Sie sind auf Seite 1von 11

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.

) _______________________________________________________________________________________

A Lactobacillus-derived biosurfactant inhibits biofilm formation of human pathogenic Candida albicans biofilm producers
L. Fracchia1,2, M. Cavallo1,2, G. Allegrone1,2, and M.G. Martinotti1,2
1

Department of Chemical, Food, Pharmaceutical and Pharmacological Sciences, University of Eastern Piedmont, Via Bovio 6, 28100, Novara, Italy. 2 Drug and Food Biotechnology Center, Via Bovio 6, 28100, Novara, Italy. Fifteen lactic-acid bacteria, isolated from fresh fruits and vegetables produced biosurfactants in the mid-exponential phase (5 hours). Twelve isolates were genotipically identified to belong to the genus Lactobacillus. Among these, the Lactobacillus sp. CV8LAC, isolated from cabbage, showed the largest oil spreading halo. Extracted CV8LAC biosurfactant reduced the water surface tension from 70.92 mN/m to 47.68 mN/m and its CMC was 106 g/mL. The CV8LAC biosurfactant significantly (p<0.05) inhibited the adhesion of two Candida albicans pathogenic biofilmproducer strains (CA-2894 and DSMZ 11225) in pre-coating and co-incubation experiments. In pre-coating assays, biofilm formation of the strain CA-2894 was reduced by 82% at concentration of 312.5 g/ml and that of DSMZ 11225 by 81% at 625 g/ml. In co-incubation assays, biofilm formation of CA-2894 and DSMZ 11225 was inhibited by 70% at 160.5 g/well and by 81% at 19.95 g/well, respectively. No inhibition of both C. albicans planktonic cells was observed, thus indicating that the biosurfactant displayed anti-biofilm formation but not antimicrobial activity. Keywords Lactobacillus sp. CV8LAC; biosurfactant; Candida albicans; biofilm

1. Introduction
Probiotic bacteria, such as lactobacilli, are well known to have a positive effect on the maintenance of human health [13]. These bacteria, which constitute an important part of natural microbiota, are recognized as potential interfering bacteria by producing various antimicrobial agents such as organic acids, hydrogen peroxide, carbon peroxide, diacetyl, low molecular weight antimicrobial substances, bacteriocins, and adhesion inhibitors, such as biosurfactants [3]. In particular, lactobacilli have long been known for their antimicrobial activity and capability to interfere with the pathogens adhesion on epithelial cells of urogenital and intestinal tracts [4-6], and for their anti-biofilm production on catheter devices [7] and voice prostheses [8, 9]. The mechanisms of this interference have been demonstrated to include, among others, the release of biosurfactants [10-12]. Biosurfactants have recently become an important product of biotechnology for industrial and medical applications [13-15]. Adsorption of biosurfactants to a substratum surface modifies its hydrophobicity, interfering in the microbial adhesion and desorption processes [16]; in that sense, the release of biosurfactants by probiotic bacteria in vivo can be considered as a defence weapon against other colonizing strains in the urogenital and gastrointestinal tracts [17] and on medical devices. Biosurfactants produced by lactobacilli, in fact, have been shown to reduce adhesion of pathogenic micro-organisms to glass [18], silicone rubber [19], surgical implants [20] and voice prostheses [8, 9]. Consequently, previous adsorption of biosurfactants can be used as a preventive strategy to delay the onset of pathogenic biofilm growth on catheters and other medical insertional materials, reducing the use of synthetic drugs and chemicals [16, 21, 22]. Candida species are of increasing concern as causative agents of fungal biofilm related infections on prosthesis in odontoiatry and otorinolaringoiatry [23-25]. Development of new technologies based on the control of the Candida spp. biofilm growth is, thus, foreseen as a major breakthrough in medicine and will have a strong impact in the clinical practice and preventive medicine. Many lactobacilli are known to inhibit the growth of Candida spp. in different ways, such as competition for adhesion sites or production of different antagonistic metabolites which inhibit its growth [26, 27] however, the specific role of lactobacilli-produced biosurfactant on Candida albicans biofilm has been rarely investigated [28, 12]. The aim of this study was to determine the anti-biofilm capability of a biosurfactant produced by a Lactobacillus sp., isolated from cabbage, against two pathogenic strains of C. albicans biofilm producers.

2. Materials and Methods


2.1 Collection of samples and lactic acid bacteria isolation Three cucumbers and one head of lettuce were collected from different local markets of Novara in Italy, seven apples, one cabbage and five pears were directly obtained from a producer of biological fruit and vegetable in a rural area of

FORMATEX 2010

827

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

Piedmont, Italy. All samples were collected aseptically in sterile poly-bags kept in an ice-box, and transported to the laboratory for lactic acid bacteria isolation. Samples were thoroughly washed with sterile water and blended with a sterile blender (Carlo Erba, Italy) for one minute. Ten grams of each sample were homogenised in a stomacher (Easy Mix, AES Laboratoire, Bruz, France) with 90 ml of 0.85% (w/v) sterile physiological saline and incubated for one hour at 28C at 120 rpm. Samples were then serially diluted (10-1 to 10-8) in saline and 150 l were plated onto Man Rogosa and Sharpe (MRS) (Oxoid, Italy) for lactic acid bacteria (LAB) isolation, and Rogosa Agar (Oxoid, Italy) for lactobacilli. Plates were incubated under anaerobic conditions in an AnaeroGenTM Compact system (Oxoid, Italy) at 28C up to 7 days. After 24 h and, daily, up to 7 days, colonies with different morphology, colour and dimension were selected with the help of a stereomicroscope (Nikon SMZ200) and isolated. Purity of the isolates was checked by streaking again and sub-culturing on fresh agar plates of the isolation media, followed by microscopic examinations. Purified strains of LAB were stored in MRS broth with 15% (v/v) glycerol at -80C. 2.2 Phenotypic characterization To select all the presumptive isolates under the scope of present study, initially, conventional methods of identification based on morphological, cultural, and biochemical characteristics were followed [29]. Isolates were Gram-stained to select for Gram-positives and to study cell morphology. Catalase and oxidase tests were also performed. Finally, CO2 production from glucose was evaluated by means of the Hot-loop test [30] on strains resulted catalase and oxidase negative. 2.3 Genotypic characterization Total genomic DNA was extracted enzimatically from 800 L samples of 24 h cultures grown in MRS broth at 28C according to the method of Campoccia et al. [31]. The strain Lactobacillus delbrueckii subsp. delbrueckii 20074 obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany) was used as reference strain. The extracted DNA was quantified spectrophotometrically according to the method of Sambrook et al. [32]. In order to select members of the genus Lactobacillus, two PCR were performed with genusspecific primers targeting the 16S rRNA genes with the conditions described by Roopashri and Varadaraj [33] and by Byun et al. [34]. PCR amplifications were performed in an automated DNA thermal Cycler (Applied Biosystem 2720) following the conditions as detailed in Table 1. The synthesized primers used in this study were obtained from Sigma Genosys, UK. The PCR products were run in 1% agarose gels containing 0.4 g/mL ethidium bromide in Tris Borate EDTA buffer pH 8.00 (TBE buffer) (Sigma-Aldrich) for 1.5 h at 80 V and documented in Gel Documentation System (ChemiDocTM XRS System, Biorad). The isolates that failed to exhibit amplification of the specific 16S rRNA product were discarded, while the others were further characterized by RAPD-PCR, in order to determine their genetic diversity. RAPD-PCR analysis was carried out by means of the random primer M13 (5-GAGGGTGGCGGTTCT-3) and the amplification conditions described by Schillinger et al. [35]. The PCR products were run in 1.8% agarose gels containing 0.4 g/mL ethidium bromide in TBE buffer for 3 h at 60 V. RAPD-PCR profiles were analyzed by means of the GelCompar II program package (version 5.1; Applied Maths, Kortrijk, Belgium). Profiles were normalized using the molecular weight markers on each gel as a reference. The similarity matrix was calculated using the Dice formula and the clustering method was UPGMA (Unweighted Pair Group Method With Arithmetic Averages). The Lactobacillus sp. CV8LAC was further characterized by sequencing the total 16S rRNA gene (Colony PCR Project Report, U.S.A.) and the sequence analyzed by means of the Ribosomal Database Project [36].
Table 1 Nucleotide sequence of specific PCR primers and conditions for targeted genes among microbial cultures.

Microbial culture Lactobacillus spp.

Target gene 16S rRNA

Primers sequence / PCR conditions F 5 GGAACTCAGACACGGTCCAT 3 R 5 TACGGATTCCACCGCTAAAC 3 95C 3; 35 cycles of 94C 40 s; 46C 40 s; 72C 2; final one cycle of 72C 15 [33] LactoF 5 TGGAAACAGRTGCTAATACCG 3 LactoR 5 GTCCATTGTGGAAGATTCCC 3 95C 15; 30 cycles of 95C 15 s, 62C 60 s, 72C 60 s; final one cycle 72C 7 [34]

Amplicon size (bp) 385

Lactobacillus spp.

16S rRNA

231233

2.4 Surface activity To select the isolates showing the highest surface activity, bacteria were cultivated in 100-mL flasks containing 20 mL MRS broth at 28C in static conditions for 20 hours. At 5 and 20 h, 1 mL of the culture broths were centrifuged at 8,000g for 10 min and the supernatants filter sterilized. Surface activity was measured by the oil spreading assay [37]

828

FORMATEX 2010

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

by using 20 L of Motor Oil 10 W-40 (Selenia, Italy) previously deposited onto the surface of 20 mL of distilled water in a Petri dish (90 mm in diameter) to form a thin membrane. Twenty microlitres of each bacterial supernatant were gently put onto the centre of the oil membrane. Diameters of clearly formed oil displaced circle were measured. 2.5 Growth curve and biosurfactant production of Lactobacillus sp. CV8LAC Two-hundred millilitres of modified MRS broth without Tween 80 were inoculated with 100 L of an overnight subculture of Lactobacillus sp. CV8LAC to obtain an inoculum density of about 1.0106 CFU/mL. Bacterial growth was followed with time by viable count on MRS agar and by reading the optical density at 600 nm at regular time intervals up to 30 h. Bacterial counts were expressed as Log10CFU/mL. Simultaneously, biosurfactant production was estimated by the oil spreading method (see Paragraph 2.4). 2.6 Biosurfactant production and extraction For biosurfactant production, a seed culture was prepared by transferring a single colony of the CV8LAC strain from a MRS agar culture into 20 mL of modified MRS broth without Tween 80 and incubating overnight at 28C in static conditions. Thereafter, the 20 mL were inoculated in 1 L of modified MRS broth in a 5 L flask and incubated again at 28C for 5 h in static conditions. The broth culture was then centrifuged at 8,000g for 30 min and the supernatant was collected. To exclude that the biosurfactant was adherent to the bacterial cell wall, bacteria separated from the supernatant were washed three times, re-suspended in 500 L of saline and tested by means of the oil spreading method. For the biosurfactant extraction, the supernatant was acidified to pH 2 with 6 N HCl, stored overnight at 4C and extracted three times with ethyl acetate/methanol (4:1). The organic fraction was evaporated to dryness under vacuum condition, acetone was added to recover the raw biosurfactant. Acetone was evaporated and biosurfactant was collected and weighted. In order to estimate the molecular weight of the CV8LAC biosurfactant and concentrate it, a portion of the supernatant was filter-sterilized and passed through Vivaspin 20 ultrafiltration spin columns (Sartorius) with different cut-off (50,000 and 30,000 MW). A preliminary analytical thin-layer chromatography (TLC) was carried out on pre-coated silica gel 60 F254 plates (Merck Co. Inc. Damstadt, Germany). TLC plates were spotted with the extracted biosurfactant sample dissolved in acetonitrile, and developed using acetonitrile/water, 6:3 by volume, as mobile phase. 2.7 Surface tension and critical micelle concentration To measure the surface tension between biosurfactant solution and air, an extracted-enriched biosurfactant solution was prepared in sterile demineralized water at 2000 g/mL. Distilled water was used for calibration. Twenty milliliters of biosurfactant solution were used for each measurements, carried out by means of a platinum-iridium ring tensiometer Du Noy (KSV Sigma 703 D); the ring was placed just below the surface of the solution, subsequently the force to move this ring from the liquid phase to the air phase was determined in triplicate. Critical micelle concentration (CMC), known as the concentration of surfactants above which micelles are spontaneously formed, was determined on serially diluted biosurfactant solutions in distilled water. Surface tension of each dilution was determined in triplicate. Maximal standard deviation associated with these surface activity measurements was 0.30 mN/m. The CMC was estimated from the intercept of two straight lines extrapolated from the concentration-dependent and concentration-independent sections of a curve plotted between biosurfactant concentration and surface tension values. 2.8 Biofilm production by Lactobacillus sp. CV8LAC The capability of the strain CV8LAC to produce biofilm in different media was tested by means of the Calgary Biofilm device (CBD, Innovotech, Edmonton, AB, Canada) as described by Harrison et al. [38]. The CBD consists of a polystyrene lid with 96 pegs that may be fitted inside a standard 96-well microtiter plate. Each peg of the CBD has a surface area of approximately 109 mm2. A stock culture of Lactobacillus sp. CV8LAC stored at -80C was streaked onto MRS agar and incubated overnight at 28C in anaerobic conditions. A second subculture of CV8LAC was grown again at the same conditions; then by means of a cotton swab, some colonies from this fresh secondary subculture were picked and suspended in MRS broth to match a 1.0 McFarland standard, corresponding to approximately 3.0108 CFU/mL. This suspension was diluted again 30-fold respectively in MRS broth (Oxoid, Italy), Rogosa broth (Oxoid, Italy) and LAPTg (15 g/L peptone, 10 g/L tryptone, 10 g/L yeast extract, 10 g/L glucose, and 1 mL/L Tween 80, final pH 6.5) to create an inoculum of approximately 1.0107 CFU/mL for the CBD. Then, 200 L of the bacterial inoculum were added to each well of the microtiter plate; negative controls consisted in broth alone. The CBD peg lid was then fitted inside the microplate and the assembled device was placed on a rotatory shaker at 150 rpm in a humidified incubator for 24 h. In parallel, in order to verify the starting cell number in the inoculum (1.0107 CFU/mL), serial dilutions in saline were prepared in

FORMATEX 2010

829

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

microtiter plate and 20 L of each dilution were spot plated onto each corresponding agar media. Plates were incubated for the appropriate time and scored for cell number calculation. After 24 h, biofilms were rinsed twice by inserting the peg lids into microtiter plates with 200 L/well of 0.85% saline for 2 min to remove loosely adherent cells. The lid of the CBD was then inserted into 200 L of each corresponding broth in the wells of a microtiter plate. Biofilms were disrupted from the peg surface using an Aquasonic 250HT ultrasonic cleaner (VWR International) set at 60 Hz for 10 min. The disrupted biofilm cells were serially diluted in 0.85% saline, and then plated onto the corresponding agar media. Agar plates were incubated for 24 h at 28C in anaerobic conditions and then enumerated as above described; results were expressed as Log10CFU/peg. 2.9 Culturing and storage of Candida albicans strains The strain Candida albicans CA-2894, isolated from human tongue, was purchased from The Belgian Co-ordinated Collections of Microorganisms (BCCM) and the strain Candida albicans DSMZ 11225, isolated from blood, was from The German Collections of Microorganisms and Cell Cultures (DSMZ). Strains were cultivated on Yeast Nitrogen Base agar (YNB) (Sigma-Aldrich) and stored in the same medium added with 15% glycerol (v/v) at -80C. 2.10 Biofilm production by Candida albicans CA-2894 and DSMZ 11225 In order to determine the best conditions for the biofilm production of the two C. albicans strains, three different culture media, Yeast Nitrogen Base (YNB) (Sigma-Aldrich), Universal Medium for Yeast (UMY) (Medium 186, DSMZ, Germany) and Sabouraud Dextrose Broth (SDB) (Sigma-Aldrich) were used and quantification was performed by means of the crystal violet method [39-40]. Starting from 24 h liquid cultures in the media above mentioned, yeast suspensions of approximately 1.0107 CFU/mL were made. For the Candida biofilm assay, 72 wells (6 rows of 12 wells) of flat-bottomed polystyrene 96-well microtiter plates (Greiner Bio-One) were inoculated with 150 L of each yeast strain suspension and 24 control wells were filled with each sterile medium. After 3 h of adhesion, supernatants (containing non-adhered cells) were removed from each well and plates were rinsed using 100 L of saline. Subsequently, 150 L of each fresh media were added to wells and the plates were further incubated at 37C for a minimum time of 24 h at 75 rpm. For biofilm quantification and fixation, the supernatants were removed, wells were rinsed with 100 L of saline and 100 L of 99% methanol was added for 15 min. Then, after supernatants removal, plates were air-dried. One hundred microlitres of a 2% crystal violet (CV) solution was added to all the wells. After 20 min, the excess CV was removed by washing the plates with distilled water and air-dried. Finally, bound CV was released by adding 150 L of 33% acetic acid (Sigma-Aldrich). The absorbance was measured at 590 nm. All steps were carried out at room temperature. Biofilm formation was analyzed at 24, 48 and 72 h. Absorbance values three times higher than the standard deviation of the sterile control indicated a good biofilm production; inversely, absorbance values three times lower indicated a lack of biofilm production. 2.11 Biofilm inhibition assay against Candida albicans Biofilm inhibition assays with the extracted CV8LAC biosurfactant were performed in pre-coating and co-incubation experiments. Briefly, in pre-coating experiments (modified from Gudia et al. [12]), flat-bottomed polystyrene 96-well microtiter plates were filled with 200 L of different concentrations of CV8LAC biosurfactant (ranging from 2,500 g/mL to 78 g/mL) and incubated for 24 h at 37C at 130 rpm. Control wells containing sterile water only were treated in the same way. Biosurfactant solutions were, then, removed and the plates carefully washed twice with Phosphate Buffer Saline (PBS) pH 7.2 to remove non-adhering biosurfactant. Aliquots of 150 L of each C. albicans suspension in YNB broth at the concentration of 1.0107 CFU/mL were then added to each well and plates incubated at 37C for 3 h at 75 rpm. After this time, non-adherent cells were removed by gently washing twice the wells with PBS and then 150 L of fresh YNB broth were added to wells. Plates were incubated again at 37C for 48h at 75 rpm. In co-incubation experiments, C. albicans inocula at the concentration of 1.0107 CFU/mL were added to microtiter wells together with different concentrations of the extracted biosurfactant, ranging from 160 g/well to 2.5 g/well (800 g/mL to 17.5 g/mL) and incubated for 3 hours as previously described. After this time, procedures were exactly the same as for the pre-coating experiments except for the fact that each well was filled with fresh YNB added with the different biosurfactant concentrations. Incubation conditions were as above. C. albicans biofilm production of both strains was quantified by the crystal violet method described in Paragraph 2.10. Percentages of microbial adhesion were calculated as described in Eq. (1). % Microbial adhesionc= (Ac/A0) 100 (1)

Where Ac represents the absorbance of the well with biosurfactant concentration c and A0 the absorbance of the control well. This allows to estimate the percentage of microbial adhesion in relation to the control wells, which were set at 100% indicating total cells adhesion in the absence of biosurfactant.

830

FORMATEX 2010

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

CV8LAC biosurfactant activity on planktonic cells of both C. albicans strains was evaluated on supernatants removed from wells at 48 hours. Briefly, supernatants from each well were serially diluted in saline and plated onto YNB agar. Incubation was then carried out for 48 h at 37C. Results were expressed as Log10CFU/well. 2.12 Statistical analysis The Students t test was performed when the aim was to investigate whether the difference in between the experimental values obtained under different conditions could be considered significant.

3. Results
3.1 Phenotypic and genotypic characterization

Fifty bacterial isolates and 7 yeasts were obtained from fresh fruit and vegetable samples. In particular, 38 bacteria were isolated from cabbage, 1 from pear, 6 from lettuce, 4 from cucumber and 1 from apple; 6 yeasts were isolated from pear and one from apple. According to Gram-staining, 32 bacterial isolates were non spore-forming Gram-positive and among these 14 were rods, 6 cocci and 12 ovoid cocci. All of them were considered lactic acid bacteria (LAB) based on CO2 production and absence of catalase and oxidase. In order to identify members of the genus Lactobacillus, a genus-specific PCR was performed on the rod shaped bacteria. Among 14 isolates, 12 resulted in positive amplifications with both couples of primers (Figure 1) and were further characterized by RAPD-PCR by means of the random primer M13 (Figure 2). The analysis of genetic profiles indicated that the isolates were genetically different, with similarity lower than 75%, and were grouped in four clusters. The isolate CV8LAC was further characterized by sequencing the complete 16S rRNA gene. Sequence alignment in the Ribosomal Database Project [36] confirmed that it belongs to the genus Lactobacillus but, at the moment, classification at the species level has not been done yet.

a)

b)

Fig. 1 Agarose gel electrophoresis showing the Lactobacillus genus-specific PCR products amplified with primers a) R and F [33] and b) Lacto F and Lacto R [34]. Legend: a) 1: CV1LAC, 2: CV2LAC, 3: CV3LAC, 4: CV4LAC, 5: CV5LAC, 6: CV6LAC; 7: CV7LAC, 8: CV8LAC, 9: CV14LAC, 10: CV1I, 11: CV16I, 12: CV21I, 13: CV7T7I, 14: CV15B1, 15: L. delbrueckii, 16: Lactococcus lactis (this study), 17: negative control. M: molecular marker b) M: molecular marker, 1: CV1LAC, 2: CV2LAC, 3: CV3LAC, 4: CV4LAC, 5: CV5LAC, 6: CV6LAC; 7: CV7LAC, 8: CV8LAC, 9: CV14LAC, 10: CV1I, 11: CV7T7I, 12: CV15B1, 13: L. delbrueckii.

Fig. 2 Dendrogram obtained by using RAPD patterns generated with M13 primers from isolates belonging to the genus Lactobacillus. Patterns were grouped with the unweighted pair group method with arithmetic averages (UPGMA). The scale represents the percentage of similarity among isolates.

FORMATEX 2010

831

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

832

FORMATEX 2010

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

FORMATEX 2010

833

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

834

FORMATEX 2010

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

released by Lactobacillus species are named surlactin and have a glycoproteinaceus character [10, 28, 41, 43]. In literature, release of glycosyldiglycerides as biosurfactants produced by lactobacilli has also been reported [44]. It is also known that lactobacilli, among other species, secrete lipoteichoic acid into the culture medium during exponential growth [45]. CV8LAC biosurfactant displayed a considerable anti-adhesive activity against two biofilm producers strains of C. albicans. In particular, in co-incubation experiments, the biofilm formation of strain DSMZ 11225 was reduced by 81% at the very low concentration of 19.95 g/well (about 100 g/mL). These results looks very encouraging since, to our knowledge, this is the first time that a Lactobacillus biosurfactant shows such a high anti-adhesive activity against C. albicans biofilm formation. Other biosurfactants, produced by Lactobacillus acidophilus and Lactobacillus paracasei ssp. paracasei A20, showed lower anti-adhesive activities against C. albicans strains (adhesion reduction of about 25% and 50%, respectively) at higher concentration [12, 28]. However, successful inhibition of C. albicans biofilm formation has been observed by treating different materials with biosurfactants obtained by probiotics other than lactobacilli or with probiotics suspensions (including lactobacilli). Most of these studies investigated the potential role of probiotics and their surface-active products on silicone-rubber voice prostheses [8, 9, 19, 46, 47, 48]. Anti-adhesive activity of biosurfactant produced by lactobacilli has been described also against biofilm formation of bacterial pathogens by preconditioning materials used in the urogenital tract or the oral cavity, glass or plastic [12, 18, 28, 41, 42]. Results obtained by our laboratory, as well, indicated the CV8LAC biosurfactant efficacy against biofilm formation of Listeria monocytogenes, Salmonella arizonae, Escherichia coli and Staphylococcus aureus on polystyrene and of Listeria monocytogenes on stainless steel. Remarkably, the activity of CV8LAC biosurfactant was not related to a direct antimicrobial action, as observed by Gudia et al. [12], Rodrigues et al. [8, 11, 48, 49]. Similarly to what observed by Velraeds et al. [41], Rodrigues et al [16], Vesterlund et al. [50], Walencka et al. [42] with their products, CV8LAC biosurfactant inhibited pathogen adhesion without affecting cell growth. Thus, the way in which these surfactants influence bacterial-surface interactions seems to be more closely related to changes in surface tension and bacterial cell-wall charge. Surfactants may affect both cell-to-cell and cell-to-surface interactions [42]. Our results support the opinion that lactobacilli-derived biosurfactants remarkably affect these interactions and, as a result, the surface is made less supportive for bacterial deposition. In conclusion, the anti-adhesive properties of the CV8LAC biosurfactant against two Candida albicans biofilm producers suggest its potential use as an anti-adhesive product on medical devices (catheters, prosthesis, stents) to prevent Candida albicans infections.
Acknowledgements The support by Progetto Ricerca Sanitaria Finalizzata 2008 of the Piedmont Region is gratefully acknowledged. Technical support of Dr. Rosa Montella is acknowledged too.

References
[1] [2] [3] [4] [5] [6] Reid G, Burton J. Use of Lactobacillus to prevent infection by pathogenic bacteria. Microbes Infect. 2002;4:319324. Merk K, Borelli C, Korting HC. Lactobacillibacteriahost interactions with special regard to the urogenital tract. Int J Med Microbiol. 2005;295:918. Gupta V, Garg R. Probiotics. Indian J Med Microbiol. 2009;27:202209. Reid G, Bruce A, Smeianov V. The role of Lactobacilli in preventing urogenital and intestinal infections. Int Dairy J. 1998;8:555562. Reid G, Bruce AW, Fraser N, Heinemann C, Owen J, Henning B. Oral probiotics can resolve urogenital infections. FEMS Immunol Med Microbiol. 2001;30:4952. Otero MC, Nader-Macas ME. Lactobacillus adhesion to epithelial cells from bovine vagina. Communicating Current Research and Educational Topics and Trends in Applied Microbiology. A. Mndez-Vilas (Ed.) FORMATEX 20007, Badajoz Spain pp. 749-757. Hawthorn LA, Reid G. Exclusion of uropathogen adhesion to polymer surfaces by Lactobacillus acidophilus. J Biomed Mater Res. 1990;24:3946. Rodrigues L, van der Mei HC, Teixeira J, Oliveira R. Influence of biosurfactants from probiotic bacteria on formation of biofilms on voice prostheses. Appl Environ Microbiol. 2004;70:44084410. Rodrigues L, van der Mei H, Banat IM, Teixeira J, Oliveira R. Inhibition of microbial adhesion to silicone rubber treated with biosurfactant from Streptococcus thermophilus A. FEMS Immunol Med Microbiol. 2006;46:107112. Velraeds MCM, van der Mei HC, Reid G, Busscher HJ. Physicochemical and biochemical characterization of biosurfactants released by Lactobacillus strains. Colloids Surf B Biointerfaces. 1996;8:5161. Rodrigues LR, Teixeira JA, van der Mei HC, Oliveira R Physicochemical and functional characterization of a biosurfactant produced by Lactococcus lactis 53. Colloids Surf B Biointerfaces. 2006;49:7986. Gudia EJ, Teixeira JA, Rodrigues LR Isolation and functional characterization of a biosurfactant produced by Lactobacillus paracasei. Colloids Surf B Biointerfaces. 2010;76:298304. Rivardo F, Turner RJ, Allegrone G, Ceri H, Martinotti MG. Anti-adhesion activity of two biosurfactants produced by Bacillus spp. prevents biofilm formation of human bacterial pathogens. Appl Microbiol Biotechnol. 2009;83:541553. Martinotti MG, Rivardo F Allegrone G, Ceri H, Turner R. Biosurfactant composition produced by a new Bacillus licheniformis strain, uses and products thereof. International patent PCT/IB2009/055334 25 November 2009.

[7] [8] [9] [10] [11] [12] [13] [14]

FORMATEX 2010

835

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

[15] Banat IM, Franzetti A, Gandolfi I, Bestetti G, Martinotti MG, Fracchia L, Smyth TJ, Marchant R. Microbial biosurfactants production, applications and future potential. Appl Microbiol Biotechnol. 2010;87:427444. [16] Rodrigues L, Banat IM, Teixeira J, Oliveira R. Biosurfactants: potential applications in medicine. J Antimicrob Chemother. 2006;57:609618. [17] Van Hoogmoed CG, Van der Mei HC, Busscher HJ. The influence of biosurfactants released by S. mitis BMS on the adhesion of pioneer strains and cariogenic bacteria. Biofouling. 2004;20:261267. [18] Velraeds MM, Van der Mei HC, Reid G, Busscher HJ. Inhibition of initial adhesion of uropathogenic Enterococcus faecalis by biosurfactants from Lactobacillus isolates. Appl Environ Microbiol. 1996;62:19581963. [19] Busscher HJ, Van Hoogmoed CG, Geertsema-Doornbusch GI, Van Der Kuijl-Booij M, Van Der Mei HC. Streptococcus thermophilus and its biosurfactants inhibit adhesion by Candida spp. on silicone rubber. Appl Environ Microbiol. 1997; 63:38103817. [20] Gan BS, Kim J, Reid G, Cadieux P, Howard JC. Lactobacillus fermentum RC-14 inhibits Staphylococcus aureus infection of surgical implants in rats. J Infect Dis. 2002,185:13691372. [21] Singh A, Van Hamme JD, Ward OP. Surfactants in microbiology and biotechnology: part 2. Application aspects. Biotechnol Adv. 2007;25:99121. [22] Falagas ME, Makris GC. Probiotic bacteria and biosurfactants for nosocomial infection control: a hypothesis. J Hosp Infect. 2009;71:301306. [23] Crump JA, Collignon PJ. Intravascular catheter-associated infections. Eur. J. Clin. Microbiol. Infect. Dis. 2000;19:18. [24] Douglas LJ Medical importance of biofilms in Candida infections. Rev. Iberoam. Micol. 2002;19:139143. [25] Kojic EM, Darouiche RO. Candida infections of medical devices. Clin. Microbiol. Rev. 2004;17:255267. [26] Reid G, Bruce AW, McGroarty JA, Cheng KJ, Costerton JW. Is there a role for lactobacilli in prevention of urogenital and intestinal infections? Clin Microbiol Rev. 1990;3:335344. [27] Rnnqvist D, Forsgren-Brusk U, Husmark U, Grahn-Hkansson E. Lactobacillus fermentum Ess-1 with unique growth inhibition of vulvo-vaginal candidiasis pathogens. Journal of Medical Microbiology. 2007;56:15001504. [28] Velraeds MW, Van De Belt-Gritter B, Van Der Mei HC, Reid G, Busscher HJ. Interference in initial adhesion of uropathogenic bacteria and yeasts to silicone rubber by a Lactobacillus acidophilus biosurfactant. J.Med.Microbiol. 1998;47:10811085. [29] Tamang JP, Tamang B, Schillinger U, Franz CM, Gores M, Holzapfel WH. Identification of predominant lactic acid bacteria isolated from traditionally fermented vegetable products of the Eastern Himalayas. Int J Food Microbiol. 2005;105:347-356. [30] Sperber WH, Swan J. Hot-loop test for the determination of carbon dioxide production from glucose by lactic-acid bacteria. Appl Environ Microbiol. 1976;31:990-991. [31] Campoccia D, Montanaro L, Baldassarri L, An YH, Arciola CR. Antibiotic resistance in Staphylococcus aureus and Staphylococcus epidermidis clinical isolates from implant orthopedic infections. Int J Artif Organs. 2005;28:1186-1191. [32] Sambrook J, Fritsch E, Maniatis T. Molecular cloning: A Laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, 1989. [33] Roopashri AN, Varadaraj MC. Molecular characterization of native isolates of lactic acid bacteria, bifidobacteria and yeasts for beneficial attributes. Appl Microbiol Biotechnol. 2009;83:11151126. [34] Byun R, Nadkarni MA, Chhour K-L, Martin FE, Jacques NA, Hunter N. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J Clin Microbiol. 2004;42:31283136. [35] Schillinger U, Yousif NMK, Sesar L, Franz CMAP. Use of group-specific and RAPD-PCR analyses for rapid differentiation of Lactobacillus strains from probiotic yogurts. Current Microbiology. 2003;47:453-456. [36] Ribosomal Database Project. RDP Release 10, Update 20. Available at: http://rdp.cme.msu.edu Accessed May 24, 2010. [37] Morikawa M, Hirata Y, Imanaka T. A study on the structure-function relationship of lipopeptide biosurfactants. Biochimica et Biophyica Acta. 2000;1488:211-218. [38] Harrison JJ, Ceri H, Yerly J et al. The use of microscopy and three-dimensional visualization to evaluate the structure of microbial biofilms cultivated in the Calgary Biofilm Device. Biol Proced Online. 2006;8:194215. [39] Jin Y, Yip HK, Samaranayake YH, Yau JY, Samaranayake LP. Biofilm-forming ability of Candida albicans is unlikely to contribute to high levels of oral yeast carriage in cases of human immunodeficiency virus infection. J Clin Microbiol. 2003;41:2961-2967. [40] Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in microtiter plates. J Microbiol Methods. 2008;72:157-165. [41] Velraeds MMC, Van der Mei HC, Reid G, Busscher HJ. Inhibition of initial adhesion of uropathogenic Enterococcus faecalis to solid substrata by an adsorbed biosurfactant layer from Lactobacillus acidophilus. Urology. 1997;49:790-794. [42] Walencka E, Ralska S, Sadowska B, Ralska B. The Influence of Lactobacillus acidophilus-derived surfactants on staphylococcal adhesion and biofilm formation. Folia Microbiol. 2008;53:6166. [43] Goek P, Bednarski W, Lewandowska M. Characteristics of adhesive properties of Lactobacillus strains synthesizing biosurfactants. Pol. J. Natur. Sc. 2007;22:333-342. [44] Gerson DF., The biophysics of microbial surfactants: growth on insoluble substrates. In N. Kosaric (Ed.). BiosurfactantsProduction, Properties, Applications. M. Dekker, New York. 1993:269-286. [45] Pollack JH, Ntamere AS, Neuhaus FC. D-Alanyl-lipoteichoic acid in Lactobacillus casei: secretion of vesicles in response to benzylpenicillin J. Gen. Microbiol. 1992;138:849-859. [46] Busscher HJ, Bruinsma G, van Weissenbruch R, et al. The effect of buttermilk consumption on biofilm formation on silicone rubber voice prostheses in an artificial throat. Eur Arch Otorhinolaryngol. 1998;255:410-413. [47] Van der Mei HC, Free RH, Elving GJ, van Weissenbruch R, Albers FWJ, Busscher HJ. Effect of probiotic bacteria on prevalence of yeasts in oropharyngeal biofilms on silicone rubber voice prostheses in vitro. J Med Microbiol. 2000;49: 713-718. [48] Rodrigues L, Van der Mei HC, Teixeira J, Oliveira R. Biosurfactant from Lactococcus lactis 53 inhibits microbial adhesion on silicone rubber. Appl Microbiol Biotechnol. 2004;66:306-311.

836

FORMATEX 2010

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Mndez-Vilas (Ed.) _______________________________________________________________________________________

[49] Rodrigues LR, Teixeira JA, Van der Mei HC, Oliveira R. Isolation and partial characterization of a biosurfactant produced by Streptococcus thermophilus A. Colloids Surf B Biointerfaces. 2006;53:105112. [50] Vesterlund S, Karp M, Salminen S, Ouwehand AC. Staphylococus aureus adheres to human intestinal mucus but can be displaced by certain lactic acid bacteria. Microbiology. 2006;152:18191826.

FORMATEX 2010

837