Beruflich Dokumente
Kultur Dokumente
LABORATORY MANUAL
Coordinator: Luc Poitras Technicians: Christian Prudhomme Marc Fredette Jean Kan
Table of Contents Schedule ........................................................................................................................................ iii General information ..................................................................................................................... iv Objectives .................................................................................................................................. iv Organization ............................................................................................................................... v Attendance ................................................................................................................................. v Safety in the Laboratory ............................................................................................................. v WHIMIS ...................................................................................................................................... vi Evaluation ................................................................................................................................. vii Assignments ..................................................................................................................... vii In Lab performance .......................................................................................................... vii Lab Notebook .................................................................................................................. viii In lab teaching ................................................................................................................. viii Laboratory reports .......................................................................................................... viii Exams ................................................................................................................................ ix General introduction for Laboratory class I-IV ............................................................................ 1 Introductory Laboratory Basic techniques and Polymerase Chain Reaction (PCR) amplification .................................... 3 Laboratory Class I Amplification of a target DNA sequence by PCR ..................................................................... 17 Laboratory Class II Ligation of PCR products into a cloning vector ....................................................................... 31 Laboratory Class III Bacterial transformation of the ligation products .................................................................. 47 Laboratory Class IV Screening for recombinant plasmid and DNA sequencing ...................................................... 59 General introduction for Laboratory class V-VIII ........................................................................ 75 Laboratory Class V Protein expression ................................................................................................................... 77 Laboratory Class VI Protein purification .................................................................................................................. 89
i
Laboratory Class VII Western analysis and enzymatic assay (Part I) ..................................................................... 103 Laboratory Class VIII Western analysis and enzymatic assay (Part II) .................................................................... 115 Appendices Appendix SI (Systme International) units and prefixes ............................................................... 121 Appendix A Laboratory notebook .................................................................................................... 122 Appendix B In-Lab teaching .............................................................................................................. 127 Appendix C Laboratory reports ........................................................................................................ 128 Appendix D: Calculations Appendix D1 : Serial dilution ......................................................................................... 130 Appendix D2 : Beer-Lambert Law ................................................................................. 132 Appendix D3 : Percentage of error ............................................................................... 134 Appendix D4 : Insert/vector molar ratio for ligation .................................................... 135 Appendix D5 : Bacterial competency ............................................................................ 136 Appendix E : Techniques Appendix E1 : Agarose gel casting ................................................................................ 137 Appendix E2 : Estimation of length and amount of DNA bands ................................... 138 Appendix E3 : DNA purification by affinity chromatography ....................................... 139 Glossary ................................................................................................................................. 140
ii
LAB
Introduction Lab 1 : PCR amplification Lab 2 : Ligation Lab 3 : Transformation No lab Lab 4 : Screening and DNA sequencing Reading week Practical Exam Lab 5 : Protein expression Lab 6 : Protein purification Lab 7 : Western and enzymatic assay Lab 8 : Western and enzymatic assay Final Exam No Lab
Due dates
First assignment report for section Materials and methods, results and discussion
iii
General information
Web site: Course BCH3356 Molecular Biology Laboratory is on the virtual campus of the University of Ottawa. On this site, you will find this manual, video demonstrations of specific techniques, lab results as well as discussion forums. Lab coordinator: Luc Poitras Office: GNN170A, Tel; 2039 Office/lab hours: Monday to Thursday 13:00 to 17:00 lpoitras@uottawa.ca
Teaching Assistants (TAs): During the course of this lab, you will be supervised by a TA. Each TA will be responsible for eight lab stations corresponding to 16 students. TAs will evaluate your In-lab performance, mark your assignments and your lab reports as well as answer your questions. A list containing the contact information for all TAs will be available on virtual campus.
Objectives:
The Molecular Biology Laboratory (BCH3356) is intended to introduce you to a variety of techniques required to conduct research in the field of molecular biology. During the course of this laboratory, you will first employ these techniques to characterize a mutation that has been introduced into the gene coding sequence of an enzyme. Subsequently, you will express and purify this enzyme with the goal of assessing the effect of this mutation on the enzymes enzymatic activity. Upon completion of this project, you should have gained an understanding of the techniques and skills used in a molecular biology laboratory. In addition, you will learn to write laboratory reports modeled on those present in scientific literature. We can summarize these goals into five specific objectives:
1. To provide you with essential laboratory skills and 'hands on' experience in performing basic molecular biology techniques. 2. To introduce you to the theory behind each technique and to describe common applications of each methodology in molecular biology. 3. To teach you how to explore the scientific literature and to use various bioinformatics web sites. 4. To provide you with experience in scientific communication, in the form of In-lab teaching and laboratory reports. 5. To prepare you for a future career in research.
iv
Course Organization:
1. There will be seven laboratory sections from Monday to Thursday. All laboratory sessions will be held in the afternoon from 11:30 to 17:30 or from 13:00 to 19:00 (See Section schedule on page iii). 2. The first laboratory session (Introduction) will take place on the week of September 12th. During this session you will be grouped in teams of two students (If you do not have a partner, we will help you find one). Your group number will determine the TA who will supervise your lab work. 3. Following the introduction session, there will be eight 6-hour sessions (See Detailed schedule on page iii). 4. Every week, two discussion groups will be held. You can choose to attend one of the two sessions. Thursdays DGD will be held in Tabaret 333 (TBT333) from 8h30 to 10h whereas Fridays DGD will be presented in Montpetit 203 (MNT203) from 14h30 to 16h. Topics covered at the DGD will include: the theory behind the techniques used in the lab, exercises involving common calculations seen in molecular biology and lectures on how to write scientific reports. Attendance at the DGD is highly recommended.
Attendance:
1. Attendance at laboratory sessions is compulsory. If you miss a laboratory session, you need to justify your absence to the course coordinator and provide the necessary documentation. Medical certificates issued by a licensed physician must be provided. For an unjustified absence, a mark of zero (0) will be automatically assigned for the corresponding laboratory session. 2. Absences at two lab sessions or more, even if they are justified, will result in a final grade of Incomplete for the BCH3356 lab. If you have two justified laboratory absences, consult the lab coordinator as soon as possible in order to make up for the missed sessions on a different day.
Wear latex or plastic gloves to protect your skin from exposure to chemicals or infectious materials. (This is normally indicated in the lab manual). Gloves will not be provided by the lab, you will have to buy them. You must remove your gloves and immediately wash your hands before leaving the laboratory and at any time after handling materials known or suspected to be contaminated. You may also have to remove your gloves to handle certain instruments. Gloves should be removed carefully and disposed with other laboratory waste. If you have, or think you are developing, a latex allergy, be sure to inform your TA or a member of the staff. Wear safety glasses for all procedures. Contact lenses should only be worn when other forms of corrective eyewear are not suitable. Contact lenses should not be worn when you are working with volatile solvents. Use a fume hood when working with volatile chemicals. Keep your working space clean and free from clutter. Personal belongings such as books, bags and coats should be left in lockers outside the lab. Familiarize yourself with the location of fire extinguishers, eye wash stations, showers and first aid stations. Dispose of waste in the appropriately labeled containers. If you are not sure, ask first. If an accident or a spill occurs, or if you believe that you have been exposed to hazardous materials, start a washing procedure and inform your TA or a member of the staff immediately.
WHIMIS
Federal legislation such as the Workplace Hazardous Materials Information System ( WHIMIS) requires that all hazardous substances, including microorganisms, be labeled and that a Material Safety Data Sheet (MSDS) accompany each hazardous substance. An MSDS describes hazardous properties, handling and storage precautions, as well as decontamination procedures for a particular substance. Through different computers in the lab, you have online access to the MSDS for all reagents used during a laboratory session (Click on the MSDS Search icon on the desktop window). You can also use the links provided in the lab manual.
vi
Evaluation:
The Molecular Biology laboratory will be marked according to the following scheme:
Your lab TA will be evaluating all components related to the assignments, in-lab performance and teaching. A different TA will be correcting your lab reports. 1. Assignments (10%) Most labs include a section: To be individually handed to your TA when entering the lab. The Introduction lab assignment will be completed during the lab session whereas the remaining 9 assignments are to be completed before entering the following lab. All assignments will be equally weighted. 2. In Lab performance (10%) In Lab performance will be assessed based on technical ability and the quality of your results: 1. Technical ability (5%): Your TA will evaluate your dexterity, precision, work organization and efficiency as well as the proper use of equipment. Also, your TA will evaluate your compliance with the safety guidelines provided by this manual and staff members. You will not be responsible for cleaning glassware: however you will be required to leave a tidy work station. Ice buckets must be emptied and excess reagents disposed as demonstrated by your TA. 2. Quality of results (5%): The quality of your lab results generally reflects the quality of your work in the lab. Therefore, the quality of your lab results will be taken into consideration for the in lab performance assessment. Evaluation of in lab performance should not be considered as a strict marking scheme since a number of marks may get subtracted every time an incorrect action or behavior is noticed.
vii
3. Lab notebook (10%) You are expected to record all your experimental work in a personal lab notebook. Guidelines for the maintenance of your laboratory notebook are listed in Appendix A. Lab notebooks will be initialed by your TA twice at every session. It is your responsibility to ask your TA to initial your notebook (1) immediately upon your arrival and (2) just before your departure from the lab. Your TA will initial your notebook immediately below the very last lane of written information. Notebooks will be assessed by the coordinator at two different occasions during the semester. The first assessment will be done randomly during any of the laboratory classes and a second, more formal assessment will be done at the end of lab 8. These two assessments will be equally weighted (5% each). 4. In lab teaching (10%) During the course of this lab, you will be asked to do two or three presentations. The objective of these teaching presentations is to highlight important experimental aspects of each laboratory and to stimulate discussion among students and TAs. Understanding these aspects will help you better appreciate the molecular principles that underlie molecular biology techniques. At the end of each class section in this manual there is a subsection called, Reading Materials for Teaching Topics. These teaching topics are to be taught during down times by pre-designated groups. The number beside each teaching topics corresponds to the group in charge of preparing and delivering the teaching lesson. In lab teaching sessions are to be prepared and presented in groups (the regular lab groups). Each presentation should fit within a timeslot of 5-10 minutes and you only have access to a chalk and a black board for illustrating information (Power Point slideshows are not possible). Every group will have the opportunity to present 2 or 3 times during the semester. The form that will be used for the evaluation of the teaching sessions is an adapted version of the one used for the Biochemistry Seminar class (BCH4932). In lab teaching marks will be assigned by TAs. All teaching sessions will be equally weighted. 5. Laboratory reports (25%: 2.5 % for each of the two assignment reports and 10% for each of the two formal laboratory reports) The semester is divided in two modules, subcloning and protein purification. You will be required to produce a complete laboratory report (formal report) for each module. Before handing in your first formal laboratory report, you will be required to prepare two short assignment reports (or drafts). The first draft report will be about the <Materials and methods>, <Results>, and <Discussion> sections of the PCR reaction performed in Lab 1. The second draft report will be the <Introduction> of your formal
viii
lab report. The purpose of these two short assignment reports is to provide you with some feedback before you hand in your first formal laboratory report. Each assignment report is worth 2.5%. Full marks will be assigned as long as a satisfactory assignment is submitted. Half marks will be assigned if a draft report receives an unsatisfactory rating. All assignment reports should be prepared according to the guidelines that are provided in A Guide to Writing in the Sciences. This book, which is essential for BCH3356, can be purchased at the University of Ottawa bookstore ( 20$). Additional suggestions on how to organize and write your report are provided in Appendix C. The marking scheme that will be used by the TA in charge of evaluating your report is also provided in the same appendix. All lab reports are to be directly handed in to the lab coordinator at your arrival in the lab at the due dates indicated in the Detailed Schedule on page iii. Late reports will be penalized at the rate of 10% per day. Your report can be prepared and submitted in pairs OR on an individual basis. Laboratory reports will be evaluated by a TA, different then your regular TA, who has been specifically assigned for marking lab reports. In preparing your reports, you will use only your own data. Use of results, calculations or sentences from previous reports or any other non-quoted sources will be considered plagiarism. Any explicit discordance between your report and the recorded data from the lab session will be also considered as evidence of plagiarism. According to the Academic Regulations of the University, section 9B, academic fraud, including plagiarism and falsified data, may result in severe sanctions (see http://www.uottawa.ca/plagiarism.pdf). Any evidence of plagiarism will result in an academic fraud report to the Faculty. 6. Exams (35%) a. In lab practical exam (10%) A practical exam will be administered on an individual basis during the regular laboratory classes scheduled on the week of Oct 31-Nov 3. Every student will prepare a reaction mixture for PCR amplification and assess the products of, one treatment and one negative control, by agarose gel electrophoresis. Analytical skills will also be assessed by written questions to be answered during the downtime of the PCR amplification. For this exam, each laboratory section will be divided in two groups: the team member whose last name comes first alphabetically should attend the first three hours of the laboratory session while the other partner must attend the second half of the laboratory session. Evaluation will be based on the quality of PCR products (5%) and analytical skills to be assessed through your written answers (5%). b. Final exam (25%) The faculty of Science will release a date for a final exam which counts for 25% of your final mark. The final exam will assess your general understanding of
ix
the concepts described in the lab manual and your ability to analyze and interpret experimental results. The content of the final exam will be based on the specific objectives (<Underlying molecular principles> and <Analytical skills>) listed at the beginning of each laboratory class. The questions from the assignments are also representative of what you should expect for the final exam. One full DGD will be dedicated to review the final exam from last year.
OVERVIEW This introductory laboratory quickly reviews some basic laboratory skills that you learned last year in the Introduction to Biochemistry: BCH2333 laboratory component. These skills are crucial for successful experiments in molecular biology. By the end of this introductory laboratory, you should feel comfortable with the hands-on procedures listed in the Learning objectives. At the beginning of this lab, groups of students (2 or 3 if needed) will be formed. However, for this laboratory session, all protocols are to be completed on an individual basis.
LEARNING OBJECTIVES Underlying molecular principles Understand the underlying principles of a PCR amplification Hands-On skills Use a pipettor to transfer micro-volumes Prepare serial dilutions Prepare a suitable microenvironment for an enzyme assay Measure the UV absorbance of a DNA solution to estimate its concentration Amplify DNA using PCR Cast an agarose gel Load DNA samples onto an agarose gel and proceed to electrophoresis Analytical skills Estimate the concentration of a DNA solution based on its absorbance at 260nm Assess the size and amount of DNA fragments visible on an agarose gel picture Estimate PCR amplification yield by comparing the amount of DNA amplified to the amount of DNA template initially added to the reaction mixture
Step 3: Primer extension: This is the DNA synthesis step mediated by a DNA-dependent DNA polymerase. A heat-stable DNA polymerase is required to withstand the denaturing steps carried out at 95-98C. Many commercial DNA polymerases were originally purified from a thermophilic bacterium such as Thermus aquaticus, which lives in hot springs. Optimal extension activity occurs at about 72C. DNA extension can be initiated only at a free 3 end. It is the annealing of primers onto their complementary target sequences that generates the necessary free 3 ends for priming DNA extension. Depending on the pH and salt concentration, the rate of nucleotide incorporation for Taq DNA polymerase at 72C varies from 35 to 100 nucleotides per second, although the extension rate for the Phusion High-Fidelity polymerase used in this lab is significantly higher. Figure 1. Overview of the process of PCR amplification of a target DNA sequence. This schematic describes the first 3 cycles of a PCR reaction. You should notice that by the end of the third cycle only 2 out of the 8 amplified copies have the correct lengths. To better understand how the target fragment gets selectively amplified during the subsequent PCR cycles, make sure to watch this animation on PCR amplification: http://www.dnalc.org/ddnalc /resources/pcr.html.
(http://scienceblogs.com/insolence/upload/2007/06/PCR.jpg)
5
Figure 2. AlphaQuant 1 DNA molecular weight marker (Cell Biosciences). The AlphaQuant 1 molecular weight marker has 14 DNA fragments ranging in size from 200 base pairs (bp) to 10,000 bp. Fixed amounts of each DNA fragment were mixed to produce this ladder. The amount of each DNA fragment is dependent on the volume of ladder that was loaded on your agarose gel. For example, 5 microliters (L) of ladder contains 100 ng of the 10,000 bp DNA fragment whereas 10 L contains 200 ng of the same fragment. It is important to keep in mind that the distance travelled by a DNA fragment is dependent on its length.
2. Transfer 900 L of each dilution into 6 pre-identified 1 mL cuvettes. Prepare an extra cuvette with 900 L of water. 3. Zero the spectrophotometer at 559 nm with water (extra cuvette) and read the absorbance of your samples. 4. Note the R-squared and slope values given by the spectrophotometer. 5. Discuss the absorbance, R-squared and slope values obtained with your TA.
Usually in a PCR experiment, you have a minimum of 3 samples: a positive control, a negative control and the test sample. For todays exercise each student will prepare only 2 control samples (negative and positive) for PCR amplification. In the negative control, water is used instead of the DNA template, and in the positive control, a template will be provided. Keep all your samples on ice until they are transferred into the thermocycler preset to 4C. 1. Prepare two PCR reactions as indicated in the table below. 2. PCR reactions should be setup in labeled PCR tubes (0.2 mL). Each student should use the following format to label their tubes: Group #, + or (positive and negative controls) and the first letter of your family name (e.g. Luc Poitras, Group 14 = 14+P and 14-P). Table 2. PCR reactions setup PCR Components H2O (Brown tube) PCR Buffer (Blue tube) MgCl2 (Purple tube) dNTPs (Green tube) Forward primer (Pink tube) Reverse primer (Yellow tube) DNA template (Clear tube) Taq DNA polymerase See TA Total volume Target Concentration concentration of the stock in reaction sample tube 10X 50 mM 10 mM 10 M 10 M 0.01 ng/L 1X 1.5 mM 0.2 mM 0.2 M 0.2 M 0.1 ng/50L 5 U/50 L Volume per reaction: Positive control 29.5 L 5.0 L 1.5 L 1.0L 1.0L 1.0 L 10.0L 1.0L 50L Volume per reaction: Negative control 39.5L 5.0L 1.5L 1.0L 1.0L 1.0L 1.0 L 50L
10
5. While you wait for your PCR to be completed, you can proceed to Experiment #2. 6. Once the PCR reaction is completed, retrieve your two tubes and proceed to the electrophoresis procedure (Experiment #3).
Experiment #2: Analysis of plasmid DNA by absorbance at 260nm and 280nm, and by agarose gel electrophoresis (to be done during PCR amplification; individual exercise)
You will be provided with an aliquot of plasmid DNA at an unknown concentration. Using a spectrophotometer, you will be required to calculate its concentration and then determine the 260/280 ratio. Once you know the concentration, you will load 50 ng of the plasmid DNA on an agarose gel to validate your calculation. 1. Prepare a 1:50 dilution of the unknown DNA solution in a final volume of 1.0mL. Water should be used for the dilution. 2. Transfer this dilution into a 1.5 mL spectrophotometer cuvette. Prepare a second cuvette with 1mL of water for the blank. 3. Read the absorbance of your DNA dilution at 260nm (Remember that 1 OD260 = 50 g/mL of dsDNA). 4. Once the concentration of the DNA solution has been determined, prepare an aliquot that contains 50 ng of plasmid DNA in a final volume of 10 L. 5. Add 3.5 L of water and 1.5 L of 10X DNA loading buffer. 6. Load your aliquot on a 1% agarose gel.
11
12
13
The <Pick Primers> tool offers two main options. You can submit a request without specifying any forward or reverse primers and, in this case, the server returns a list of optimal pairs of primers that could be used to amplify the gene of interest. Notice that most pairs of primers are designed to amplify only one part of the gene of interest. How many pairs of primers are suggested? Explain why none of those pairs of primers can be used for the subcloning exercise you will complete during the semester? ( /3 Marks) 3. Now proceed to a new request by specifying the forward and reverse primers you will be using in the Lab #1 (see page 21 and 22). This can be done by typing the appropriate DNA sequence in each of the two boxes circled in the figure below. To be successful in this alignment, why should you use only the nucleotides of your primers that are complementary to the DNA template and omit the nucleotides coding for the recognition site of a restriction enzyme? A hard copy of your alignment results should be appended to your answer and handed in to your TA. ( /2 Marks)
14
15
Web references for the materials used in the lab Phusion DNA polymerase: http://www.neb.com/nebecomm/tech_reference/polymerases/phusion_high.asp SYBR safe: http://www.invitrogen.com/sybrsafe AlphaQuant 1 molecular weight marker http://www.cellbiosciences.com/consumables_alphaimager.html
2
16
OVERVIEW The purpose of this course is to make use of recombinant DNA technology to purify an enzyme, T7 RNA polymerase, in sufficient amounts so that its function can be assessed. As a first step, we will employ a PCR-based subcloning strategy to transfer the coding sequence of a T7 RNA polymerase mutant into a destination plasmid vector, the pTrcHisB vector. During this laboratory session, you will be provided with a recombinant plasmid vector containing the coding sequence (cDNA) of one of three T7 RNA polymerase sequences. You wont know until the end of laboratory session #4 which sequences you received. In fact, you will be required to identify which T7 RNA polymerase sequence you received as well as the position of the point mutation where applicable. As a first step in our PCR-based subcloning, we will PCR amplify the coding sequence of your polymerase mutant using primers that were specially designed to ensure proper ligation into the destination plasmid vector. Following this PCR amplification, the resulting amplicon will be purified and assessed by agarose gel electrophoresis to ensure that a product with the appropriate length has been made. LEARNING OBJECTIVES Underlying molecular principles List and explain the different steps involved in PCR Explain the underlying principle for the QIAquick spin column Hands-On skills Amplify a target DNA sequence of interest using PCR Perform agarose gel electrophoresis Perform a BLAST alignment Purify a PCR amplicon using a Wizard SV Gel and PCR Clean-up system Analytical skills Design PCR primers with proper 5 and 3 ends for subcloning at specific restriction site(s) within a destination vector Estimate the size and amount of DNA fragments on an agarose gel by relative comparison to quantitative DNA markers Refer to the picture of an agarose gel to discuss the specificity of PCR amplification Refer to the picture of an agarose gel to estimate the PCR amplification yield (# of copies amplified) Use BLAST alignment to predict the length of PCR amplicons
17
Figure 1. Conversion of an mRNA into cDNA. The first step in the production of a cDNA is the conversion of the messenger RNA (mRNA) into a complementary DNA strand. This is done by using a DNA polymerase called Reverse transcriptase forming the antisense strand (First strand cDNA synthesis). Then, RNaseH is used to remove the mRNA and the second strand of the cDNA is subsequently synthesized by the DNA polymerase I (in combination with specific primers). The newly synthesized strand corresponds to the sense strand. In this representation, ATG corresponds to the start codon (AUG in the mRNA) and the TGA (UGA in the mRNA) represents the stop codon (for simplicity, only one of the three stop codons is shown). The polyadenine tail of the transcript is designated by five adenines.
18
By convention, this sequence reads identical to the coding sequence of the mRNA molecule or the sense strand of your cDNA. Anneals to the antisense (non-coding) strand to initiate elongation of the sense strand from its 5 to 3 ends
Figure 2. Forward and reverse primers. When amplifying a cDNA, the forward primer sequence will anneal near the start codon on the antisense strand of the cDNA (see A and B). Inversely, the reverse primer will anneal near the stop codon region on the sense strand of the cDNA. The 5 to 3 polymerization activity of the Taq DNA polymerase will synthesize a new strand of DNA from the 3 end of each primer (C) generating an antisense strand from the reverse primer and a sense strand from the forward primer.
Once you have selected a region you want to amplify, you need to design your primers by following these basic general rules: Primers usually have a length of 17-28 nucleotides; The primers base composition should be 50-60% (G+C); Primers 3-end should have one or two terminal C or Gs. This allows a firm adhesion of primers 3 terminal nucleotides onto the template; Runs of three or more consecutive Cs or Gs within primers may promote mispriming at GC-rich sequences (because of the stability of annealing); this problem is more common when genomic DNA is used as a template; The 3'-ends of the forward and reverse primers should not be complementary (i.e. they should not be able to anneal to each other) to prevent the formation of primer dimers;
19
Finally, the melting temperature (Tm) of your primers should be optimized for your PCR conditions (see Background section of the Introductory Lab). C. PCR Subcloning Subcloning is a technique used to move a particular gene of interest from a point of origin (parent plasmid vector, genomic DNA, etc) into a suitable destination vector. In this laboratory, you will subclone your PCR product which corresponds to the coding sequence of the T7 RNA polymerase into the XhoI and EcoRI recognition sites of your destination plasmid vector, pTrcHisB (Figure 3 and 4). To successfully achieve this insertion, it is necessary to engineer the PCR primers to include the appropriate restriction site at each of the two ends. Figure 3. pTrcHisB map (Invitrogen). We will be using the pTrcHisB destination vector for the subcloning of the T7 RNA polymerase. Once digested by XhoI and EcoRI, our PCR amplicon will be inserted into a pTrcHisB vector which was previously digested with the same enzymes (boxes). Important features of the vector are also displayed on this map: the Ptrc hybrid promoter, the lac operator and the 6 Histidine tag (6xHis). These features will be further discussed in the second half of the semester. The ATG start codon for the fusion protein is also displayed on the map (dashed line box). Figure 4. Multiple cloning site (MCS) of the pTrcHisB vector. This sequence corresponds to nucleotides 361 to 604 of the pTrcHisB vector. You can easily notice the reading frame dictated by the vector start codon (ATG in bold at position 413). Translation of the MCS is provided below the nucleotide sequence. Restriction sites used in our PCR-based subcloning are XhoI (CTCGAG) and EcoRI (GAATTC) (both sites are shown in boxes).
20
TAT
1
CTCGAG
2 3
ATGAACACGATTAACATCGCTAAG
4
1 : Three extra nucleotides to ensure optimal XhoI activity 2 : XhoI recognition site 3 : One extra G to maintain the reading frame 4 : Coding sequence (open reading frame) of the T7 RNA polymerase. ATG of the T7 RNA polymerase is shown in bold.
21
TAT
GAATTC
TTACGCGAACGCGAAGTCC
1: Three extra nucleotides to ensure optimal EcoRI activity 2: EcoRI recognition site 3: Coding sequence for the 3 end of the T7 RNA polymerase cDNA. This sequence is the reverse complement of the sense strand.
22
H2O (Brown tube) 5X Phusion HF buffer (Blue tube) dNTPs (Green tube) T7RNA.forward (Pink tube) T7RNA.reverse (Yellow tube) Phusion DNA polymerase Total volume
270 L
2. Label 2 PCR tubes (T7 pol and control). You should also add your group number on the lid) and add 90 L of the master mix into each one. Mix your master mix well before transferring it to the PCR tubes. 3. Your TA will supply the DNA template (0.05 ng/L). This aliquot contains a recombinant plasmid vector with the full length sequence for your mutant T7 RNA polymerase to be used as the DNA template for your experimental treatment. Record your mutant template number in your lab notebook. Add 10 L of the aliquot into the appropriate PCR tube (0.5ng of template DNA) and add 10 L of water to your negative control. Keep all your tubes on ice until they are transferred into the thermocycler pre-set to 4C.
23
EXPERIMENT #2: Purification of the T7 RNA polymerase PCR amplicon. In this experiment, we will purify your T7 RNA polymerase amplicon using the Promega Wizard SV Gel and PCR Clean-up System. Purification of your amplicon is necessary because the conditions (pH, salt concentrations, etc.) used for PCR amplification are not necessarily compatible with the conditions to be used for the restriction digest to be performed next week. The process works via binding of DNA to silica at high ionic strength, and release at low ionic strength. Addition of chaotropic salts, such as guanidine, create a salt bridge between the negatively charged phosphate groups of the DNA and the silica column. This figure, taken from the Promega Wizard handbook, represents a schematic of the purification procedure with the Wizard SV Gel and PCR Clean-up System. (a PDF copy of this handbook can be found in the Useful resources folder of the course virtual campus.)
24
17. Load 5 L of each of your 4 samples and reserve one lane for the DNA ladder (5L) near the middle of the gel. To facilitate the identification of samples, please fill the Loading log sheet. 18. Carry out electrophoresis at 100V until the dark blue dye (bromophenol blue) has moved about halfway down the gel. It takes about 40 min to properly separate the DNA bands. Shorter electrophoresis times might result in partial overlapping of DNA markers and inaccurate length estimate of your PCR products. 19. Take a picture of your gel using the AlphaImager mini. All the gel pictures will be posted on the BCH3356 virtual campus so you can retrieve and analyze your results. Ask for a print out of your gel picture to be inserted in your notebook. If your PCR amplification failed, you will be required to prepare another set of PCR reactions before leaving the lab. If this is your case, make sure that your second set of PCR tubes are properly labeled and handed in to your TA before leaving the lab. Your PCR reactions will be amplified overnight and ONE MEMBER OF THE TEAM should be designated to come back to the lab the following morning (9-12AM) to purify and analyze the amplicon by agarose gel electrophoresis. This is necessary to ensure that all students can use their own amplicon for ligation next week. Since only one technician will be present to assist you, book a specific time on the log sheet.
26
Ligation reaction
H2O
(L)
Purified and digested plasmid + purified and digested PCR amplicon
Ligation buffer 5X
Ligase (1U/L)
Total volume
(L)
(L)
(L)
40
28
29
Phusion DNA polymerase: http://www.neb.com/nebecomm/tech_reference/polymerases/phusion_high.asp Promega Wizard SV Gel and PCR Clean-up System: http://www.promega.com/resources/protocols/technical-bulletins/101/wizard-sv-gel-and-pcrcleanup-system-protocol/
30
OVERVIEW The primers used last week to amplify the insert coding for T7 RNA polymerase had been engineered with a recognition sequence at their 5 ends. This week, youll use the appropriate restriction enzymes, XhoI and EcoRI, to digest your amplicon as well as the destination plasmid vector, pTrcHisB. These enzymes will generate compatible sticky ends necessary for the insertion of T7 RNA polymerase insert into the pTrcHisB vector to form a recombinant plasmid, pTrcHisB/T7. The last step will be to seal the nicks by forming phosphodiester bonds using T4 DNA ligase
LEARNING OBJECTIVES Underlying molecular principles Discuss the functional organization of the different components of the cloning vector to be used for ligation, pTrcHisB Explain the procedure for preparing recombinant DNA plasmids Explain the difference between directional and non-directional cloning and discuss the benefits and limitations of each strategy
Hands-On Skills Digest plasmid and a PCR product with restriction enzymes Purify restriction digests using the Wizard SV Gel and PCR Clean-up system Quantify DNA by agarose gel electrophoresis Ligate DNA fragments using T4 ligase
Analytical Skills Design or engineer PCR primers for subcloning Estimate the size and amount of DNA bands on an agarose gel by comparison with quantitative DNA markers Estimate the recovery yield for the purification of digests with the Wizard SV Gel and PCR Clean-up system
31
32
C. Ligation Principle Double-stranded DNA fragments with compatible cohesive termini or blunt ends can be covalently joined (ligated) in an ATP-dependent reaction that involves the formation of phosphodiester bonds between 5'-phosphate residues and 3'-hydroxyl residues. A common enzyme used in molecular biology laboratories for the ligation of DNA fragments (for example, the insertion of a DNA fragment into a linearized plasmid vector) is T4 DNA ligase (Figure 3). In ligation reactions, the optimal ratio of vector to insert DNA depends on the vector (lambda,
33
It is important to note that the ligation process can proceed without the 5 phosphate on one of the DNA strands (Figure 3, DNA-2). Thus we can artificially block ligation by removing the 5 phosphate of thic DNA strand. This dephosphorylation can be achieved using an enzyme called Alkaline Phosphatase. This enzyme can hydrolyze monoester bonds but not diester bonds (Figure 4). Dephosphorylation is often used in non-directional ligation strategies since it can prevent can self-ligation of the plasmid vectors digested with only one enzyme (See the next section on Ligation strategies). Figure 4. Dephosphorylation of DNA ends. Alkaline phosphatase hydrolyzes the monoester bond between the 5phosphate and the oxygen atom at the end of a DNA fragment.
D. Ligation Strategies There are two basic strategies for ligating DNA fragments into plasmid vectors depending on the kind of termini in the insert and vector:
34
35
b) Non-directional ligation: Non-directional ligation occurs when only one enzyme is used to produce either blunt or protruding ends (Figure 5). This strategy can result in the formation of undesirable, recircularized plasmid molecules without any insert. As mentioned before, alkaline phosphatase should be used to avoid recircularization of the vector when non-directional ligation is performed. Figure 5 Non-directional ligation. In this example, only one restriction enzyme was used to digest the vector and the insert (XhoI). Following ligation, three molecules could potentially be found: a recombinant molecule in which the insert was inserted in the wrong orientation (bottom left), a recombinant molecule in which the insert was inserted in the right orientation (bottom center) and a recircularized vector (bottom right).This semester, we will be subcloning the coding sequence of the T7 RNA polymerase in a specific orientation to match the reading frame of the pTrcHisB vector and therefore, it will be a directional ligation.
36
These controls are ONLY for the ligation portion of the experiment (that will verify that your ligase enzyme is functioning properly, and that your restriction enzymes cut appropriately). These controls are in ADDITION to the controls that will be included for the bacterial transformation portion of the lab next week.
37
EcoRI
[10units/L]
(10 units) 1 L 1 L
(10 units) 1 L 1 L
T7 Amplicon pTrcHisB (2 g)
2. Digest your two samples for 2 hour at 37C. 3. While waiting for your digests, prepare the agarose gel you will require at step 8 (4-5 groups can share one gel). 4. At the end of the 2 hour incubation, add 2 L (1 U/L) of Shrimp Alkaline Phosphatase (SAP) to the vector digestion sample and put it back in the water bath for 30 min. Under normal circumstances, you shouldnt have to dephosphorylate your vector since you are using two different enzymes. This step was added to ensure that vector re-ligation cannot occur and to help avoid false positives in later labs. During the dephosphorylation procedure keep the T7 amplicon digestion in the 37C water bath.
38
9. Prepare your DNA aliquots to be electrophoresed as follows: 1) 9 L of undigested pTrcHisB vector from step 1 + 1 L of 10X loading buffer 2) 2.5 L of purified digested pTrcHisB vector + 6.5 L of H2O + 1 L of 10X loading buffer. 3) 2.5 L of purified digested T7 amplicon + 6.5 L of H2O + 1 L of 10X loading buffer. 10. Proceed with electrophoresis at 100 V for about 40 min and take a picture of your gel using the AlphaImager mini. Request a print out of your gel picture to be inserted into your laboratory notebook.
39
Ligation buffer 5X
T4 DNA ligase
Total volume
(L)
(L)
(L)
Digested and purified T7 amplicon and pTrcHisB Digested and purified pTrcHisB alone. pTrcHisB digested with XhoI only.
40
40
21
40
You will be provided with an aliquot of pTrcHisB that had already been digested with XhoI (20 ng/L) 13. Incubate the ligations overnight in a thermocycler pre-set to 16C. Tomorrow the Technical Staff will store your samples at -70C. Next week, you will require these ligation products for the transformation protocol. All ligation tubes should be clearly labeled with your group number and the treatment number (Gr2-I, Gr2-ii, Gr2-iii).
40
14. Before leaving the lab, give the leftovers of your pTrcHisB and amplicon samples to your TA.
41
Treatment Transformation
I II VI
pTrcHisB + T7 Insert pTrcHisB without any insert DNA (negative control for ligation) Positive transformation treatment with undigested pTrcHisB (1 ng)
43
Groups 5, 13 and 21: Plasmid conformations and mobility on agarose gel vs oxidative stress: http://www3.interscience.wiley.com/cgi-bin/fulltext/113449269/PDFSTART a) How could you assess if a plasmid was completely digested by a restriction enzyme or not by exclusively considering the results from agarose gel electrophoresis? b) Could you estimate the size of a supercoiled plasmid using the Alphaquant1 DNA ladder? Groups 6, 14 and 22: T4 DNA ligase a) What are the different possible controls for a ligation treatment? b) Discuss the difficulties sometimes encountered when DNA ligation is completed with T4 DNA ligase. Groups 7, 15 and 23: A Guide to Writing in the Sciences (pp. 10-11 and 23-26) a) Introduction versus abstract Groups 8, 16 and 24: A Guide to Writing in the Sciences, References (pp. 26-30 and 33-35) a) When should a reference be included? b) Plagiarism versus referencing
44
Web references for the materials used in the lab EcoRI: http://www.neb.com/nebecomm/products/productr0101.asp XhoI: http://www.neb.com/nebecomm/products/productr0146.asp Shrimp Alkaline Phosphatase or SAP http://www.fermentas.com/en/products/all/modifying-enzymes/phosphatases-kinase/ef051shrimp-ap T4 DNA ligase http://tools.invitrogen.com/content/sfs/manuals/t4dnaligase_1U_man.pdf
45
OVERVIEW Last week, your T7 RNA polymerase PCR amplicon was ligated into the pTrcHisB vector at the XhoI and EcoRI restriction sites. In this laboratory, you will recuperate your ligation products and use them to transform competent E coli cells. You will then plate your transformation mixtures on agar plates containing the ampicillin antibiotic, and only the successfully transformed cells having integrated an intact copy of pTrcHisB or pTrcHisB/T7 will survive and grow. Next week, you will count the transformant colonies and analyze some of the colonies to confirm the presence of the expected recombinant plasmid, pTrcHisB/T7. LEARNING OBJECTIVES Underlying molecular principles Explain the concept of cell competence and the procedure for making cells competent List and explain the genetic features of the DH5 cell line that justify its common use for subcloning
Hands-On Skills Prepare competent E. coli cells Transform competent cells Cast agar plates Inoculate agar plates with bacterial suspensions under sterile conditions
Analytical Skills No results to be generated this week (colonies will only be counted next week)
47
To enhance the efficacy with which bacterial cells take up DNA and become transformed, bacteria are made competent. E. coli is normally made competent for uptake of exogenous DNA in the laboratory by artificial means that usually involve chemical treatments. The importance of divalent cations, especially Ca2+, for inducing competence is well established; the transformation efficiency of E. coli DH5, for instance, is nearly 106 transformants per g of plasmid DNA in presence of 50 mM Ca2+ compared to less than 10 transformants per g of plasmid DNA without Ca2+ (J Bacteriol 1995, 177:486). The mechanism by which the negatively charged DNA gets transported across the plasma membrane involves the formation of transitory coordination complexes between lipopolysaccharides, Ca2+, and the phosphate groups within the plasmid DNA backbone (Biomacromol 2008, 9:2501). Step 4 displays screening of transformant cells using a selective medium. In the lab, you will use an agar plate with ampicillin to screen for successfully transformed cells containing pTrcHisB, as this vector has a gene coding for resistance to ampicillin.
48
C. Sterile Conditions Sterile conditions refer to laboratory practices to avoid exposing preparations to bacteria, mold, and other contaminants. Sterile conditions are important in this experiment to prevent contamination of your LB agar plates. At the ampicillin concentration found in agar (200 g/mL), most microorganisms will not survive (bactericidal effect), although the growth of many others will only be retarded (bacteriostatic effect) and some microorganisms will not be affected at all. If contaminants are transferred onto the agar plates during inoculation, ideally only the transformant cells will be able to actively grow. But after a couple of days, the ampicillin concentration remaining in agar will be lowered due to degradation (The half life of ampicillin is approximately 2-5 days) or metabolism by transformant cells, and the bacteriostatic effect is lessened. This explains why initially `clean` agar plates might become contaminated after a couple of days. For the purpose of this lab, maintenance of sterile conditions is imperative as your plates will be kept in the lab for one week you will only return to the lab by next week for counting colonies and proceeding to the inoculation of some liquid cultures (see lab 4). The following general guidelines will help you maintain a sterile environment:
49
D. Why are we using the DH5 E. coli Cells? The DH5 cell line has been designed for routine cloning applications. Some features contributing to the stability of the DH5cell line and making it suitable for cloning purposes are: F- : Does not carry the F+ plasmid for conjugation. An important step in ensuring biosafety since it prevents accidental dissemination of plasmids.
50
E. Important Considerations: TRANSFORMATION CONTROLS Controls should be included to assess the efficacy of the experimental procedure when transforming competent cells. The specific controls you will be doing in the lab this week are: Positive transformation control: Competent E. coli cells will be transformed with the undigested pTrcHisB that contains the resistance gene to ampicillin, Amp r. This control will allow you to calculate the transformation efficiency. It is the efficiency with which competent cells can take up exogenous DNA and survive the antibiotic selection process. Transformation efficiency is always represented as the number of transformants or colony forming units (cfu) per microgram of DNA used for the transformation (See Appendix D5) Negative transformation control: Competent cells will be incubated without any plasmid DNA. This treatment is to assess for background resistance of the competent DH5 cells to ampicillin without any plasmid DNA.
Notice that these controls, which verify competence and absence of background ampicillin resistance of bacteria, strictly refer to the transformation portion of the experiment. These transformation controls are in ADDITION to the controls that were included in the ligation portion of the experiment
51
Part A: Preparation of Competent Bacteria Yesterday, 2 mL of Luria Bertani (LB) liquid broth without ampicillin was inoculated with a colony of DH5 cells by the Technical Staff, and this inoculated broth was incubated overnight at 37C on a rotary shaker (225 cycles/min). At their arrival in the lab this morning, the Technical Staff members transferred 1 mL of this overnight LB liquid culture, which had reached the stationary phase by then, into a flask containing 100 mL of fresh LB medium without ampicillin. The flask was then kept under vigorous agitation at 37C until an optical density at 600nm of ~0.25-0.30 was reached (about 2 hours). It is important to note that this optical density was chosen due to time constraints (an optimal optical density would be around 0.6). At your arrival in the laboratory, you will be provided with 10 mL of this liquid culture. 1. Pour 10 mL of the DH5 liquid culture into a centrifuge tube and immediately chill the tube on ice for 15 min. Also ensure that the two working solutions of 0.1M CaCl2 s and 0.1M CaCl2 plus 15% glycerol are on ice. 2. Centrifuge the cells for 10 min at 3,300g and 4C. 3. Discard the medium and gently resuspend the pellet of cells in 5 mL of cold 0.1M CaCl2 (DO NOT VORTEX). E. coli cells treated with CaCl2 have very weak cell walls. They will easily lyse and die if vortexed or handled roughly. This will result in your transformation failing due to insufficient competent cells. 4. Keep the cells on ice for 30 min. 5. Centrifuge the cells for 10 min at 3300g and 4C. 6. Remove the supernatant and gently resuspend the cell pellet in 1.0 mL 0.1 M CaCl2 solution containing 15% glycerol. (DO NOT VORTEX) 7. Your cell preparation is now ready for transformation. Keep your tubes on ice until you are ready to proceed with the transformation.
52
II
100
40
III
100
40
IV
100
100
40
VI
100
40
10. Incubate on ice for 30 min. 11. Transfer the tubes to a rack placed in a water bath preheated to 42C and incubate for exactly 1 min. Do not shake the tubes. 12. Transfer the tubes to ice and allow the cells to chill for 2 min.
53
54
55
Groups 1, 9 and 17: Writing A Guide to Writing in the Sciences, Scientific writing style (pp. 8090) Groups 2, 10 and 18: Bacterial transformation: Plasmid DNA binding onto E. coli cell surface (Biomacromolecules 2008, 9:2501) a) Several molecular techniques and details are covered in this article, but you dont need to cover all of them. Simply emphasize the underlying molecular principle for DNA binding onto the cell surface. Groups 3, 11 and 19: Chemical transformation versus electroporation of E. coli. (See reference 4 to 6) a) Explain to your colleagues the principle of chemical transformation and electroporation of E. coli. b) Discuss the advantages and disadvantages of both transformation methods. Make sure to talk about the transformation efficiency. Groups 4, 12 and 20: Bacterial transformation: Role of membrane potential (J Biotechnol 2006, 127:14). a) Explain how membrane potential varies throughout the transformation protocol.
56
Web references for the materials used in the lab DH5 http://tools.invitrogen.com/content/sfs/manuals/subcloningefficiencydh5alpha_man.pdf
57
OVERVIEW This week, we will finalize the sub-cloning procedure of the T7 insertion in pTrcHisB. You will first inoculate and screen five transformant colonies to confirm the presence of the T7 insert into the pTrcHisB/T7 plasmid. You should obtain at least one positive transformant colony out of your five inoculates. You will then sequence the T7 insert from your positive clone to identify the point mutation that had been introduced in the coding sequence of the mutant you received at the beginning of the semester. The positive transformant cell line you will identify this week, i.e., the one for which the expected insert will be confirmed, will be put aside and used for the second part of the course that will relate with the expression, purification and functional assessment of your T7 RNA polymerase mutant. LEARNING OBJECTIVES Underlying molecular principles Identify and explain the main procedural steps for the (mini)preparation of plasmid DNA by alkaline lysis. Identify and explain the main procedural steps for DNA sequencing
Hands-On Skills Inoculate a liquid culture with a transformant colony Isolate plasmid DNA (miniprep) Digest recombinant plasmid DNA to screen for a given DNA insert Sequence DNA Cryopreserve a cell culture in glycerol-supplemented liquid medium
Analytical Skills Analyze and discuss transformation results Discuss the efficacy of ligation based on the number of colonies obtained for the different treatments Estimate the transformation yield in # colonies/g plasmid DNA Select appropriate restriction enzymes to screen for the presence of a DNA insert in recombinant plasmids Use Nebcutter to simulate restriction digests and predict the size of the expected DNA fragments Use nucleotide BLAST to analyze DNA sequencing results Assemble the individual sequencing results to reconstruct the whole sequence of your DNA insert coding for T7 RNA polymerase
59
60
61
62
This animation: http://www.wellcome.ac.uk/Education-resources/Teaching-and-education /Animations/DNA/WTDV026689.htm provides a good resume of the Sanger sequencing method.
63
II
100
40
III
100
40
IV
100
100
40
VIa
100
40
VIb
100
40
2. You need five polystyrene snap cap tubes (17mm X 100mm) each containing 5 mL of LB broth with 100 g/mL ampicillin.
64
65
Part C: Analysis of the Minipreparations by Restriction Digest and Cryopreservation of One Positive Clone 18. Prepare a Master mix to digest your five minipreps knowing that you will digest 3 L of each minipreps in a final volume of 20 L (do not forget to add 1 more reaction to the master mix to create a buffer zone so you dont run short of your master mix) Components Volume per reaction (L) 13 2 1 1 171 Volume of the master mix (6 reactions) (L) 78 12 6 6 1022
H2O 10X Buffer H EcoRI (10 Units/L) XhoI (10 Units/L Total volume
1 2
Three microliters of plasmid DNA will be added for a final digestion volume of 20 L. To verify that your calculation were done properly, you can divide the total volume of Master mix by the number of reactions and you should get the total volume of one reaction (102L/6 reactions=17L)
26. Retrieve the miniprep corresponding to your positive transformant and purify it using the Wizard PCR clean-up system as explained in Appendix E3 with one important modification. You should use 35 L of water for the final elution volume instead of 50 L (see step 8 in Appendix E3). This modification will help ensure that the final concentration of the purified plasmid DNA is enough to meet the minimum concentration requirement for DNA sequencing. The procedure for DNA sequencing is relatively straightforward, but very sensitive. The amount of DNA template is critical: either a too low or a too high concentration of DNA can significantly reduce the number of nucleotides that can be read or sequenced. To ensure a good estimate of the DNA concentration of your purified miniprep product to be sequenced, an aliquot will be electrophoresed along with a quantitative DNA ladder (AlphaQuant1). Your miniprep DNA could also be quantified by reading the absorbance at 260nm, but that approach would require too much of your purified 35 L sample. 27. Combine 2 L of your purified plasmid to be sequenced with 7 L of water and 1 L of the 10X loading buffer in a microcentrifuge tube. Mix, and then load the whole volume on a 1% agarose gel. Electrophorese at 100V for about 40 min. 28. Take a picture of your gel and accurately estimate the concentration of your purified recombinant plasmid DNA. The minimal concentration required for proceeding to DNA sequencing is 100 ng/L. If your concentration is below that minimum threshold, you will have to borrow the sequencing results of another group having worked with the same mutant number. DNA sequencing will be performed at the McGill and Genome Quebec Innovation Centre in Montreal. Samples are to be labeled as Day_lab#_Group#_Mutant#_Primer (e.g. Monday_202_Gr8_M2_SeqF1). You will be asked to enter your sample names in an electronic file to be directly sent to the sequencing centre along with your samples. The sample names you enter will be the ones used when the sequencing results are posted.
68
69
70
71
Groups 5, 13 and 21: Specificity of the DNA sequencer, Applied Biosystems model 3730. This is the sequencer model to be used at McGill for sequencing your DNA. Groups 6, 14 and 22: Explain how Illumina sequencing works: https://www.uppnex.uu.se/uppnex-book/technologies/solexa-sequencing http://www.wellcome.ac.uk/Education-resources/Teaching-andeducation/Animations/DNA/WTX056051.htm Groups 7, 15 and 23: BLAST tutorials: http://www.digitalworldbiology.com/BLAST/index.html Groups 8, 16 and 24: Interpretation of sequencing chromatogram: http://seqcore.brcf.med.umich.edu/doc/dnaseq/interpret.html
72
Web references for the materials used in the lab Big Dyes: http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocume nts/cms_040741.pdf Nanuq server: https://genomequebec.mcgill.ca/nanuq
73
General Introduction for Lab V-VIII 2011 General Introduction for Laboratory V-VIII
Gene expression is the process by which information from a gene is used to guide the synthesis of a functional protein product. There are several steps in the gene expression process, including transcription, translation and some post-translational modifications. The second part of the semester involves a series of experiments to be performed with your transformant DH5 clone containing the recombinant plasmid vector with containing your T7 RNA polymerase insert, pTrcHisB/T7. You will first use your positive transformant cell line selected in laboratory class 4 to inoculate a liquid culture and induce the expression of the T7 RNA polymerase protein. Notice that your expressed protein constitutes a fusion, or chimeric, protein because the His tag has been merged to the N-terminal end of T7 RNA polymerase. Upon completion of the induction protocol, the cells will be harvested and lysed to prepare a total protein extract. Your fusion protein will be further purified using a His tag affinity chromatography column. Your fusion protein containing a His tag will be selectively retained within the column, and all other peptides will be eluted and collected in the flowthrough fraction. Once eluted from the affinity column, your T7 RNA polymerase fusion protein will be analyzed by SDS-PAGE and Western analysis. For your western analysis, you will be using an antibody that has been specifically raised against the His tag. SDS-PAGE experiments will assess the presence as well as the length of your fusion protein whereas Western analysis will confirm that the purified protein contains the His-tag. Finally, you will evaluate the enzymatic activity of your mutant fusion T7 RNA polymerase. This will be achieved by comparing RNA transcription assays using your mutant T7 RNA polymerase in parallel with assays using a wild type T7 RNA polymerase.
75
OVERVIEW This week, you will be performing the first step in the expression of your fusion T7 RNA polymerase. Induction of the fusion proteins expression will be achieved using genetic components of the lac operon which are present in the pTrcHisB/T7 construct in combination with an analog of allolactose (IPTG). Notice that your expressed protein constitutes a fusion or chimeric protein because the His tag had been merged at the N-terminal end of T7 RNA polymerase. Upon completion of the induction protocol, the cells will be harvested and lysed to prepare a crude bacterial protein extract. Your fusion protein will be further purified next week by His tag affinity chromatography. LEARNING OBJECTIVES Underlying molecular principles Explain the genetic components of the lac operon regulating the IPTG-inducible expression of T7 RNA polymerase in the TrcHisB/T7 and DH5 system
Hands-On Skills Inoculate and grow a transformant DH5 cell line Assess the cell growth phase by absorbance at 600nm Induce protein expression by adding IPTG Harvest cells from a liquid culture Prepare one buffer solution to be used in laboratory class 6
77
Figure 1. lac operon. (A) Structure of the lac operon: promoter of lacI (p in white box) and of the operon (p in gray box), repressor (i), operator (o) and the genes (z, y and a). (B) In absence of lactose, the lacI repressor (i), which is constitutively expressed, binds to the lac operator (o) and thus prevents the transcription of the z, y and a genes by the lac promoter (p). (C) When lactose is present in the cell, it is metabolized into allolactose (inducer). This metabolite acts as an inducer by binding to the repressor lacI and consequently, reducing the affinity of this repressor for the operator element. The derepression of the lac operon leads to the transcription of the three lac genes. This figure was taken from Biochemistry, 6th Edition.
78
Lactose
OH O H OH
Allolactose
-galactosidase
HO H OH H
O H H H OH H OH O H
B)
Isopropyl--D-thio-galactoside (IPTG)
OH HO H OH H H OH H H O S CH3 CH3
Figure 2. (A) Conversion of lactose into allolactose by the -galactosidase. (B) Molecular structure of the Isopropyl--thio-galactoside (IPTG).
79
Figure 3. Induction mechanism of the pTrcHisB plasmid vector. The lacI gene is present on the pTrcHisB plasmid vector. This gene is constitutively expressed and translated (step 1 and 2). (A) In absence of inducer, the lacI repressor binds to the lac operator which is located just after the Ptrc promoter (step 3). This binding leads to the repression of the transcription (step 4). (B) In presence of an inducer (IPTG), the lacI repressor binds to the inducer and therefore, is removed from the lac operator (step 3). Transcription via the Ptrc promoter can now proceed (step 4).
80
81
82
2.
You can now prepare the solution that was assigned to your group and that will be used for the His tag affinity chromatography next week. 3. After 2 hr of growth, check the A600 of your cell culture. This can be done by swirling the flask gently to homogenize the contents of the flask, tilting the flask to fill the sidearm with some liquid broth, and then inserting the sidearm into the aperture of the spectrophotometer to read the absorbance at 600nm. If the absorbance is below 0.25, return your flask in the incubator for another 30 min before verifying the absorbance again.
Culture flask with a sidearm A reference aliquot (before induction) is to be put aside before proceeding to induction with IPTG. This initial aliquot is to be compared with a second aliquot to be sampled at the end of the induction with IPTG (after induction; see steps 6 and 8). 4. Transfer 1mL of the culture into a 1.5 mL microfuge tube. This non induced aliquot (before induction control) is to be used to prepare a total protein extract at Step 8. The groups that are responsible for the collective controls should also take a sample at this step. Figure out the volume of a 100 mM IPTG stock that should add to your culture to obtain a final concentration of 1 mM. Add the IPTG to the flask and put it back in the shaking incubator at 37C for 2 hours. Transfer 1 mL of the culture into a 1.5 mL microfuge tube. This IPTG-induced aliquot (after induction control) is to be used to prepare of a total protein extract
83
5.
6.
Next week, only your IPTG-induced cell pellet will be used for the purification of your His-tagged T7 RNA polymerase by His tag affinity chromatography. The other two 1 mL aliquots put aside at steps 4 and 6 are to be kept for SDS-PAGE analysis to be done in lab 6. 8. Recuperate the two 1 mL aliquots put aside at Steps 4 and 6, and centrifuge them for 1 min at 13,000 rpm. Discard the supernatants and resuspend each cell pellet in 25 L of distilled water, which is a strong hypotonic environment triggering cell bursting and release of cytosolic proteins. Add 25 L of 2X Loading Buffer to each of your two tubes. These two aliquots are to be stored; you will recuperate those aliquots for SDS-PAGE analysis to be done in lab 6.
The extra two series of controls prepared by pre-designated groups should be similarly mixed with the 2X loading buffer and returned to the TA. Those controls are to be assessed by SDS-PAGE next week, lab 6.
84
85
Groups 1, 9 and 17: Choice of host and vector for protein amplification, page 8 and 9 from: http://130.15.90.245/methods/handbooks%20and%20manuals/the%20recombinant%20protei n%20handbook.pdf Groups 2, 10 and 18: GST gene fusion system, describe this other system of recombinant protein production, page 2 to 6 from: https://homes.bio.psu.edu/people/faculty/lai/lab/protocols/GST%20Gene%20Fusion%20Syste m.pdf Groups 3, 11 and 19: Production of recombinant protein in vitro: http://www.ambion.com/techlib/basics/translation/index.html Groups 4, 12 and 20: How to optimize your recombinant protein yield: Summarize these four sections from the web site below: 1) Optimization of expression levels 2) Improving protein solubility 3) improving protein stability and 4) Decreasing protein toxicity. http://www.embl.de/pepcore/pepcore_services/protein_expression/ecoli/index.html
86
87
OVERVIEW At the end of last week lab, bacterial cells were harvested by centrifugation. This week, you will proceed to the purification of the T7 RNA polymerase by Immobilized Metal ion Affinity Chromatography or IMAC. You will have to quantify your purified recombinant protein by UV absorbance. Finally, you will perform a SDS-PAGE analysis of the IPTG induction controls (harvested during Lab session #5). LEARNING OBJECTIVES Underlying molecular principles Explain the underlying principle for immobilized metal ion affinity chromatography (IMAC) used to purify recombinant proteins with a His tag
Hands-On Skills Lyse cells and prepare a crude protein extract Use IMAC to purify your recombinant his-tagged T7 RNA polymerase Quantitate proteins by UV absorbance Perform SDS-PAGE
Analytical Skills Plan the procedure for the purification of your his-tagged T7 RNA polymerase by affinity chromatography; establish a list of important samples to be kept for further quantitation and SDS-PAGE analysis Discuss the efficacy of the His tag affinity chromatography based on your own set of experimental results Discuss the information that can be derived from the analysis of different controls for the IPTG-inducible protein expression
89
90
Figure 1. Immobilized Metal ion Affinity chromatography.(A) A nickel ion (Ni2+) is held in place by a molecule of iminodiacetic acid, also called IDA (HN(CH2CO2H)2), which is covalently attached to an agarose bead (gray box). The Ni2+ ion is at the center of a coordination bond formed by the nitrogen and the two carboxyl oxygens of the IDA molecule, as well as three molecules of water. (B) When recombinant His-tagged proteins are added to this column, nitrogen from the imidazole ring of the histidines will replace the three molecules of water in the coordination bond. (C) An excess of imidazole is added to the column to eluate the recombinant proteins. B- PAGE (Polyacrylamide Gel Electrophoresis) When an electric potential difference is applied to two electrodes immersed in a solution of substances whose molecules bear an electric charge, the electrostatic attraction causes movement of the charged particles towards the electrode of opposite charge. This phenomenon is called electrophoresis and may lead to discharge at the electrode, electrolysis, if the particle reaches it at the appropriate potential. The sample is usually applied to a porous solid support, such as a gel, wetted with the appropriate buffer. The porous support not only decreases diffusion but it also provides a molecular sieving effect. For proteins separation, the most common support is a gel of polyacrylamide poured between 2 glass plates forming a very thin vertical slab (Figure 2). The rate of electrophoretic migration of a protein is a function of the voltage gradient, the pore size of the support matrix and the charge and "size" of the protein; the latter parameter combines both molecular weight and conformational effects (6-8). The overall size of a protein molecule is determined by the folding of the protein and by the presence of intra- or intermolecular disulphide bridges. These bridges can hold the folded molecule together or form polymers of protein molecules by linking different molecules together. To be able to distinguish between these folding and bridging effects, the sample can be treated to insure that all molecules have the same conformation, thereby making migration solely dependent upon molecular weight and electrical conditions. This treatment involves dissolving the sample in a buffer containing 1-2% sodium dodecyl sulfate (SDS, a detergent) and 0.5-1.0 M mercaptoethanol (SHCH2CH2OH). Mercaptoethanol reduces -S-S- cross-linked polymers to monomers and SDS binds to all proteins at a high ratio (1.4 g SDS/ g protein) and also unfolds
91
In order to determine the molecular weight of a protein on a SDS-PAGE gel, we need to have a reference marker. In this lab, you will be using a molecular weight marker called, RainbowTM ladder. This ladder is a mixture of individually colored and purified proteins of known molecular weights (Figure 3).
Figure 3. Rainbow colored protein molecular weight marker separated by SDS-PAGE (Full range). Molecular weight is expressed in kiloDaltons (e.g. 225 = 225 kDa or 225,000 Da) For a recommended loading volume of 5 L, the different marker bands add up to a total of 7.5 g. Figure from GE Healthcare.
92
93
7.
Purification of His-Tagged Proteins 8. After the Binding Buffer has drained, load column with prepared cell extract (10 mL). Take a 1.5 mL aliquot of this 10 mL solution after it has gone through the column (Flowthrough control). Wash column with 12.5 ml 1X Binding Buffer. Take a 1.5 mL aliquot of this 12.5 mL solution after it has gone through the column (Wash 1 control).
9.
10. Wash column with 7.5 ml 1X Wash Buffer. Take a 1.5 mL aliquot of this 7.5 mL solution after it has gone through the column (Wash 2 control). 11. Elute protein from column with 7.5 ml 1X Elute Buffer in a 15 mL tube. The solution coming out of your column contains your recombinant T7 RNA polymerase. Keep this solution on ice until the Desalting procedure.
94
Keep all the protein fractions you generated from the purification procedure so you can assess their concentrations by absorbance at 280nm BEFORE leaving the lab. You should measure the absorbance at 280nm of all your controls as well as your purified protein (see table in question 1 of the assignment).
Column Stripping 12. Wash column with 3 column bed volumes of 1X Strip Buffer. Allow half of the buffer to run through column and then cap both ends of the column. Return the capped column back to TA. Part C: Desalting of the Purified His-Tagged T7 RNA Polymerase Some contaminants that are found in the elution buffer, especially the high imidazole concentration, might interfere with the activity of your recombinant T7 RNA polymerase that will be assessed next week. In this experiment, you will use a centrifugal filter column with a molecular weight cut-off of 50kDa for substituting the elution buffer (250 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) of your eluted fraction with T7 Storage Buffer (30 mM HEPES, 0.15 M K-Acetate, 0.25 mM EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5). The underlying principle for buffer substitution is to use a column with a filter that allows small molecules to flow through, but not the larger ones. After the solution has been filtered, the appropriate buffer is used to resuspend the large molecules that stayed inside the column. The figure below illustrates the procedure to be used.
13. Transfer the final eluted sample from Part B by filling the inner column provided in the tube. Notice that not all of your eluted sample can fit into the column tube, but you will be able to add the remaining fraction after the first centrifugation. 14. Centrifuge at 4,000g using a swinging bucket for 8 min.
95
15. Transfer the rest of the purified protein sample into the column tube, and centrifuge again at 4,000g for 8 min. It is recommended to have approximately 500 L left in the column before adding the second fraction. If too much is left inside your column after the first centrifugation, you can simply centrifuge for another 5 min before loading the remaining fraction. The rate of filtration during centrifugation can vary significantly due to the occlusion of the pores with large cell fragments. Never let the membrane dry out completely. 16. Fill up the inner column with T7 storage buffer and centrifuge at 4,000g again for 10 min. 17. Repeat step 16. 18. Transfer the solution remaining in the inner column to a 15 mL conical centrifuge tube and fill it up to 2 mL with T7 Storage Buffer. Part D: SDS-PAGE Analysis of IPTG Induction Controls In this section, the protein profile of the different controls that were prepared by some groups in lab 5 will be compared to your IPTG-induced sample. For the electrophoresis, you will be using two pre-cast gradient gels (4-20% acrylamide). 19. Each TA will run two gels. The loading sequence of samples to be analyzed are provided in the two tables below. (Remember that these loading volumes include the 2X loading buffer pre-added in lab 5)
96
Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Sample Rainbow marker (7.5ug/5ul) Groups 1, 9 or 17: 1 mL aliquot before induction Groups 1, 9 or 17: 1 mL aliquot after induction Groups 2, 10 or 18: 1 mL aliquot before induction Groups 2, 10 or 18: 1 mL aliquot after induction Groups 3, 11 or 19: 1 mL aliquot before induction Groups 3, 11 or 19: 1 mL aliquot after induction Groups 4, 12 or 20: 1 mL aliquot before induction Groups 4, 12 or 20: 1 mL aliquot after induction Groups 5, 13 or 21: 1 mL aliquot before induction Groups 5, 13 or 21: 1 mL aliquot after induction Groups 6, 14 or 22: 1 mL aliquot before induction Groups 6, 14 or 22: 1 mL aliquot after induction Groups 7, 15 or 23: 1 mL aliquot before induction Groups 7, 15 or 23: 1 mL aliquot after induction
Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Sample Rainbow marker (7.5ug/5ul) Groups 8, 16 or 24: 1 mL aliquot after induction Groups 8, 16 or 24: 1 mL aliquot before induction 1st set of extra controls: (no induction - first 1 mL aliquot) 1st set of extra controls: (no induction - second 1 mL aliquot) 2nd set of extra controls: 1 mL aliquot before induction 2nd set of extra controls: 1 mL aliquot after induction
20. Heat all samples, except the Rainbow marker, in a thermocycler at 95C for 5 min. After
97
ASSIGNMENT ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 MARKS) 1. Complete this table with regard to the protein amounts obtained at the different purification steps. Protein quantification for the purified aliquot should be based on the 280 you estimated for the recombinant T7 RNA polymerase in lab 5 assignment. All other fractions should be converted into protein amounts based on the 280 you estimated for a complex protein mixture. Please include your calculations. ( /3 Marks) Protein concentration (g/L) Total volume of the fraction (L) Total amount of protein (g)
Control fraction Input control Flowthrough control Wash1 control Wash2 control Elution control Purified protein
Absorbance at 280 nm
2. Based on your results in the above table, can you estimate the percentage of the Histagged T7 RNA polymerase in the total protein preparation of the IPTG-induced treatment? ( /2 Marks) 3. Next week, you will initiate the Western analysis with the protein fractions you put aside different protein fractions while purifying your His-tag T7 RNA polymerase by affinity chromatography. The first step will be to run a SDS-PAGE. The amounts of protein the aliquots to be prepared for the Western analysis, as well as those for the staining with the Gel Code Blue Staining Reagent, are provided in the following table (see next page). Refer to the concentration obtained in Question #1 to calculate the volume of each fraction to be loaded. Please include your calculations. ( /5 Marks)
99
Lane 1 2 3 4 5 6 7 -89 10 11 12 13 14 15
Sample Rainbow marker (7.5ug/5ul) Input control, 5 g or a maximum of 12.5 L Flowthrough control, 5 g or a maximum of 12.5 L Wash1 control, 1 g or a maximum of 12.5 L Wash2 control, 1 g or a maximum of 12.5 L Elution control, 0.5 g or a maximum of 12.5 L Purified protein, 0.5 g or a maximum of 12.5 L --------------------------Blank: cut zone-------------------------Rainbow marker (7.5ug/5ul) Input control, 50 g or a maximum of 12.5 L Flowthrough control, 50 g or a maximum of 12.5 L Wash1 control, 10 g or a maximum of 12.5 L Wash2 control, 10 g or a maximum of 12.5 L Elution control, 0.5 g or a maximum of 12.5 L Purified protein, 0.5 g or a maximum of 12.5 L
--------
-----------
----------5
100
Groups 5, 13 and 21 : Statistical determination of the extinction coefficients of Trp and Tyr in proteins. Anal Biochem 200:74 (1992) Groups 6, 14 and 22 : Short review on Immobilized Metal Ion Affinity Chromatography: Trends in Analytical Chemistry 1988 7:254-259. Groups 7, 15 and 23 : How SDS-PAGE works. Make sure to talk about native PAGE versus denaturing PAGE. http://bitesizebio.com/articles/how-sds-page-works/ Groups 8, 16 and 24 : Review article on how to concentrate proteins: http://bitesizebio.com/articles/the-in%E2%80%99s-and-out%E2%80%99s-of-proteinconcentration-%E2%80%93-semi-permeable-membranes/ (You should present all three parts: Semi-permeable membrane, protein precipitation and chromatography)
101
102
OVERVIEW This week, you will analyze your purified T7 RNA polymerase by SDS-PAGE. This analysis will provide an assessment of the size as well as the abundance of the recombinant protein. You will also begin a Western analysis that should confirm that the purified protein contains the Histag. During this lab session, you will also optimize of the enzymatic assay that you will use to evaluate the activity of your mutant T7 RNA polymerase. These optimized conditions will be used next week to perform a formal evaluation of the enzymatic activity of your mutant enzyme in comparison to the wild type enzyme. LEARNING OBJECTIVES Underlying molecular principles Explain the different steps of Western analysis Explain the different steps of in vitro transcriptional assay Explain the principle for the colorimetric detection with alkaline phosphatase
Hands-On Skills Assess protein size and relative abundance by SDS-PAGE Transfer protein bands from SDS-PAGE to blot membrane by electrophoretic transfer Immunodetect His-tagged T7 RNA polymerase by Western analysis Assess the enzyme activity of your His-tagged T7 RNA polymerase mutant in parallel to its wild type version Prepare an agarose gel and proceed to the electrophoresis of RNA samples
Analytical Skills Assess protein size and relative abundance by SDS-PAGE Refer to your detection results to discuss the sensitivity and specificity of the Western analysis
103
Figure 1. Components of the semi-dry protein transfer sandwich. In the lab this week, you will be using a PVDF membrane with high binding capacity, 140150 g/cm2 membrane, allowing for efficient protein retention.
104
Figure 2. Detection of the recombinant His-taggedT7 RNA polymerase by western blotting. (A) Summary of the various steps in a western blotting procedure. (B) This cartoon is a zoom in of the antigen-antibody complex which is representative of your western blot membrane at the end of the western blot procedure (step 7).
105
In the protocol that you will use, the transcription product will be assessed by agarose gel electrophoresis. Transcription activity will therefore be estimated based on the intensity of the RNA transcript visible on an agarose gel. In research labs, diethylpyrocarbonate (DEPC) is used to inactivate any contaminating ribonucleases, which will quickly digest your RNA transcript. Buffer and water are treated with DEPC before performing the transcription assay. However, since DEPC is toxic and volatile, our solutions wont be treated with DEPC and therefore, you should be extremely careful while preparing your enzymatic assay. Samples collected during the enzymatic assay should always be kept on ice. You should also proceed quickly when loading your agarose gel with your RNA samples.
106
Table 1. Loading sequence on SDS-PAGE gel (Question 3 of last weeks assignment). Sample volume (L) 2X Loading buffer (L) Loading volume (L) 5
Lane 1 2 3 4 5 6 7 -89 10 11 12 13 14 15
Sample
Rainbow marker (7.5ug/5ul) Input control, 5 g or a maximum of 12.5 L Flowthrough control, 5 g or a maximum of 12.5 L Wash1 control, 1 g or a maximum of 12.5 L Wash2 control, 1 g or a maximum of 12.5 L Elution control, 0.5 g or a maximum of 12.5 L Purified protein, 0.5 g or a maximum of 12.5 L --------------------------Blank: cut zone------------------------------------------- ----------Rainbow marker (7.5ug/5ul) 5 Input control, 50 g or a maximum of 12.5 L Flowthrough control, 50 g or a maximum of 12.5 L Wash1 control, 10 g or a maximum of 12.5 L Wash2 control, 10 g or a maximum of 12.5 L Elution control, 0.5 g or a maximum of 12.5 L Purified protein, 0.5 g or a maximum of 12.5 L Please check with your TA before making your samples to ensure that your calculated volumes are correct. Refer to steps 18-28 of Experiment D in lab 6 for details on the preparation and staining of SDS-PAGE. At the end of the electrophoresis, place the gel on a clean surface and cut it at Well #8 with a blade. The first part of the gel corresponding to Lanes 1 to 7 will be transferred to the PVDF membrane whereas the second part of the gel (Lanes #9 to 15) will be stained using the Gel code blue staining reagent
2.
107
4.
6.
a. Load the bottom of the transfer unit (the platinum anode) with two sheets of filter paper pre-soaked in the Transfer Buffer and cut to the same size as your membrane. Be careful not to introduce any air bubbles. b. Roll a pipette or glass rod over the surface of the paper to exclude all air bubbles that would interfere with ionic conductivity and protein transfer. c. Place your pre-soaked PVDF membrane on top of the filter paper and roll out any air bubbles. d. Carefully lift the gel from the transfer buffer, place it on top of the membrane and roll a pipette or test tube over the gel to make sure that good contact is achieved with the membrane. e. To complete this 'sandwich' put a piece of transfer buffer-saturated filter paper on top of the gel and remove any air bubbles. f. Place the cathode of the transfer unit on top of the stack, being careful not to disturb the stack. g. Place the safety cover on the unit and connect the cables (these are colourcoded, too). 7. 8. Transfer is done at 0.3A for 45 minutes. Turn off the power supply, remove the cover and carefully peel off the upper layer of filter paper and the gel, without the membrane. Rinse the membrane two times for 5 min in a plastic dish with 50 mL of PBS+Tween20 0.05%. Maintain gentle agitation during the rinses. If the transfer was successful, the colored markers should be visible on the membrane. 10. At this point the transfer membrane can be sealed wet in a plastic bag and stored at 4C until next week.
9.
Part C: Optimization of the T7 RNA polymerase enzymatic assay The procedure below only provides general guidelines. This weeks goal is for you to optimize an experimental procedure that will assess the relative activity of your mutant T7 RNA polymerase preparation compared to a wild type preparation. Your TA will supply you with a preparation of the wild type version of T7 RNA polymerase that was prepared under the same conditions as the ones you used for purifying your mutant T7 RNA polymerase. The three following aspects should be taken into consideration while planning your protocol:
109
Figure 4. Examples of enzymatic assay. In A), four individual reactions are prepared. One reaction will be kept on ice as a To control. The remaining three reactions will be placed in a water bath at 37C. At each specific time point (T1 to T3), one reaction will be taken out of the water bath and placed on ice to stop the reaction. In the second method (B), 3 to 5 reactions
110
General Guidelines for the Transcription Assay Mixture for one in vitro transcription assay with a final volume of 10L o 75 ng of DNA template (1 L @ 75 ng/L) o 2.0 L of 5X Transcription buffer o 1.25 L of 10mM NTP mix (Invitrogen) o 0.5 L of RNaseOut RNase inhibitor (40U) (Invitrogen) o 0.5 L of Pyrophosphatase 100U/mL o 0.5-1.5 g of T7 RNA polymerase source o Complement to 10 L with water 1. Incubate @ 37C for up to 30 min. 2. Remember that each time you take an aliquot or take out a reaction from the water bath, you should immediately mix with DEPC-treated 10X Loading Buffer. 3. Keep all your reaction on ice until you have collected all your samples. 4. Proceed to electrophoresis and take a picture of your agarose gel.
111
Groups 1, 9 and 17: Advantages and disadvantages of different staining methods for protein gel: Coomassie blue, silver nitrate and SYPRO red staining:
http://www.piercenet.com/browse.cfm?fldID=b06ffe8f-5056-8a76-4e15-af49e5f5a91f http://probes.invitrogen.com/media/pis/mp12000.pdf
Groups 2, 10 and 18: Wet versus semi-dry gel transfer in western blotting:
http://www.abcam.com/ps/pdf/protocols/WB-beginner.pdf http://www.millipore.com/immunodetection/id3/proteintransfer
Groups 3, 11 and 19: Western blotting: http://www.millipore.com/immunodetection/id3/western_blotting Groups 4, 12 and 20: Antibodies tutorial: http://www.millipore.com/immunodetection/id3/antibodiestutorial
112
Web references for the materials used in the lab PVDF membrane http://www.roche-applied-science.com/proddata/gpip/3_7_4_15_2_1.html BioRad Transblot semi-dry transfer unit http://www.bio-rad.com/LifeScience/pdf/Bulletin_9002.pdf
113
OVERVIEW This week, you will finish the Western analysis. You will also complete the formal evaluation of your T7 RNA polymerases enzymatic activity. LEARNING OBJECTIVES Underlying molecular principles Explain the different steps of Western analysis Explain the different steps of in vitro transcriptional assay Explain the principle for the colorimetric detection with alkaline phosphatase
Hands-On Skills Assess protein size and relative abundance by SDS-PAGE Transfer protein bands from SDS-PAGE to blot membrane by electrophoretic transfer Immunodetect His-tagged T7 RNA polymerase by Western analysis Assess the enzyme activity of your His-tagged T7 RNA polymerase mutant in parallel to its wild type version Prepare an agarose gel and proceed to the electrophoresis of RNA samples
Analytical Skills Assess protein size and relative abundance by SDS-PAGE Refer to your detection results to discuss the sensitivity and specificity of the Western analysis
115
Primary anti-His antibody binding 2. A 12000X dilution of the commercial anti-His antibody has already been prepared by the Support Staff. Place the membrane between plastic sheets provided by your TA and seal 3 of the sides with a vacuum sealer. Place your membrane inside the space between the plastic sheets and pipette all 3 mL of the pre-diluted primary antibody (TBS, 0.05% Tween20) onto the protein side of the membrane. Carefully push out all air bubbles between the membrane and the baggie before sealing the 4 th side. Place the bag with your membrane onto the waver for 1 hr, but gently massage the bag content with your fingers every 10-15 min to ensure complete mixing.
Binding of secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase 3. 4. Cut away all four sides of the baggie and discard the antibody/buffer solution. Wash the membrane with 50 mL of wash buffer (TBS, 0.05% Tween20) for 10 min with gentle mixing. Discard the wash buffer and repeat the wash one more time. Re-block the membrane with 50 mL of blocking buffer (TBS, 0.05% Tween20, 5% nonfat dry milk) for 10 min with gentle mixing. Discard the blocking buffer and repeat one more time. A 3000X dilution of the commercial secondary antibody has already been prepared by the Support Staff. Place the membrane in a new baggie (refer to step 11) containing 3 mL of the pre-diluted secondary antibody and put on the waver for 1 hour. Again gently massage the bag every 10-15 min. Decant and discard the antibody/buffer. Wash the membrane with 50 mL of wash buffer (TBS, 0.05% Tween20) for 10 min with gentle mixing. Discard the wash buffer and repeat three more times. Rinse the membrane with 50 mL of distilled water for about 30 sec. Discard water and
116
5.
6.
7. 8.
9.
117
Groups 5, 13 and 21: Principle of chromogenic western blotting: http://www.piercenet.com/browse.cfm?fldID=5A423056-5056-8A76-4E25-1E5F9C0596B2 Groups 6, 14 and 22: Principle of chemiluminescence (ECL) western blotting. http://www.gelifesciences.com/aptrix/upp00919.nsf/Content/4DE67EABFB9A9D25C12576280 01CDC12/$file/28955347AD.pdf (page 7-12) Groups 7, 15 and 23: Recent studies of T7 RNA polymerase mechanism: FEBS Letters (1998) 440 264-267 Groups 8, 16 and 24: Frequently asked questions about the T7 RNA polymerase : http://www.neb.com/nebecomm/products/faqproductM0251.asp
118
Web references for the materials used in the lab Anti-His antibody (GE Healthcare) http://www.gelifesciences.com/aptrix/upp01077.nsf/Content/Products?OpenDocument&mod uleid=164402 Secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Datasheet/6/a4312dat.Par.0001.File.t mp/a4312dat.pdf Western blue substrate
http://www.promega.com/products/biochemicals-and-labware/biochemical-buffers-andreagents/western-blue-stabilized-substrate-for-alkaline-phosphatase/
119
SI Units: Length: meter (m) Mass: kilogram (kg) Time: second (s) [lower case] Electric current: ampere (A) Amount of substance: mole (mol) Non-SI units sometimes used: liter (L or l) used to measure volume. Dalton (Da) or unified atomic mass unit (u). One dalton is equal to 1.661027 kg. Minute (min), hour (h), day (d) as units of time. SI prefixes: SI prefix SI symbol Decimal value 10x (scientific) value 10-12 10-9 10-6 10-3 10-2 10-1 100 101 102 103 106 109 1012
p n m c d da h k M G T
0.000000000001 0.000000001 0.000001 0.001 0.01 0.1 1 10 100 1,000 1,000,000 1,000,000,000 1,000,000,000,000
121
122
Get your note book initialed by the TA before you start your lab.
3. During the lab session Annotate any required calculations, any variation from the manual protocol, all your readings from instruments (like a spectrophotometer). Remember to always include units. Record equipment details such as brand and model. Record all your observations Record your measurements, in a table format when appropriate. Have your note book initialed before you leave.
4. After the lab session Further analysis of your results, graphics and calculations when preparing your lab report. (Not all final graphics and tables need to appear on your lab-book). All printout containing experimental results (gel pictures ) should be included in your lab manual along with a descriptive annotation. (Make sure that added printouts do not cover or obscure other entries).
123
124
125
126
Below expectations (2.5/5) Timeline Less than 5 min. Presenter seemed to not understand what he had to present Take home message missing or confusing Underlying molecular principle(s) were not covered Incohesive flow of information Presenter was on delivery mode with not much opportunities for audience to step in
Meets expectations (3.5/5) Between 5 and 10 min. Presenter was able to deliver his talk At least one important aspect was not discussed Underlying molecular principle(s) briefly overviewed Presentation was more or less fluid
Excellent (4.5/5) Between 5 and 10 min. Presenter knew the material very well The most important aspects and their relevance to BCH3356 were emphasized Underlying molecular principle(s) clearly explained Presentation was well structured and it was easy to follow the progression Engaging presentation (questions, opportunities for others to ask for clarifications, )
Knowledgeable
127
Verbs
Active present except for findings which should be introduced in the past tense Present tense to describe well established aspects Past and passive for describing the hypothesis or research goal that was assessed Past and passive for brief summary of methodology that had been used Past and passive voice rd at 3 person
Contents
Concise, but specific and descriptive Purpose has to be stated Doesnt have to be a complete sentence See steps 1-6 at p. 23
Abstract
Introduction
Present tense to describe well established aspects Past and passive for describing the hypothesis or research goal that was assessed Past and passive for brief summary of methodology that had been used
Results
rd
Discussion
Past tense at 3 person when referring to results Present when referring to well established facts Past when referring to specific results from an article
rd
Dont use a flowchart and dont list the different procedural steps, but Describe what you did and explain how, providing sufficient details for readers to assess the reliability of your methods. First part of a lab report to be written Decide whether a table or a figure is more appropriate to effectively communicate the results Organize your tables and figures so they could be selfsufficient Do not interpret the data here, but simply describe what was obtained Descriptive text is to be used to highlight the key results that were obtained. Be explicit and corroborate your statements with numbers whenever possible. Something like A DNA fragment with an approximate length of 1200bp (lane 3, Figure 4) was amplified by PCR. Emphasize the results: your statements should first emphasize your results not what textbooks are saying. In other words, distinguish between facts (results show or indicate that ) and speculation (might, could). What do the findings mean? Conclusion is in the last paragraph
Expended referencing style is to be used throughout the Avoid lab manual and websites Bibliography is to be formatted as in middle of p.29 and lower half of p. 33 of writing guide)
128 text
MARK
/5
Abstract
/5
Introduction
/15
/10
Results
/15
Discussion
/25
Rfrences
/10
Writing style
/10
129
Serial Dilution:
1:10
1:10
1:10
V1
V2
V3
Va
Vb
Vc
C0/10
C0/100
C0/1000
where i refers to the initial solution and f to the final solution 2nd dilution: (C0/10) x V2 = (C0/100) x Vb V2 = (C0/100) x Vb (C0/10) V2 = Vb/10
Example
You want to do a 1/5 serial dilution of a 2 mM solution of compound A. You decide to do 3 dilutions in a 1ml volume. What will be the final concentration of compound A in each dilution? What will be the values of V1, V2 and V3 (in fact it should be the same value)?
130
1:5
1:5
1:5
V1
V2
V3
Va
Vb
Vc
C0/5
C0/25
C0/125
Stock solution: 2 mM 1st dilution: C0/5 = 0.4 mM 2nd dilution: C0/25 = 0.08 mM 3rd dilution: C0/125 = 0.016 mM Value of Va, Vb and Vc:
2nd dilution: (C0/5) x V2 = (C0/25) x Vb V2 = (2 mM/25) x 1mL (2 mM/5) V2 = (2 mM/25) x 1mL (2 mM/5) V2 = 1 mL/5 V2 = 0.2 mL
3rddilution: (C0/25) x V2 = (C0/125) x Vc V2 = (2 mM/125) x 1mL (2 mM/25) V2 = (2 mM/125) x 1mL (2 mM/25) V2 = 1 mL/5 V2 = 0.2 mL
131
Where A is the absorbance at a specific wavelength, Io is the intensity of incident light, It is the transmitted intensity, is the absorption coefficient at the specified wavelength, c is the concentration of compound and l is the path length of the cell (cuvette). Any spectrophotometer shows optimal precision (minimal relative error) when the absorbance is 0.434. With many instruments, readings of absorbance above 2 are not reliable since the light reaching the detector approaches its sensitivity limit. Also, the relative contribution of stray light (light with a different from the one being measured) increases at high absorbance, thus the real value of the absorbance is underestimated. The Beer-Lambert equation is an analytical tool used very often to measure the concentration of biochemicals in solution. It is important to note that the absorption properties of most molecules can be affected by pH, solvent polarity, temperature etc. For example, both the max and max for tyrosine change substantially depending on the pH of the solution. These changes are due to alterations in the protonation state of the tyrosine hydroxyl group. Experiment standards (of known concentrations of a specific compound) are often used to measure the concentration of an experimental solution containing the same compound. This could be achieved by doing the following transformation on the Beer-Lambert law:
132
Therefore, if you have the concentration of the standard solution (cStandard) as well as its absorbance (AStandard), you can determine the concentration of your solution of unknown concentration by using its absorbance:
133
Example: You have to purify 2 g of DNA using a purification procedure. At the end of the procedure, you quantify your DNA and you found that you have 1 g. What is the percentage of error? First, you can determine easily the theoretical value: If everything works perfectly, you should get 2 g at the end of the purification. Therefore, your theoretical value is 2 g.
You can now assume that 50% of the DNA was loss during the purification.
134
or
To this equation, you can add the ratio (for example an insert to vector ratio of 10:1):
or
Example: You want to ligate 40 ng of vector with ratio of insert to vector of 8:1. Assuming that the length of your vector and insert are respectively 4000 bp and 1000 bp, how much insert should you add to the reaction?
135
136
For 1 litre of 25X TAE buffer 121g Tris base (2-amino-2-hydroxymethyl-propane-1,3-diol) 28.6 mL glacial acetic acid 50 mL 0.5M Na2EDTA (pH 8.0) Add H2O up to 1000 mL
137
Length of an unknown The mobility of the unknown in the gel picture above is 13.8. The graph shows that a linear regression between log(length) vs mobility has a high fit (r2=0.997). One can estimate the length of the unknown on the gel at the top right by substituting its mobility, which is 13.8, in the regression equation. This gives a log(length) equal to 2.921 and a length value of 833bp. Amount of an unknown The intensity of a band is directly related with the number of SYBR Safe molecules bound onto the DNA and therefore, the number of bp or amount of DNA. A visual estimate of the intensity of the unknown band indicates that it is roughly the same as the 10000bp marker. Its amount can therefore be estimated as 100ng, i.e the amount of DNA in the 10000bp marker.
138
139
140
Glossary 2011
BLAST alignment A computer-based analytical algorithm used to compare and align primary sequences of amino acids (proteins) or nucleotides (DNA or RNA). BLAST stands for Basic Local Alignment Search Tool, but the specific meaning for the BLAST-based alignment approach is beyond the scope of BCH3356 Cloning
Broadly speaking, cloning refers to the action of generating multiple copies of something. In the context of BCH3356, cloning will refer to molecular cloning that is the procedure of isolating a defined DNA sequence and obtaining multiple copies of it in vivo.
Cloning vector A small, self-replicating DNA molecule - usually a plasmid or viral DNA chromosome into which foreign DNA is inserted in the process of cloning genes or other DNA sequences of interest. It can carry inserted DNA and be perpetuated in a host cell. (BioBasics Biotech Canada) Important features of a cloning vector include the capacity to integrate and carry a foreign DNA fragment into a host cell, and then to self-replicate once it has been inserted within a cell. Several terms are used in the scientific literature for referring to a cloning vector, including plasmid vector, expression vector, cloning expression vector and vector. In BCH3356 your will be using the plasmid vector, pTrcHisB (the p at the front indicates that it is a plasmid vector). Competency The ability of a cell to take up extracellular or naked DNA from its environment. For the purpose of BCH3356, the concept of competency will specifically refer to the artificially induced competency that arises when cells in laboratory cultures are treated to make them transiently permeable to DNA. (Wikipedia) Control treatment Experimental controls are intended to minimize artefacts The simplest forms of controls are positive and negative controls. Positive controls are controls confirm that the procedure is effective in observing the effect (therefore minimizing false negatives). Negative controls confirm that the procedure is not observing an unrelated effect (therefore minimizing false positives). (Wikipedia) Electropherogram A plot of results from an analysis done by electrophoresis In the context of DNA sequencing, an electropherogram shows a trace of fluorescence recorded at the output of the capillary electrophoresis unit (see example below).
141
Glossary 2011
Hands-on skills Expertise or experimental knowledge exercised in the performance of some task Capabilities to effectively execute laboratory procedures Capabilities to effectively use, handle and troubleshoot laboratory equipments (the know how skills) Require basic knowledge about underlying principles of executed task Melting temperature is the midpoint of the temperature at which 1/2 of the DNA molecules are denatured and 1/2 are annealed. (Baylor College of Medicine) The temperature at which a double-stranded DNA or RNA molecule denatures into separate single strands. The Tm is characteristic of each DNA species and gives an indication of its base composition. DNAs rich in G:C base pairs are more resistant to thermal denaturation than A:T rich DNA since three hydrogen bonds are formed between G and C, but only two between A and T. (FAO Biotechnology Glossary) Plasmid vector A special type of cloning vector in which the carrier is a circular plasmid Primer
A short DNA or RNA fragment annealed to a template of single-stranded DNA, providing a 3 hydroxyl end from which DNA polymerase extends a new DNA strand to produce a duplex molecule. (FAO Biotechnology Glossary)
Quantitative DNA ladder Set of usually equimolar DNA markers allowing estimation of length and amount of DNA fragments analyzed by gel electrophoresis. The Alpha Quant 1 quantitative DNA ladder is used in BCH3356 (see Appendix E2) Recombinant DNA is a form of DNA that does not exist naturally, which is created by combining DNA sequences that would not normally occur together. (Wikipedia) In molecular biology, recombinant DNA refers to DNA that has been engineered in vitro, and therefore differs from in vivo genetic recombination. Recombinant plasmid (vector) A plasmid into which an exogenous DNA had been inserted in vitro by ligation
142
Glossary 2011
In BCH3356, the DNA fragment coding for T7 RNA polymerase was inserted into pTrcHisB to form the recombinant plasmid pTrcHisB/T7
Recombinant protein A protein whose amino acid sequence is encoded by a recombinant DNA In BCH3356, the his-tagged T7 RNA polymerase to be expressed and purified is a recombinant protein Sensitivity The lower significant signal (should be above background signal) that can be detected through an experimental procedure For example, the sensitivity of the agarose gel procedure used as described in the BCH3356 Lab Manual is in the range of 5-20ng Specificity The discrimination capacity of a test or procedure to detect a given signal For example, enzymes usually exhibit a fairly high substrate specificity (only the proper substrate can bind and trigger enzyme catalysis) Subcloning The transfer of of a cloned fragment of DNA from one vector to another. (Nexxus Glossary of Life Sciences) a technique used to move a particular gene of interest from a parent vector to a destination vector to better suit the requirements of a specific application or experimental context In BCH3356, the gene coding for T7 RNA polymerase is subcloned from an unknown parent vector into pTrcHisB Western analysis A procedure in which proteins separated by electrophoresis in polyacrylamide gels are transferred (blotted) onto nitrocellulose or nylon membranes and identified by specific complexing with antibodies that are tagged with a labelled secondary protein. (MondoFacto dictionnary)
143