Molecular Markers and QTL Mapping; An Introduction, Review and Discussion

Seth C. Murray
Assistant Professor Quantitative Genetics and Maize Breeding 09/10/10 TAMU Plant Breeding Roundtable

BIG PICTURE Why Crop Improvement and Genetic Diversity Understand Genetics for Review of Genetic Variation - Focus on Gene (Point) Mutations Crop Improvement
What are Morphological Markers? What are Molecular Markers? - Restriction Fragment Length Polymorphisms - Polymerase Chain Reaction - SSRs - SNPs - Sequence Based What is a Quantitative Trait Locus QTL? How do you perform QTL mapping? What is the difference between QTL and a gene?

Overview

FOCUS What is a (Molecular) Marker and How Does it Help Characterize Diversity?

FOCUS What is a QTL and How Does it Help us to Characterize and Use Diversity?

DISCUSSION: Using QTL for Crop Improvement - Crop Improvement via Linked Loci - Crop Improvement via specific genes - Transgenics

BIG PICTURE How Do Molecular Markers Help Us in Crop Improvement?

Where Does Genetic Variation Come From?

1. Polyploidy (changes in number of chromosomes) 2. Gene or point mutations 3. Recombination 4. Changes in chromosome structure 5. Transposition: mobile genetic elements

Using Gene or Point Mutations in Crop Improvement

Mutation at a single gene is usually deleterious
Naturally occurring mutations are rare and spontaneous -1 108 /bp/generation (0.00000001) ACTGCATG ACCGCATG (Transitions) ACTGCATG AC_GCATG (Deletions) ACTGCATG ACCCGCATG (Insertions) Human Induced Mutations -Gamma radiation -Chemical - Ethyl methyl sulfonate (EMS) -Popular in 1940s and 1950s for breeding -Now used primarily for genetic studies

A Real Diversity Example From Sorghum

CA Transversion

Crop Landraces

Wild Species

insertion

deletion

insertion

CG Transversion

What is a Marker?
-Websters Dictionary defines as: something that serves to identify, predict, or characterize [the GENETIC VARIATION present] Morphological (phenotypic) markers - A trait you can observe and/or measure as different between two individuals (must be heritable, genetic). (Example ~ corn mutants)

Genetic (molecular, DNA) markers - A measurable DNA mutation which may or may not have an effect on the phenotype (also must be heritable, genetic).

Molecular markers are much more common than phenotypic markers Most gene (point) mutations do not result in phenotypic changes.
www.cals.cornell.edu/.../images/mutant-corn.jpg

How are Genetic Linkage Maps Made?

- In progeny from a segregating two parent cross:
- Markers on different chromosomes are inherited independently - Markers on the same chromosome will have the more similar inheritance in the progeny the closer they are located because recombination is less likely to separate them.

- Most linkage maps have many loci so computer software is needed

http://www.animalgenome.org/edu/QTL/Julius_notes/05_linkagemap.PDF

Morphological (Phenotypic) Markers

-Developing the first morphological (phenotypic) markers and linkage maps - Corn mutants - Chromosome 4 mutant linkage map

www.cals.cornell.edu/.../images/mutant-corn.jpg

Corn Mutant Linkage Mapping Cornell University

Burnham Beadle (Nobel in 1958) Rhodes Emerson McClintock (Nobel Prize in 1983)

How do we Make More Mutations Measurable? Molecular markers! - Isozymes

- RFLPs (Restriction fragment length polymorphisms): -The first genetic markers - Require a lot of DNA, blotting and radiation -Rock Solid markers for amplifying across species

- PCR (Polymerase Chain Reaction) -Very little DNA needed -AFLPs -SSRs -Sequencing and SNPs

From Morphological Maps to Molecular Maps Example

Tomato was one of the first to use Molecular Markers (1985) -These were integrated with known morphological markers

Morphological Markers are in RED Molecular Markers are in BLUE

Restriction Digests for RFLPs DNA Strand Restriction Enzyme Cuts Specific DNA Patterns
G/AATTC 80kbp - kilobase pairs 50kbp G/AATTC 10kbp

Digesting the DNA

Run Gel Electrophoresis

Digested DNA

DNA standard
100kbp 50kbp 20kbp 10kbp

Restriction Fragment Probes Radioactive probe that binds to specific DNA sequence GGCCTTAATTCCGG
GGCCTTAATTCCGG 80kbp G/AATTC 50kbp G/AATTC 10kbp

Run Gel Electrophoresis Hybridize Radioactive Probe

100kbp 50kbp 20kbp 10kbp

RFLPs -Restriction Fragment Length Polymorphisms

GGCCTTAATTCCGG 80kbp G/AATTC 50kbp Digestion Can NOT Cut Due to AC Transversion GGCCTTAATTCCGG GCATTC 130kbp G/AATTC 10kbp G/AATTC 10kbp

Different Sizes = Polymorphism!

150kbp 100kbp 50kbp 20kbp 10kbp

Measurable Mutations!

Polymerase Chain Reaction - PCR

Allows the selective replication and amplification of specific(targeted) DNA sequences. PCR basics 1. Know some sequence of the piece of DNA to be targeted 2. Make primers - sequences of DNA that are complementary to the DNA sequence of interest 3. Add a cocktail of -DNA template -Primers -A,C,T,Gs The four nucleotide building blocks -Taq1 - DNA polymerase

Steps in DNA amplification via PCR

Polymerase Chain Reaction (PCR)

Denaturation DNA template is denatured with high heat to separate strands. Each DNA primer anneals, binding to its complementary sequence on the template DNA DNA polymerase creates a new strand of DNA complementary to the template DNA starting from the primer.

Annealing

Extension

Multiple rounds of denaturation-annealing-extension are performed to create many copies of the template DNA between the two primer sequences.

Steps in DNA amplification via PCR

Primers must match sequences close enough to drive amplification Depending on conditions and primers used, DNA amplified is 1 to ~6000 bp

Amplification potential: How many copies after 35 cycles of amplification?

Single / Simple Sequence Repeat (SSR marker)

Repeated simple sequence that causes polymerase slippage CATGTTACGCATCATCATCATGTAGGGTCA CATGTTACGCATCATCAT- - - GTAGGGTCA CATGTTACGCATCAT- - - - - - GTAGGGTCA * Highest mutation rate in genome * Many alleles at a locus

Stutter

Stutter

NICE

seq.mc.vanderbilt.edu/DNA/images/mma.jpg www.epibio.com/f6_1/Fig2trace.gif
Agro 643 Molecular Markers

NICE

PCR Based Molecular Markers Continued

Sequencing -Get the actual DNA sequence or code between two primers

SNPs (Single Nucleotide Polymorphisms) -Newest, most popular marker -Detects a single base pair (bp) mutation only -Must find the polymorphism first by sequencing

Chromatagram / Trace File for Sequence Data

Notice it is not always clear which base is being observed.

genecodes.com/.../Var_detail_report.gif bioinformatics.utmem.edu

Agro 643 Molecular Markers

File for SNP Polymorphism on Illumina Beadstation, Similar to K-biosciences

aa

Aa aA

AA

www.biotech.uiuc.edu
Agro 643 Molecular Markers

Kbiosciences systems

http://www.kbioscience.co.uk/

pipeline

Agro 643 MAS and Genomic Selection Genotyping Platforms

Illumina Makes Sense for Mapping But NOT for MAS

http://www.genomecenter.ucdavis .edu/dna_technologies/prices.htm l

Illumina Golden Gate Genotyping Bead Array 96 SNPs (per sample) Bead Array 384 SNPs (per sample) Bead Array 768 SNPs (per sample) Bead Array 1536 SNPs (per sample) BeadXpress 96 SNPs (per sample) BeadXpress 384 SNPs (per sample) 1536 SNP bead chip, 16 samples 1536 SNP bead chip, 32 samples

UC Recharge Rate 42 51 63 78 17 37 1810 3170

Non-Profit Recharge Rate 63 77 95 118 25 55 2751 4818

Industry Recharge Rate 75 92 113 141 30 66 3285 5753

Agro 643 MAS and Genomic Selection Genotyping Platforms

Whole Genome Sequencing

Agro 643 MAS and Genomic Selection Genotyping Platforms

Coming soon from DOE! - soybean - cotton - re-sequencing sorghum

Whole Genome RE-Sequencing is Here!

http://www.hpcgg.org/Genotyping/index.jsp

http://www.sequenom.com/

http://www.illumina.com/

http://www.sequenom.com/
Agro 643 MAS and Genomic Selection Genotyping Platforms

Dr. Patricia Klein will be speaking on her work in this area here on Oct. 1st!

What are Molecular Markers Good For

Genetic Diversity Measurements - Selecting what genotypes to use in breeding - Narrowing germplasm searches (only if less costly then phenotyping!) - Managing germplasm collections Intellectual Property Protection - Preventing others from using your proprietary technology Food Safety - Detecting transgenes - Detecting pathogens QTL Mapping - We will discuss today Marker-Assisted Selection - Backcrossing in a transgene - Maintaining or crossing in a QTL Genomic Selection (too complex to discuss here)

Gene Frequencies Mirror Geography Within European Humans

Novembre et al. 2008. Genes mirror geography within Europe.Nature. 456(7218):98-101.

Amber

Variance Explained = 0.21

Modern sugar and energy, MN landraces

Historical and modern syrup Variance Explained = 0.36

Markers for Predicting Diversity .

Labate, J., K.R. Lamkey, M. Lee, and W.L. Woodman. 1999. Population genetics of increased hybrid performance between two maize populations under reciprocal recurrent selection. p. 127137. In J. Coors and S. Pandey (ed.) Genetics and Exploitation of Heterosis in Crops, CIMMYT, Mexico City. 1722 Aug. 1997. ASA, Madison, WI.

Agro 643 - Relationships and Genetic Diversity Measurements and Visualizations of Genetic Diversity

What is a Quantitative Trait Locus (QTL) A statistically significant locus (not necessarily a gene) that quantitatively affects a phenotype of interest with physical boundaries defined by linked molecular markers.
Composite Interval Mapping Single Marker Analysis

AA aa Aa

QTL

QTL

Genetic Markers

Agro 643 QTL Mapping - Introduction

Why do We Conduct QTL Mapping?

Mapped QTL ($$$$+) - Identify genetic control of a trait (inheritance, position, co-localization) - Identify molecular markers for Marker Assisted Selection (MAS) - Identify homology with other genes/ other species (comparative mapping) - Get hints on genome organization - Use to select elite individuals by predicting breeding value. - Clone a QTL can do many more things once cloned but a lot of work! Forward Genetics: Phenotypic Variation QTL Gene Functional Polymorphism Reverse Genetics: Gene Functional Polymorphism Phenotypic Variation

What is the plural of QTL?: Quantitative Trait Loci , but can still be called QTLs to draw attention to the fact that there is more than one.

Agro 643 QTL Mapping General

QTL and QTL mapping What do we need to map QTL? - A controlled segregating population -*Heritable variation in the population is necessary, phenotypic variation in the parents is NOT (think of transgressive segregation; parents with different genes for height can phenotypically look the same.) - Phenotypic data - A molecular marker based linkage map - Recombination and linkage disequilibrium What is the mapping strategy (simple overview) -Test phenotypic value difference in progeny separated by marker state for significant difference (t-test, ANOVA, regression) - A significant difference is indicative of a marker linked to a QTL - Difference between mean value of separated progeny classes is an estimate of the QTL effect. - Replicate and test across environments to: - Minimize error variance - Identify QTL that are consistently expressed - QTL only expressed in one (rare) environment are of little use except if preparing for a stress expected to become more common

Agro 643 QTL Mapping - Introduction

Single marker QTL analysis (F2) Simplest Case of a Perfect Marker Basic Regression - Code genotypic data (Parent 1 alleles = 0, Parent 2 alleles =1) - Missing genotypes get treated as the mean probability of both parents (0.5 for F2 or RILs, 0.75 for backcross 1) - Create genetic map (not necessary for most basic test) - Prepare phenotypic data (BLUPs, location means, transform to normality) - Regress genotypes onto phenotypes (same result as t-test, ANOVA) - Significant genotypic marker means the marker is likely linked to a QTL - Estimation of the regression slope = estimate of QTL effect

120 115 110 105 100 95 90 85

y = 5.213x + 94.904 R = 0.6085

HEIGHT (CM)

Data simulated in R (additive) AA<-rnorm(10,110,3) Aa<-rnorm(20,105,3) aa<-rnorm(10,100,3)

AA Aa

Regression found difference in height to be 5.213cm compared to 5cm that we specified

aa

R: #Single Marker QTL analysis

Agro 643 QTL Mapping Single Marker Analysis

QTL and QTL mapping Five primary types of QTL mapping with increasing complexity and (theoretically) power - Single marker analysis - Interval mapping (IM) - Composite interval mapping (CIM) - Multiple interval mapping (MIM) - Bayesian ( Hidden Markov Model) - Others that are more rare. Variety of programs for QTL mapping (only free software) - QTL Cartographer - Command Line - WinQTL Cartographer - Nicest GUI - Less up to date then QTL Cartographer - MapQTL5 - Nice GUI - PLABQTL - Command Line -R/QTL - Command line / Most flexible - Offers Bayesian (most technically complex ) R/QTL - for more Brian Yandell keeps a great reference at: http://www.stat.wisc.edu/~yandell/statgen/reference/software.html

Agro 643 - Heritability - Genetic and Environmental Variances

Types of Populations Inbred Derived

F2/ F3

Good - Quick to create - Can estimate both additive and dominance effects Bad - Lower power (more unknowns especially with dominant markers) - Not immortalized genetic map is only good for that generation - Limited to no ability to replicate (environments, replicates) - Limited recombination

Recombinant Inbred Lines (RILs)

Good - Lots of recombination - Immortalized and easily replicated and shared Bad - Takes years to create (not even possible for some species/ crosses) - Only look at additive effects (no heterozygotes)

Agro 643 - Heritability - Genetic and Environmental Variances

Types of Populations Inbred Derived

Doubled Haploid
Good - Quick to create - Immortalized and easily replicated and shared Bad - Limited recombination - Can be difficult and expensive - Can only look at additive effects (no heterozygotes)

Backcross
Good - Can be combined with trait introgression breeding - Moderate recombination Bad - Difficult to replicate unless further inbred - Can not evaluate additive effects (no donor parent recessive homozygotes)

Agro 643 - Heritability - Genetic and Environmental Variances

Types of Populations - Goals

Want to find QTL that will improve trait of interest for breeding Want to find underlying genetic causes of trait variation

Population derived from an Elite x Elite cross (Only progeny must segregate)
- Primary improvement may only be on transgressive segregation
Agro 643 QTL Mapping Types of Populations

Population derived from an extreme low parent x extreme high parent cross (Note parents and progeny segregate)

Rio BTx623
HeightHgt_(cm) Flowering_time Flower Tiller
stand_density

QTL Mapping For Biomass in College Station, TX 2005

Chr. 1 Chr. 2 Chr. 3 Chr. 4 Chr. 5 Chr. 6 Chr. 7 Chr. 8 Chr. 9 Chr. 10

S diameter Mean_stem_thickness
Total_Biomass_dry_yield Biomass

Grain Stem Leaf Brix

Grain_dry_matter_yield Stem_structural_dry_yield Leaf_dry_matter_yield

Sugar Sugar_yield
Brix Starch_grain G starch

G fat Fat_grain Crude_protein_grain G protein

ADF_grain G fiber Thousand_Seed_Weight G 1K Wt. Cellulose_stem_(%solids) S cellulose

S h-cellu Hemi-cellulose_stem(%solids)
Lignin_stem(%solids) S lignin Crude_protein_stem(%solids) S protein Cellulose_leaf L Cellulose Hemicellulose_leaf L h-cellul Lignin_leaf L lignin Crude_protein_leaf LAgro 643 QTL Mapping QTL Verification Multiple Traits protein

Rio QTL Mapping For Biomass in Stem and Leaf Tissue in College Station, TX 2005 BTx623 Chr. 1 Chr. 2 Chr. 3 Chr. 4 Chr. 5 Chr. 6 Chr. 7 Chr. 8 Chr. 9 Chr. 10
HeightHgt_(cm) Flowering_time Flower Tiller
stand_density

S diameter Mean_stem_thickness
Total_Biomass_dry_yield Biomass

Grain Stem Leaf Brix

Grain_dry_matter_yield Stem_structural_dry_yield Leaf_dry_matter_yield

Sugar Sugar_yield
Brix Starch_grain G starch

G fat Fat_grain Crude_protein_grain G protein

ADF_grain G fiber Thousand_Seed_Weight G 1K Wt. Cellulose_stem_(%solids) S cellulose

S h-cellu Hemi-cellulose_stem(%solids)
Lignin_stem(%solids) S lignin Crude_protein_stem(%solids) S protein Cellulose_leaf L Cellulose Hemicellulose_leaf L h-cellul Lignin_leaf L lignin Crude_protein_leaf LAgro 643 QTL Mapping QTL Verification Multiple Traits protein

Rio BTx623
HeightHgt_(cm) Flowering_time Flower Tiller
stand_density

QTL Mapping For Multiple Traits in College Station, TX 2005

Chr. 1 Chr. 2 Chr. 3 Chr. 4 Chr. 5 Chr. 6 Chr. 7 Chr. 8 Chr. 9 Chr. 10

S diameter Mean_stem_thickness
Total_Biomass_dry_yield Biomass

Grain Stem Leaf Brix

Grain_dry_matter_yield Stem_structural_dry_yield Leaf_dry_matter_yield

Sugar Sugar_yield
Brix Starch_grain G starch

G fat Fat_grain Crude_protein_grain G protein

ADF_grain G fiber Thousand_Seed_Weight G 1K Wt. Cellulose_stem_(%solids) S cellulose

S h-cellu Hemi-cellulose_stem(%solids)
Lignin_stem(%solids) S lignin Crude_protein_stem(%solids) S protein Cellulose_leaf L Cellulose Hemicellulose_leaf L h-cellul Lignin_leaf L lignin Crude_protein_leaf LAgro 643 QTL Mapping QTL Verification Multiple Traits protein

Rio QTL College Station, TX 2005 QTL Co-localization Linkage vs. Plieotropy BTx623 Chr. 1 Chr. 2 Chr. 3 Chr. 4 Chr. 5 Chr. 6 Chr. 7 Chr. 8 Chr. 9
HeightHgt_(cm) Flowering_time Flower Tiller
stand_density

Chr. 10

S diameter Mean_stem_thickness
Total_Biomass_dry_yield Biomass

Grain Stem Leaf Brix

Grain_dry_matter_yield Stem_structural_dry_yield Leaf_dry_matter_yield

Sugar Sugar_yield
Brix Starch_grain G starch

G fat Fat_grain Crude_protein_grain G protein

ADF_grain G fiber Thousand_Seed_Weight G 1K Wt. Cellulose_stem_(%solids) S cellulose

S h-cellu Hemi-cellulose_stem(%solids)
Lignin_stem(%solids) S lignin Crude_protein_stem(%solids) S protein Cellulose_leaf L Cellulose Hemicellulose_leaf L h-cellul Lignin_leaf L lignin Crude_protein_leaf L protein

QTL Meta-analysis Using 50 separate disease resistance QTL studies in maize to understand broad spectrum quantitative disease resistance
Wisser RJ, Balint-Kurti PJ, Nelson RJ (2006) The genetic architecture of disease resistance in maize: a synthesis of published studies. Phytopathology 96:120129

Agro 643 Epistasis HIFS

QTL Meta-analysis and Candidate Genes Leverage 16 separate published QTL studies along with a sequenced genome helps to further gain detection power.
Wisser, R.J., Q. Sun, S.H. Hulbert, S. Kresovich, and R.J. Nelson. 2005. Identification and characterization of regions of the rice genome associated with broadspectrum, quantitative disease resistance. Genetics 169:22772293.

Agro 643 Epistasis HIFS

Power of QTL detection is directly related to heritability

100 N = 600 90

Power (%)

80 70 60 50 40 30 20 10 0 0.4 0.5 0.6 0.7 0.8 0.9 1.0 N = 100 N = 300

Heritability
Utz and Melchinger, 1994
Agro 643 QTL Mapping Sample Size and Power

Bernardo, 2004

Bi-Parental Linkage QTL Mapping

X Cross parents different at trait(s) of interest Self F1 F2s OR

Collect DNA (molecular) markers data on all progeny

F1

Perform statistical test for significance (Genotype vs. Phenotype) based on a null model Marker Phenotype Significance
RFLP 12 AFLP 57 SSR 26 Height 0.0001*** Grain Weight 0.051 Disease Resistant 0.0023**

Self to homozygosity Is this marker not important? Or Did we not have enough data to reject the null hypothesis at (p< 0.05)?

RILs

Real Life Challenges? In Real Life If we only had five markers across a chromosome, we would not capture a lot of what is going on which can lead to reduced power and/ or increased error! L M N O P
Chromosome X INDIVIDUAL 1 INDIVIDUAL 2 INDIVIDUAL 3 INDIVIDUAL 4 INDIVIDUAL 5 INDIVIDUAL 6 INDIVIDUAL 7 INDIVIDUAL 8 INDIVIDUAL 9

Agro 643 QTL Mapping Composite Interval Mapping

Bi-Parental Linkage QTL Mapping Resolution : Limited by Recombination Events

X Cross parents different at trait(s) of interest No recombination F1
Raven, 1999.

F2s

Simulated: 100 loci , 1 chromosome, 15 individuals

Self to homozygosity

27 detectable recombination events

RILs

36 detectable recombination events Only here do we get close to gene resolution

Sample Size and Power Before asking the questions of what sample size we should use and how much detection power we expect to have, we should note the factors that influence this. 1) What is the experimental goal? 2) What is the heritability of a trait? 3) How many QTL are involved? The more QTL to detect, the more individuals and markers you will need 4) How large of a QTL effect do you want to be able to find? To detect smaller and smaller QTL effects we need an exponentially larger population because of the associated error 5) What are the effects of the trait? Dominant, additive, over-dominant, this will effect the population you use and hence the sample size. 6) Is there any reason to believe there is epistasis? Yes! Do you want to detect it probably do not have the resources too. 7) Is there any reason for using a smaller than optimum sample size? Yes! Time to create population, money to genotype and phenotype population
Agro 643 QTL Mapping Sample Size and Power

Many QTL Can Be / Are False!

Bernardo, R. 2004. What proportion of declared QTL in plants are false? Theor. Appl. Genet. 109:419424.

Note that this was a simulation of an F2 population (1 environment) with 150 individuals, 100 markers, multiple regression for detection, no permutation test and =0.05. When the author changed any of these things the results were not so dire.
Agro 643 QTL Mapping General

Null Null hypothesis hypothesis is True is False Reject the Type 1 Null Error! Hypothesis Fail to Type 2 Reject the Error! Null Hypothesis Type III error: provides the right
answer to the wrong question (discrepancy between the research focus and the research question )

Stability in QTL
Most journals would not accept a QTL study with any less than three environments. A major reason for this has to do with stability. If a QTL is only detected in one environment, it suggests it may only be useful in that one environment. A good example is photoperiod response. If two flowering time QTLs are identified, one expressed only in northern latitudes (photoperiod sensitivity) and one expressed in all environments (true flowering time). Introgression of the photoperiod sensitivity QTL is likely to decrease the yield stability where as introgressing a true flowering time QTL is likely to make the plant behave predictably.

Context Dependency in QTL

The same allele in different backgrounds will have different effects

Agro 643 - Genetic and Environmental Variances Yield stability

QTL Verification QTL Verification Locus effect quantification How large is the difference between alleles? Plieotropy Would unmeasured traits be affected? Are there negative effects? QTL x Environment Interaction Is there a year or environment effect? How large? QTL x QTL interaction Is there epistasis that may make some QTL more or less valuable Underlying gene(s) Can we, do we want to identify these? Approaches for Verification Compare multiple traits Compare in multiple environments Develop and use independent populations Fine Mapping (discussed later) Create Near Isogenic Lines (discussed later) Association mapping verification (discussed later) Cloning & Transformation (discussed later)

Agro 643 QTL Mapping QTL Verification

QTL Cloning Using Fine Mapping

Go from a statistically identifiable region to a functional polymorphism that can be tested directly.

MARKER A MARKER B

Identified QTL

Backcross NILs

Heterogeneous Inbred Families (HIFs)

NIL looks just like recurrent parent except with substitution at gene

Why do We Want to Clone QTL(s)?

Mapped QTL ($$$$+) - Identify genetic control of a trait (inheritance, position, co-localization) - Identify molecular markers for Marker Assisted Selection (MAS) - Identify homology with other genes/ other species (comparative mapping) Cloned QTL ($$$,$$$+) - Perfect marker for gene to use in MAS - Transform into another organism (G.M.O.) - Knock out, turn off, over-express, etc. - Identify the genetic pathway (may suggest other genes of interest)

What is the pathway for stem sugar accumulation?

- Identify homology with other genes/ other species

What do these genes do in maize and sugarcane?

- Look for natural variation in other alleles at that gene

Are there other alleles that would accumulate even more sugar?
Forward Genetics: Phenotypic Variation QTL Gene Functional Polymorphism Reverse Genetics: Gene Functional Polymorphism Phenotypic Variation

Cloning Crop Improvement Genes

Cloning the gene is when we know the DNA sequence of the gene CAUSING the morphological (phenotypic) difference.

We do this by finding and mapping molecular markers closer and closer to our morphological marker.

This lets us do many neat things for both crop improvement and evolution studies but is A LOT of work! Example: Cloning the First Domestication Gene - Tomato fw2.2

Doebley JF, Gaut BS, Smith BD (2006) The molecular genetics of crop domestication. Cell. 29;127(7): 1309-21

Markers for QTL Cloning

Need a very high density of markers around the gene of interest

Agro 643 Epistasis HIFS

QTL Cloning Using Fine Mapping

Li, J., M. Thomson, and S.R. McCouch. 2004. Fine mapping of a grain-weight quantitative trait locus in the pericentromeric region of rice chromosome 3. Genetics 168:2187 2195.

Gene Cloning In the F2 is Possible When There is A Large Effect

Orsi CH, Tanksley SD. 2009. Natural variation in an ABC transporter gene associated with seed size evolution in tomato species. PLoS Genet. 5(1):e1000347.

150 plants

1000 plants

9000 plants!

Dissecting a QTL Yielded Two Genes With Opposite Effects

Thomson, M. J., J. D. Edwards, E. M. Septiningsih, S. E. Harrington and S. R. McCouch, 2006 Substitution mapping of dth1.1, a flowering-time quantitative trait locus (QTL) associated with transgressive variation in rice, reveals multiple Sub-QTL. Genetics 172: 25012514.

Dissecting A Quantitative Trait: Time Versus Resolution

5 Research Time in Years Positional Cloning NILs RI QTL Mapping

Associations 1 1 1x104 Resolution in bp

F2 QTL Mapping 1x107

Stolen from Dr. Edward Buckler USDA-ARS

Resolution Versus Allelic Range

>40 Alleles Evaluated Associations In Diverse Germplasm

Associations In Narrow Germplasm Positional Cloning 1 1x104 Resolution in bp NIL

Pedigree

F2 or RIL Mapping 1x107

Stolen from Dr. Edward Buckler USDA-ARS

Improving A Quantitative Trait: Cost vs. Usefullness

more Costs For a Useful Study NILs

Associations HIFs RIL QTL Mapping

less less

F2 QTL Mapping Selection Mapping

Genomic Selection more

Usefulness to Crop Improvement

Not Stolen

Combines association mapping with Bi-parental linkage mapping

FIGURE 1. Diagram of genome reshuffling between 25 diverse founders and the common parent and the resulting 5000 immortal genotypes

Nested Association Mapping (NAM)

Yu, J. et al. Genetics 2008;178:539-551 Copyright 2008 by the Genetics Society of America

An aside into segregation distortion cont

Agro 643 - Relationships and Genetic Diversity Inbreeding Coefficient

Technology Needed for MAS (and Genetic Fingerprinting) MARKERS x GENOTYPES = DATA POINTS Most of the applications we have discussed so far (gene / polymorphism discovery) involve the identification of many markers on a few number of genotypes to cover the genome.
QTL mapping: 100 1,000 markers X 100-500 individuals = 10,000 to 500,000 data points Association mapping: 100 1,000,000 markers X 100-7000 individuals = 10,000 to 7,000,000,000 data points

Once the subset of useful/ important markers has been established, we now want to evaluate these over many individuals. This requires different technology to be cost efficient.
MAS: 1 100 markers X 100 10,000 individuals = 10,000 to 1,000,000 data points

In general this is a need only for plant and animal breeders, biotechnologists and some people who do gene diversity studies therefore the technology market is smaller than for what human geneticists and evolutionary biologists may use.

Agro 643 MAS and Genomic Selection Genotyping Platforms

Transition To Use (Linked) Markers to Select for Crop Improvement Traits

Once we find a marker linked to our trait of interest (exp. disease resistance) we can use this marker to make selections rather then screen all of the plants for disease resistance. This is called Marker

Assisted Selection

!!! NOTE: This marker is unlikely to be the point mutation or the gene that gives the disease resistance. It is only LINKED to the disease resistance gene of interest. Thus: WE DO NOT KNOW WHICH GENE CAUSES THE DISEASE RESISTANCE WITH THE MARKER, BUT WE CAN MAKE SELECTIONS FOR DISEASE RESISTANT PLANTS BASED ON THE MARKER.