4 primarily mediates the recruitment of mast cells, neutrophils, monocytes, macrophages and T cells. On the other hand, COX-2 catalyzes two sequential enzymatic reactions whereby AA is rst metabolized to PGG2 and PGH2 [10] of which the latter is subsequently converted to various bioactive PG by the respective terminal prostanoid synthases [11]. Microsomal prostaglandin E synthase 1 (mPGES-1) plays an important role in PGE2 production, the major prostaglandin present in skin [10, 12, 13]. PGE2 has four receptor subtypes: EP1, EP2, EP3 and EP4, which are not closely related [14, 15].
119 Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis

characterized by CD4+ lymphocytes and eosinophils and the release of Th2-type cytokines

The interaction of these various enzymes in the PGE2 and LTB 4 synthetic pathway is complex and tightly regulated. Further insight into the role of these enzymes in the inammatory reaction seen in canine AD would be helpful to discuss approaches for therapeutic manipulation of one or more of these inammatory enzymes as a strategy to inhibit PGE2 or LTB 4 production. Therefore, it is the aim of this study to investigate the prole of mRNA expression of key enzymes (cPLA 2, COX-2, 5-LO, FLAP, LTA 4H, mPGES-1) in the endogenous pathways of highly unsaturated fatty acids synthesis and the most important receptors (BLT1, EP2, EP3, EP4) for their metabolites as well as production of some predominant inammatory mediators (IL-1, IL-6) in the skin of healthy dogs and dogs suffering from AD.

Figure 1. Pathway for the conversion of arachidonic acid (AA) to eicosanoids

Chapter 6 120

Methods Dogs Two groups of dogs were used in this study. Group I consisted of 28 privately-owned dogs which fullled the diagnostic criteria for atopic dermatitis [16]. Group II included seven healthy control dogs. From all dogs 6 mm punch biopsies were obtained under general anesthesia. From the AD dogs lesional and non-lesional skin was collected. Healthy control and non-lesional skin specimens were all taken from the lateral thorax, whereas the lesional biopsies were obtained from affected predilection sites. After collection, the skin biopsies were immediately snap-frozen in liquid nitrogen and stored at -70 C until used for RNA isolation. All samples were obtained after written consent of the owner. The procedures were approved by the Utrecht University Animal Experiments Committee as required under
Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis 121

Dutch legislation.

RNA isolation and cDNA synthesis Total RNA was isolated using a combination of the TRIzol reagent (Invitrogen, Breda, the Netherlands) and the RNeasy Mini Kit (Qiagen, Leusden, the Netherlands) according to the manufacturers instructions. In short, the skin tissue was disrupted and homogenized in TRIzol reagent using a Biopulverizer (Biospec #59013, Biospec Inc., Bartlesville, OK, USA) and Ultra-turrax (T8, IKA Labortechnik GmBH, Staufen, Germany). The TRIzol manufacturers instructions were followed until the water-phase was obtained after the chloroform step. Subsequently, the procedure continued with RNeasy columns for clean-up of the RNA including the optional on-column DNase digestion (Qiagen Rnasefree DNase kit). RNA was dissolved in 30 l of RNase free water and was quantied spectrophotometrically using Nanodrop ND-1000 (Isogen Life Sciences, IJsselstein, the Netherlands). In total 1.5 g of RNA was reversed transcribed into a total volume of 60 l using oligo(dT) primers combined with random hexamer primers and a MMLV-derived reverse transcriptase according to the manufacturers instructions (iScript cDNA Synthesis Kit, Bio-Rad, Veenendaal, the Netherlands). After synthesis cDNA samples were diluted ve times. Samples were screened for contamination with genomic DNA by qPCR of nonreverse-transcribed RNA templates.

Primer design and testing Primer sets for enzymes involved in fatty acid synthesis (Table 1) were developed using known dog sequences available from Ensembl (www.ensembl.org) or NCBI (www.ncbi.nih. gov/genbank/index.html). Primer design was performed with Oligo Explorer 1.1.0 software (www.genelink.com/tools/gl-downloads.asp). To reduce chances of amplifying traces of genomic DNA, the primers were positioned in different exons. Uniqueness and specicity of each primer were veried using the Basic Local Alignment Search Tool (www.ncbi.nlm. nih.gov/blast) returning GenBank accession numbers. Final primers were selected based on the specicity and efciency by measuring a temperature gradient of a 16-fold dilution series of pooled cDNA by real-time quantitative PCR including melting curve analysis. In addition the amplied products were veried by sequencing using BigDye Terminator Cycle Sequencing Ready reaction (Applied Biosystems, Foster City, CA, USA), according to the standard protocol. The Tercycle product was puried and analyzed on an ABI3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Gene specic primers for the canine endogenous reference genes, -glucuronidase (BGLR/ GUSB), ribosomal protein S5 (RPS5) and ribosomal protein 19 (RPS 19) have been previously described [17] as are those for IL-1, IL-6 and COX-2 (Table 1).

Gene b-Glucuronidase (BGLR) Ribosomal protein S5 (RPS5) Ribosomal protein S19 (RPS19) cPLA2a COX-2 5-LO ALOX-5AP (FLAP) LTA4H BLT1 mPGES1 EP2 EP3 EP4 IL-1 IL-6

Accession number NM_001003191 XM_533568 XM_533657 XM_537170 NM_001003354 XM_534950 XM_534516 XM_539728 NM_008519 XM_537818 NM_001003170 NM_001002958 NM_001003054 NM_001003301 NM_001037971

Forward primer 5 3 AGACGCTTCCAA/GTACCCC TCACTGGTGAG/AACCCCCT CCTTCCTCAAAAA/GTCTGGG CCTCCGATTCAGTATGGCTCTG TTCCAGACGAGCAGGCTAAT TTGATAGCGAGAAGGGTGTGG TCATCACCCTCATCAGCGTG TGTACTCTCCTGGAATGCCCC TGGCTGTATTGCTCACTGCC GTGACCAGGATGTGGATCGC ACCACCTCATTCTCCTGGC TCCCTGGGTTTATCTGCTGC CCACGCCTACTTCTACAGCCAC TGCTGCCAAGACCTGAACCA

Reverse primer 5 3 AGGTGTGGTGTAGAGGAGCAC CCTGATTCACACGGCGTAG GTTCTCATCGTAGGGAGCAAG GATCACACCTGAGAATCCGACC GCAGCTCTGGGTCAAACTTC CAAACATGAGGTCTTCCTGCC CAAAGGCAAGTGTTCCCGTC AGATCCTTGAGGTCTGCTGCG TCTGGGACACAAAAGGGAGG AGCCCAGGAACAGGAAGGG AGATGGCAAAGACCCAAGG AAGGGAAGTATGGCACACGG CCAGTCGATGAAGCACCAGG TCCAAAGCTACAATGACTGACACG

Product Ta (C) length (bp) 103 141 95 199 112 192 111 139 186 78 171 167 157 115 123 62.0 62.5 61.0 63.0 60.0 63.0 58.0 62.0 65.0 66.0 62.0 63.0 65.0 68.0 65.0

GAGCCCACCAGGAACGAAAGAGA CCGGGGTAGGGAAAGCAGTAGC

122

Chapter 6

Table 1. Nucleotide sequences of canine specic primers for quantitative PCR analysis.

Quantitative PCR Real-time qPCR, based on the high afnity, double-stranded DNA-binding dye SYBR Green using a Bio-Rad My-IQ detection system (IQ SYBR Green Supermix and My-IQ, Bio-Rad, Veenendaal, the Netherlands) according to the manufacturers instructions, was performed in duplicate. Primers (Eurogentec, Maastricht, the Netherlands) had a nal concentration of 400 nM each and 1.0 l of cDNA template was used in a reaction volume of 25 l on 96-well iCycler iQ plates (Bio-Rad). All PCR reactions were performed using a two-step program, starting with a 2 or 5 min polymerase activation step at 95 C followed by 45 cycles of 20 s denaturation at 95 C and 30 s at Tm. The reaction was continued by 30 s at 60 C followed by a melting curve being the resultant of the stepwise increase in temperature of 1.5 C each 15 s, ranging from 60 C to 99C. A non-template control in duplicate was included on each plate. Standard curves constructed by plotting the relative starting amount versus threshold skin, non-lesional and lesional AD skin, Con-A-stimulated PBMC and liver. The amplication efciency, E = (10 (1/-slope) -1) x 100%, of all standard lines was > 95 % and < 105% and all melting curves described a single distinctive peak. For each experimental sample the amount of the gene of interest and of the endogenous reference genes GUSB, RPS19 and RPS5 were determined from the appropriate standard curve. The expression of the genes of interest was normalized to the average amount of the endogenous references. The normalized values were divided by the normalized values of the calibrator (control group) to generate relative expression levels. Data analysis was performed with My-IQ software (BioRAd, Veenendaal, the Netherlands).
Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis 123

cycles were generated using serial 4-fold dilutions of pooled cDNA fractions from control

Statistical analysis The relative expression levels of the genes of interest are reported as mean SEM. All statistical analyses were performed with SPSS 12.0.1 for Windows (SPSS Benelux BV, Gorinchem, the Netherlands). Normal distribution of all groups was conrmed by performing a Shapiro-Wilk test and homogeneity of variances across groups by use of the Levenes test. Group means of non-lesional and lesional atopic skin versus healthy control skin were compared by using the multivariate ANOVA (MANOVA) of the general linear model (GLM). Differences between the group means of non-lesional skin versus lesional skin were compared using repeated measures analysis of the GLM. Relationships between variables were evaluated by calculation of Pearsons correlation coefcient. The two-sided level of signicance was set at p 0.05.

Results To obtain a better insight into the expression of key enzymes involved in the two major enzymatic pathways, the COX- and LOX pathways, mRNA levels of the gene products of these enzymes were measured by qPCR. This was followed by the investigation of enzymes involved in the production of the inammatory eicosanoids, LTB 4 and PGE2 including the mRNA levels for their receptors together with the mRNA expression of two inammatory cytokines related to the production of these eicosanoids.

Gene expression measurements of enzymes, receptors and cytokines involved in the cyclooxygenase (COX) and lipoxygenase (LOX) pathway Relative mRNA expression levels of the various enzymes, receptors and cytokines showed considerable differences in healthy control, non-lesional and lesional atopic skin. 5-LO, FLAP, LTA4H and PTGER3 show the highest absolute expression in skin whereas the expression levels of COX-2 and the cytokines IL-1 and IL-6 are very low (Table 2). Before entering the COX- and LOX pathways, fatty acids need to be released from the membrane by phosholipases, such as cytosolic phospholipase A (cPLA 2). No signicant differences between the skin groups were found for this enzyme or COX-2. In contrast, the mRNA levels of 5-LO and FLAP were induced in non-lesional and lesional skin when compared to normal control skin (Figure 2). Although both AD skin groups showed elevated mRNA levels for FLAP, in lesional skin FLAP
Control cPLA2 5-LOX ALOX5-AP LTA4H BLT1 COX-2 PGES1 PTGER2 PTGER3 PTGER4 IL-1 IL_6
Chapter 6

Mean 3122 6721 7370 8389 2356 124 1538 871 11200 2986 239 77

SEM 678 459 1310 901 313 20 271 131 2652 314 23 12

is signicantly higher when compared to nonlesional skin (Figure 2). The nal enzyme in LTB 4 production, LTA4 hydrolase, showed a signicant higher mRNA level in atopic lesional skin versus control skin (Figure 2). The LTB 4 receptor BLT1 did not show differences between groups. An important nal enzyme for PGE2 synthesis, mPGES1, showed a two-fold respectively 2.5-fold increased expression in non-lesional AD and lesional AD skin versus healthy skin (Figure 2). The expression of PGES1 was signicantly higher in lesional AD skin when compared to non-lesional AD skin. With respect to the three receptors for PGE2 measured, a signicant induction of prostaglandin receptor 2 (EP2) was found in

Table 2. True mRNA values for the healthy control skin biopsies expressed as mean and SEM values.

124

lesional AD skin compared to healthy control skin (two-fold). In contrast, for EP3 a signicant increase was found in non-lesional AD skin versus normal control skin and lesional skin. EP4 did not show differences between groups. The mRNA expression of two inammatory cytokines related to the expression of PGE2 and LTB 4 revealed a signicant higher expression of IL-6 (10-fold) in lesional AD skin compared to healthy control skin, but no differences for IL-1 (Figure 2).

Figure 2. Relative mRNA levels of different enzymes, receptors and cytokines involved in the pathway of conversion of AA to eicosanoids in control skin, non-lesional skin (NL) and lesional skin (L). Control values have all been set to 1. Data represent mean SEM. a: represents p-value 0.05; b: represents p-value 0.01; c represents p-value 0.001

Correlations between mRNA expression levels of enzymes, receptors and cytokines involved in FA metabolism (Table 3 and Table 4) A strong correlation was found for the expression of 5-LO and FLAP in non-lesional and in lesional skin (Table 3). Both 5-LO and FLAP expression highly correlated to the expression of LTA4H in lesional skin (Table 3). Only in lesional skin the expression of 5-LO and LTA4H seemed to correlate to expression of the LTB 4 receptor, BLT1 (Table 3). In both non-lesional and lesional skin BLT1 expression has a strong relation with IL-1 whereas BLT1 correlation with IL-6 is restricted to non-lesional skin (Table 3). BLT1 expression was also found to relate to cPLA 2 expression in non-lesional skin. COX-2 is strongly correlated to IL-1 in both non-lesional and lesional skin (Table 4) and in non-lesional skin a relation between COX-2 and IL-6 is observed. COX-2 is furthermore associated with mPGES-1 in lesional skin and mPGES-1 is related to EP2 and IL-1 in nonlesional skin and to IL-6 in lesional skin (Table 4).

125

Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis

Table 3. Pearsons correlation coefcients between enzymes, receptors and cytokines of the LOXpathway in non-lesional skin (NLS) and lesional skin (LS) of AD dogs * = p 0.05; ** p 0.01; *** p 0.001; ns: non-signicant p-value.

Table 4. Pearsons correlation coefcients between enzymes, receptors and cytokines of the COXpathway in non-lesional skin (NLS) and lesional skin (LS) of AD dogs. * = p 0.05; ** p 0.01; *** p 0.001; ns: non-signicant p-value

126

Chapter 6

Discussion In the present study mRNA expression of the enzymes cPLA 2, COX-2, 5-LO, FLAP, LTA4H, mPGES-1 involved in fatty acid metabolism and the receptors EP2, -3 and -4 and BLT1 for the inammatory eicosanoids PGE2 and LTB 4 were assessed. Moreover, expression of the inammatory cytokines IL-1 and IL 6 which are under control of the aforementioned eicosanoids [18] were measured. High concentrations of LTB 4 and PGE2 are implicated in several chronic inammatory diseases such as rheumatoid arthritis, inammatory bowel disease, asthma and atopic dermatitis [18, 19]. It is known that PGE2 is produced in substantial amounts in the skin in response to antigens [20] and contributes to the inammatory response as seen e.g. in atopic dermatitis and contact hypersensitivity. However its role in the induction of the immune response is unclear [20]. of 5-LO, FLAP and mPGES-1 in both non-lesional and lesional skin when compared to healthy skin (Figure 2), an important initial step leading to AA metabolism and release of inammatory mediators. 5-LO is responsible for the rst two steps in leukotriene synthesis: the formation of 5-HPETE from AA followed by the conversion of 5-HPETE to LTA 4. FLAP is an essential co-molecule for 5-LO in the synthesis of leukotrienes [21]. Therefore, the signicantly increased coexpression of 5-LO and FLAP in lesional skin is as expected. Moreover, it is tempting to believe that Langerhans cells (LC) may be an important source of 5-LO in dogs with AD. Although the production of 5-LO is largely conned to leukocytes e.g. macrophages, mast cells, dendritic cells and B cells, but not T cells [22], in the skin of human and mice LC are an important producer of 5-LO [23-25]. In addition, epidermal inltrates of canine atopic skin mainly consist of antigen-presenting LC and T-lymphocytes whereas dermal inltrates mainly have antigen-presenting dendritic cells, mast cells and T-cells with lower numbers of eosinophils [26]. Also non-lesional skin, although clinically not different from control skin, does have a cellular inltrate that matches our nding of signicantly higher amounts of 5LO and FLAP mRNA [26]. The mutual activity of both 5-LO and FLAP is also reected in the signicant correlation which is found for both enzymes in both non-lesional and lesional skin (Table 3 and 4). A further enzyme in the pathway to LTB 4 production is LTA4 hydrolase. This enzyme, although also present in cells expressing 5-LO, is widely expressed by different tissues and cell types including epithelial cells like keratinocytes, broblasts and airway epithelial cells, but also by T cells, erythrocytes and platelets [19]. Lesional skin shows a signicant higher expression of LTA4H when compared to healthy control skin and also shows high correlation with both 5-LO and FLAP expression (Table 3). This may be based on high production of this enzyme by the same cells which produce 5-LO and FLAP, e.g. leukocytes, other than T cells [22], in lesional skin. The end product of LTA4H is the
127 Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis

The most noticeable ndings of our study were the signicantly increased expressions

inammatory eicosanoid LTB 4 which signals via two receptors: BLT1 and BLT2. Whereas BLT2 is expressed more ubiquitously, BLT1 expression is restricted to effector CD4+ and CD8+ T cells, neutrophils, eosinophils, basophils, monocytes and macrophages. Besides the classical role of LTB 4 in the recruitment and activation of neutrophils and eosinophils in asthma, more recent research indicates that LTB 4 is involved in the early recruitment of T cells to the airways immediately after the initiation of the allergic inammatory reaction [19]. In this respect LTB 4 might play a similar role in the skin of atopic dogs. Although the expected high correlation is found between expression of LTA4H and BLT1 in lesional skin (Table 3) no differences in BLT1 expression between control skin and non-lesional and lesional AD skin were found. This might be explained by the nding in mice that BLT1 activation is required specically for effector T cell trafcking to the place of inammation at early time points after allergen challenge [27] thus expression is expected to be high in the initiation of inammation. The lesional skin investigated in our study might very well reect a more chronic phase of inammation. Another interesting nding (Table 3) is that BLT1 expression is highly correlated to IL-1 and IL-6 cytokine production which is in agreement with the literature [18]. Based on the ndings of increased mRNA of 5-LO, FLAP and LTA4H we hypothesize that this might be reected in the production of LTB 4. Unfortunately we were not able to measure LTB 4 at the protein level in the skin. Two other studies did measure LTB 4 in canine AD skin investigating the effect of high n-3 and n-6 FA diets on LTB 4 production. One of these studies concluded that a diet with a low ratio of omega-6 to omega-3 resulted in decreased concentrations of LTB 4 and increased concentrations of LTB5, a less inammatory metabolite [28]. The other study reported no differences in concentrations of eicosanoids after n-3 supplementation [29]. Several studies, mainly from disruption of the mPGES-1 gene, indicate a role for mPGES1 in pathological conditions such as rheumatoid arthritis, osteoarthritis, pain, fever and tumorogenesis [30]. Therefore mPGES-1 might also play a role in other chronic inammatory diseases such as AD. Interestingly, in human psoriatic patients no difference was found for mPGES-1 mRNA expression in lesional skin when compared to non-lesional skin [31]. In contrast to the ndings in human psoriatic patients, we did nd a signicant higher expression of mPGES-1 in lesional canine AD skin when compared to non-lesional skin and both nonlesional and lesional skin show an important higher expression compared to healthy control skin. To the authors knowledge this has not been investigated yet in human suffering from AD. Although the mPGES-1 expression prole is very similar to that of 5-LO and FLAP, no correlation was found between 5-LO and FLAP when compared to mPGES-1, indicating
Chapter 6

that different cell types are the main producers of mPGES-1. Based on the ndings in mouse skin [32] presumably (canine) epidermal cells are the main producers of mPGES-1 and as lipid metabolism is higher in a defective epidermal barrier, this might be the reason for a higher mRNA expression of this enzyme in both non-lesional and lesional skin.

128

mPGES-1 showed a signicant correlation in expression with COX-2 in lesional AD skin (Table 4) although we did not nd signicant increased COX-2 expression in canine AD skin when compared to healthy control skin. As COX-2 mRNA and protein have short halflifes resulting in their presence for only a few hours after their synthesis [33], this might in part explain the mRNA proles found for this enzyme. Both mPGES-1 and COX-2 show correlation with IL-1 mRNA expression in non-lesional skin (Table 4) which is in agreement with the literature [34]. PGE2 induces diverse effects on various tissues and signals by binding to one of four prostanoid (EP) receptors, EP1, EP2, EP3 and EP4 [14, 35]. The EP3 receptor was shown to exhibit the highest afnity for PGE2 of all receptor subtypes [36], whereas the EP2 receptor was found to play an important role in inducing cell proliferation in mouse skin [37, 38]. LC derived of murine skin were demonstrated to express all EP receptors, but EP4 in of skin immune responses by promoting the migration and maturation of LC [39]. To the authors knowledge the presence of these receptors have not yet been demonstrated in canine skin. We demonstrate mRNA presence of EP2, EP3 and EP4 in all skin types measured: healthy control skin, non-lesional and lesional skin of atopic dogs (Fig 2). For technical reasons we were not able to measure EP1 mRNA. It is evident from the true mRNA expression values (Table 2) that EP3 is expressed at highest amounts in canine skin when compared to EP2 and EP4. The high expression of EP3 might relate to its high afnity for PGE 2 and the expected higher expression of PGE2 in atopic skin, but this cannot explain why only a signicant increase in EP3 mRNA is found in non-lesional skin. Possibly this is due to the fact that non-lesional skin already is in a primed state [40]. EP2 mRNA in contrast, is increased in lesional AD skin when compared to healthy control and non-lesional AD skin, which might be related to a high PGE 2 level in the more chronic phase of inammation. Interestingly, EP2 shows a signicant correlation with mPGES-1 expression in non-lesional skin (Table 4), but not in lesional skin where expression of this receptor is highest. Also EP2 is the only receptor showing signicant correlation to IL-6 expression in non-lesional and lesional skin (Table 4). Based on these results the role of both the EP2- and EP3-mediated signaling pathway in AD might be interesting for future research. In conclusion, we have shown that the mRNA expression of some central enzymes in the COX- and LOX pathways are increased. However we are aware of the fact that future studies are needed to evaluate the biological signicance of our ndings. Like in human AD the signicant higher expression levels of 5-LO and FLAP mRNA in canine AD likely result in increased production of leukotrienes from AA with inammatory properties. In this respect diets high in omega-3 fatty acids might indeed have a therapeutic value by replacing AA in
129 Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis

highest amounts [39]. It was further shown that PGE2-EP4 signaling facilitates the initiation

the cell membranes with EPA which metabolism will result in reduced inammatory 5-series leukotrienes and 3-series prostaglandins. Besides omega-3 FA several anti-leukotriene drugs have been investigated in human AD and asthma including the 5-LO inhibitor Zileuton, registered for use in asthma. One study in atopic dogs reported the use of Zileuton: although the 5-LO inhibitor signicantly decreased erythema no effect was observed on pruritus [41]. The FLAP inhibitors under investigation show promising results as they appear to be less hepatotoxic than 5-LO inhibitors [42]. The effects of individual leukotrienes can be blocked by leukotriene receptor antagonists. However, the trials in dogs evaluating the effect of leukotriene inhibitors did not report signicant clinical effects [43-46]. Two studies show medium efcacy of the prostaglandin E1 analogue misoprostol [47, 48]. Our results of increased mPGES-1 expression in atopic skin indicate that mPGES-1 might as well serve as a target for the treatment of canine AD which is in agreement with recent human literature [11]. Acknowledgments We wish to thank Roderick van Eijl for his technical assistance provided and we thank Noortje Jansen for her assistance with the statistical analysis.

130

Chapter 6

References
1. Grifn CE and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis. Vet Immunol Immunopathol 2001: 81(3-4): p. 255-69. Sinke JD, Rutten VP, and Willemse T. Immune dysregulation in atopic dermatitis. Vet Immunol Immunopathol 2002: 87(3-4): p. 351-6. Fujiwara S, Yasunaga S, Iwabuchi S, Masuda K, Ohno K, and Tsujimoto H. Cytokine proles of peripheral blood mononuclear cells from dogs experimentally sensitized to Japanese cedar pollen. Vet Immunol Immunopathol 2003: 93(1-2): p. 9-20. Hill PB and Olivry T. The ACVD task force on canine atopic dermatitis (V): biology and role of inammatory cells in cutaneous allergic reactions. Vet Immunol Immunopathol 2001: 81(3-4): p. 187-98. Nuttall TJ, Knight PA, McAleese SM, Lamb JR, and Hill PB. T-helper 1, T-helper 2 and immunosuppressive cytokines in canine atopic dermatitis. Vet Immunol Immunopathol 2002: 87(3-4): p. 379-84. Marsella R, Olivry T, and Maeda S. Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet Dermatol 2006: 17(2): p. 111-20. Schlotter YM, Sinke JD, van der Kaay S, Pinelli E, Hoek A, Willemse T et al. Expression of IL-4 messenger RNA in lesional skin of dogs suffering from atopic dermatitis. in Proceedings 5th Intern Vet Immunol Symp. 1998: eds. J Naessens, MS Oberoi, SK Jand, FOIL Printers. Das UN. Essential fatty acids: biochemistry, physiology and pathology. Biotechnol J 2006: 1(4): p. 420-39. Haeggstrom JZ, Tholander F, and Wetterholm A. Structure and catalytic mechanisms of leukotriene A4 hydrolase. Prostaglandins Other Lipid Mediat 2007: 83(3): p. 198-202. Murakami M and Kudo I. Recent advances in molecular biology and physiology of the prostaglandin E2biosynthetic pathway. Prog Lipid Res 2004: 43(1): p. 3-35. Kudo I and Murakami M. Prostaglandin e synthase, a terminal enzyme for prostaglandin E2 biosynthesis. J Biochem Mol Biol 2005: 38(6): p. 633-8. Conconi MT, Bruno P, Bonali A, De Angeli S, and Parnigotto PP. Relationship between the proliferation of keratinocytes cultured in vitro and prostaglandin E2. Ann Anat 1996: 178(3): p. 229-36. Park JY, Pillinger MH, and Abramson SB. Prostaglandin E2 synthesis and secretion: the role of PGE2 synthases. Clin Immunol 2006: 119(3): p. 229-40. Bos CL, Richel DJ, Ritsema T, Peppelenbosch MP, and Versteeg HH. Prostanoids and prostanoid receptors in signal transduction. Int J Biochem Cell Biol 2004: 36(7): p. 1187-205. Ishibashi R, Tanaka I, Kotani M, Muro S, Goto M, Sugawara A et al. Roles of prostaglandin E receptors in mesangial cells under high-glucose conditions. Kidney Int 1999: 56(2): p. 589-600. Willemse A. Atopic skin disease: a review and a reconsideration of diagnostic criteria. J Small Anim. Pract. 1986: (27): p. 771-778.

2.

3.

4.

6.

7.

8. 9.

10.

11.

12.

13.

14.

15.

16.

131

Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis

5.

17.

Brinkhof B, Spee B, Rothuizen J, and Penning LC. Development and evaluation of canine reference genes for accurate quantication of gene expression. Anal Biochem 2006: 356(1): p. 36-43. Calder PC. n-3 polyunsaturated fatty acids, inammation, and inammatory diseases. Am J Clin Nutr 2006: 83(6 Suppl): p. 1505S-1519S. Luster AD and Tager AM. T-cell trafcking in asthma: lipid mediators grease the way. Nat Rev Immunol 2004: 4(9): p. 711-24. Narumiya S. Prostanoids in immunity: roles revealed by mice decient in their receptors. Life Sci 2003: 74(2-3): p. 391-5. Peters-Golden M and Brock TG. 5-lipoxygenase and FLAP. Prostaglandins Leukot Essent Fatty Acids 2003: 69(2-3): p. 99-109. Peters-Golden M and Henderson WR, Jr. Leukotrienes. N Engl J Med 2007: 357(18): p. 1841-54. Steinhilber D. 5-Lipoxygenase: a target for antiinammatory drugs revisited. Curr Med Chem 1999: 6(1): p. 71-85. Doepping S, Funk CD, Habenicht AJ, and Spanbroek R. Selective 5-lipoxygenase expression in Langerhans cells and impaired dendritic cell migration in 5-LO-decient mice reveal leukotriene action in skin. J Invest Dermatol 2007: 127(7): p. 1692-700. Spanbroek R, Stark HJ, Janssen-Timmen U, Kraft S, Hildner M, Andl T et al. 5-Lipoxygenase expression in Langerhans cells of normal human epidermis. Proc Natl Acad Sci U S A 1998: 95(2): p. 663-8. Olivry T and Hill PB. The ACVD task force on canine atopic dermatitis (XVIII): histopathology of skin lesions. Vet Immunol Immunopathol 2001: 81(3-4): p. 305-9. Tager AM, Bromley SK, Medoff BD, Islam SA, Bercury SD, Friedrich EB et al. Leukotriene B4 receptor BLT1 mediates early effector T cell recruitment. Nat Immunol 2003: 4(10): p. 982-90. Vaughn DM. Evaluation of dietary n-6 to n-3 fatty acid ratios on leukotriene B synthesis in dog skin and neutrophils. Veterinary Dermatology 1994: 5: p. 163-173. Mueller RS, Fettman MJ, Richardson K, Hansen RA, Miller A, Magowitz J et al. Plasma and skin concentrations of polyunsaturated fatty acids before and after supplementation with n-3 fatty acids in dogs with atopic dermatitis. Am J Vet Res 2005: 66(5): p. 868-73. Samuelsson B, Morgenstern R, and Jakobsson PJ. Membrane prostaglandin E synthase-1: a novel therapeutic target. Pharmacol Rev 2007: 59(3): p. 207-24. Stark K, Torma H, and Oliw EH. Co-localization of COX-2, CYP4F8, and mPGES-1 in epidermis with prominent expression of CYP4F8 mRNA in psoriatic lesions. Prostaglandins Other Lipid Mediat 2006: 79(1-2): p. 114-25. Neumann M, Dulsner E, Furstenberger G, and Muller-Decker K. The expression pattern of prostaglandin E synthase and EP receptor isoforms in normal mouse skin and preinvasive skin neoplasms. Exp Dermatol 2007: 16(5): p. 445-53.

18.

19.

20.

21.

22. 23.

24.

25.

26.

27.

28.

29.

30.

31.
Chapter 6

32.

132

33.

Kang YJ, Mbonye UR, DeLong CJ, Wada M, and Smith WL. Regulation of intracellular cyclooxygenase levels by gene transcription and protein degradation. Prog Lipid Res 2007: 46(2): p. 108-25. Feng L, Xia Y, Garcia GE, Hwang D, and Wilson CB. Involvement of reactive oxygen intermediates in cyclooxygenase-2 expression induced by interleukin-1, tumor necrosis factor-alpha, and lipopolysaccharide. J Clin Invest 1995: 95(4): p. 1669-75. Tober KL, Thomas-Ahner JM, Maruyama T, and Oberyszyn TM. Possible cross-regulation of the E prostanoid receptors. Mol Carcinog 2007: 46(8): p. 711-5. Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C et al. The utilization of recombinant prostanoid receptors to determine the afnities and selectivities of prostaglandins and related analogs. Biochim Biophys Acta 2000: 1483(2): p. 285-93. Sung YM, He G, and Fischer SM. Lack of expression of the EP2 but not EP3 receptor for prostaglandin E2 results in suppression of skin tumor development. Cancer Res 2005: 65(20): p. 9304-11. Sung YM, He G, Hwang DH, and Fischer SM. Overexpression of the prostaglandin E2 receptor EP2 results in enhanced skin tumor development. Oncogene 2006: 25(40): p. 5507-16. Kabashima K, Sakata D, Nagamachi M, Miyachi Y, Inaba K, and Narumiya S. Prostaglandin E2-EP4 signaling initiates skin immune responses by promoting migration and maturation of Langerhans cells. Nat Med 2003: 9(6): p. 744-9. Leung DY, Boguniewicz M, Howell MD, Nomura I, and Hamid QA. New insights into atopic dermatitis. J Clin Invest 2004: 113(5): p. 651-7. Crow DW, Marsella R, and Nicklin CF. Double-blinded, placebo-controlled, cross-over pilot study on the efcacy of zileuton for canine atopic dermatitis. Vet Dermatol 2001: 12(4): p. 189-95. Evans JF, Ferguson AD, Mosley RT, and Hutchinson JH. Whats all the FLAP about? 5-lipoxygenaseactivating protein inhibitors for inammatory diseases. Trends Pharmacol Sci 2008. DeBoer DJ, Moriello KA, and Pollet RA. Inability of a short duration treatment with a lipoxygenase inhibitor to reduce clinical signs of canine atopy. Vet Dermatol 1994: 5: p. 13-16. Senter DA, Scott DW, and Miller WH, Jr. Treatment of canine atopic dermatitis with zarlukast, a leukotrienereceptor antagonist: a single-blinded, placebo-controlled study. Can Vet J 2002: 43(3): p. 203-6. Thomsen M, Kristensen F, and Elling F. Species specicity in the generation of eicosanoids. Emphasis on leukocyte-activating factors in the skin of allergic dogs and humans. 1993: 2: p. 63-78. Goodman L, Coles TB, and Budsberg S. Leukotriene inhibition in small animal medicine. J Vet Pharmacol Ther 2008: 31(5): p. 387-98. Olivry T, Dunston SM, Rivierre C, Jackson HA, Murphy KM, Peters E et al. A randomized controlled trial of misoprostol monotherapy for canine atopic dermatitis: effects on dermal cellularity and cutaneous tumour necrosis factor-alpha. Vet Dermatol 2003: 14(1): p. 37-46. Olivry T, Guagure E, and Hripret D. Treatment of canine atopic dermatitis with the prostaglandin E1 analog misoprostol: an open study. Journal of Dermatological Treatment 1997: 8: p. 243-7.
Expression of enzymes related to fatty acid metabolism in the skin of dogs with atopic dermatitis 133

34.

35.

36.

37.

38.

39.

40.

41.

42.

43. 44.

45.

46.

47.

48.

134

Chapter 6

CHAPTER 7

Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response
Yvette M. Schlottera, Victor P.M.G. Ruttenb, c, Frank M. Riemersa, Edward F. Knold, Ton Willemsea, b

Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, the Netherlands Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, the Netherlands; Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Republic of South Africa and University Medical Center Utrecht, Department of Dermatology/Allergology, Utrecht, the Netherlands

Submitted for publication

Abstract Background Canine atopic dermatitis (AD) is a chronic inammatory and pruritic skin disease which shares several characteristics with its human counterpart. In human AD acute lesions show a Th2-skewed milieu, whereas in chronic lesional skin a more Th1skewed environment is demonstrated. Objective In canine AD the gene expression of the Th1 cytokines IL-12p35, IL-12p40 and IFN- and their related transcription factors STAT4, SOCS5 and T-bet, the Th2 cytokines IL-4 and IL-13 and transcription factors STAT6, SOCS3 and GATA-3 and the regulatory cytokines IL-10 and TGF- and the transcription factor FOXP3 was evaluated. Methods In non-lesional (NLS) and lesional skin (LS) of atopic dogs and skin from healthy control dogs mRNA expression levels of cytokines and transcription factors were measured by quantitative real-time PCR. Results IL-12p40 mRNA was signicantly increased in NLS when compared to LS. STAT4 showed a signicant higher expression in LS compared to healthy skin and NLS. For both IL-13 and SOCS3 signicant higher levels were found in NLS and LS when compared to healthy skin and also in LS compared to NLS. GATA-3 was signicantly decreased in LS compared to NLS. IL-10 expression was increased in both NLS and LS compared to healthy skin and LS showed a signicantly increased level of this cytokine compared to NLS. Conclusion We have shown a mixed Th1 and Th2 inammatory pattern in spontaneous occurring lesions in canine atopic skin. Non-lesional atopic skin is primed for the atopic status. For canine AD this is the rst article to describe expression of transcription factors.

Chapter 7 136

Introduction Canine atopic dermatitis (AD) is a chronic inammatory and pruritic skin disease with an incidence of about 10 to 15 % of the canine population. It shares several characteristics with its human counterpart e.g. the genetic predisposition to develop the disease, the early age of onset, the predilection sites of the affected skin and similarities in immunopathogenic mechanisms [1, 2]. In canine and human AD it is currently accepted that imbalances in lymphocyte populations and the related cytokine production play an important role in the pathogenesis of the disease. Non-lesional skin, although clinically unaffected, is different from healthy skin and comprises increased amounts of CD4+ T cells [3, 4]. In human it has been shown, by use of the atopy patch test as a model for the induction of eczematic lesions, that a biphasic T cell response occurs during epicutaneous allergen challenge [5, 6]. In the initial phase the inltrate is characterized by Th2 cells, mainly producing IL-4, IL-5 and IL-13, and eosinophils whereas after 24 to 48 hours it is characterized by inltration with Th1 cells and macrophages and presence of Th1 selective cytokines like IFN- and IL-12 [7]. Similar events have been described for acute AD lesions versus chronic lesions, displaying a Th2 versus Th1-skewed milieu [3]. Besides the Th1 and Th2 helper T cells, regulatory T cells (Treg) are supposed to play a role in AD, producing cytokines with a regulatory function, such as IL-10 and TGF [8-10]. The action of these different cytokines in allergic inammation is tightly regulated by transcription factors such as suppressors of cytokine signalling (SOCSs) and signal transducer and activator of transcription (STATs) [11-14]. These groups of transcription factors are associated with specic subsets of cytokine-producing Th cells and cross-talk between different signalling pathways is mediated by these factors. Genes encoding for STAT4, SOCS5 and T-bet are associated with Th1 cells, STAT6, GATA-binding protein 3 (GATA-3) and SOCS-3 with Th2 cells and FOXP3 with regulatory T cells [14, 15]. SOCS5 protein is selectively expressed by Th1 cells. It can bind the IL-4R and suppress STAT6 phosphorylation [12]. STAT6 inhibits expression of IFN-, IL-12 and TNF- and collaborates with GATA-3, which promotes expression of Th2 cytokines and suppresses IL12 and STAT4 expression thereby inhibiting Th1 development [16, 17]. GATA-3, however, is inhibited by T-bet [14]. SOCS 3 is expressed in both Th1 and Th2 cells, but much higher in Th2 cells. SOCS3 expression has been shown to correlate to disease severity in atopic patients and to inhibit IL-12-mediated activation of the STAT4 pathway, thereby inducing Th2 differentiation [18, 19]. FOXP3 is a critical transcription factor for regulatory T cells and interest in this factor stems from the observation that Treg cells inhibit effector T cells, both Th1 and Th2 in disease [20, 21]. Reports regarding the expression of cutaneous transcription factors in canine atopic disease have not been published.
137 Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response

In this study real-time quantitative PCR was used to determine Th1, Th2 and regulatory cytokines and transcription factors in non-lesional and lesional atopic skin versus healthy control skin. We hypothesised that canine atopic non-lesional skin has already been primed to an atopic status and in this respect differs from healthy control skin. Furthermore lesional skin of dogs with chronic AD displays a Th1- polarized cytokine and transcription factor prole like is observed in chronic spontaneous AD lesions in human.

Chapter 7 138

Materials and Methods Dogs Two groups of dogs were used in this study. Group I consisted of privately-owned AD dogs (n=28) presented to the Department of Clinical Sciences of Companion Animals, Utrecht University. All dogs fullled the diagnostic criteria for atopic dermatitis. Group II included seven healthy control dogs. From all dogs 6 mm punch biopsies were obtained under general anesthesia. From the AD dogs lesional and non-lesional skin was collected. Healthy control and non-lesional skin specimens were all taken from the lateral thorax, whereas the lesional biopsies were obtained from affected predilection sites. After collection, the skin biopsies were immediately snap-frozen in liquid nitrogen and stored at -70 C until used for RNA isolation. The procedures were approved by the Utrecht University Animals Ethical Committee, as required under Dutch legislation.

RNA isolation and cDNA synthesis Total RNA was isolated using a combination of the TRizol reagent (Invitrogen, Breda, the Netherlands) and the RNeasy Mini Kit (Qiagen, Leusden, the Netherlands) according to the manufacturers instructions. In short, the skin tissue was disrupted and homogenized in Trizol reagent using a Biopulverizer (Biospec #59013, Biospec Inc., Bartlesville, OK, USA) and Ultra-turrax (T8, IKA Labortechnik GmBH, Staufen, Germany RNeasy columns were used for clean-up of the RNA including DNase digestion (Qiagen Rnase-free DNase kit). RNA was quantied spectrophotometrically using Nanodrop ND-1000 (Isogen Life Sciences, IJsselstein, the Netherlands). cDNA synthesis was performed as described before [22, 23]. Samples were screened for contamination with genomic DNA by qPCR of non-reversetranscribed RNA templates.
Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response 139

Primer design and testing Primer sets for cytokines and transcription factors (Table 1) were developed using known dog sequences available from Ensembl (www.ensembl.org) or NCBI (www.ncbi.nih.gov/ genbank/index.html). Primer design was performed with Oligo Explorer 1.1.0 software (www.genelink.com/tools/gl-downloads.asp) and was performed as described previously [22] To reduce chances of amplifying traces of genomic DNA, the primers were positioned in different exons. All PCR products had sizes between 100-150 bp. Gene specic primers for the canine endogenous reference genes, -glucuronidase (BGLR/ GUSB), ribosomal protein S5 (RPS5) and ribosomal protein 19 (RPS 19) have been previously described (Table 1)[22].

Gene -Glucuronidase (BGLR) Ribosomal protein S5 (RPS5) Ribosomal protein S19 (RPS19) IL-12p35 IL-12p40 IFN- IL-4 IL-13 IL-10 TGF- GATA-3 STAT-4 STAT-6 SOCS-3 SOCS-5 Foxp3 T-bet

Forward primer 5 3 AGACGCTTCCAA/GTACCCC TCACTGGTGAG/AACCCCCT CCTTCCTCAAAAA/GTCTGGG TAATGGATCCCAAGAGGCAG GGACGTTTCACATGCTGGT AGCGCAAGGCGATAAATG CCAAAGAACACAAGCGATAAGGAA GAGGAGCTGGTCAACATCA CCCGGGCTGAGAACCACGAC CAAGGATCTGGGCTGGAAGTGGA TACGTCCCCGAATACAGCTC ACTGGAAGAGGCGACAACAG AACTGCAGCGGCTCTATGTC ACACCAGCCTGCGCCTCAAGACCT TCTGCCGTGCAGTAATCTGT CAAATGGTGTCTGCAAGTGG AATCAGCACCAGACGGAGAT

Reverse primer 5 3 AGGTGTGGTGTAGAGGAGCAC CCTGATTCACACGGCGTAG GTTCTCATCGTAGGGAGCAAG TCAAGGGAGGATTTCTGTGG CCACTCTGACCCTCTCTGCT GCGGCCTGGAAACAGATT GTTTGCCATGCTGCTGAGGTT TGCAGTCGGAGACATTGA AAATGCGCTCTTCACCTGCTCCAC CCAGGACCTTGCTGTACTGCGTGT ACTCCCTGCCTTCTGTGCT GCCTTCTGAGTTGGAACAGG CATGTTGCAGCAGAAGGTGT CGCCTCGCCGCCCGTCA GCCTTGACTGGTTCTCGTTC GTGCTCTGCCCTTCTCATCT GTCCACGAACATCCGGTAAT

Ta (C) 62.0 62.5 61.0 62.5 59.0 55.8 61.0 59.0 63.0 65.0 64.0 59.0 64.0 63.0 65.0 59.0 61.2

Table 1. Nucleotide sequences of canine specic primers for quantitative PCR analysis.

Quantitative PCR Real-time qPCR, based on the high afnity, double-stranded DNA-binding dye SYBR Green using a Bio-Rad My-IQ detection system (IQ SYBR Green Supermix and My-IQ, Bio-Rad, Veenendaal, the Netherlands) according to the manufacturers instructions, was performed in duplo. Primers (Eurogentec, Maastricht, the Netherlands) had a nal concentration of 400 nM each and 1.0 l of cDNA template was used in a reaction volume of 25 l on 96well iCycler iQ plates (Bio-Rad). Q-PCR reactions were performed as described before [22]. Standard curves constructed by plotting the relative starting amount versus threshold cycles were generated using serial 4-fold dilutions of pooled cDNA fractions from control skin, non-lesional and lesional AD skin, Con-A stimulated PBMC and liver. The amplication efciency, E = (10 (1/-slope) -1) x 100%, of all standard lines was > 95 % and < 105% and
Chapter 7

all melting curves described a single distinctive peak. For each experimental sample the amount of the gene of interest and of the endogenous reference genes GUSB, RPS19 and RPS5 were determined from the appropriate standard curve [23]. The expression of the genes of interest was normalized to the mean expression of the endogenous references. The

140

normalized values were divided by the normalized values of the calibrator (control group) to generate relative expression levels. Data analysis was performed with My-IQ software (BioRAd, Veenendaal, The Netherlands).

Statistical analysis The relative expression levels of the genes of interest are reported as mean SEM. All statistical analyses were performed with SPSS 12.0.1 for Windows (SPSS Benelux BV, Gorinchem, the Netherlands). The two-sided level of signicance was set at p 0.05. Group means of non-lesional and lesional atopic skin versus healthy control skin were compared by using the multivariate ANOVA (MANOVA) of the general linear model (GLM). Differences between the group means of non-lesional skin versus lesional skin were compared using repeated measures analysis of the GLM. Relationships between variables were evaluated by calculation of Pearsons correlation coefcient.

Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response 141

Results Th1 related cytokine and transcription factor expression levels STAT4 in lesional skin shows a signicant higher expression when compared to control skin (p < 0.01) as well as to non-lesional skin (p < 0.001). A signicant decrease was noted in the expression of IL12p40 (p = 0.001) in lesional skin when compared to non-lesional skin. SOCS5 shows an increase in lesional skin when compared to non-lesional skin (p < 0.05). IFN- is signicantly elevated in lesional skin compared to non-lesional skin (p 0.05) and for T-bet a trend for higher expression levels was observed in lesional skin compared to NLS and control skin (Figure 1).

Figure 1. Relative mRNA levels of Th1 cytokines and transcription factors in control skin, non-lesional AD skin (NLS) and lesional AD skin (LS). Data represent mean SEM; a: p 0.05; b: p 0.01; c: p 0.001

Th2 related cytokine and transcription factor expression levels SOCS3 and IL-13 both showed a signicant increase in non-lesional skin (p < 0.001 respectively p < 0.05) and lesional skin (p < 0.001 respectively p = 0.001) when compared to control skin and also in lesional skin when compared to non-lesional skin (p < 0.001 respectively p < 0.01). A signicant decrease was found for the expression of GATA-3 in lesional skin compared to non-lesional skin (p < 0.05), whereas only a trend to decrease was
Chapter 7

observed for GATA-3 in lesional skin compared to control skin (p = 0.07). IL-4 and STAT-6 expression did not show signicant differences between the skin groups (Figure 2).

142

Figure 2. Relative mRNA levels of Th2 cytokines and transcription factors in control skin, non-lesional AD skin (NLS) and lesional AD skin (LS). Data represent mean SEM; a: p 0.05; b: p 0.01; c: p 0.001

T regulatory cell related cytokine and transcription factor expression levels Of the regulatory cytokines only for IL-10 a signicantly increased expression level (p 0.001) was noted in non-lesional (p < 0.05) and lesional skin (p <0.001) when compared to control skin and in lesional skin when compared to non-lesional skin (p 0.01). Foxp3 showed a trend to increased expression in lesional skin compared to non-lesional skin (p = 0.08). No differences in expression of TGF- were found (Figure 3).
Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response 143

Figure 3. Relative mRNA levels of T regulatory cytokines and transcription factors in control skin, nonlesional AD skin (NLS) and lesional AD skin (LS). Data represent mean SEM; a: p 0.05; b: p 0.01; c: p 0.001

Correlation Signicant interactions between the expression levels of the genes analyzed in each of the tissue groups are mentioned in Table 2 and 3. Control skin did not show any signicant correlations. In the Th1 group both non-lesional and lesional skin show a signicant positive correlation for IL12-p35 and T-bet (p < 0.05) and for STAT4 and T-bet (p < 0.01). In lesional skin also a positive relation was observed for IL12-p35 and STAT4 (p < 0.05). For SOCS5 a positive relation with STAT4 was found in both skin types and in non-lesional skin SOCS5 shows another positive relation with T-bet (p < 0.05). High correlations are noticed for STAT4 and T-bet with IFN- in both non-lesional and lesional skin (p < 0.01). Within the Th2 group both non-lesional skin and lesional skin show a high positive relation between GATA-3 and STAT-6 (p 0.01). However, a negative relation was found for IL-13 and GATA-3 (p 0.01). In lesional skin further signicant positive correlations are observed for both STAT-6 and GATA-3 with IL-4 (p < 0.05). IL-13 shows a strong negative relation with GATA-3 in non-lesional skin (p 0.01), whereas a positive relation between this cytokine and SOCS-3 is found in lesional skin (p < 0.05).
STAT4 SOCS5 STAT4 IL12p35 IFN- NLS LS NLS LS NLS LS NLS LS 0,420* 0,456* NS 0,469* 0,642** 0,552** Tbet 0,437* NS 0,709** 0,621** 0,440* 0,391* 0,715** 0,647**

Table 2. Signicant correlation coefcients of Th1 related cytokines and transcription factors in non-lesional (NL) and lesional (LS) skin of AD dogs. * = p 0,05; ** p 0,01; NS: non-signicant p-value

GATA3 STAT6 IL-13 GATA-3 NLS LS NLS LS NLS LS 0,523** 0,507** -0,503** NS -

IL4 NS 0,403* NS NS NS 0,455*

SOCS3 NS NS NS 0,457* NS NS

Table 3. Signicant correlation coefcients of Th2 related cytokines and

Chapter 7

transcription factors in non-lesional (NLS) and lesional (LS) skin of AD dogs. * = p 0,05; ** p 0,01; NS: non-signicant p-value

144

Discussion Canine AD, like human AD, is supposed to be characterized by a dysregulation of the immune response comprising both Th2 and Th1 responses. Next to Th1 and Th2 subsets also the regulatory T cells are gaining interest in canine studies. In our study, cytokines and transcription factors were subdivided into a Th1 group (IL-12p35, IL-12p40, IFN-, STAT4, SOCS5 and T-bet), a Th2 group (IL-4, IL-13, STAT6, SOCS3 and GATA-3) and a T regulatory group (TGF-, IL-10 and FOXP3) (Figures 1-3). Within the Th1 group no signicant differences were found when non-lesional atopic skin was compared to healthy control skin. IL-12p40 expression was signicantly decreased in lesional skin when compared to non-lesional skin, whereas IL-12p35 did not show differences between the skin groups (Figure 1). In an earlier study the IL-12p35 subunit was not detected in healthy control skin, whereas the IL-12p40 subunit was detected more in healthy control skin than in lesional atopic skin [24]. These differences might result from different techniques and the lower number of dogs used in that study. Another study using semi-quantitative RT-PCR, but a comparable amount of atopic dogs, did not nd signicant differences in IL-12 expression (both p35 and p40) between healthy control, non-lesional and lesional skin samples [25]. In human AD it is hypothesized that IL-12 is responsible for the switch of the response of the lymphocytes from the acute phase to chronic phase [3]. Taken this into account we did not anticipate to nd lower mRNA expression of p40 in canine lesional skin. An explanation might be that IL-12 production by macrophages, eosinophils and inammatory dendritic epidermal cells (IDECs), has already occurred and the resulting Th1-type cytokine milieu has been established in lesional skin. This is in agreement with results obtained in a canine AD model which showed a signicant increase in IL12-p35 mRNA only 24 h after epicutaneous allergen challenge after which timepoint the mRNA decreased to nonsignicant levels [26]. Our nding of signicant increased IL-10 and IL-13 mRNA in lesional skin (Figure 2 and 3), cytokines known to inhibit IL-12 production [27] support the low IL-12 levels found. Related to these lower levels of IL-12 in lesional skin, also lower levels of IFN are expected. However, a signicant higher expression in lesional skin is found (Figure 1) which is in agreement with the nding of Nuttall et al.[25] . Also T-bet, the Th1-lineagedecisive factor, showing a trend to higher expression in lesional skin (Figure 1), has been observed to induce IFN- production although this effect is questioned by other studies [28]. Activation of STAT4, like T-bet involved in controlling Th1 gene expression, largely depends on IL-12 to induce production of IFN- [27]. Our study shows signicant increased STAT4 mRNA expression in lesional skin compared to non-lesional and healthy control skin which is in agreement with both the signicant higher expression of IFN- observed in nonlesional and lesional skin and the increased level of SOCS5 in lesional skin [19] (Figure 1).
145 Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response

The signicant correlations between the Th1 factors point out their important relationship (Table 2). An important inhibitor of IL-12 mediated STAT4 activation is SOCS3 [18] which, in agreement with human AD and asthma patients, was indeed found to be signicantly increased [18] (Figure 2). STAT6, also a potent inhibitor of IL-12 expression [14], does not show any differences in expression between the various skin groups (Figure 2). GATA-3, highly expressed in Th2 cells [17] can be upregulated by IL-4 through STAT6 [16]. Our study shows no increased expression of both these factors which may in part explain the ndings for GATA-3 (Figure 2). This is supported by the signicant correlation found between these factors, especially in lesional skin (Table 3) .SOCS-5 association with the IL-4R chain results in a decreased STAT-6 activation, a mechanism to downregulate IL-4 signalling in Th1 cells [29] which ts with our ndings (Figure 1 and 2). Also the trend for higher expression of T-bet in lesional skin (Figure 1), a potent inhibitor of GATA-3 expression [14], might in part account for the GATA-3 inhibition in lesional skin in our study [30]. The signicant negative correlation found for GATA-3, an important factor in IL-13 activation [31], and IL-13 in non-lesional skin might indicate that IL-13 is produced by different cells or in higher amounts [32, 33] (Table 3). The signicant higher expression of IL-13 in our study coincides with results in a canine AD model [26] and with many human studies in AD (Figure 2). These human studies have emphasized the importance of IL-13 in allergic asthma and atopic dermatitis in the recruitment of inammatory cells to the sites of inammation in AD [34, 35], in the activation and changes of the keratinocyte differentiation status [36] and induction of brosis [37] by modulating the expression of cytokines, chemokines and MMPs [35]. A recent study using a transgenic mouse model showed the direct tissue effects of IL-13 as expression of IL-13 leads to a skin phenotype which reects human AD in several aspects [38]. IL-13, like IL-4, is produced by Th2 cells, mast cells, eosinophils and basophils [39]. Although the differences in the contribution of IL-4 and IL-13 in allergic inammation are difcult to elucidate as they signal through the shared IL4R chain, it is evident that in vivo IL-13 occasionally dominates the response where also IL-4 could use the receptor-complex [40]. One explanation is that IL-13 is produced in greater quantities, by more cell types and for a longer period than IL-4 [40]. Another model postulates that the binding efciency of the IL-13: IL13R1 complex to IL4R is much higher compared to the binding of the IL-4: IL-4R1 complex to IL-13R1. Our study shows a signicant increase in IL-10 expression in atopic skin compared to healthy control skin (Figure 3). Lesional AD skin even contains signicant higher amounts of IL-10 mRNA compared to non-lesional skin (Figure 3). These results are in contrast to
Chapter 7

other studies in dogs with naturally occurring AD and in a dog model of AD in which no signicant differences were observed [25, 26]. A study in high-IgE-Beagles experimentally sensitized to house dust mites, even showed a decrease in IL-10 mRNA expression in whole blood following environmental allergen challenge [41]. No differences were observed

146

for the expression of TGF- between the different skin types (Figure 3) whereas other studies showed a decrease of TGF- in lesional AD skin and both PBMC of IgE sensitized dogs and PBMC from dogs experimentally sensitized to Japanese cedar pollen [25, 41, 42]. These studies supposed a role for IL-10 and TGF- as important mediators preventing allergic inammation and suggested that AD lesions might be associated with suppression of regulatory cytokines. Indeed studies into human AD suppose a role for T regulatory cells producing IL-10 and also increased production of TGF- has been shown to contribute to regulatory T cell function [8, 43]. In human it is evident that IL-10 can be produced from many different cell types such as dendritic cells, macrophages and several regulatory T cell populations [44]. In our specic case of atopic skin these different IL-10 producing populations make out (an important) part of the inammatory population and might all be responsible for making IL-10. Moreover IL-10 production by one of these cell populations inuences other IL-10 producing cells thereby regulating each other [44]. For Foxp3, expressed by CD4+CD25+ T regulatory cells, we did not nd differences between the skin groups (Figure 3) which coincides with ndings in human AD skin lesions that lack functional regulatory T cells [45, 46]. In conclusion, our results show a mixed Th1 and Th2 inammatory response in lesional skin of dogs suffering from spontaneously occurring AD. Like in human AD the regulatory T cell compartment needs further elucidation but the high mRNA levels found for IL-10 might indicate that the inammatory effects of the mixed Th1/Th2 inltrate is counteracted by IL-10 irrespective of the source of this cytokine. Interestingly, our nding of a mixed population of Th1 and Th2 is largely in agreement with results from studies in human AD. Although future studies are needed to evaluate the biological signicance of these ndings, canine AD might function as a naturally occurring model of human AD. A better understanding of the tightly regulated pathways in which both cytokines and transcription factors play important roles, could nally lead to strategies to suppress the inammatory reaction in both human and canine AD.
Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response 147

Acknowledgments We wish to thank Roderick van Eijl for his technical assistance provided.

References
1. Grifn CE and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis. Vet Immunol Immunopathol, 2001. 81(3-4): p. 255-69. Sinke JD, Rutten VP, and Willemse T. Immune dysregulation in atopic dermatitis. Vet Immunol Immunopathol, 2002. 87(3-4): p. 351-6. Leung DY, Boguniewicz M, Howell MD, Nomura I, and Hamid QA. New insights into atopic dermatitis. J Clin Invest, 2004. 113(5): p. 651-7. Sinke JD, Thepen T, Bihari IC, Rutten VP, and Willemse T. Immunophenotyping of skin-inltrating T-cell subsets in dogs with atopic dermatitis. Vet Immunol Immunopathol, 1997. 57(1-2): p. 13-23. Langeveld-Wildschut EG, Thepen T, Bihari IC, van Reijsen FC, de Vries IJ, Bruijnzeel PL et al. Evaluation of the atopy patch test and the cutaneous late-phase reaction as relevant models for the study of allergic inammation in patients with atopic eczema. J Allergy Clin Immunol, 1996. 98(6 Pt 1): p. 1019-27. Grewe M, Walther S, Gyufko K, Czech W, Schopf E, and Krutmann J. Analysis of the cytokine pattern expressed in situ in inhalant allergen patch test reactions of atopic dermatitis patients. J Invest Dermatol, 1995. 105(3): p. 407-10. Thepen T, Langeveld-Wildschut EG, Bihari IC, van Wichen DF, van Reijsen FC, Mudde GC et al. Biphasic response against aeroallergen in atopic dermatitis showing a switch from an initial TH2 response to a TH1 response in situ: an immunocytochemical study. J Allergy Clin Immunol, 1996. 97(3): p. 828-37. Larche M. Regulatory T cells in allergy and asthma. Chest, 2007. 132(3): p. 1007-14. Herrick CA and Bottomly K. To respond or not to respond: T cells in allergic asthma. Nat Rev Immunol, 2003. 3(5): p. 405-12. Wu K, Bi Y, Sun K, and Wang C. IL-10-producing type 1 regulatory T cells and allergy. Cell Mol Immunol, 2007. 4(4): p. 269-75. Chen W and Khurana Hershey GK. Signal transducer and activator of transcription signals in allergic disease. J Allergy Clin Immunol, 2007. 119(3): p. 529-41; quiz 542-3. Knisz J and Rothman PB. Suppressor of cytokine signaling in allergic inammation. J Allergy Clin Immunol, 2007. 119(3): p. 739-45. Elliott J and Johnston JA. SOCS: role in inammation, allergy and homeostasis. Trends Immunol, 2004. 25(8): p. 434-40. Prefontaine D, Fiset PO, and Hamid Q. Transcription factors in allergic diseases. J Allergy Clin Immunol, 2007. 119(3): p. 761-4. Arakawa S, Hatano Y, and Katagiri K. Differential expression of mRNA for Th1 and Th2 cytokineassociated transcription factors and suppressors of cytokine signalling in peripheral blood mononuclear cells of patients with atopic dermatitis. Clin Exp Immunol, 2004. 135(3): p. 505-10.

2.

3.

4.

5.

6.

7.

8. 9.

10.

11.

12.

13.

14.

Chapter 7

15.

148

16. 17.

Mowen KA and Glimcher LH. Signaling pathways in Th2 development. Immunol Rev, 2004. 202: p. 203-22. Ho IC, Tai TS, and Pai SY. GATA3 and the T-cell lineage: essential functions before and after T-helper-2cell differentiation. Nat Rev Immunol, 2009. 9(2): p. 125-35. Seki Y, Inoue H, Nagata N, Hayashi K, Fukuyama S, Matsumoto K et al. SOCS-3 regulates onset and maintenance of T(H)2-mediated allergic responses. Nat Med, 2003. 9(8): p. 1047-54. Yoshimura A, Naka T, and Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol, 2007. 7(6): p. 454-65. Huehn J, Polansky JK, and Hamann A. Epigenetic control of FOXP3 expression: the key to a stable regulatory T-cell lineage? Nat Rev Immunol, 2009. 9(2): p. 83-9. OGarra A and Vieira P. Twenty-rst century Foxp3. Nat Immunol, 2003. 4(4): p. 304-6. Brinkhof B, Spee B, Rothuizen J, and Penning LC. Development and evaluation of canine reference genes for accurate quantication of gene expression. Anal Biochem, 2006. 356(1): p. 36-43. Schlotter YM, Veenhof EZ, Brinkhof B, Rutten VP, Spee B, Willemse T et al. A GeNorm algorithm-based selection of reference genes for quantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopic dermatitis. Vet Immunol Immunopathol, 2009. 129(1-2): p. 115-8. Olivry T, Dean GA, Tompkins MB, Dow JL, and Moore PF. Toward a canine model of atopic dermatitis: amplication of cytokine-gene transcripts in the skin of atopic dogs. Exp Dermatol, 1999. 8(3): p. 204-11. Nuttall TJ, Knight PA, McAleese SM, Lamb JR, and Hill PB. Expression of Th1, Th2 and immunosuppressive cytokine gene transcripts in canine atopic dermatitis. Clin Exp Allergy, 2002. 32(5): p. 789-95. Marsella R, Olivry T, and Maeda S. Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet Dermatol, 2006. 17(2): p. 111-20. Watford WT, Hissong BD, Bream JH, Kanno Y, Muul L, and OShea JJ. Signaling by IL-12 and IL-23 and the immunoregulatory roles of STAT4. Immunol Rev, 2004. 202: p. 139-56. Usui T, Preiss JC, Kanno Y, Yao ZJ, Bream JH, OShea JJ et al. T-bet regulates Th1 responses through essential effects on GATA-3 function rather than on IFNG gene acetylation and transcription. J Exp Med, 2006. 203(3): p. 755-66. Seki Y, Hayashi K, Matsumoto A, Seki N, Tsukada J, Ransom J et al. Expression of the suppressor of cytokine signaling-5 (SOCS5) negatively regulates IL-4-dependent STAT6 activation and Th2 differentiation. Proc Natl Acad Sci U S A, 2002. 99(20): p. 13003-8. Szabo SJ, Kim ST, Costa GL, Zhang X, Fathman CG, and Glimcher LH. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell, 2000. 100(6): p. 655-69. Zhu J, Min B, Hu-Li J, Watson CJ, Grinberg A, Wang Q et al. Conditional deletion of Gata3 shows its essential function in T(H)1-T(H)2 responses. Nat Immunol, 2004. 5(11): p. 1157-65. Obara W, Kawa Y, Ra C, Nishioka K, Soma Y, and Mizoguchi M. T cells and mast cells as a major source of interleukin-13 in atopic dermatitis. Dermatology, 2002. 205(1): p. 11-7.
Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response 149

18.

19.

20.

21. 22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

Tazawa T, Sugiura H, Sugiura Y, and Uehara M. Relative importance of IL-4 and IL-13 in lesional skin of atopic dermatitis. Arch Dermatol Res, 2004. 295(11): p. 459-64. Purwar R, Werfel T, and Wittmann M. IL-13-stimulated human keratinocytes preferentially attract CD4+CCR4+ T cells: possible role in atopic dermatitis. J Invest Dermatol, 2006. 126(5): p. 1043-51. Purwar R, Kraus M, Werfel T, and Wittmann M. Modulation of keratinocyte-derived MMP-9 by IL-13: a possible role for the pathogenesis of epidermal inammation. J Invest Dermatol, 2008. 128(1): p. 59-66. Howell MD, Fairchild HR, Kim BE, Bin L, Boguniewicz M, Redzic JS et al. Th2 cytokines act on S100/A11 to downregulate keratinocyte differentiation. J Invest Dermatol, 2008. 128(9): p. 2248-58. Wills-Karp M. Interleukin-13 in asthma pathogenesis. Immunol Rev, 2004. 202: p. 175-90. Zheng T, Oh MH, Oh SY, Schroeder JT, Glick AB, and Zhu Z. Transgenic expression of interleukin-13 in the skin induces a pruritic dermatitis and skin remodeling. J Invest Dermatol, 2009. 129(3): p. 742-51. Gessner A, Mohrs K, and Mohrs M. Mast cells, basophils, and eosinophils acquire constitutive IL-4 and IL-13 transcripts during lineage differentiation that are sufcient for rapid cytokine production. J Immunol, 2005. 174(2): p. 1063-72. Wills-Karp M and Finkelman FD. Untangling the complex web of IL-4- and IL-13-mediated signaling pathways. Sci Signal, 2008. 1(51): p. pe55. Maeda S, Tsuchida H, and Marsella R. Allergen challenge decreases mRNA expression of regulatory cytokines in whole blood of high-IgE beagles. Vet Dermatol, 2007. 18(6): p. 422-6. Fujiwara S, Yasunaga S, Iwabuchi S, Masuda K, Ohno K, and Tsujimoto H. Cytokine proles of peripheral blood mononuclear cells from dogs experimentally sensitized to Japanese cedar pollen. Vet Immunol Immunopathol, 2003. 93(1-2): p. 9-20. Jutel M, Akdis M, Budak F, Aebischer-Casaulta C, Wrzyszcz M, Blaser K et al. IL-10 and TGF-beta cooperate in the regulatory T cell response to mucosal allergens in normal immunity and specic immunotherapy. Eur J Immunol, 2003. 33(5): p. 1205-14. Couper KN, Blount DG, and Riley EM. IL-10: the master regulator of immunity to infection. J Immunol, 2008. 180(9): p. 5771-7. Verhagen J, Akdis M, Traidl-Hoffmann C, Schmid-Grendelmeier P, Hijnen D, Knol EF et al. Absence of Tregulatory cell expression and function in atopic dermatitis skin. J Allergy Clin Immunol, 2006. 117(1): p. 176-83. Ou LS, Goleva E, Hall C, and Leung DY. T regulatory cells in atopic dermatitis and subversion of their activity by superantigens. J Allergy Clin Immunol, 2004. 113(4): p. 756-63.

34.

35.

36.

37. 38.

39.

40.

41.

42.

43.

44.

45.

46.

Chapter 7 150

Lesional skin in atopic dogs shows a mixed Th1 and Th2 inammatory response

151

Chapter 7

152

CHAPTER 8

General discussion

General discussion Atopic dermatitis in dogs is dened as: a genetically-predisposed inammatory and pruritic allergic skin disease with characteristic clinical features. It is associated most commonly with IgE antibodies to environmental allergens such as house dust mites and grass pollen [1]. Canine AD (cAD) demonstrates many similarities with humans with atopic dermatitis (Table 1).The mechanisms involved in the initiation and maintenance of skin inammation in human, despite intensive research, are still not understood. Although numerous reports have been published on different aspects of cAD studies into the pathogenesis of cAD are scarce and like in human studies they have mainly focused on the possible abnormalities of the immune system as the primary cause of disease. Apart from the genetic predisposition the (chronic) inammatory conditions observed in AD are most likely due to interactions with environmental factors such as contact of the immune system with pathogens, presence of allergens and food constituents like FA, fueling inammatory responses. Both immune response genes and genes involved in the constitution of the skin barrier may be altered as compared to healthy individuals. In human, it is generally accepted that both an epithelialbarrier dysfunction together with an immunologic disturbance leads to disease at a specic site, e.g. atopic dermatitis or asthma although it is not yet known which of these two systems initiate disease development. Studies into cAD also indicate the importance of the epidermal barrier function and the immune system in the pathogenesis of the disease.

Chapter 8

Table 1. Similarities between canine and human AD

154

To study the pathogenesis of cAD several options are available: (1) using non-lesional and lesional skin of dogs that spontaneously developed AD; (2) using spontaneous atopic dogs in which experimentally-induced skin lesions in non-lesional skin are used for research; (3) using a model of dogs that were experimentally made atopic. In human a useful tool (see (2) to study the kinetics of AD has been the development of the atopy patch test [2]. By applying the relevant aeroallergen onto non-lesional skin of AD patients, eczematous skin reactions can be induced [3]. At specic timepoints in the development of the lesions different parameters of importance in the AD pathogenesis can be investigated. It is a specic test as only AD patients respond and both macroscopically and microscopically the reaction shares characteristics with AD lesions. Such a tool is at present under investigation in cAD but is not yet useful for research. A model does exist (see 3) in which a group of high IgE Beagles are used which develop dermatitis after environmental allergen challenge with house dust mites (HDM) [4]. The cutaneous lesions also do show similarities with those of natural-occurring AD. However the Beagle is not a breed commonly seen developing spontaneous AD and unlike the human patch test model these dogs are made atopic, both these features might also inuence ndings with respect to the immunopathogenesis. For these reasons we chose to use dogs that spontaneously developed AD and which were referred to our clinic regarding their skin problems, despite we know that this would make it impossible to study lesions in a time-based manner.

The role of polyunsaturated fatty acids in atopic dermatitis AD, probably the most common cause of pruritus in dogs, is an incurable disease so far, mainly due to the limited knowledge regarding underlying defect(s). It is hard to manage as not one therapy exists that has shown to resolve all skin problems. Besides trying to untangle the immunopathogenesis both human and dog studies also focused on therapies that might have the potential to modulate predisposition to chronic inammatory conditions. In human AD research it is hypothesized that the excess intake of n-6 polyunsaturated fatty acids (PUFA) is causally linked to atopic disease. Indeed, dietary intake of PUFA by humans has changed considerably over the past decades in favor of the n-6 PUFA predominantly linoleic acid. Also standard canine diets contain higher amounts of n-6 PUFA as compared to n3 PUFA. These nutritional constituents have gained interest as modulators of inammation investigating chronic inammatory diseases. Studies mostly focused on the omega-3 fatty acids assumed to have immunomodulatory and especially anti-inammatory activities. In AD the increased production of inammatory eicosanoids (e.g. LTB 4 and PGE2) and of cytokines (e.g. IL-1, IL-6) are important factors in sensitization to allergens, in initiation of inammation and in sustaining the inammatory reaction [5, 6]. Under most present dietary conditions
155 General Discussion

and immune responses during the past decades in human but also in veterinary studies

arachidonic acid (AA), a product of the linoleic acid (LA) metabolism, is the main precursor of the eicosanoids. Long-chain n-3 PUFA might reduce the inammatory reaction by inhibiting AA incorporation into cell membranes and inhibiting AA metabolism into eicosanoids. The characteristics, sources of fatty acids in diets and relevant aspects of their metabolism are extensively described in chapter 2 and the roles of AA- and eicosapentaenoic acid (EPA)derived eicosanoids in inammation are addressed. Studies into the health effects of n-3 FA in human and dogs with AD are reviewed. Regarding the relationship between PUFA and AD two important questions were addressed: (a) is the supplementation with (n-3) FA effective in reducing inammation and (b) is there evidence for a relationship between atopic dermatitis and altered fatty acid metabolism and composition in atopic individuals. The latter might have consequences for immune regulation as well as skin barrier function. With regard to question (a), despite many studies in humans into the effects of these PUFA on inammation in several chronic diseases, the number of studies reporting health effects of dietary n-3 FA supplementation on AD is limited and these studies fail to show the inhibitory effect of n-3 PUFA on inammation (chapter 2). Regarding question (b) in humans two hypothesis have been proposed linking PUFA to atopic disease [7] (chapter 2); the rst suggesting that abnormalities in fatty acid metabolism are due to an impaired activity of -6desaturase resulting in lower amounts of both long chain n-6 and n-3 PUFA. Several studies indeed found lower amounts of long chain n-6 and n-3 metabolites, however results are inconsistent. The possible causal relation of a lower amount of n-6 FA and an atopic state is also in obvious contrast with the hypothesis that metabolites of n-6 FA are responsible for pro-inammatory metabolites (chapter 2). However, recently a new paradigm has been proposed that states that AA serves as a precursor for a group of potent anti-inammatory mediators as well [8]. The second hypothesis suggests an apparent link between higher LA intake and the epidemic rise in allergic diseases over the last decades. Irrespective of both hypotheses, a recent review [5] exploring the evidence for FA abnormalities in atopic disease concluded that indeed ndings are not consistent with a clear pattern of altered status of a particular FA or a particular FA family. They state that, if anything, there is evidence of lower levels of -linolenic acid (GLA), dihomo--linolenic acid (DGLA) and AA in atopic individuals [5]. These lower levels might represent a poor ability to convert LA to GLA, DGLA and AA or they may represent increased utilization of these FA in atopic disease. This was also conrmed in our dietary intervention study. In humans FA compositions have been investigated in whole blood, red blood cells, mononuclear
Chapter 8

cells, serum and plasma of atopic children (reviewed in [5]). Furthermore, PUFA have been determined in cord blood of neonates with a high risk of atopy as well as in breast milk of atopic mothers or breast milk received by children who became atopic [5]. Remarkably FA were not determined in non-lesional and lesional skin of human atopic individuals.

156

With respect to both questions (a) and (b) in dog studies, it can be concluded from chapter 2 that like in human studies inconsistent data are available about the effect of n-3 and n-6 FA supplementation on the clinical management of AD in dogs. In part this is caused by the study designs, e.g. many open designs, non-standardized diets, short study duration, and the high variability in study designs. However, some well-designed studies (double-blinded, randomized, controlled, standardized diets) showed that plasma FA mirrored the dietary FA composition [9-12]. Only two studies measured skin FA composition before and after the dietary trial [9, 10] and from these studies it can be concluded that skin FA composition is inuenced by the dietary FA content, but far less than it is in plasma. In the study of BadakkyTaugbol et al. [9] the experimental diet contained a higher percentage of total n-3 FA (15.1%) than total n-6 FA (10.7%) whereas the habitual diets of the dogs before they started the trial contained a total n-3 FA % of 3.6 % and a total n-6 FA % of 19.2 %. The plasma n-6: n-3 FA ratio in the experimental group at entry was 5.9. This large difference between the habitual diet and experimental diet n-6:n-3 FA ratio is well reected after the trial in plasma FA content, n-6:n-3 FA ratio being 1.4. However, in skin, the change in FA composition is far less: the post-trial cutaneous level of total n-6 FA and LA was slightly reduced compared with baseline and the switch was associated with a signicant, although small, increase in the cutaneous content of EPA and DHA. These results are in agreement with data from our dietary clinical trial (chapter 4). In our study the plasma FA ratio of total n-6:n-3 was around 11 for all dogs at entry and became 22.6 in diet group A (20:1) and 10.4 in diet group B (5:1). However, skin tissue did not reect this change in plasma FA ratio. Although the plasma FA ratio for n-6:n-3 doubles in diet group A, no signicant changes are observed for the n-6:n-3 ratio and individual FA in skin tissue whereas in diet group B, in which plasma n-6:n-3 ratio does not change over time, a signicant decrease is found in LA both in non-lesional and lesional skin. This indicates that not the dietary n-6:n-3 FA ratio is indicative of the change in FA composition, but rather the absolute amounts of the individual FA in the diet fed to the dogs. This is in agreement with a study in normal dogs which concluded that the n-3 fatty acid dose, independent of the n-6:n-3 FA ratio, affected the plasma FA prole [13]. Our study was the rst to measure the FA composition in both non-lesional and lesional skin (chapter 4 and 5). Two other studies only determined the FA composition of skin tissue taken from the dorsal area [9] and lateral portion of the thorax [10] normally referred to as nonlesional skin in atopic dogs. In our study non-lesional biopsies were taken from the lateral that lesional skin contains a signicant 4.7-fold higher amount of arachidonic acid (AA), as compared to non-lesional skin (chapter 4 and 5). To the authors knowledge this has not been observed before in human or veterinary studies. A higher AA content in lesional skin ts with the theory that metabolism of AA results primarily in inammatory metabolites which are likely to contribute to the inammatory reaction seen in lesional atopic skin.
157 General Discussion

thoracic site and the predilection sites showing a lesional aspect. A remarkable nding was

Arachidonic acid metabolism and distribution A more complex question, however, is how AA in lesional skin did reach this level. In chapter 5 some theories have been discussed. There are few (main) ways by which AA can be present in the skin: (I) it is being produced in the skin by metabolisation from LA (see Figure. 2; chapter 2) or (II) it comes to the skin as AA derived from dietary sources or (III) it must be transported to the skin from other endogenous sources such as the liver, which is capable of elongation and desaturation (chapter 5). With respect to (I) it has been generally accepted that human, rat and guinea pig epidermis lack activity of both -5 and -6 desaturase [14, 15] meaning that AA production from LA is not possible in epidermis of these species (chapter 5). In human, it is thus supposed that AA comes from sources as described under (I) and (II). In homology between the dog and these species, it is tempting to suggest that canine epidermis does not exhibit activity of both these desaturases, but we can neither exclude nor conrm this assumption since we measured mRNA in total skin including both epidermis and dermis (chapter 4, 5, 6 and 7). On the other hand, we did measure mRNA of both desaturases in non-lesional as well as lesional skin. When mRNA levels are associated with enzyme activities, as it has been proven for human -5 and 6 desaturase [16, 17], production of AA from LA is possible in lesional skin as well as nonlesional skin. However, future studies into the exact location of both these desaturases in skin (e.g. epidermis or dermis) are needed. Dietary sources being the main supply of AA to skin (option II) seems a good alternative. Several studies have shown that when dietary LA is increased, this is not reected in the AA amounts in tissue. This implicates that the endogenous metabolism from LA to AA (option III) can be neglected and dietary amounts of FA will predict the FA composition of the different tissues [8, 18, 19]. This is in agreement with the observation in our clinical trial (chapter 4) in which plasma FA of diet group A (high in LA) showed a signicant increase in plasma LA at T=1 but failed to show an increase in AA as well. This would be expected in case of endogenous metabolism of LA to AA. In PBMC the percentage of AA even decreased, which is also in agreement with human studies in which the effect of increased dietary LA amounts was investigated [19]. However, dietary FA alone, although they seem the best alternative for tissue FA composition, do neither explain the FA composition of tissues such as the skin. In the case of option (II) and (III), it would imply that specic FA, e.g. AA, are transported in higher amounts into lesional skin, whereas others are not. This does not seem very likely. Thus far, none of the proposed mechanisms: (I), (II), or (III) can completely explain our ndings (chapter, 4 and 5). A possible explanation is a combination of these mechanisms. Furthermore, since cells tend
Chapter 8

to maintain homeostasis dietary changes might result in altered lipid composition of different tissues only within certain limits.

158

Cell inltrates in relation to arachidonic acid (AA) An alternative explanation for the high AA content comes from perspectives of lesional skin itself, compared to non-lesional skin. The similarity between canine and human AD also involves epidermal and dermal cell inltrates in non-lesional and lesional skin (chapter 6). We have shown that as well in non-lesional and lesional skin signicant increased levels of 5-lipoxygenase and 5-lipoxygenase-activating protein (FLAP) mRNA is found compared to healthy control skin (chapter 6). We reasoned that these high levels could be explained by the cell inltrates found in non-lesional and lesional atopic skin (chapter 6) as it is known that the capacity to generate large amounts of leukotrienes from AA is largely conned to leukocytes [20]. Langerhans cells (LC) in the skin of atopic dogs might be an important source of 5-LO production since LC in skin of mice strongly express 5-LO [21-23]. This increased production of 5-LO might serve as the link with the high AA levels we found in lesional skin (chapter 3 and 5). The main FA in leukocyte membranes is AA and the high number of inammatory cells might explain the nding of signicant higher AA amount in lesional skin compared to NL skin. The output of 5-LO biosynthesis is regulated by the amount of free AA that phospholipase A 2 releases from cell-membrane phospholipids [24]. Lesional skin is injured skin; the epidermal barrier is defect and keratinocytes respond to skin irritation and injury by rapid activation of AA metabolism [25, 26]. However, the capacity of skin itself to biosynthesize the LTs has been questioned as several studies have shown that no 5-LO mRNA or protein is present in human keratinocytes [27-30] The epidermis can signicantly attribute to LT formation through another mechanism: transcellular leukotriene synthesis [31]. By this mechanism, LTA4 formed in one cell type is released and further metabolized in another cell type, a leukocyte containing 5-LO. These provide LTA 4 to the keratinocytes which lacks 5-LO but expresses LTA 4 hydrolase and can thereby metabolize the donated LTA4 to LTB 4 [24, 31].

Linking a defective barrier and immune response AA is the principal compound for the 2-series prostaglandins and the 4-series leukotrienes. As mentioned, a defective barrier leads to increased lipid metabolism e.g. also increased amounts of LTB 4 will be produced from AA. Leukotrienes act on target cells by interacting with their cognate receptors. B leukotriene receptor 1 (BLT1) is expressed primarily on specic cognate receptors leukotrienes can promote the movement and accumulation into tissues and function of virtually all subgroups of leukocytes [24, 32-34]. LTB 4 primarily mediates the recruitment of mast cells, monocytes/macrophages, neutrophils and T cells [33]. Leukotrienes also increase the expression of adhesion molecules and promote cell motility, which further increases transmigration into tissues [24]. Once these leukocytes
159 General Discussion

leukocytes and is a high-afnity receptor for LTB 4 (Chapter 6)[32]. By binding to their

reach the inamed tissues their survival and activation are again enhanced by leukotrienes. Also important is their role in amplifying inammatory responses by Th2 cells as it has been shown that leukotrienes and cytokines regulate each other e.g. IL-4 reduces 5-LO expression in monocytes and maturing DCs which is counteracted by TGF- [20, 35]. It may be obvious that the inammatory cell inltrates in AD play an important role in the pathogenesis of the disease. A major role is contributed to Th cells. We showed the existence of a mixed Th1 and Th2 inammatory response (chapter 7). Treg cells might contribute by producing signicant increased amounts of IL-10. However as IL-10 can be produced by different cell types [36], future research must conrm which cell types are main producers of IL-10 in chronically inamed cAD skin. In addition, the keratinocytes themselves are important participants in the cutaneous immune response. They produce large quantities of several cytokines (IL-1, TNF-) besides a large number of chemokines and other immunoregulatory cytokines in response to stimulation [37-40]. They thereby affect resident innate immune cells in the skin such as mast cells, DCs and macrophages resulting in the upregulation of expressing of other inducible mediators and recruitment of additional immune cells from the blood [40].

Chapter 8 160

Summarizing the following main conclusions can be drawn from the studies described in this thesis (Figure 1): Altering the dietary n-6:n-3 FA ratio by specic addition of linoleic acid (LA) does not result in a signicantly lower percentage improvement compared to that of a low n-6:n3 FA ratio. The plasma FA prole is a clear reection of the FA amounts present in the diet. In contrast skin FA prole far less reects the FA amounts of the diet. For that reason dietary FA might have less inuence on skin inammation than is hypothesized. The amount of AA is signicantly increased in lesional AD skin compared to nonlesional AD skin. This is likely related to the inammatory reaction present in lesional skin. Future research is needed to explain these increased amounts of AA at the lesional predilection sites. -5 desaturase is responsible for the production of AA out of DGLA. The expression of -5 desaturase mRNA is signicantly lower in lesional AD skin. This is probably related to the high amount of AA present in lesional skin, where negative feed back regulation of -5 desaturase plays a role. In both non-lesional and lesional skin mRNA expression of the enzymes 5-lipoxygenase (5-LO), 5-lipoxygenase activating protein (FLAP) en microsomal prostaglandin-E synthase-1 (mPGES-1) are signicantly increased. These enzymes can be seen as interesting targets to inhibit skin inammation in cAD. Lesional atopic skin shows a mixed Th phenotype based on mRNA expression results of Th1-, Th2- and Treg- related cytokines and transcription factors.

General Discussion 161

5-LO FLAP mPGES-1 EP3 SOCS3 IL-13 IL-10

AA 5-LO FLAP LTA4H mPGES-1 EP2 IL-6 STAT4 IFN- SOCS3 IL-13 IL-10 FADS1

NON-LESIONAL SKIN

LESIONAL SKIN

macrophage eosinophil allergens

Langerhans cell IgE antibody T-cell receptor

mast cell Th1 or Th2 cell CD8+ T-cell

granulocyte monocyte

LEGEND

Chapter 8 162

Figure 1. Non-lesional and lesional skin in canine AD Canine lesional skin is characterized by a spongiotic dermatitis with a mononuclear inltrate, accumulation of epidermal and dermal IgE+ CD1a+ [41] and dermal eosinophil microaggregates. In the epidermis increased numbers of Langerhans cells, T lymphocytes and rare eosinophils are found. Dermal inammatory cells comprise mast cells, dermal antigen-presenting cells and T lymphocytes and occasionally eosinophils. Non-lesional skin also is not comparable to healthy control skin [42, 43]. It contains more epidermal LC, T-cells [44] and mononuclear cells than healthy skin and thus can be interpreted as primed skin. Lesional skin, containing an inammatory cell inltrate, and a (possibly related) high AA level might thus be an important source of LTB 4 production. The ndings of signicantly increased mRNA for 5-LO and LTA4H in lesional skin further support this. Moreover, several studies in atopic dogs have found evidence for a defect in the epidermal barrier [45-49]. A defective epidermal barrier leading to increased lipid metabolism also seems a valid explanation for the high mPGES-1 mRNA levels found as epidermal cells are probably main producers of this enzyme. No specic Th1 or Th2 phenotype in non-lesional and lesional skin was found, but a pro-inammatory mixed phenotype in which both cell Th-types might be involved. We might thus conclude that the results in this thesis together with the existing evidence from other dog studies indicate a possible primary defect in the epidermal barrier followed by involvement of the immune system.

General Discussion 163

References
1. Olivry T, DeBoer DJ, Grifn CE, Halliwell RE, Hill PB, Hillier A et al. The ACVD task force on canine atopic dermatitis: forewords and lexicon. Vet Immunol Immunopathol 2001: 81(3-4): p. 143-6. Langeveld-Wildschut EG, Thepen T, Bihari IC, ven Reijsen FC, de Vries IJ, Bruijnzeel PL et al. Evaluation of the atopy patch test and the cutaneous late-phase reaction as relevant models for the study of allergic inammation in patients with atopic eczema. J Allergy Clin Immunol 1996: 98(6 Pt 1): p. 1019-27. Bruijnzeel PL, Kuijper PH, Kapp A, Warringa RA, Betz S, and Bruijnzeel-Koomen CA. The involvement of eosinophils in the patch test reaction to aeroallergens in atopic dermatitis: its relevance for the pathogenesis of atopic dermatitis. Clin Exp Allergy 1993: 23(2): p. 97-109. Marsella R, Olivry T, and Maeda S. Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet Dermatol 2006: 17(2): p. 111-20. Sala-Vila A, Miles EA, and Calder PC. Fatty acid composition abnormalities in atopic disease: evidence explored and role in the disease process examined. Clin Exp Allergy 2008: 38(9): p. 1432-50. Calder PC. n-3 polyunsaturated fatty acids, inammation, and inammatory diseases. Am J Clin Nutr 2006: 83(6 Suppl): p. 1505S-1519S. Calder PC. Abnormal fatty acid proles occur in atopic dermatitis but what do they mean? Clin Exp Allergy 2006: 36(2): p. 138-41. Fritsche KL. Too much linoleic acid promotes inammation-doesnt it? Prostaglandins Leukot Essent Fatty Acids 2008: 79(3-5): p. 173-5. Baddaky-Taugbol B, Vroom M, Nordberg L, Leistra M, Sinke J, Hovenier R et al. A randomised, controlled, double-blinded, multicentre study on the efcacy of a diet rich in sh oil and borage oil in the control of canine atopic dermatitis. Advances in Veterinary Dermatology, eds. A.Hillier, A.Foster, K.Kwochka., Proceedings of fth world congress of veterinary dermatology, Vienna (25-28 August 2004) 2005: 5: p. 173-178. Mueller RS, Fettman MJ, Richardson K, Hansen RA, Miller A, Magowitz J et al. Plasma and skin concentrations of polyunsaturated fatty acids before and after supplementation with n-3 fatty acids in dogs with atopic dermatitis. Am J Vet Res 2005: 66(5): p. 868-73. Nesbitt GH, Freeman LM, and Hannah SS. Effect of n-3 fatty acid ratio and dose on clinical manifestations, plasma fatty acids and inammatory mediators in dogs with pruritus. Vet Dermatol 2003: 14(2): p. 67-74. Hall JA, Henry LR, Jha S, Skinner MM, Jewell DE, and Wander RC. Dietary (n-3) fatty acids alter plasma fatty acids and leukotriene B synthesis by stimulated neutrophils from healthy geriatric Beagles. Prostaglandins Leukot Essent Fatty Acids 2005: 73(5): p. 335-41. Hall JA, Picton RA, Skinner MM, Jewell DE, and Wander RC. The (n-3) fatty acid dose, independent of the (n-6) to (n-3) fatty acid ratio, affects the plasma fatty acid prole of normal dogs. J Nutr 2006: 136(9): p. 2338-44. Chapkin RS and Ziboh VA. Inability of skin enzyme preparations to biosynthesize arachidonic acid from linoleic acid. Biochem Biophys Res Commun 1984: 124(3): p. 784-92.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.
Chapter 8

14.

164

15.

Chapkin RS, Ziboh VA, Marcelo CL, and Voorhees JJ. Metabolism of essential fatty acids by human epidermal enzyme preparations: evidence of chain elongation. J Lipid Res 1986: 27(9): p. 945-54. Cho HP, Nakamura M, and Clarke SD. Cloning, expression, and fatty acid regulation of the human delta-5 desaturase. J Biol Chem 1999: 274(52): p. 37335-9. Cho HP, Nakamura MT, and Clarke SD. Cloning, expression, and nutritional regulation of the mammalian Delta-6 desaturase. J Biol Chem 1999: 274(1): p. 471-7. Woodside JV and Kromhout D. Fatty acids and CHD. Proc Nutr Soc 2005: 64(4): p. 554-64. Adam O, Tesche A, and Wolfram G. Impact of linoleic acid intake on arachidonic acid formation and eicosanoid biosynthesis in humans. Prostaglandins Leukot Essent Fatty Acids 2008: 79(3-5): p. 177-81. Radmark O, Werz O, Steinhilber D, and Samuelsson B. 5-Lipoxygenase: regulation of expression and enzyme activity. Trends Biochem Sci 2007: 32(7): p. 332-41. Steinhilber D. 5-Lipoxygenase: a target for antiinammatory drugs revisited. Curr Med Chem 1999: 6(1): p. 71-85. Doepping S, Funk CD, Habenicht AJ, and Spanbroek R. Selective 5-lipoxygenase expression in Langerhans cells and impaired dendritic cell migration in 5-LO-decient mice reveal leukotriene action in skin. J Invest Dermatol 2007: 127(7): p. 1692-700. Spanbroek R, Stark HJ, Janssen-Timmen U, Kraft S, Hildner M, Andl T et al. 5-Lipoxygenase expression in Langerhans cells of normal human epidermis. Proc Natl Acad Sci U S A 1998: 95(2): p. 663-8. Peters-Golden M and Henderson WR, Jr. Leukotrienes. N Engl J Med 2007: 357(18): p. 1841-54. Iversen L and Kragballe K. Arachidonic acid metabolism in skin health and disease. Prostaglandins Other Lipid Mediat 2000: 63(1-2): p. 25-42. Proksch E, Brandner JM, and Jensen JM. The skin: an indispensable barrier. Exp Dermatol 2008: 17(12): p. 1063-72. Sola J, Godessart N, Vila L, Puig L, and de Moragas JM. Epidermal cell-polymorphonuclear leukocyte cooperation in the formation of leukotriene B4 by transcellular biosynthesis. J Invest Dermatol 1992: 98(3): p. 333-9. Iversen L, Ziboh VA, Shimizu T, Ohishi N, Radmark O, Wetterholm A et al. Identication and subcellular localization of leukotriene A4-hydrolase activity in human epidermis. J Dermatol Sci 1994: 7(3): p. 191201.
General Discussion 165

16.

17.

18. 19.

20.

21.

22.

23.

24. 25.

26.

27.

28.

29.

Iversen L, Kristensen P, Gron B, Ziboh VA, and Kragballe K. Human epidermis transforms exogenous leukotriene A4 into peptide leukotrienes: possible role in transcellular metabolism. Arch Dermatol Res 1994: 286(5): p. 261-6. Iversen L, Fogh K, Ziboh VA, Kristensen P, Schmedes A, and Kragballe K. Leukotriene B4 formation during human neutrophil keratinocyte interactions: evidence for transformation of leukotriene A4 by putative keratinocyte leukotriene A4 hydrolase. J Invest Dermatol 1993: 100(3): p. 293-8.

30.

31.

Folco G and Murphy RC. Eicosanoid transcellular biosynthesis: from cell-cell interactions to in vivo tissue responses. Pharmacol Rev 2006: 58(3): p. 375-88. Luster AD and Tager AM. T-cell trafcking in asthma: lipid mediators grease the way. Nat Rev Immunol 2004: 4(9): p. 711-24. Tager AM, Bromley SK, Medoff BD, Islam SA, Bercury SD, Friedrich EB et al. Leukotriene B4 receptor BLT1 mediates early effector T cell recruitment. Nat Immunol 2003: 4(10): p. 982-90. Ott VL, Cambier JC, Kappler J, Marrack P, and Swanson BJ. Mast cell-dependent migration of effector CD8+ T cells through production of leukotriene B4. Nat Immunol 2003: 4(10): p. 974-81. Spanbroek R, Hildner M, Kohler A, Muller A, Zintl F, Kuhn H et al. IL-4 determines eicosanoid formation in dendritic cells by down-regulation of 5-lipoxygenase and up-regulation of 15-lipoxygenase 1 expression. Proc Natl Acad Sci U S A 2001: 98(9): p. 5152-7. Couper KN, Blount DG, and Riley EM. IL-10: the master regulator of immunity to infection. J Immunol 2008: 180(9): p. 5771-7. Murphy JE, Robert C, and Kupper TS. Interleukin-1 and cutaneous inammation: a crucial link between innate and acquired immunity. J Invest Dermatol 2000: 114(3): p. 602-8. Kupper TS and Fuhlbrigge RC. Immune surveillance in the skin: mechanisms and clinical consequences. Nat Rev Immunol 2004: 4(3): p. 211-22. Dinarello CA. Interleukin-1, interleukin-1 receptors and interleukin-1 receptor antagonist. Int Rev Immunol 1998: 16(5-6): p. 457-99. Steinhoff M, Brzoska T, and Luger TA. Keratinocytes in epidermal immune responses. Curr Opin Allergy Clin Immunol 2001: 1(5): p. 469-76. Looringh van Beeck FA, Zajonc DM, Moore PF, Schlotter YM, Broere F, Rutten VP et al. Two canine CD1a proteins are differentially expressed in skin. Immunogenetics 2008: 60(6): p. 315-24. Leung DY, Boguniewicz M, Howell MD, Nomura I, and Hamid QA. New insights into atopic dermatitis. J Clin Invest 2004: 113(5): p. 651-7. Olivry T, Naydan DK, and Moore PF. Characterization of the cutaneous inammatory inltrate in canine atopic dermatitis. Am J Dermatopathol 1997: 19(5): p. 477-86. Sinke JD, Thepen T, Bihari IC, Rutten VP, and Willemse T. Immunophenotyping of skin-inltrating T-cell subsets in dogs with atopic dermatitis. Vet Immunol Immunopathol 1997: 57(1-2): p. 13-23. Hightower K, Marsella R, Creary E, and Dutcher P. Evaluation of transepidermal water loss in canine atopic dermatitis: a pilot study in Beagle dogs sensitized to house dust mites. 2008. Marsella R, Samuelson D, Doerr K, K. H, and Harrington L. Defective barrier function in an experimental model of atopic dermatitis in high IgE producing Beagles. In the Proceedings of the 5th George Rajka International Symposium on Atopic Dermatitis, Kyoto, Japan, 18 2008.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

Chapter 8

46.

166

47.

Pucheu-Haston CM, Jackson HA, Olivry T, Dunston SM, and Hammerberg B. Epicutaneous sensitization with Dermatophagoides farinae induces generalized allergic dermatitis and elevated mite-specic immunoglobulin E levels in a canine model of atopic dermatitis. Clin Exp Allergy 2008: 38(4): p. 667-79. Marsella R and Girolomoni G. Canine Models of Atopic Dermatitis: A Useful Tool with Untapped Potential. J Invest Dermatol 2009. Inman AO, Olivry T, Dunston SM, Monteiro-Riviere NA, and Gatto H. Electron microscopic observations of stratum corneum intercellular lipids in normal and atopic dogs. Vet Pathol 2001: 38(6): p. 720-3.

48.

49.

General Discussion 167

Chapter 8

168

CHAPTER 9

Nederlandse samenvatting

Nederlandse samenvatting Atopische dermatitis (AD) bij de hond is een erfelijk bepaalde, allergische huidaandoening. De allergie wordt veroorzaakt door een overmatige reactie van het immuunsysteem op feitelijk onschadelijke prikkels (allergenen) uit de omgeving, zoals huisstofmijten (Dermatophagoides (D.) farinae, D. pteronyssinus), haren van andere dieren, pollen van grassen, bomen en onkruid [1, 2]. Geschat wordt dat 3 tot 15 procent van de honden de aandoening krijgt, maar betrouwbare epidemiologische data zijn er niet [3]. Bij de meeste honden worden de eerste verschijnselen gezien tussen de leeftijd van 9 maanden en 4 jaar. Er is altijd sprake van jeuk (pruritus) die de honden tonen door het krabben, bijten en likken aan de snuit, oren, poten (en in het bijzonder de ondervoeten), oksels, buik en liezen [4]. Bij bepaalde rassen, zoals de Labrador en Golden Retriever, Duitse Herders, Boxers, Jack Russell terriers, Lhasa Apsos en West Highland white terriers komt de aandoening vaker voor dan bij andere rassen [5]. Wanneer de klinische diagnose atopische dermatitis is gesteld wordt door middel van allergietesten uitgezocht welke allergenen een rol spelen. Bij de ene test (de zgn. huidpriktest) krijgt de hond injecties in de huid met verschillende allergenen [6] en bij de tweede test (zgn. serum test) worden in het bloed (IgE) antilichamen (antistoffen) aangetoond tegen de allergenen [7]. Atopische dermatitis bij de hond vertoont veel gelijkenis met atopisch eczeem bij de mens. Dit geldt voor zowel de klinische manifestatie als ook voor de immunologische achtergrond (zie Tabel 1; Hoofdstuk 8) [8, 9]. De werkingsmechanismen van het onstaan en onderhouden van de huidonsteking bij atopisch eczeem bij de mens zijn ondanks intensief onderzoek nog niet volledig opgehelderd. Net als bij de mens heeft het onderzoek bij de hond zich vooral gericht op de achtergrond van de overmatige reactie van het immuunsysteem, dat lang werd gezien als de primaire oorzaak van het onstaan van AD [10, 11]. Een belangrijke rol wordt daarin toebedeeld aan een bepaald type witte bloedcellen, de T lymfocyten ofwel T helper (Th) cellen [12]. Er bestaan verschillende categorien (subsets) van deze Th cellen. De verschillende subsets produceren verscheidene cytokinen (kleine eitwitten) met specieke functies. De Th1 (type 1) cellen produceren met name interleukine-2 (IL-2) en interferon gamma (IFN-), terwijl de Th2 cellen vooral IL-4, IL-5 en IL-13 produceren. Onder normale omstandigheden bestaat er een evenwichtige balans tussen de Th1 en Th2 cellen dat (mede) in stand wordt gehouden door de regulatoire T cellen (Treg) en de bijbehorende cytokinen, zoals IL-10 en TGF- [13]. Naast de genetische predispositie zou het krijgen van een allergische aandoening tevens
Chapter 9

een gevolg kunnen zijn van interactie met omgevingsfactoren zoals de blootstelling of juist verminderde blootstelling van het immuunsysteem aan microbile pathogenen (b.v. bepaalde bacterin of parasieten) of voedselcomponenten die de onstekingsreactie kunnen aanwakkeren. Naast een overmatige reactie van het immuunsysteem speelt een niet goed

170

functionerende huidbarrire (de buitenste beschermende laag van de huid) een rol in AD, ook bij de hond zijn hier aanwijzigen voor gevonden, o.a. door verminderde productie van bepaalde huidvetten (ceramiden) (zie Tabel 1; hoofdstuk 8) [14]. Het is op dit moment onduidelijk welk systeem, het reactieve immuunsysteem of de huidbarrire, de belangrijkste rol speelt in het ontstaan van de aandoening. Bij de mens met AD is de atopie plaktest een bruikbare methode gebleken om de kinetiek van de onstekingsreactie te monitoren [15]. Door het relevante allergeen (waar de betreffende persoon gevoelig voor is gebleken) op de huid aan te brengen kunnen in een groot deel van de humane AD patinten huidreacties (gelijkend op het eczeem dat ze spontaan ontwikkelen) opgewekt worden [16]. Door op verschillende tijdstippen in de huid naar bijvoorbeeld Th cellen en cytokines te kijken, kan een indruk worden verkregen over het verloop van de ontstekingreactie. De ontsteking die op deze wijze ontstaat is zowel macroscopisch (van buitenaf bezien) als microscopisch (de cellen aanwezig in de ontstoken huid) overeenkomstig met de huidafwijkingen die deze personen spontaan ontwikkelen. Op dit moment worden de gegevens uitgewerkt van een onderzoek (niet behorend tot dit proefschrift) met patch testen bij AD honden en zal duidelijk worden of een dergelijk model tevens bij de hond gebruikt kan worden. Daarnaast is in de Verenigde Staten een experimenteel atopisch hondenmodel ontwikkeld bij Beagles [17]. Deze honden zijn allergisch voor huisstofmijt allergeen. Nadelen aan dit model zijn dat (1) de Beagle geen ras is dat vaak spontaan AD ontwikkelt en (2) niet duidelijk is of het achterliggende mechanisme dat tot de huidontstekingen leidt vergelijkbaar is met hetgeen gezien wordt bij honden met spontaan optredende AD. Om deze redenen is in de onderzoeken in dit proefschrift gekozen voor honden die de spontane vorm van AD hebben ontwikkeld.

De rol van meervoudig onverzadigde vetzuren in atopische dermatitis In humaan onderzoek is wel gesteld dat een overmatige opname van meervoudig onverzadigde omega-6 vetzuren (PUFA) leidt tot een toename van atopische aandoeningen. De afgelopen decennia is het dieet van mensen namelijk zodanig veranderd dat omega3 vetzuren. Dit geldt ook voor het standaard hondenvoer. Deze voedingscomponenten werden echter een bron van onderzoek omdat met name aan de omega-3 vetzuren ontstekingsremmende eigenschappen worden toegedacht (hoofdstuk 2). Betreffende de relatie tussen PUFA en AD werden in dit proefschrift twee onderzoeksvragen gesteld: (a) is het supplementeren van omega-3 vetzuren aan het dieet effectief in het reduceren van de onstekingsreactie en (b) is er bewijs voor een relatie tussen AD en een afwijkend vetzuurmetabolisme of vetzuurcompositie in atopische individuen (mensen
171 Nederlandse samenvatting

6 vetzuren, met name linolzuur, hier een veel groter deel van uitmaken dan de omega-

danwel honden)? Deze laatste vraag zou consequenties kunnen hebben voor zowel immuunregulatie als de huidbarrire functie. Met betrekking tot vraag (a) kan geconcludeerd worden dat het aantal humane studies dat de gezondheidseffecten van omega-3 vetzuren op AD onderzocht heeft beperkt is en dat het remmende effect van deze vetzuren op het onstekingsproces niet aangetoond kan worden (hoofdstuk 2) [18]. Met betrekking tot vraag (b) zijn er humaan twee hypotheses opgesteld die meervoudige onverzadigde vetzuren koppelen aan AD [19]. De eerste veronderstelt dat afwijkingen in het vetzuurmetabolisme het gevolg zijn van een verminderde activiteit van het enzym -6 desaturase, wat zou resulteren in lagere hoeveelheden van zowel de langketen omega-6 als omega-3 vetzuren. Studies m.b.t. deze veronderstelling zijn echter niet consistent. Een mogelijke causale relatie van lagere hoeveelheden omega-6 vetzuren en AD is tevens in contrast met de hypothese dat omega6 vetzuren verantwoordelijk zijn voor het ontstaan van de pro-inammatoire metabolieten. Recent zijn er echter tevens aanwijzingen dat arachidonzuur (AA) ook een precursor is van een groep van ontstekingsremmende mediatoren. De tweede hypothese veronderstelt dat er een relatie bestaat tussen de hogere inname van linolzuur (LA) en de toename van allergische aandoeningen de afgelopen decennia. In een recent literatuuronderzoek naar het daadwerkelijke bewijs voor veranderingen in de vetzuur samenstelling in AD bij de mens kwamen de auteurs tot de conclusie dat er niet n duidelijk ander patroon in n type vetzuur of familie van vetzuren te onderkennen is in AD [18]. Hoogstens zijn er aanwijzingen dat er lagere hoeveelheden aanwezig zijn van de vetzuren gamma-linoleenzuur (GLA), dihomo-gamma-linoleenzuur (DGLA) en arachidonzuur (AA). Dit zou kunnen berusten op een verminderde capaciteit om LA te metaboliseren ofwel het betekent dat er een verhoogd verbruik is van deze vetzuren [18]. Deze aanwijzingen berusten op metingen van de vetzuursamenstelling in het bloed, rode bloedcellen, witte bloedcellen, serum en plasma van kinderen met AD. Daarnaast is dit gemeten in navelstrengbloed van hoog-risico kinderen (d.w.z. met een positieve familiegeschiedenis voor allergische aandoeningen), in de borstvoeding van atopische moeders evenals in de borstvoeding van moeders van kinderen die later atopische dermatitis ontwikkelden [18]. Echter, voor zover de auteur bekend, is de vetzuur compositie in de huid van deze kinderen niet gemeten. Met betrekking to beide vragen (a) en (b) kan ook voor studies bij honden geconcludeerd worden dat de onderzoeksresultaten niet consistent zijn. Dit heeft mede te maken met het feit dat er vele verschillen bestaan tussen de opzet van de betreffende studies (i.e. verschil in studieduur, verschillende vetzuren gebruikt, wel of niet dubbelblind, etc). Uit het
Chapter 9

beperkte aantal vergelijkbare en goed opgezette studies kan geconcludeerd worden dat het vetzuurgehalte in het plasma een goede afspiegeling is van de vetzuursamenstelling van het dieet [20-23]. Bij honden met AD is de vetzuurcompositie van de huid voor en na een dieettest in twee studies onderzocht en hoewel het duidelijk is dat het dieet ook de

172

vetzuursamenstelling van de huid beinvloedt, is deze invloed zeer beperkt in vergelijking met de invloed op het plasma vetzuur gehalte. Deze resultaten komen overeen met data van onze klinische trial (hoofdstuk 4). De groep die het dieet kreeg met een hoge n-6:n3 ratio (20:1) door een verhoogde hoeveelheid van het omega-6 vetzuur linolzuur, liet een stijging van de n-6:n-3 ratio zien van 11 naar 22.6. De dieetgroep met de lagere n-6:n-3 ratio (5:1) liet geen verschil zien. Echter de verdubbelde n-6:n-3 ratio in het plasma zagen we niet terug in de huid. In de groep met de lagere n-6:n-3 ratio (5:1) zagen we een signicante daling van het linolzuur in de huid, ondanks dat de plasma n-6:n-3 ratio niet veranderde. Dit geeft aan, dat met name de absolute hoeveelheden van de verschillende vetzuren in de voeding een richtlijn zijn voor de uiteindelijke vetzuurcompositie van de huid en niet de n-6: n-3 vetzuur ratio in de voeding [20]. In tegenstelling tot de overige twee studies in de hond, waarin alleen de vetzuurcompositie van niet-ontstoken huid is bepaald , is in ons onderzoek tevens naar die in de ontstoken huid gekeken (Hoofdstuk 4 en 5). Een opvallend verschil in de vetzuursamenstelling bleek de signicant hogere (4.7 maal hoger) hoeveelheid van AA in onstoken huid. Deze hogere hoeveelheid AA past bij de theorie dat het metabolisme van dit vetzuur leidt tot stofwisselingsproducten die zeer waarschijnlijk bijdragen aan de onstekingreactie die wordt waargenomen.

Arachidonzuur metabolisme Een meer complexe vraag is echter hoe dit verschil in AA tussen de niet-onstoken en onstoken huid tot stand is gekomen (Hoofdstuk 5). AA kan op een aantal verschillende manieren in de huid terecht komen: (I) AA wordt in de huid zelf gemetaboliseerd vanuit LA door -5 en -6 desaturase (Hoofdstuk 2; Figuur 2); (II) AA is afkomstig uit de voeding ofwel (III) AA wordt getransporteerd naar de huid vanuit andere endogene bronnen zoals de lever, een orgaan dat primair verantwoordelijk is voor het vetzuurmetabolisme (of combinaties van deze mogelijkheden). Met betrekking tot punt (I): het is algemeen geaccepteerd dat de opperhuid van de mens, rat en cavia geen activiteit bezit van zowel -5 als -6 desaturase, wat betekent dat AA productie vanuit linolzuur niet mogelijk is in de opperhuid van deze species is de verwachting dat ook in de opperhuid van de hond deze enzymen niet actief zijn. Uitsluiten kunnen wij dit echter niet aangezien wij mRNA hebben gemeten in de huid als totaal (zowel opper- als lederhuid; hoofdstuk 4, 5, 6, 7). mRNA voor beide desaturases was in deze totale huid (non-lesionaal als lesionaal) aanwezig en aangezien in humane huid de mRNA hoeveelheden samen gaan met de eiwitactiviteit verwachten wij dit ook voor de hond [26, 27]. In de toekomst zullen aanvullende studies echter moeten uitwijzen waar deze desaturases zich exact bevinden in de huid. De voeding als bron van AA (optie II) lijkt een
173 Nederlandse samenvatting

species [24, 25]. Gezien de homologie die bestaat in eiwitstructuur tussen deze verschillende

goed alternatief. Verschillende studies hebben aangetoond dat wanneer LA in de voeding verhoogd wordt dit niet terug wordt gezien in de hoeveelheid AA in de weefsels. Dit betekent dat het endogene metabolisme van LA naar AA (optie III) verwaarloosd kan worden en dat de hoeveelheden AA in de voeding een voorspellende waarde heeft voor het AA in de weefsels [28-30]. Dit komt overeen met de resultaten van onze klinische trial (Hoofdstuk 4). Hoewel de vetzuur compositie van de voeding het beste alternatief lijkt te zijn voor de vetzuurcompositie van de weefsels verklaart ook dit niet het verschil in AA in non-lesionale versus lesionale huid. Combinaties van bovenstaande opties spelen zeer waarschijnlijk een rol. Daarnaast streven het lichaam en de cellen een bepaalde homeostase na en is een verandering van de vetzuurcompositie van de huid waarschijnlijk slechts mogelijk binnen bepaalde marges.

De celinltraten aanwezig in de atopische huid in relatie tot het arachidonzuur Een alternatieve verklaring voor het hoge AA in lesionale huid komt vanuit het verschil tussen lesionale en niet-lesionale huid zelf. De overeenkomst tussen AD bij de mens en de hond betreft ook de celinltraten (typen van verschillende onstekingscellen) aanwezig in de nietlesionale en lesionale huid. Wij hebben aangetoond dat zowel niet-lesionale als lesionale huid signicant verhoogde hoeveelheden van 5-lipoxygenase (5-LO) en 5-lipoxygenase activating protein (FLAP) bevat vergeleken met gezonde huid (Hoofdstuk 6) [31, 32]. Wij hebben deze verhoogde waarden verklaard uit de typen cellen die aangetroffen worden in deze huid, aangezien het bekend is dat met name witte bloedcellen over de capaciteit beschikken om grote hoeveelheden zogenaamde leukotrienen (ontstekingsbevorderende stoffen) te produceren uit AA [33]. Deze verhoogde productie van 5-LO en FLAP door witte bloedcellen kan tevens een verklaring zijn voor het verhoogde AA wat aangetroffen wordt in atopische huid. Daar het belangrijkste vetzuur in de membranen van leukocyten AA is, zou het verhoogde AA in lesionale huid het gevolg kunnen zijn van het hoge aantal onstekingscellen in deze huid.

Het verband tussen een defecte huidbarrire en de immuunrespons Leukotrienes en prostaglandines worden voornamelijk gevormd vanuit AA. Een defecte huidbarrire zal leiden tot een verhoogd vetzuurmetabolisme en om die reden zullen meer leukotrienen als LTB4 (een ontstekinsbevorderende metaboliet) en prostaglandines geproduceerd worden. De al eerder genoemde witte bloedcellen bezitten receptoren op hun
Chapter 9

oppervlak voor de verschillende leukotrienen. Wanneer leukotrienen in grote(re) hoeveelheden in een weefsel aanwezig zijn zal dat leiden tot het aantrekken van verschillende typen witte bloedcellen waar ze een interactie mee aangaan (zie Hoofdstuk 8; Figuur 1) [34, 35]. Het is duidelijk dat deze cellen van het immuunsysteem een belangrijke rol spelen in

174

de pathogenese van AD. Daarnaast spelen de oppervlaktecellen van de huid zelf (de keratinocyten) een belangrijke rol. Ook deze cellen produceren een reeks immunoregulatoire stoffen na prikkeling/stimulatie, bijv. door beschadiging van de huidbarrire door krabben met als gevolg het aantrekken van immuuncellen vanuit de bloedbaan en activatie van cellen in de huid. In dit proefschrift is geen duidelijke aanwijzing gevonden dat een bepaalde subset van de Th cellen overheerst in lesionale en niet-lesionale AD huid, maar op basis van de cytokine metingen in de huid lijken beide typen Th cellen een rol te spelen (hoofdstuk 7). Om de rol van deze cellen beter te bestuderen zou een toekomstig patch test model bij de hond met AD een belangrijke bijdrage kunnen leveren.

Nederlandse samenvatting 175

Samenvattend kunnen we concluderen dat (Figuur 1, hoofdstuk 8): het verlagen van de n-6:n-3 ratio in het voordeel van n-3 vetzuren geen duidelijke klinische verbetering geeft. Het metabolisme van n-6 en n-3 vetzuren is zeer complex. Meer vergelijkbare studies zijn nodig om een beter inzicht te verkrijgen in de op zichzelf staande effecten van deze vetzuren; het plasma vetzuurproel een duidelijke afspiegeling is van de vetzuurgehalten in de voeding. Voor de huid geldt dit niet of vele malen minder. Derhalve is de invloed van vetzuren in de voeding mogelijk van veel minder invloed dan tot op heden wordt verondersteld; het arachidonzuur gehalte sterk verhoogd is in lesionale AD huid. Dit houdt logisch verband met de onsteking die aanwezig is in lesionale huid. Toekomstig onderzoek zal echter moeten uitwijzen hoe deze verhoging tot stand is gekomen tot stand is gekomen; -5 desaturase mRNA sterk verlaagd is in lesionale AD huid. Dit enzym is verantwoordelijk voor de omzetting van DGLA naar AA. Het aangetoonde verhoogde gehalte van AA is waarschijnlijk verantwoordelijk voor de negatieve feedback regulatie, waardoor -5 desaturase geremd wordt; in zowel niet-lesionale als lesionale huid van honden met AD de mRNA expressie van de enzymen 5-lipoxygenase (5-LO), 5-lipoxygenase activating protein (FLAP) en microsomaal prostaglandin-E synthase-1 (mPGES-1) sterk verhoogd is. Toekomstig onderzoek moet uitwijzen of dit op eiwitniveau ook het geval is. Deze resultaten maken deze enzymen tot interessante targets om de ontsteking in de huid te kunnen onderdrukken; lesionale huid een gemengd Th phenotype vertoont, hetgeen is gebaseerd op de mRNA metingen van de Th1 en Th2 cytokines en transcriptiefactoren. Het verhoogde IL-10 geeft aan dat regulatoireT cellen mogelijk een rol spelen, echter dit cytokine kan tevens door andere celtypen geproduceerd worden. Aanvullend onderzoek om de IL10 producerende celtypen te karakteriseren is noodzakelijk.

Chapter 9 176

Referenties
1. Olivry T, DeBoer DJ, Grifn CE, Halliwell RE, Hill PB, Hillier A et al. The ACVD task force on canine atopic dermatitis: forewords and lexicon. Vet Immunol Immunopathol 2001: 81(3-4): p. 143-6. Hill PB and DeBoer DJ. The ACVD task force on canine atopic dermatitis (IV): environmental allergens. Vet Immunol Immunopathol 2001: 81(3-4): p. 169-86. Hillier A and Grifn CE. The ACVD task force on canine atopic dermatitis (I): incidence and prevalence. Vet Immunol Immunopathol 2001: 81(3-4): p. 147-51. Grifn CE and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis. Vet Immunol Immunopathol 2001: 81(3-4): p. 255-69. Sousa CA and Marsella R. The ACVD task force on canine atopic dermatitis (II): genetic factors. Vet Immunol Immunopathol 2001: 81(3-4): p. 153-7. Hillier A and DeBoer DJ. The ACVD task force on canine atopic dermatitis (XVII): intradermal testing. Vet Immunol Immunopathol 2001: 81(3-4): p. 289-304. DeBoer DJ and Hillier A. The ACVD task force on canine atopic dermatitis (XVI): laboratory evaluation of dogs with atopic dermatitis with serum-based allergy tests. Vet Immunol Immunopathol 2001: 81(3-4): p. 277-87. Marsella R and Girolomoni G. Canine Models of Atopic Dermatitis: A Useful Tool with Untapped Potential. J Invest Dermatol 2009. Sinke JD, Rutten VP, and Willemse T. Immune dysregulation in atopic dermatitis. Vet Immunol Immunopathol 2002: 87(3-4): p. 351-6. Leung DY, Boguniewicz M, Howell MD, Nomura I, and Hamid QA. New insights into atopic dermatitis. J Clin Invest 2004: 113(5): p. 651-7. Bieber T. Atopic dermatitis. N Engl J Med 2008: 358(14): p. 1483-94. Herrick CA and Bottomly K. To respond or not to respond: T cells in allergic asthma. Nat Rev Immunol 2003: 3(5): p. 405-12. Larche M. Regulatory T cells in allergy and asthma. Chest 2007: 132(3): p. 1007-14. Proksch E, Brandner JM, and Jensen JM. The skin: an indispensable barrier. Exp Dermatol 2008: 17(12): p. 1063-72. Langeveld-Wildschut EG, Thepen T, Bihari IC, ven Reijsen FC, de Vries IJ, Bruijnzeel PL et al. Evaluation of the atopy patch test and the cutaneous late-phase reaction as relevant models for the study of allergic inammation in patients with atopic eczema. J Allergy Clin Immunol 1996: 98(6 Pt 1): p. 1019-27. Bruijnzeel PL, Kuijper PH, Kapp A, Warringa RA, Betz S, and Bruijnzeel-Koomen CA. The involvement of eosinophils in the patch test reaction to aeroallergens in atopic dermatitis: its relevance for the pathogenesis of atopic dermatitis. Clin Exp Allergy 1993: 23(2): p. 97-109.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11. 12.

13. 14.

15.

16.

Nederlandse samenvatting 177

17.

Marsella R, Olivry T, and Maeda S. Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet Dermatol 2006: 17(2): p. 111-20. Sala-Vila A, Miles EA, and Calder PC. Fatty acid composition abnormalities in atopic disease: evidence explored and role in the disease process examined. Clin Exp Allergy 2008: 38(9): p. 1432-50. Calder PC. Abnormal fatty acid proles occur in atopic dermatitis but what do they mean? Clin Exp Allergy 2006: 36(2): p. 138-41. Hall JA, Picton RA, Skinner MM, Jewell DE, and Wander RC. The (n-3) fatty acid dose, independent of the (n-6) to (n-3) fatty acid ratio, affects the plasma fatty acid prole of normal dogs. J Nutr 2006: 136(9): p. 2338-44. Baddaky-Taugbol B, Vroom M, Nordberg L, Leistra M, Sinke J, Hovenier R et al. A randomised, controlled, double-blinded, multicentre study on the efcacy of a diet rich in sh oil and borage oil in the control of canine atopic dermatitis. Advances in Veterinary Dermatology, eds. A.Hillier, A.Foster, K.Kwochka., Proceedings of fth world congress of veterinary dermatology, Vienna (25-28 August 2004) 2005: 5: p. 173-178. Mueller RS, Fettman MJ, Richardson K, Hansen RA, Miller A, Magowitz J et al. Plasma and skin concentrations of polyunsaturated fatty acids before and after supplementation with n-3 fatty acids in dogs with atopic dermatitis. Am J Vet Res 2005: 66(5): p. 868-73. Nesbitt GH, Freeman LM, and Hannah SS. Effect of n-3 fatty acid ratio and dose on clinical manifestations, plasma fatty acids and inammatory mediators in dogs with pruritus. Vet Dermatol 2003: 14(2): p. 67-74. Chapkin RS and Ziboh VA. Inability of skin enzyme preparations to biosynthesize arachidonic acid from linoleic acid. Biochem Biophys Res Commun 1984: 124(3): p. 784-92. Chapkin RS, Ziboh VA, Marcelo CL, and Voorhees JJ. Metabolism of essential fatty acids by human epidermal enzyme preparations: evidence of chain elongation. J Lipid Res 1986: 27(9): p. 945-54. Cho HP, Nakamura M, and Clarke SD. Cloning, expression, and fatty acid regulation of the human delta-5 desaturase. J Biol Chem 1999: 274(52): p. 37335-9. Cho HP, Nakamura MT, and Clarke SD. Cloning, expression, and nutritional regulation of the mammalian Delta-6 desaturase. J Biol Chem 1999: 274(1): p. 471-7. Woodside JV and Kromhout D. Fatty acids and CHD. Proc Nutr Soc 2005: 64(4): p. 554-64. Adam O, Tesche A, and Wolfram G. Impact of linoleic acid intake on arachidonic acid formation and eicosanoid biosynthesis in humans. Prostaglandins Leukot Essent Fatty Acids 2008: 79(3-5): p. 177-81. Fritsche KL. Too much linoleic acid promotes inammation-doesnt it? Prostaglandins Leukot Essent Fatty Acids 2008: 79(3-5): p. 173-5. Peters-Golden M and Henderson WR, Jr. Leukotrienes. N Engl J Med 2007: 357(18): p. 1841-54. Peters-Golden M and Brock TG. 5-lipoxygenase and FLAP. Prostaglandins Leukot Essent Fatty Acids 2003: 69(2-3): p. 99-109.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28. 29.

30.

Chapter 9

31. 32.

178

33.

Radmark O, Werz O, Steinhilber D, and Samuelsson B. 5-Lipoxygenase: regulation of expression and enzyme activity. Trends Biochem Sci 2007: 32(7): p. 332-41. Luster AD and Tager AM. T-cell trafcking in asthma: lipid mediators grease the way. Nat Rev Immunol 2004: 4(9): p. 711-24. Tager AM, Bromley SK, Medoff BD, Islam SA, Bercury SD, Friedrich EB et al. Leukotriene B4 receptor BLT1 mediates early effector T cell recruitment. Nat Immunol 2003: 4(10): p. 982-90.

34.

35.

Nederlandse samenvatting 179

Chapter 9

180

CHAPTER 10

Dankwoord Curriculum vitae Abbreviations

Dankwoord Ik was zon jaar of 4-5 dat ik regelmatig vertelde: later, als ik groot ben, ga ik naar de universiteit. Universiteit vond ik een prachtig woord, het moest wel iets moois en heel interessants zijn, mijn vader ging er immers iedere dag naartoe. Uiteindelijk mocht ik een keer mee en dat deed niets af aan de verwachting: een heel spannend en groot gebouw, net een doolhof, ik kon me er uren vermaken. Ongeveer 15 jaar later kwam de universiteit opnieuw in mijn leven en in de verschillende fasen die ik er doorliep, als student, als onderzoeker en nu als specialist in opleiding: ik kan me er nog steeds uren en uren vermaken. De huid en zijn aandoeningen wekten mijn interesse al tijdens de opleiding en dat leidde uiteindelijk tot het starten van een promotieonderzoek. De huid bleek echter een verre van geschikte samenwerkingspartner. Afgunstig keek ik naar collegas die werkten met lever of nierweefsel, dat zich zeer gewillig liet vermalen en verwerken. Waar zelfs bot tot gruis werd, bleef huid gewoon huid. In feite een puntje voor dit orgaan, dat zich niet kapot liet krijgen, inherent aan zijn natuurlijke functie. Uiteindelijk, het had tijd nodig, ging de samenwerking steeds beter. Mede door de verdienste van heel veel mensen die mij ondersteund hebben tijdens dit project, met name ook tijdens de Graves tijd, heb ik het wel kunnen volbrengen. Jullie wil ik allen danken, een aantal mensen in het bijzonder: Prof.dr T. Willemse, beste Ton: dat mijn aankloppen op jouw deur, omdat ik graag onderzoekservaring wilde opdoen en liefst in de dermatologie, zou leiden tot het punt waar we nu staan, had ik nooit kunnen vermoeden. Ik ben je veel verschuldigd, je behield altijd je vertrouwen in mij en gaf me alle kansen, ook tijdens momenten dat ikzelf vond dat ik het niet kon waarmaken. We hadden allen tijd nodig om grip te krijgen op het project, maar daarna ging het in een stroomversnelling en dat gaf me een enorme drive. Je bent de founder van de Dermatologie in onze kliniek (en daarbuiten!), er is nog veel dat ik van je kan leren, hopelijk kunnen wij nog een tijd op je rekenen! Prof.dr. C.A.F.M. Bruijnzeel-Koomen: beste Carla: ik wil je bedanken voor de mogelijkheden die ik heb gekregen om op het lab van de afdeling Dermatologie/Allergologie van het UMCU onderzoek te doen. Ik heb er zeer veel tijd doorgebracht, het is een inspirerende omgeving en hoewel in dit proefschrift slechts beperkt gebleven, liggen er nog bergen immunohistochemische data klaar om verwerkt te worden.
Chapter 10

Prof.dr. V.P.M.G Rutten: beste Victor: bij jou begon het eigenlijk allemaal, op jouw afdeling (1996!) deed ik mijn eerste onderzoekservaring op. Het was een pittig jaar maar jij hebt een essentiele bijdrage geleverd aan het plekje in mijn hart dat onderzoek doen vanaf die tijd innam. Het was geweldig dat je en paar jaar daarna co-promoter en daarna promotor werd

182

van mijn onderzoek. Je bent een gedreven en perfectionistisch wetenschapper en hield ons goed scherp met je kritische blik. Je bracht soms afgesloten discussies opnieuw ter sprake en eerlijk gezegd, het werk werd er vrijwel altijd beter van. Als het goed is, houdt onze samenwerking niet op bij het beeindigen van mijn promotietraject en ik zie erg uit naar de voortzetting hiervan in de toekomst. Hopelijk kun je in jouw drukker dan drukke schema nog wat tijd vrijmaken... Dr. E.F. Knol: beste Edward: net als Vic, een man die leeft voor de wetenschap! Je sleurt een ieder mee in je enthousiasme (heel jn voor als ik in een dipje zat) en je energie lijkt oneindig. Je kennis van de immunologie van de huid en atopie is mijns inziens onovertroffen en op al mijn vragen produceerde je la minute een lijstje met referenties om even op te zoeken. Ik heb je bijdrage aan mijn onderzoek als enorm waardevol ervaren en hoop dat we deze samenwerking in de toekomst kunnen voortzetten. Prof.dr. J. Rothuizen, beste Jan: heel graag bedank ik je voor de goede adviezen en inzichten die je met ons gedeeld hebt. Je hebt duidelijk veel ervaring met de verschillende problematiek die aan het onderzoek onderhevig is en je begeleiding daarin op een aantal momenten is voor mij van veel waarde geweest. Jacqueline Sinke: een speciaal woord voor jou. Als student startte ik in jouw onderzoek naar atopische dermatitis bij de hond. Dat heeft toch de basis gelegd voor het verdere verloop van mijn carriere, het heeft me gegrepen. Je hebt enorm genvesteerd in dit project, tegenslagen moeten verwerken en toch, je gaat er weer helemaal voor. Ik bewonder je grenzeloze doorzettingsvermogen, het zal je zeker lukken en ik zal er voor je zijn (meer dan de afgelopen maanden..). Gary Davenport and Stefan Massimino of Procter and Gamble Petcare, your funding made this project possible. During the dietary trial we frequently contacted each other and Stefan and I survived many anxious hours waiting if the samples on dry ice would safely arrive to the States. Thanks for your interest and ever lasting support throughout the whole project. Dr. Louis Penning en Dr. Bart Spee: zoals Bart al memoreerde: Louis je enthousiasme is enorm en dit gaat verder dan tissue repair. Je interesse en betrokkenheid leidden tot een artikel dat we samen publiceerden. je bent nu toch aan het pipetteren, draai die reference genes er ook nog even door, Yvette. Dank voor je bijdrage en alle gesprekken over het onderzoek in het algemeen en andere zaken van belang in het leven. Bart, in mijn beleving zijn qPCR en jij met elkaar verbonden, ontzettend veel dank voor het uitleggen
183

Dankwoord Curriculum vitae Abbreviations

van de techniek en berekeningen daarna (je geduld, steeds opnieuw kwamen de vragen). Tweemaal opnieuw werden we elkaars kamergenoot, ik heb hier goede herinneringen aan. Ilse Bihari: vanaf bijna het allereerste begin was je daar, je hebt me meteen als mijn labmoeder omarmd om me in te wijden in de immunohistochemie. Ik geloof dat ik niemand ken die zo perfectionistisch en georganiseerd werkt als jij. Je hebt bergen en bergen werk verzet, we hebben enorm veel tijd samen doorgebracht. Het is al genoemd, nu komt de tijd om te beginnen aan de verwerking van de immunohistochemische data, daar komen nog wel wat mooie artikelen uit! Ik wil je ontzettend bedanken voor je persoonijke goede zorgen voor mij. In de Graves tijd liet je me nooit gaan voordat ik minstens een of twee stukken fruit had opgegeten. Eveline Veenhof, Eef: gedurende een aantal jaren waren we partners in (skin)crime. Samen hebben we veel moeten investeren om bepaalde technieken lopend te krijgen (of moeten besluiten dat we het niet lopend kregen). We hebben behoorlijk wat moeten incasseren en om die reden was het een enorme steun dat we daarin niet alleen waren, ik heb er heel veel aangehad. We hebben het uiteindelijk toch gehaald, ook voor jou is het einde in zicht (twijfelden we niet wel eens daaraan?). Ik bewonder je doorzettingsvermogen, heel veel succes met de afronding! Frank Riemers: jij hebt een bijzondere plaats verdiend in dit dankwoord. Hoewel ik geen ofcile analytische ondersteuning had, heb je je wel over mij ontfermd in het lab. Vanaf het begin heb je altijd tijd gemaakt om mee te denken n te helpen en technische problemen waar we tegen aan liepen op te lossen. De hele logistiek rond de bergen qPCR metingen die uiteindelijk verricht moesten worden is door jouw begeleiding vlekkeloos verlopen, heel veel dank daarvoor. Het voelt goed om je als co-auteur terug te zien op een aantal artikelen! De afdeling Anaesthesiologie, zonder jullie geen onderzoek, mijn dank aan een paar mensen in het bijzonder: in de eerste plaats Ron van Wandelen: heel simpel, ik weet niet hoe dit project tot een goed einde was gekomen zonder jouw immense hulp rond de logistiek om de honden in het programma in te plannen. Al snel bood je me de gelegenheid mijn honden op een vaste ochtend in te plannen, dit gaf zoveel rust, onzettend veel dank voor je exibiliteit en je betrokkenheid, zowel projectmatig als persoonlijk! Daarnaast natuurlijk Rob Sap, Max Verver, Ies Akkerdaas, Isabelle Janssen, Joost Uilenreef, jullie hebben de meeste
Chapter 10

onderzoekshonden zien langskomen. Heel veel dank voor jullie steun, betrokkenheid bij het onderzoek (welke anaesthesie mag wel en welke niet) en de vele uren gezelligheid die we in de prep doormaakten. Ik vind jullie afdeling (inclusief alle medewerkers die erbij kwamen en ik hierboven niet noemde) een voorbeeld voor de kliniek!

184

Mijn mede-dermatologen Marinus Wisselink, Annette Jassies-van der Lee, Sebastian Schleifer, Sylvia Auxilia: jullie waren verantwoordelijk voor de allereerste belangrijke stap: screening van de honden die mogelijk binnen mijn project pasten. Veel dank voor de eerste motivatie van de eigenaren om hun hond deel te laten nemen aan onderzoek. Dit was essentieel voor het project. Marinus, dank voor je interesse altijd als ik even langswandelde, dank voor je luisterend oor. Annette, ik wens je alle sterkte met je promotietraject, je weet wat je wilt en laat je er niet snel van afbrengen, ik maak me geen zorgen. En ik noem het voorzichtig: ik verheug me op onze (toekomstige) samenwerking, whats in a name, zowel Ton als Yvette, het moest toch zo zijn?. Mede-labgenoten: velen van jullie ben ik veel meer dan dit beperkt dankwoord verschuldigd. Niet alleen door jullie interesse en hulp bij mijn onderzoek, maar tevens door jullie persoonlijke betrokkenheid heb ik me zeer thuisgevoeld op het lab. We hebben nogal wat met elkaar meegemaakt, achteraf ook hilarische momenten. Jeannette, Elpetra, Adri en Monique, ik heb heel veel waardering voor jullie hulp, belangstelling en goede zorgen voor mij toen (en nu nog steeds), cht, binnenkort kom ik langs! Bas, de reference gene king, dank voor je bijdrage aan dit artikel en vele adviezen. Aan alle anderen: bedankt voor de gezelligheid en goede sfeer. Aan een aantal mensen die inmiddels elders werken, Marja, dank voor mijn eerste inwijding in de RNA isolatie uit de huid, Rosalia, thanks for the great time we shared, I admire your exibility in life! Dan mijn waarde kamergenoten: ik heb nogal wat interne verhuizingen meegemaakt, o.a. naar het JDV-gebouw, wat een luxe. Dr. Polona en Dr. Sacha, wij beleefden een memorabele autorit naar het Diakonessen in Utrecht. Polona, your quote during driving my car Yvette, nice car exactly describes your incredible sense of humour and your perfect altijd, veel dank, .. drie uur later schaarde ik me onder de moeders. Dr. Bart, Dr. Linda, geen ander die alles zo onder controle had als jij en zeer verontwaardigd was als anderen daar zelf niet zo nauw mee omgingen...dank voor al je jaren gezelschap en dat ik je paranimf mocht zijn. Dr. Jeanette, wij bleven kamergenoten gedurende de verhuizingen, ik bewonder je om je enorme drive en doorzettingsvermogen die je telkens laat zien, soms dacht ik hoe houd je dit vol. Ik ben heel blij dat we nog steeds kliniekcollegas zijn. Dr. Gaby, ik zag aan jou wat een zuigende kracht het kliniekleven op je kan hebben en hoe complicerend dit was voor het afronden van je proefschrift, het lukte je wel, Dr. Brigitte, jouw struggle in het lab resulteerde in een prachtig proefschrift en uiteindelijk veel meer.... Ineke, weet je nog, rond middernacht samen pipetteren, super dat je hielp! Baukje, Frank, Hille, Gaya, Niklas, Ana, heel veel succes met jullie werk of afronding.
185 Dankwoord Curriculum vitae Abbreviations

ability to put things in perspective in stressy times en Sacha, je hield het zeer levendig, als

Daarnaast, dierbare (ex) collegas: Dr. Lars Slingerland, studiemaatje, jij was ook een beetje een voorbeeld, de aanhouder wint. Dr. Nagesha Rao, (thank you for RNA protocols whenever I wanted to try something new), Dr. Chen-Li Lai and Dr. Jedee, thanks for the nice time we spend in the lab. Aan alle collegas van de kliniek: velen van jullie zijn zo betrokken geweest, veel dank hiervoor. Aan de doctors in wording: nog heel veel succes met de afronding! Het is een eer met jullie allen te mogen samenwerken! Alle collegas van het lab in het UMCU: Dr. Inez, Dr. Machteld, Dr. Els, Marloes, Annemieke, Adrie, Kees (dank dat je altijd tijd nam om oplossingen aan te dragen voor de immunohistochemische techniek!) en alle anderen: door jullie heb ik me heel erg thuisgevoeld op het lab van de dermatologie/allergologie!! En dan last maar zeker niet least naar het leven naast de universiteit: mijn levensmaatjes, Floor, Noor, Merijn, Miriam, Francien en Marit!! Hoewel ik het zeker het afgelopen anderhalf jaar erg liet afweten, was jullie steun onvoorwaardelijk. Ik heb het heel erg getroffen, jullie zijn me allen even dierbaar. Een speciale toevoeging voor Noor: jou hoefde ik nooit iets uit te leggen over onderzoek doen, je bent zelf, op een heel ander vakgebied weliswaar, een gedreven onderzoekster. Het was heerlijk om hierover met je te praten, geweldig dat je mijn mentor was in de statistiek. Dank dat je mijn paranimf wilt zijn. Fien, waar waren wij geweest zonder jou de afgelopen twee jaar! Je bracht ons zoveel rust, je hulp in het huishouden, opvangen van de kinderen en af en toe een professionele Indonesische maaltijd waren onbetaalbaar. Louk en Lea, onze buren en Culemborgse ouders. Ook jullie kan ik niet genoeg bedanken voor al jullie goede zorgen voor ons gezin inclusief huis, tuin en poes. Niets is jullie teveel en ik herinner me de meerdere keren dat ik je belde Lea: ik sta achter een road-blok, met nog 30 autos en ga de creche niet halen... Altijd is je antwoord: meis, maak je niet druk, het komt voor elkaar, je zult het niet met me eens zijn, maar het is niet vanzelfsprekend. Olivier en Vita hebben maar geluk met hun 3e Opa & Oma!
Chapter 10

Frans en Judith, onze kennismaking gaat al heel wat jaartjes terug, naar de studententijd. Juut, jij en Joost huisgenoten, Frans en ik frequente gasten op de Monseigneur. Toen konden wij nog niet vermoeden dat we heel wat jaren later, op niet geheel toevallige wijze, tot bijna buren zouden worden. Wij, en onze jongere afstammelingen, lopen nu regelmatig

186

bij elkaar in en uit. Minder nog konden we vermoeden dat jij ooit de opmaak van mijn toekomstige proefschrift voor je rekening zou nemen, Frans! De laatste weken heb ik gezien: wat voor jou je werk is, is voor mij wizardry, het is schitterend geworden, ik ben je meer dan dankbaar. Jullie hebben mij en mijn project van dichtbij meegemaakt, mij geholpen tot aan de laatste hand die ik eraan legde. Binnenkort borreltje? Mijn schoonfamilie: ook jullie zijn niet weg te denken uit mijn leven, al zovele jaren lang. Fred en Caroline, maar ook Mechtelt en Peter, bedankt voor jullie oneindige ondersteuning tijdens dit project van mij (Fred weet er alles van), ook voor de kindjes. Meerdere malen heb ik jullie vertwijfeld gezien, jullie je zien afvragen of dit wel allemaal kan. Maar we redden het, maak je geen zorgen, echt. Mijn Opa en Oma, Marie en Simon Mey, echte wereldburgers, dank voor alle dierbare herinneringen die ik heb aan de vele en overgetelijke tijd die we bij jullie doorbrachten. Oma, ondanks een respectabele leeftijd en de afstand leef je nog altijd met ons mee. Opa blijft altijd in mijn hart, een charismatisch man van weinig woorden, he lived his life to the fullest. Mijn ouders, KiKi en Wouter, Pap en Mam, jullie spelen een onbeschrijfelijk belangrijke rol in ons leven. Jullie steun en liefde is onvoorwaardelijk geweest, menigmaal kwam jij alleen een maandje over uit Spanje, Mam (welke vader trekt dat), om even ons gezin te runnen, als ik weer eens ondergedompeld was in de kliniek. Dagelijkse gewoonten zijn jullie onbekend (ok, dat wijntje dan aan het eind van de dag), dat maakt jullie tot de meest exibele mensen die ik ken. Doorgaan is jullie motto, zonder dat je dit hardop verkondigt. We raken bijna de tel kwijt van het aantal huizen dat jullie verbouwden (even bewoonden) en verkochten de afgelopen jaren. Ik hoop dat jullie van dit laatste prachtige plekje dat jullie Ik ben supertrots op zulke ouders. Dit proefschrift is niet voor niets aan jullie opgedragen. Mijn zusje, Minke, jij bent mijn steun en toeverlaat, ook al faalde ik ernstig in de communicatie het laatste jaar. Gelukkig ben jijzelf behoorlijk druk met het managen van al die mannen, Norbert (jouw steun en toeverlaat) en de drie musketiers: Siebe, Valentijn en de nog hele kleine Benjamin. Al sinds de middelbare school bracht jij me bij tijd en wijle down to earth: Yv, relax, je leven hangt er niet van af. Die zin heb ik vaak herhaald sindsdien. Toen ook jij besloot te vertrekken naar dat zonnige zuiden met je gezin, gunde ik je die kans heel erg, maar tegelijkertijd miste ik je vreselijk. Ik kan je nu wel vertellen, de dag dat je vertelde dat jullie terugkwamen was een van de betere in de afgelopen jaren! Ik ben heel blij dat je mijn paranimf wilt zijn.
187 Dankwoord Curriculum vitae Abbreviations

realiseerden in het zonnige La Mora wat langer gaan genieten, hebben jullie cht verdiend!

Lieve Olivier en Vita, het boek is af! Jullie werden beiden tijdens het project geboren en mede om die reden nam ik tijdelijk wat gas terug, ik heb genoten van de tijd die ik met jullie had. Hoewel de rollen tijdelijk zijn omgedraaid en dat voor ons allen even wennen was, zie ik nu die drie-eenheid als ik thuiskom en weet: dit zit wel goed. Olivier, bijna geboren op de universiteit en nu een kleine Darwin-in-dop: het liefst op zijn buik in het gras, de neus van een pad bestuderend om die vervolgens na te tekenen; Vita, vol energie, liedjes en verhalen, je gaat dansend door het leven, blijf wie je bent, volg je hart, jullie zijn het mooiste wat mij is gegeven! Joost, mijn allerliefste levensmaatje, dit project wat mij zo in beslag nam, werd om die reden ook deel van jouw leven. Het moet gezegd, het duurde even voor je begreep dat ik deze weg, niet een zonder obstakels, echt moest gaan. Dit heb je me echt gegund en het laatste jaar was je een duizendpoot, mannen die slechts n ding tegelijk kunnen doen, jij hebt het tegendeel meer dan bewezen!. Ondanks een pittig afgelopen jaar was je steun deze laatste maanden onvoorwaardelijk en je bijdrage aan de afronding groot, zo kan ik me geen mooiere omslag bedenken. En nu, is het weer tijd voor ons!

Chapter 10 188

Curriculum vitae Yvette Schlotter werd 28 maart 1971 geboren in Amsterdam. Zij behaalde haar VWO diploma in 1989 aan het Sint Vituscollege in Bussum. Na een aantal jaren aan de universiteit in Wageningen gestudeerd te hebben startte zijn in 1992 met de studie Diergeneeskunde in Utrecht. In 1996 doorliep zij een jaar lang het Excellent Trac programma waarin zij een jaar lang onderzoek heeft gedaan naar de immunologische achtergrond van atopische dermatitis bij de hond. Hier legt zij de basis voor verdere interesse in het onderwerp. In 1997 sluit zij dit onderzoek af met het behalen van het diploma Master of Veterinary Science. De studie Diergeneeskunde werd in 2000 voltooid. In 2001 start Yvette met het onderzoek dat resulteerde in dit proefschrift. In 2008 volgt zij de algemene klinische roulatie in de kliniek bij het Departement van Geneeskunde voor Gezelschapsdieren, waar zij in januari 2009 startte als Specialist in Opleiding. In 2003 en 2005 is zij moeder geworden van Olivier en Vita. Yvette Schlotter was born in Amsterdam on March 28th 1971. After completing secondary school in Bussum (Sint Vituscollege) in 1989 she studied a few years at the Wageningen University. In 1992 she continued to study veterinary medicine at the University of Utrecht, Faculty of Veterinary Medicine. In 1996 she was allowed to participate in the facultys Excellent Track research programme during which period she researched the immunological background of atopic dermatitis in dogs and which became the basis for future interest. In 1997 this research was concluded by obtaining the degree Master of Veterinary Science. She graduated in 2000 and starts further research a year later in 2001, resulting in this thesis. The author followed a Clinical Rotation Internship at the Department of Clinical Sciences of Companion Animals in 2008 en started the Residency in Dermatology in January 2009.In 2003 and 2005 she became mother of Olivier (2003) and Vita (2005).
Dankwoord Curriculum vitae Abbreviations 189

Chapter 10

190

Abbreviations
AA AD ALA APC ASIT cAD CAM CLA COX Df DGLA DHA EFA EPA FA FceRI GLA HLA HSVEC IDEC IFN Ig IL LA LC LOX LS LT mAb Arachidonic acid Atopic dermatitis Alpha-linolenic acid Antigen presenting cells Allergen specic immunotherapy Canine atopic dermatitis Cell adhesion molecules Cutaneous lymphocyteassociated antigen Cyclooxygenase Dermatophagoides farinae Dihomo-gamma-linolenic acid Docosahexaenoic acid Essential fatty acids Eicosapentaenoic acid Fatty acids High afnity receptor for IgE Gamma-linolenic acid Human leukocyte antigen Human saphenous venous endothelial cells Inammatory dendritic epidermal cells Interferon Immunoglobulin Interleukin Linoleic acid Langerhans cells Lipoxygenase Lesional skin Leukotrienes Monoclonal antibody MC MFA mRNA NF-.B NLS PBMC PCR PG PPAR PUFA qPCR RANTES RT SASSAD SC SDA SEM SFA SREBP TARC TEWL TGF Th1 Th2 TNF Treg TSLP Mast cell Monounsaturated fatty acids messenger RNA Nuclear factor-.B Non-lesional skin Peripheral blood mononuclear cells Polymerase chain reaction Prostaglandins Peroxisome proliferatoractivated receptor Polyunsaturated fatty acids quantitative (real-time) PCR Regulated on activation, normal T cell expressed and secreted Room temperature Six area six sign atopic dermatitis Stratum corneum Stearidonic acid Standard error of the mean Saturated fatty acids Sterol regulatory element binding protein Thymus and activationregulated chemokine Trans epidermal water loss Transforming growth factor T helper cell type 1 T helper cell type 2 Tumor necrosis factor Regulatory T cell Thymic stromal lymphopoietin

Dankwoord Curriculum vitae Abbreviations 191