Naturwissenschaften (2007) 94:449–458

DOI 10.1007/s00114-007-0222-6

ORIGINAL PAPER

Insecticide resistance may enhance the response

to a host-plant volatile kairomone for the codling
moth, Cydia pomonella (L.)
Benoît Sauphanor & Pierre Franck & Thérèse Lasnier &
Jean-François Toubon & Dominique Beslay &
Thomas Boivin & Jean-Charles Bouvier & Michel Renou

Received: 7 September 2005 / Revised: 27 December 2006 / Accepted: 14 January 2007 / Published online: 13 February 2007
# Springer-Verlag 2007

Abstract The behavioral and electroantennographic re-
sponses of Cydia pomonella (L.) to the ripe pear volatile
ethyl (2E,4Z)-2,4-decadienoate (Et-E,Z-DD), were com-
pared in insecticide-susceptible and -resistant populations
originating from southern France. A dose–response rela-
tionship to this kairomonal attractant was established for
antennal activity and did not reveal differences between
susceptible and resistant strains. Conversely, males of the
laboratory strains expressing metabolic [cytochrome P450-
dependent mixed-function oxidases (mfo)] or physiological
(kdr-type mutation of the sodium-channel gene) resistance
mechanisms exhibited a significantly higher response to
Et-E,Z-DD than those of the susceptible strain in a wind
tunnel experiment. No response of the females to this
kairomone could be obtained in our wind-tunnel conditions.
In apple orchards, mfo-resistant male moths were captured
at significantly higher rates in kairomone-baited traps than
in traps baited with the sex pheromone of C. pomonella.
Such a differential phenomenon was not verified for the
kdr-resistant insects, which exhibited a similar response to
both the sex pheromone and the kairomonal attractant in
B. Sauphanor (*) : P. Franck : J.-F. Toubon : D. Beslay :
T. Boivin : J.-C. Bouvier
INRA–PSH, Ecologie de la Production Intégrée,
Site Agroparc,
84914 Avignon Cedex 9, France
e-mail: sauphano@avignon.inra.fr
T. Lasnier : M. Renou
INRA UMR 1272 Physiologie de l’Insecte:
Signalisation et Communication,
Route de Saint Cyr,
78026 Versailles Cedex, France
apple orchards. Considering the widespread distribution of
metabolic resistance in European populations of C. pomo-
nella and the enhanced behavioral response to Et-E,Z-DD
in resistant moths, the development of control measures
based on this kairomonal compound would be of great
interest for the management of insecticide resistance in this
species.
Keywords Olfaction . Plant volatile compound .
Pheromone . Attraction . Pleiotropy
Introduction
Volatile phytochemicals largely guide host-finding in both
herbivorous insects and their natural antagonists. Certain
host-plant volatiles also synergize aggregation behavior
or sexual communication in several insect species,
enhancing the host-plant selection and colonization
(Dickens et al. 1990; Light et al. 1993; Visser et al.
1979). The receptivity of Cydia pomonella (L.), a major
pest of apple and pear worldwide, to volatiles released by
apple foliage or fruits has been extensively investigated
(Yan et al. 1999). E,E-α-Farnesene is a sesquiterpene
(Murray et al. 1964) recognized as one of the most active
compounds on C. pomonella in apple fruits, as it stimulates
oviposition and short-range attraction of adults and larvae
(Sutherland et al. 1977). However, its environmental
instability and rapid chemical breakdown (Light et al.
2001) greatly reduces the potential of this semiochemical
for the control of pests in orchards. A specific attraction
response to the ripe pear volatile ethyl (2E,4Z)-2,4-
decadienoate (Et-E,Z-DD) in both sexes of C. pomonella
was recently demonstrated (Light et al. 2001) along with
450
female oviposition stimulation (Knight and Light 2001),
providing new prospects for understanding host recognition
in this species. Moreover, the lack of emission of this
compound by apple and walnut trees makes it a promising
tool for population monitoring or direct control in apple
orchards, and Et-E,Z-DD has already been shown to attract
females in field conditions and neonate larvae in the
laboratory (Knight and Light 2001).
In commercial orchards, the receptivity of moths to such
attractants may be affected by environmental factors includ-
ing climatic conditions and odor background. The sensory
perception of insects and their mobility can be affected by
pesticide applications. The ability of C. pomonella males to
respond to calling females is altered by a previous exposure
to insecticide-treated surfaces (Hoelscher and Barrett 2003).
However, intraspecific variability may also cause differences
in the adaptation and the response of insects to their chemical
environment. Insecticide pressure is a demonstrated selective
force acting on genetic variation among insect populations.
Variability in the susceptibility of C. pomonella to insecti-
cides has been documented in most apple fruit-growing
areas for a long time (Hough 1928; Smith 1955; Moffit et
al. 1988; Welter et al. 1991; Sauphanor and Bouvier 1995;
Charmillot et al. 1999). In insects, insecticide resistance
genes are often associated with pleiotropic effects that may
result in biological constraints. Such pleiotropic effects can
be expressed as changes or deficiencies in vigor, behavior,
or reproductive potential, which may select against resis-
tance genes and enable reversion towards susceptibility
once insecticide pressure is removed (Roush and MCKenzie
1987; Coustau et al. 2000). The level and periodicity of flight
activity of Anopheles stephensi Liston is affected by dieldrin
resistance, which may also affect its mating competitiveness
and thus the frequency of resistance genes (Rowland 1991).
Pleiotropic effects of insecticide resistance on sexual commu-
nication have also been reported in several lepidopteran
species, including the noctuid moth Heliothis virescens (F;
Campanola et al. 1991) and the tortricid moth Choristoneura
rosaceana Harris (El-Sayed et al. 2001; Delisle and Vincent
2002). Declines in both pheromone production by females and
males’ ability to detect the pheromone source are reported in
these species, resulting in alterations of the reproductive
success of resistant moths with potentially profound influence
on the dynamics of insecticide resistance.
In C. pomonella, several negative effects of resistance
mechanisms have been demonstrated, including a decreased
fertility and increased developmental time (Boivin et al.
2001, 2003a). However, the resulting fitness cost is rather
low in this species, a decrease of 11% in the frequency of
resistance to diflubenzuron being observed per generation
in the absence of this insecticide (Boivin et al. 2003b).
Furthermore, the specific mate-recognition system is not
modified in resistant populations of C. pomonella, as both
Naturwissenschaften (2007) 94:449–458
sex pheromone production and perception are similar in
susceptible and resistant laboratory strains (Poullot et al.
2001). In addition, susceptible or resistant females attract
similar number of males in the field, and traps baited with
synthetic sex pheromone capture the same rate of suscep-
tible and resistant males released in orchards (Frérot et al.
1999). Pleiotropic effects of insecticide resistance on host-
plant recognition might strongly reduce the benefits of
using host-plant volatiles as pest-control agents, but to date,
no data are available regarding this point. To study this
hypothetical phenomenon, we focused on the response of
susceptible and insecticide-resistant genotypes of C. pomo-
nella to Et-E,Z-DD. We analyzed both the behavioral
responses of laboratory-selected strains in a wind tunnel
bioassay and the response of field populations of suscep-
tible and resistant individuals using trapping experiments in
apple orchards. The physiological mechanisms underlying
these behavioral responses were then explored through
electroantennographic recordings.
Materials and methods
Laboratory strains
C. pomonella larvae were collected in 1995 in two apple
orchards, located 10 km apart near Avignon in southeastern
France. These orchards were chosen because C. pomonella
populations displayed a significant decrease in susceptibil-
ity to diflubenzuron and to deltamethrin. Thirty and 130
larvae were collected in these orchards to generate the Rdfb
and RΔ strains. Neonate progeny were selected by
exposure to increasing concentrations of diflubenzuron
(for the Rdfb strain) or deltamethrin (for the RΔ strain)
that induced 50% mortality for the first ten generations at
concentration high enough to kill all susceptible larvae for
20 following generations. At the end of this selection
regime, individuals of Rdfb and RΔ strains expressed
homogeneously enhanced mixed-function oxidase (mfo)
and glutathione S-transferase (GST) activities (Sauphanor et
al. 1997; Bouvier et al. 2002). In addition, individuals from
the RΔ strain were homozygous for a resistance allele
(kdr-type) at the sodium channel gene (Bouvier et al. 2001;
Brun-Barale et al. 2005). Neonate larvae of the Rdfb strain
expressed a resistance ratio to diflubenzuron that was more
than 10,000-fold, and neonate larvae of the RΔ strain
expressed an 80-fold resistance ratio to deltamethrin.
A field population was also used to generate a
susceptible strain. Eighty larvae were grown in the
absence of insecticide treatment, and the resulting adults
were used to create isofemale lines. Progenies of these
lines were divided into two fractions: one was grown in
the absence of insecticide, the other was treated with a
Naturwissenschaften (2007) 94:449–458
concentration of deltamethrin known to kill all susceptible
larvae (Sauphanor et al. 1998). We detected 50 isofemale
lines for which all the treated fraction of the progeny died.
The untreated progenies of these lines were pooled for
generating the susceptible strain (Sv). Further biochemical
and molecular analyses performed on individuals of the Sv
strain indicated homogeneous susceptible values for mfo
and GST activities and homozygosity for the susceptible
allele at the sodium channel locus.
Subsequent to their selection process, Rdfb, RΔ, and Sv
strains were maintained by mass-rearing, in which the size
of the breeding populations of each strain approximated
4,000 individuals at each generation to limit inbreeding and
drift effects.
Behavioral response in flight tunnel
Behavior experiments were conducted in a Plexiglas flight
tunnel (60 cm high, 60 cm wide, and 180 cm long),
according to Poullot et al. (2001). The attractive source
was equidistant from the lateral sides of the wind tunnel,
30 cm above its floor and 130 cm from the moth release
point. A wind speed of 0.7 m s−1 was generated by an
electric fan. The pear ester plume was exhausted from the
tunnel with an air pump connected to a fume hood. The
temperature in the chamber housing the tunnel was kept
constant at 25°C (±1°C). The relative humidity in the
chamber was 55% (±10%). The tunnel was illuminated
with white and red light with 10–12 lx intensity,
corresponding to the conditions during the crepuscular
flight period of the codling moth. Rearing the adults
under inversed photoperiod allowed daytime observations.
Both males and females of codling moth respond to the
pear ester in electroantennogram (EAG) or field experi-
ments (Light et al. 2001). In our preliminary tests, there
was no observation of flight behavior of females,
presumably due to the fact that our wind tunnel structure
could not provide linear air flow at the low wind speed
(0.3 m s−1) suitable for C. pomonella females (Hern and
Dorn 2004). Thus, only males were tested experimentally.
One-day-old males were placed individually in glass tubes
from 24 to 48 h before the test. The males contained in the
tubes were placed in the test chamber at the beginning of
their artificial scotophase and were then tested individually
for a 2-h period.
The attractant, formulated specifically by Trécé for this
experiment and contained in rubber septa, was fixed to a
pin and placed in the airflow as a source. Isomeric purity
of Et-E,Z-DD was evaluated by Trécé by an approved
gas chromatography-flame ionization detector method,
and average purity was shown to be 98.5% of the mixed
isomers. Exceptionally intensive methods to prevent
cross-contamination throughout the sample-preparation
451
process were in practice at the lab before and during
the time the samples were prepared, and gas chromatog-
raphy traces from analytical files show absolutely no
contamination of C. pomonella pheromone isomers in any
of the analyses, including the lots of chemistry used in the
subject trials. Five doses of Et-E,Z-DD were tested (0.0001,
0.001, 0.01, 10, and 1,000 μg). The tests were conducted in
blocks including five treatments and the three strains. A
combination of three treatments and two strains was tested
each day. Three parameters of the response of each moth
were measured: latency before taking off when exposed to
the air flow, duration of the flight, and contact or no contact
with the source. Males that did not respond after a 5-min
exposure to the air flow were considered to be non-
responding. About 20 codling moths were tested per day.
At least 20 moths from each strain were tested for each test
dose. At least 100 moths per strain were thus compared for
Et-E,Z-DD attractivity.
Trapping experiments.
Comparisons of pheromonal and kairomonal lures for their
attractiveness to resistant moths were conducted in 2003
and 2004 on populations of six apple orchards from two
locations in Avignon region, Cantarel, and Velorgues. In
both locations, the experimental orchards were included in
an apple-production area. The three orchards in the Cantarel
farm were under chemical protection for more than 15 years,
and their C. pomonella populations were, thus, expected to
exhibit high frequencies of insecticide-resistant individuals.
Cantarel orchards were annually protected against C.
pomonella using organophosphate applications at 10 to
15-day intervals during the entire risk period. The three
orchards of the Velorgues farm had previously received
chemical control; however, for the last 4 years, insecticide
use was replaced by an organic fruit-production guideline.
During the trapping experiment, Velorgues orchards were
exclusively protected against C. pomonella using both
granulosis virus applications and false trial application with
sex pheromone dispensers (Ecodiane®). Thus, these three
orchards were expected to contain polymorphic C. pomo-
nella populations at the resistance loci. Two diamond-
shaped traps (II-B® traps; Trécé) baited with either Et-E,
Z-DD (40 mg/septum) or the main component of the sex
pheromone E8-E10 dodecadiene 1-ol (codlemone, 3 mg/
septum) were hung in each orchard of each farm. Traps
were checked twice a week during the entire flight period
of the codling moth (consisting in three adult generations,
occurring from the middle of April to the end of
September). Trapped moths were counted and sexed, and
living males were submitted to enzymatic and molecular
analysis the day of their collection to determine their status
with respect to susceptibility or resistance. The females
452
captured in Et-E,Z-DD-baited traps were not included in
this analysis, as far as only males are captured in the
codlemone-baited traps. The captures in the three orchards
from the same location were pooled for analysis.
Tracking resistance in field populations through enzymatic
and molecular analysis
Enzymatic analysis The 7-ethoxycoumarin-O-deethylation
activity was assessed in field-collected moths as a marker
of nonspecific mfo-related resistance (De Sousa et al. 1995;
Boivin et al. 2004). The abdomen of each adult was cut
longitudinally and placed individually into microplate wells
filled with 100 μl of 50 mM sodium phosphate buffer
(pH 7.2) and 0.4 mM of 7-ethoxycoumarin. The enzymatic
reaction was stopped after 4 h incubation at 30°C by adding
100 μl of glycine buffer (10−4 M), pH 10.4/ethanol (v/v).
Similar wells receiving glycine buffer previous to incuba-
tion were used for blanks. Microplates were then centri-
fuged at 2,000×g for 1 min. Fluorescence was measured
with 380-nm excitation and 465-nm emission filters using a
microplate reader (HTS 7000, Perkin Elmer).
Molecular analysis Total DNA was extracted from one
leg of individual moths. Tissues were digested overnight
at 55°C with 60 μg of proteinase K in 200 μl of 10%
Chelex 100 (Biorad) resin solution then boiled for
30 min (modified from Walsh et al. 1991). These extracts
were used as DNA template for polymerase chain reaction
(PCR) amplification of a 170-bp fragment of the sodium
channel gene to detect the kdr mutation (leucine to
phenyalanine replacement at position 1,014 in transmem-
brane segment IIS), which confers pyrethroid resistance in
insects (Brun-Barale et al. 2005). PCR amplifications were
carried out in 25 μl reaction volume containing 10 mM
Tris–HCl, pH 9, 50 mM KCl, 1.5 mM MgCl2, 50 μM each
of deoxyribonucleotide triphosphate, 0.4 μM of each
primer CpNaF (TAGAGAGCATGTGGGATTGC) and
CpNaR (AATTTCGTAGCCCTTGATCG), one unit of Taq
DNA polymerase, and 2 μl of DNA template. A volume
of 5 μl of the PCR product was subsequently digested
with two units of Tsp509I (NEB) in 20 μl reaction
volume before electrophoresis on 2% agarose gel. DNA
fragments were visualized under UV light after ethidium
bromide coloration. Tsp509I specifically cut at AATT site,
which is specific of the kdr allele in C. pomonella. Thus,
homozygous resistant moths to deltametrhrin (with a
genotype referred to as kdr/kdr) displayed a specific 80-bp
DNA fragment. Homozygous susceptible moths (with a
genotype referred to as +/+) to deltamethrin displayed a
112-bp DNA fragment. Heterozygous moths (with a ge-
notype referred to as +/kdr) displayed two DNA fragments
of 80 and 112 bp.
Naturwissenschaften (2007) 94:449–458
Electrophysiology
EAGs were recorded on isolated heads according to Renou
et al. (1997). Briefly, a 1- to 4-day old male or female was
anaesthetized with CO2. Its head was removed, and the last
two or three segments of one antenna were cut off. The
reference electrode was introduced into the head. The cut
tip of the antenna was introduced into the recording
electrode. Both electrodes were connected to the input
stage of a WPI pre-amplifier. Amplitudes of the EAGs were
read directly on the screen of an oscilloscope.
Et-E,Z-DD was diluted in hexane to various concen-
trations. An amount of 1 μl of test solution was deposited
on a piece of filter paper inserted in a Pasteur pipette. The
outlet of a glass tube (10 mm inner diameter) was
positioned 1 cm in front of the antenna. A flow of
humidified pure air (2.2 l/min) was continuously blown
over the antenna. To stimulate, the tip of the test solution
Pasteur pipette was placed perpendicularly through a hole
in the glass tube carrying the main airflow. Stimulations
were achieved by directing a puff of air (1 sec, 0.5 l/min)
through the pipette with a timer-controlled solenoid valve.
A dose–response data was established for each genotype by
presenting stimuli in order of seven increasing doses of
Et-E,Z-DD, ranging from 0.1 to 5,000 ng (0.1, 1, 10, 100,
500, 1,000, and 5,000 ng). Each stimulation was separated
by an interval of 1 min. Control stimulations were
performed using a pipette with a filter paper having a
deposit of pure hexane. Measurements were repeated on 15
(Sv strain), or 12 (RΔ and Rdfb strain) individuals using
newly prepared stimuli for each individual.
Data analysis
Comparisons between the responses of the Sv, RΔ, and
Rdfb strains to Et-E,Z-D in the wind tunnel were made
using analyses of variance (ANOVA). Mean comparisons
were analyzed using the Protected Least Significant
Difference Fisher test. Statistical significance was set at
the 0.05 threshold. The frequency of kdr genotypes in moth
populations captured in the Et-E,Z-D-baited traps were
compared to those of moths captured in codlemone-baited
traps using a chi-squared test with one degree of freedom,
considering that the response to the sex pheromone was not
altered by insecticide resistance (Poullot et al. 2001).
Considering the overlapping of mfo activity values in
susceptible and resistant strains (Boivin et al. 2004), the
genotype of field-captured moths could not be clearly
established for mfo-related resistance. The attractiveness of
the different traps in relation to mfo-related resistance was
thus analyzed by comparing the mfo activities of the moths
captured with different attractants and, according to the kdr
genotype, using ANOVA. Before analysis, EAG data in mV
Naturwissenschaften (2007) 94:449–458 453

Table 1 Dose–response relationship to pear ester (Et-E,Z-DD) in males of a susceptible (Sv) and two insecticide-resistant (Rdfb and RΔ)
laboratory strains of C. pomonella in a wind tunnel

Vibration (%) Oriented flight (%) Contact (%)

Dose (μg) Sv Rdfb RΔ Sv Rdfb RΔ Sv Rdfb RΔ

0.0001 56.7 100.0 95.2 53.3 69.2 95.2 53.3 69.2 95.2
0.001 51.6 90.0 94.7 41.9 70.0 89.5 41.9 70.0 89.5
0.01 20.0 64.6 77.4 13.3 37.5 69.8 13.3 37.5 66.0
10 30.0 57.6 69.4 23.3 33.3 55.6 23.3 30.3 55.6
1000 53.3 96.9 83.3 40.0 81.3 69.4 40.0 78.1 69.4
Mean 42.4 b 75.7 a 81.2 a 34.4 c 52.2 b 72.1 a 34.4 c 50.7 b 70.9 a
F value (P) 34.8 (<0.0001) 24.9 (<0.0001) 23.2 (<0.0001)

Values sharing the same letter do not differ significantly using the protected least significant difference Fisher test, P>0.05

for each individual were normalized according to the
formula:
ðRni  R minÞ
100

ðR max R minÞ
where Rni is the EAG response of the individual to the dose
ni, Rmin is the lowest response to the doses n1 to n7, and
Rmax the highest response to dose n1 to n7. Means and
standard deviations of corrected values were calculated.
Results
Behavioral response in wind tunnel
Male codling moth responded by wing-fanning and
oriented flight to Et-E,Z-DD in the wind tunnel (Table 1).
The attraction of codling moth males of the Sv, RΔ, and
Rdfb strains towards Et-E,Z-DD under wind-tunnel con-
ditions did not increase regularly with the dose of attractant;
a reduced response was recorded at intermediate doses.
However, the two resistant strains responded significantly
more than the susceptible one, regardless of the dose of
attractant (Table 1). The first obvious behavioral response
of the olfactory perception of the attractant, i.e., wing-
vibration, was similar for Rdfb and RΔ strains. The
oriented flight and contact with the source were signifi-
cantly more frequent for the RΔ than in Rdfb strain.
Resistance status of field C. pomonella populations
and their responses to both Et-E,Z-DD and codlemone-
baited traps
During the first flights of 2003 and 2004, a mean capture of
29.9 and 35.4 male moths per trap was recorded weekly in
traps baited with 3 mg of codlemone in Cantarel and
Velorgues (respectively) orchards. During the same period,
traps baited with 40 mg Et-E,Z-DD lures captured a mean
of 7.0 and 4.5 adults per week in both Cantarel and
Velorgues (respectively) orchards, including 32.9 and
29.8% females (respectively). Trapping success was very
low in Et-E,Z-DD traps during both the second and third
flights, compared with traps baited with codlemone.
Considering the possible divergences in resistance frequen-
cy between generations, only the resistance assessments
performed during the first generation were analyzed.
A total of 87 male moths captured in pear ester-baited
traps and 588 male moths captured in codlemone-baited
traps during the first generation of 2003 and 2004 were
analyzed for their resistance status with respect to the mfo
character (Table 2). The mfo activities of moths captured in
both locations and attractants were significantly reduced in

Table 2 Mean 7-ethoxycoumarin-O-deethylation (Ecod) activities of C. pomonella male moths captured in codlemone- and pear ester (Et-E,Z-
DD)-baited traps in two apple orchards (Cantarel and Velorgues) from the Avignon region, southeastern France

Year Location Ecod activitya

In codlemone-baited traps In Et-E,Z-DD-baited traps

Number of moths Mean Standard error Number of moths Mean Standard error

2003 Cantarel 212 407.4 27.2 25 620.2 95.9

Velorgues 52 249.5 49.2 32 408.7 87.5
2004 Cantarel 156 191.4 17.3 22 374.8 95.3
Velorgues 168 120.0 15.1 8 242.5 121.8
a
Ecod activity expressed in pg of 7OH formed individual−1 min−1
454 Naturwissenschaften (2007) 94:449–458

Table 3 Frequency of the kdr allele in pear ester (Et-E,Z-DD)- and codlemone-baited traps in two apple orchards from Avignon region

Location kdr Genotype Pear ester frequency (n) Codlemone frequency (n) Chi squared value P value

Cantarel SS (+/+) 50.0 (18) 64.8 (94) 3.471 >0.05

RS (+/kdr) 41.6 (15) 29.7 (43) 2.489 >0.05
RR (kdr/kdr) 8.3 (3) 5.5 (8) 0.548 >0.05
Velorgues SS (+/+) 17.1 (6) 11.4 (14) 1.152 >0.05
RS (+/kdr) 45.7 (16) 40.7 (50) 0.372 >0.05
RR (kdr/kdr) 37.1 (13) 48.0 (59) 1.643 >0.05

Chi squared values compare the ratio of one genotype captured in pear ester-baited traps to the frequency of the same genotype captured in
codlemone-baited traps

2004 compared to 2003 (F=19.3; df=1; P<0.001). Expect-
edly mean mfo activities in Cantarel moths were signifi-
cantly higher than those in Velorgues ones (F=11.05; df=1;
P=0.0009), in which pesticide selection pressure had been
interrupted 4 years ago. In both locations, male moths
captured in traps baited with Et-E,Z-DD expressed a
significantly higher mfo activity than those captured in
traps baited with 3 mg codlemone (F =15.46; df =1;
P<0.0001), whereas both location and attractant factors
(F=0.441; df=1; P=0.507) or year and attractant factors
(F=0.147; df=1; P=0.702) did not interact.
Unexpectedly, the frequency of the kdr allele in
cumulated captures of male moths in 2003 and 2004
reached 81.7% (with 46.7% of homozygous resistant
genotypes) in the organic orchards in Velorgues but only
36.2% (with 6.3% of homozygous resistant genotypes) in
the chemically treated orchards in Cantarel. Analysis of
pooled captures of the 2 years trapping in both locations
indicated that Et-E,Z-DD and the codlemone-baited traps
captured similar frequency of the three genotypes (Table 3).
The Rdfb strain assessed in wind tunnel experiment for
response to Et-E,Z-DD is resistant and susceptible with
respect to the mfo and kdr (respectively) mechanisms. As
an evaluation of the possible interaction of the kdr mutation
with the response of mfo resistant moths to Et-E,Z-DD, mfo
activities were compared for the different sodium channel
genotypes in Et-E,Z-DD- and codlemone-baited traps. Mfo
activities of different sodium channel genotypes did not
differ significantly (F=1.193; df=2; P=0.305), and no
interaction was observed between the attractant and the
sodium channel genotype for pooled mfo activities of both
locations and years (F=0.298; df=2; P=0.7422). The +/+
genotypes for the sodium channel gene captured in Et-E,Z-
DD-baited traps in both Cantarel and Velorgues locations
expressed higher mfo activities than those captured in the
codlemone baited traps, suggesting that the mfo-resistant
moths were more responsive to Et-E,Z-DD than the
susceptible ones, irrespective of the sodium channel
genotype (Table 4).
Electrophysiology
Et-E,Z-DD stimulations elicited EAG responses ranging
from 0.5 to 3.6 mV according to the dose and the
individual. The EAG dose–responses of the male of the
resistant strains were very similar to each other and to that
of the susceptible strain (Fig 1). EAG amplitude increased
with the dose and did not reach saturation at he highest
dose tested, 5 μg. The EAG response threshold to Et-E,Z-
DD stimulations was below 1 ng in each of the populations.
Discussion
The response of C. pomonella males in wind tunnel
experiments is in agreement with the high attractivity of
Et-E,Z-DD to this species recorded worldwide in field
conditions, often similar to the attractivity of the synthetic
sex pheromone (Light et al. 2001; Knight and Light 2005a,
b; Sauphanor et al. 2005; Trimble and El-Sayed 2005).
However, Et-E,Z-DD-baited traps were found in a few
situations much less attractive on male moths than

Table 4 7-Ethoxycoumarin-O-deethylation (Ecod) activities in moths of different kdr genotypes captured in codlemone- and pear ester (Et-E,Z-
DD)-baited traps

kdr Genotype Et-E,Z-DD Codlemone

Number of moths Meana Standard error Number of moths Meana Standard error
SS (+/+) 24 557.5 88.9 108 297.7 30.9
RS (+/kdr) 31 437.9 85.2 93 252.4 38.0
RR (kdr/kdr) 16 425.3 140.3 67 260.3 47.7
a
Ecod activity expressed in pg of 7OH formed individual−1 min−1
Naturwissenschaften (2007) 94:449–458
100
Sv
RΔ
80
Rdfb
60
40
20
0 may also reflect several sources of variation between the
0,01
. 0,1
. 1 10 100 1000 10000
dose of Et-E,Z-DD (ng)
Fig. 1 Electroantennogram responses (mV) to increasing doses of Et-
E,Z-DD in males of a susceptible (Sv) and two insecticide-resistant
(RΔ and Rdfb) laboratory strains of C. pomonella
codlemone-baited traps (Ioriatti et al. 2003). C. pomonella
females are commonly captured in Et-E,Z-DD-baited traps,
often close to the number of male captures (Knight and
Light 2005a; Yang et al. 2005). However, we failed to get
any answer of females to this compound in the wind tunnel.
This may be due to the requirement of multicompound
blends for female attraction (Coracini et al. 2004) and also
to the inappropriate wind speed mentioned above. Actually,
Yang et al. (2005) observed an upwind flight of more than
25% of mated females in a 0.3 m s−1 air flow but without
any contact with the source (10 mg Et-E,Z-DD in rubber
septa), whereas 50% of the males were able to reach this
source. High rate of response of C. pomonella females to
another kairomonal attractant, butyl hexanoate, could be
obtained in the wind tunnel by releasing groups of 15
individuals in a 17-h trial, also using a 0.3 m s−1 air flow
(Hern and Dorn 2004).
It was previously demonstrated that the male response to
codlemone is positively correlated with the logarithm of the
dose. In the same wind-tunnel conditions as described in
this paper, the rate of contact with the source increases from
8 to 92% for concentration of codlemone applied on filter
paper ranging from 0.1 ng to 1,000 ng. For this attractant,
no difference of response is recorded between susceptible
and resistant strains (Poullot et al. 2001). In the present
wind tunnel experiment, an enhanced response of both
Rdfb and RΔ resistant strains to Et-E,Z-DD was observed
455
when compared to the susceptible strain. The decreased
response of the three strains at intermediate doses could not
be explained. However, a similar non-linearity of the dose–
response of C. pomonella females to butyl hexanoate in
wind tunnel is also observed, the highest response being
observed at intermediate dose, whereas the response to the
highest dose is not significant (Hern and Dorn 2004). In our
experimental conditions, it is noteworthy that extremely
high responses were obtained from the resistant strains to
very low doses of Et-E,Z-DD. Over-expressed mfo is the
main resistance mechanism in Rdfb, whereas an additional
kdr mutation is involved in the insecticide resistance in RΔ.
The incidence of wing vibration, which is the primary
demonstration of the sensory perception of the attractant,
was similar in both resistant strains. However, the increased
frequency of upwind flight in RΔ, when compared to Rdfb,
suggests that both mfo- and kdr-related resistance mecha-
nisms may be involved in the enhanced or altered response
to Et-E,Z-DD. However, these highly significant differences
laboratory strains that might not be related to resistant
alleles. Genetic variability may have been affected in the
field-derived laboratory strains due to population bottle-
necks occurring during field sampling procedures and
insecticide selection in the laboratory. The observed
variation in the responses to Et-E,Z-DD could result from
other alleles, which were fixed by genetic drift indepen-
dently of the resistance selection process. Drift effects could
also occur in laboratory populations during the selection
process of the resistant strains as a consequence of the
inbreeding associated with their maintenance (Falconer
1981; Georghiou 1972). Therefore, we cannot exclude in
this paper an effect due to variation in the genetic
background. Nevertheless, both the use of a reverted
susceptible strain (Sv) sharing the same genetic background
as that of the resistant one (RΔ) and the sizes of
the breeding populations used in the mass-rearing of the
resistant strains may support pleiotropic effects of the
resistant alleles on traits observed in our wind tunnel.
Within the context of the pleiotropy hypothesis, addi-
tional investigations on the responses of different genotypes
within natural populations are of particular interest, as
individuals issued from a given natural population are
likely to share a similar genetic background. Moreover, the
genetic structuration of C. pomonella based on micro-
satellite analysis is very low at the regional level, indicating
strong exchanges and homogenization of populations
developed on different host plants (Franck et al. 2005).
As far as it has been shown that insecticide resistance does
not affect the sensory or behavioral response of C.
pomonella to the sex pheromone and the captures in
female- or sex pheromone-baited traps as well (Frérot et al.
1999; Poullot et al. 2001), we postulated for our analysis that
456
the frequency of resistant individuals captured in
pheromone-baited traps reliably represents the frequency
of resistant individuals within the population. The
higher frequency of mfo-resistant moths captured in
Et-E,Z-DD baited traps, when compared to that in
pheromone-baited traps, may thus be attributed to a higher
attractiveness of Et-E,Z-DD for mfo-resistant moths than
for susceptible ones.
Under field conditions, sub-lethal residues of pesticides
could affect differently the chemical communication of
susceptible and resistant codling moths, as recently shown
in C. rosaceana (Trimble et al. 2004). However, a
differential response of mfo-susceptible and mfo-resistant
codling moths to Et-E,Z-DD was observed in both conven-
tional and organic orchards, that is, in the presence and
absence of chemical residues. Thus, for the mfo-related
resistance, the results obtained in trapping experiments are in
agreement with the response of selected strains in the wind
tunnel. In contrast, the enhanced response of kdr-resistant
genotypes in the wind tunnel was not confirmed by the field
experiment, where susceptible and kdr-resistant moths
responded similarly to Et-E,Z-DD-baited traps irrespective
of their mfo resistance status. As the kdr-resistant strain RΔ
was more sensitive to Et-E,Z-DD than the mfo-resistant
strain Rdfb in the wind tunnel, different mechanisms of
response could be involved in the two strains.
The sensory or behavioral response to a semiochemical
compound is more likely to be altered by a mutation
affecting the nervous system than by a metabolic resistance.
The kdr-based resistance is associated with reduced
responsiveness to the alarm pheromone (E)-β-farnesene in
Myzus persicae (Foster et al. 1999), which is probably not
the case for metabolic resistance of the same species (a
reduced propensity to move from senescing leaves as
observed in resistant aphids overproducing carboxylester-
ase) but also in reverted clones that retain the amplified
esterase genotype and exhibit a susceptible phenotype
(Foster et al. 1997). For this species, it is thus hypothesized
that such behavior alteration is a consequence of genetic
linkage between the esterase-based resistance and the kdr
mutation of sodium channel. The single amino acid
substitution is expected to increase the nerve action
potential threshold and, thereby, to result in a reduced
sensitivity of the nervous system to external stimuli.
However, there is no evidence of altered nervous system
sensitivity through acetylcholinesterase associated with
resistance to organophosphates in populations of C.
rosaceana from southern Ontario (Pree et al. 2002). In
these populations, only esterase-based metabolic resistance
is demonstrated, which may cause reduced sensitivity to
sexual pheromones. With respect to the EAG responses of
codling moth to Et-E,Z-DD, sensory transduction in
olfactory receptor neurons involves two steps: first, a
Naturwissenschaften (2007) 94:449–458
depolarization of the neuron membrane, the receptor
potential; second, the firing of action potentials. It is
purported that receptor potentials are the main contributors
to the EAG response. As sodium channels that are affected
by the kdr mutation do not affect the generation of the
receptor potential, a kdr mutation is not expected to directly
affect the EAG. However, one cannot exclude that steps
further along the perception and behavior-evoking path-
ways are not altered.
It is generally assumed that resistant genotypes express
high relative fitness under pesticide exposure but may be
also selected against when the selective pressure is relaxed
(Roush and MCKenzie 1987; Coustau et al. 2000). The
alteration of sexual communication, a fitness component,
imposed by insecticide resistance in some moth species, is
expected to contribute to the decline of resistance in the
absence of insecticide (Rowland 1991; Delisle and Vincent
2002). Conversely, the enhanced response to one isolated
volatile compound, having a specific role in host-plant
recognition (Light et al. 2001), conferred by mfo-resistance
in C. pomonella, would rather suggest an increased capacity
of location and recognition of the host plant by male
resistant moths, providing a benefit for their fitness.
Agricultural landscapes are highly fragmented in south-
ern Europe. Whereas codling moth populations in large
monocultural crop production areas, frequently occurring in
North America, adapt their diapause strategy to the food
availability related to the host species or variety precocity
(Van Steenwyk et al. 2004), French populations of C.
pomonella are more likely to migrate during the season
from early- to late-maturing host plants (Buès et al. 1995).
Dispersing mfo-resistant male moths thus would be
expected to colonize more efficiently their dispersed host-
plants than the susceptible ones, contributing to an
enhanced adaptive response to a spatially fragmented
environment even in absence of insecticide pressure. A
very few cases of such a selective advantage of resistance
genes in the absence of pesticides have been reported. In
the red flour beetle Tribolium castaneum (Herbst), the
malathion-resistant phenotype has almost completely
replaced the susceptible one, which displays both lower
male reproductive success and female fecundity (Beeman
and Nanis 1986; Arnaud and Haubruge 2002; Arnaud et al.
2002). Thus, the spatial dynamics of C. pomonella
resistance genes in southeastern France would be expected
to be partially influenced by such pleiotropic effects on
chemical communication. The adaptive potential of this
trait could be further investigated in C. pomonella by
analyzing the response of susceptible and resistant geno-
types to host plant toxins, i.e., juglone or to other host plant
volatiles, such as butyl hexanoate, which was recently
identified as a female-specific attractant of the codling moth
(Hern and Dorn 2004).
Naturwissenschaften (2007) 94:449–458
The high potential of female attractants in codling moth
monitoring emphasizes the importance of a sound under-
standing of their relative attractiveness to different popula-
tions. (Light et al. 2001). The use of Et-E,Z-DD as an
attractant for insecticide resistance monitoring or sampling
in orchards releasing the pear ester volatile could lead to
over-estimating the prevalence of mfo-related resistance.
However, the early detection of resistance, which is needed
for resistance management, could gain from such altered
estimation of resistance. Furthermore, direct control based
on semiochemicals highly active on mfo-resistant popula-
tions would be of great interest for crop protection and
insecticide resistance management. The occurrence of
negative cross-resistance between two insecticides is likely
to result in a selection against resistance to one insecticide
if the other one is used (Tabashnik 1990). A negative cross-
resistance between azinphosmethyl and two other organo-
phosphates, chlorpyriphos and methyl parathion, was
demonstrated in North American populations of C. pomo-
nella (Dunley and Welter 2000), allowing the development
of resistance management strategies based on alternation of
these insecticides between seasons. Similarly, a decrease in
resistance frequency may result from higher fitness of
susceptible individuals expected under direct control
measures involving the pear ester, i.e., attract-and-kill
technology including the pear ester as an attractant or mating
disruption implemented by associating the pear ester to the
sexual pheromone of C. pomonella (Light and Knight 2006).
Acknowledgment This study is a part of the Bioinnova project
funded by the Trento province, Italy. We also thank the Trécé for the
supply of traps, attractants and dispensers, and B. Lingren for critical
review of the manuscript. The experiments comply with the current
French laws.
References
Arnaud L, Haubruge E (2002) Insecticide resistance enhances male
reproductive success in a beetle. Evolution 56:2435–2444
Arnaud L, Brostaux Y, Assie LK, Gaspar C, Haubruge E (2002)
Increased fecundity of malathion-specific resistant beetles in
absence of insecticide pressure. Heredity 89:425–429
Beeman RW, Nanis SM (1986) Malathion resistance alleles and their
fitness in the red flour beetle (Coleoptera: Tenebrionidae) J Econ
Entomol 79:580–587
Boivin T, Chabert d’Hieres C, Bouvier JC, Beslay D, Sauphanor B
(2001) Pleiotropy of insecticide resistance in the codling moth,
Cydia pomonella (L). Entomol Exp Appl 99:381–386
Boivin T, Bouvier JC, Chadoeuf J, Beslay D, Sauphanor B (2003a)
Constraints on adaptative mutations in the codling moth:
measuring fitness trade-offs and natural selection. Heredity
90:107–113
Boivin T, Bouvier JC, Beslay D, Sauphanor B (2003b) Phenological
segregation of insecticide resistance alleles in codling moth
(Lepidoptera: Tortricidae): a case study of ecological divergences
457
associated with adaptative changes in populations. Genet Res
81:169–177
Boivin T, Bouvier JC, Beslay D, Sauphanor B (2004) Variability in
diapause propensity within populations of a temperate insect
species: interactions between insecticide resistance genes and
photoperiodism. Biol J Linn Soc 83:341–351
Bouvier JC, Buès R, Boivin T, Boudinhon L, Beslay D, Sauphanor B
(2001) Deltamethrin resistance in codling moth: inheritance and
number of genes involved. Heredity 87:456–462
Bouvier JC, Boivin T, Beslay D, Sauphanor B (2002) Age-dependent
response to insecticides and enzymatic variation in susceptible
and resistant codling moth larvae. Arch Insect Biochem Physiol
51:55–66
Brun-Barale A, Bouvier JC, Pauron D, Berge JB, Sauphanor B (2005)
Involvement of a sodium channel mutation in pyrethroid
resistance in Cydia pomonella L. and development of a
diagnostic test. Pest Manag Sci 61:549–554
Buès R, Toubon JF, Poitout HS (1995) Variabilité écophysiologique et
enzymatique de Cydia pomonella L en fonction de l’origine
géographique et de la plante hôte. Agronomie 15:221–231
Campanola C, McCutchen BF, Baehrecke EH, Plapp JR (1991)
Biological constraints associated with resistance to pyrethroids in
the tobacco budworm (Lepidoptera: Noctuidae). J Econ Entomol
84:1404–1411
Charmillot PJ, Pasquier D, Sauphanor B, Bouvier JC, Olivier R
(1999) Carpocapse des pommes: premier cas de résistance au
diflubenzuron en Suisse. Rev Suisse Vitic Arboric Hortic
31:129–132
Coracini M, Bengtsson M, Liblikas I, Witzgall P (2004) Attraction
of codling moth males to apple volatiles. Entomol Exp Appl
110:1–10
Coustau C, Chevillon C, ffrench-Constant R (2000) Resistance to
xenobiotics and parasites: can we count the cost? Trends Ecol
Evol 15:378–383
Delisle J, Vincent C (2002) Modified pheromone communication
associated with insecticidal resistance in the obliquebanded
leafroller Choristoneura rosaceana (Lepidoptera: Tortricidae).
Chemoecology 12:47–51
De Sousa G, Cuany A, Brun A, Amichot M, Rahmani R, Berge JB
(1995) A microfluorometric method for measuring ethoxycou-
marin-O-deethylase activity on individual Drosophila mela-
nogaster abdomens: interest for screening resistance in insect
populations. Anal Biochem 229:86–91
Dickens JC, Jang EB, Light DM, Alford AR (1990) Enhancement of
insect pheromone responses by green leaf volatiles. Naturwis-
senschaften 77:29–31
Dunley JE, Welter SC (2000) Correlated insecticide cross-resistance in
azinphosmethyl resistant codling moth (Lepidoptera: Tortricidae).
J Econ Entomol 93:955–962
El-Sayed AM, Fraser HM, Trimble RM (2001) Modification of the
sex-pheromone communication system associated with organo-
phosphorus-insecticide resistance in the obliquebanded leafroller
(Lepidoptera: Tortricidae). Can Entomol 133:867–881
Falconer DS (1981) Introduction to quantitative genetics, 2nd edn.
Longman, London
Foster SP, Harrington R, Devonshire AL, Denholm I, Clark SJ,
Mugglestone MA (1997) Evidence for a possible trade-off
between insecticide resistance and the low temperature move-
ment that is essential for survival of UK populations of Myzus
persicae (Hemiptera: Aphididae). Bull Entomol Res 87:573–579
Foster SP, Woodcock CM, Williamson MS, Devonshire AL, Denholm
I, Thompson R (1999) Reduced alarm response by peach-potato
aphids, Myzus persicae (Hemiptera: Aphididae) with knock
down resistance to insecticides (kdr) may impose a fitness cost
through increased vulnerability to natural enemies. Bull Entomol
Res 89:133–138
458
Franck P, Guerin B, Loiseau A, Sauphanor B (2005) Isolation and
characterization of microsatellite loci in the codling moth Cydia
pomonella L. (Lepidoptera, Tortricidae) Mol Ecol Notes 5:99–
102
Frérot B, Beslay D, Malosse C, Renou M, Coupard H, Bouvier JC,
Sauphanor B (1999) Insecticide resistance and sexual phero-
mones in codling moth, Cydia pomonella L. ANPP, Proc 5th Int
Conf Pests in Agriculture, Montpellier, 7–9 Dec, 1:97–105
Georghiou GP (1972) The evolution of resistance to pesticides. Ann
Rev Ecolog Syst 3:133–168
Hern A, Dorn S (2004) A female-specific attractant for the codling
moth, Cydia pomonella, from apple fruit volatiles. Naturwissen-
schaften 91:77–80
Hoelscher JA, Barrett BA (2003) Effects of methoxyfenozide-treated
surfaces on the attractiveness and responsiveness of adult
codling moth (Lepidoptera: Tortricidae). J Econ Entomol 96:
623–628
Hough WS (1928) Relative resistance to arsenical poisoning of two
codling moth strains. J Econ Entomol 21:325–329
Ioriatti C, Molinari F, Pasqualini E, de Christofaro A, Schmidt S,
Espinha I (2003) The plant volatile attractant (E,Z)-2,4-ethyl-
decadienoate (DA2313) for codling moth monitoring. Boll Zool
Agrar Bachic 35:127–137
Knight AL, Light DM (2001) Attractants from Bartlett pear for
codling moth, Cydia pomonella L. larvae. Naturwissenschaften
88:339–342
Knight AL, Light DM (2005a) Factors affecting the differential
capture of male and female codling moth (Lepidoptera: Tortrici-
dae) in traps baited with ethyl (E,Z)-2,4-decadienoate. Environ
Entomol 34:1161–1169
Knight AL, Light DM (2005b) Dose–response of codling moth
(Lepidoptera: Tortricidae) to ethyl (E,Z)-2,4-decadienoate in
apple orchards treated with sex pheromone dispensers. Environ
Entomol 34:604–609
Light DM, Knight AL (2006) Kairomone augmented mating disruption
control for codling moth in Californian walnuts and apples. IOBC/
WPRS Bull (in press)
Light DM, Flath RA, Buttery RG, Zalom FG, Rice RE, Dickens JC,
Jang EB (1993) Host-plant green-leaf volatiles synergize the
synthetic sex pheromones of the corn earthworm and codling
moth (Lepidoptera). Chemoecology 4:145–152
Light DM, Knight AL, Henrick CA, Rajapaska D, Lingren W,
Dickens JC, Reynolds KM, Buttery RG, Merril G, Roitman J,
Campbell BC (2001) A pear-derived kairomone with pheromonal
potency that attracts male and female codling moth, Cydia
pomonella (L.). Naturwissenschaften 88:333–338
Moffit HR, Westigrad PH, Mantey KD, Van de Baan HE (1988)
Resistance to diflubenzuron in codling moth (Lepidoptera:
Tortricidae). J Econ Entomol 81:1511–1515
Murray KE, Huelin FE, Davenport JB (1964) Occurrence of farnesene
in the natural coating of apples. Nature 204:80
Poullot D, Beslay D, Bouvier JC, Sauphanor B (2001) Is attract and
kill technology potent against resistant Lepidoptera? Pest Manag
Sci 57:729–736
Pree DJ, Whitty K, Bittner LA, Pogoda MK (2002) Mechanisms of
resistance to organophosphorus insecticides in populations of the
obliquebanded leafroller Choristoneura rosaceana (Harris) (Lep-
idoptera: Tortricidae) from southern Ontario. Pest Manag Sci
59:79–84
Renou M, Lucas P, Malo E, Quero C, Guerrero A (1997) Effects of
trifluoromethyl ketones and related compounds on the EAG and
Naturwissenschaften (2007) 94:449–458
behavioural responses to pheromones in male moths. Chem
Senses 22:407–416
Roush RT, MCKenzie JA (1987) Ecological genetics of insecticide
and acaricide resistance. Annu Rev Entomol 32:361–380
Rowland M (1991) Activity and mating competitiveness of gHCH/
dieldrin resistant and susceptible male and virgin female
Anopheles gambiae and A. stephensi mosquitoes, with assess-
ment of an increased rotation strategy. Med Vet Entomol 5:207–
222
Sauphanor B, Bouvier JC (1995) Cross resistance between benzoylur-
eas and benzoylhydrazines in the codling moth, Cydia pomonella
L. Pestic Sci 45:369–375
Sauphanor B, Cuany A, Bouvier JC, Brosse V, Amichot M, Bergé
JB (1997) Mechanism of resistance to deltamethrin in Cydia
pomonella (L) (Lepidoptera: Tortricidae). Pestic Biochem
Physiol 58:109–117
Sauphanor B, Bouvier JC, Brosse V (1998) Spectrum of insecticide
resistance in Cydia pomonella (Lepidoptera: Tortricidae) in
southeastern France. J Econ Entomol 91:1225–1231
Sauphanor B, Toubon JF, Tronel C, Hucbourg B, Beslay D, Franck P
(2005) L’ester de poire, un nouvel attractif pour la surveillance
des populations du carpocapse des pommes et des poires.
Phytoma-La Défense des végétaux 581:28–31
Smith LC (1955) DDT resistant codling moth: a report on the 1954–
1955 control trials. J Dep Agric South Aust 60:185–187
Sutherland ORW, Wearing CH, Hutchins RFN (1977) Production of a-
farnesene, an attractant and oviposition stimulant for codling
moth, by developing fruits of ten varieties of apple. J Chem Ecol
3:625–631
Tabashnik BE (1990) Modelling and evaluation of resistance
management tactics. In: Roush RT, Tabashnick BE (eds)
Pesticide resistance in arthropods. Chapman & Hall, New York
Trimble RM, El-Sayed AM (2005) Potential of ethyl(2E,4Z)-2,4-
decadienoate for monitoring activity of codling moth (Lepidop-
tera: Tortricidae) in eastern North American apple orchards. Can
Entomol 137:110–116
Trimble RM, El-Sayed AM, Pree DJ (2004) Impact of sub-lethal
residues of azinphos-methyl on the pheromone-communication
systems of insecticide-susceptible and insecticide-resistant obli-
quebanded leafrollers Choristoneura rosaceana (Lepidoptera:
Tortricidae). Pest Manag Sci 60:660–668
Van Steenwyk RA, Fouche CF, Collier TR (2004) Seasonal
susceptibility of Bartlett pears to codling moth (Lepidoptera:
tortricidae) infestation and notes on diapause induction. J Econ
Entomol 97:976–980
Visser JH, Van Straten S, Maarse H (1979) Isolation and identification
of volatiles in the foliage of potato, Solanum tuberosum, a host
plant of the Colorado potato beetle, Leptinotarsa decemlineata.
J Chem Ecol 5:13–25
Walsh PS, Metzger DA, Higuchi R (1991) Chelex (R)100 as a
medium for simple extraction of DNA for PCR-based typing
from forensic material. Biotechniques 10:507
Welter SC, Varela L, Freeman R (1991) Codling moth resistance to
azinphosmethyl in California. Resist Pest Manag 3:12
Yan F, Bengtsson M, Witzgall P (1999) Behavioral response of female
codling moth, Cydia pomonella, to apple volatiles. J Chem Ecol
25:1343–1351
Yang ZH, Casado D, Ioriatti C, Bengtsson M, Witzgall P (2005)
Pheromone pre-exposure and mating modulate codling moth
(Lepidoptera: Tortricidae) response to host plant volatiles. Agric
For Entomol 7:231–236