DTD 5

ARTICLE IN PRESS
BRESP-20231; No. of pages: 9; 4C: 5

Brain Research Protocols xx (2005) xxx – xxx

www.elsevier.com/locate/brainresprot

Protocol

Selective capture of endothelial and perivascular cells from brain

microvessels using laser capture microdissection
Katie Kinnecom, Joel S. Pachter*
Blood – Brain Barrier Laboratory, Dept. of Pharmacology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030, USA

Accepted 15 August 2005

Abstract

Laser capture microdissection (LCM) of the major cell types comprising brain microvessels offers a powerful technology to explore the
molecular basis of the blood – brain barrier in health and disease. However, the ability to selectively retrieve endothelial or perivascular cells,
without cross-contamination from the other, has proven difficult. Additionally, histochemical methods previously described for use with
LCM have not allowed for identification of all the different size branches of the microvascular tree. Here, we describe a double
immunostaining method, combining bright-field and fluorescence microscopy, and using an extensive dehydration with xylene, to clearly
identify and spatially resolve endothelial from perivascular cells within all size microvascular branches in frozen brain sections. LCM of these
sections, coupled with RNA analysis by reverse-transcription polymerase chain reaction, revealed that captured endothelial cells show
endothelial markers but no detectable markers for astrocytes or smooth muscle cells/pericytes. Conversely, captured astrocytes or smooth
muscle cells/pericytes demonstrate their respective markers, but not those of endothelial cells. This approach has applicability to microarray
analysis, thereby enabling global gene profiling of the different cell types along the entirety of the brain microvascular tree.
D 2005 Elsevier B.V. All rights reserved.

Theme: Cellular and molecular biology

Topic: Blood – brain barrier

Keywords: Laser capture microdissection; Microvessel; Blood – brain barrier

1. Type of research
Laser capture microdissection (LCM) is a relatively new
procedure that enables retrieval of identified cellular
material, in relatively intact fashion, from microscopic tissue
domains [4]. In brief, this is accomplished by using an
infrared laser to melt a transparent ethylene vinyl acetate film
directly atop a desired region of a histological section affixed
to a microscope slide. The region of interest is then ‘‘lifted’’
from the section, and can be retrieved for subsequent protein
or nucleic acid analysis. Clearly, LCM has pioneered the way
for potentially examining genetic and metabolic events in
single cells within tissues. Not surprisingly, this technique
has found broad applicability in the examination of gene
* Corresponding author. Fax: +1 860 679 3693.
E-mail address: pachter@nso1.uchc.edu (J.S. Pachter).
1385-299X/$ - see front matter D 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.brainresprot.2005.08.002
expression by the varied cell types in the nervous system in
both normal [12,15,16] and diseased states [18,19,25].
Recently, attention has turned toward using LCM to
investigate in situ gene expression by brain microvessels
[2,17,28]. This population of vascular tributaries includes
arterioles, capillaries, and venules, and is considered, in
whole or part, to form the blood –brain barrier (BBB) [7].
The LCM approach has a decided advantage over evaluating
isolated microvessels, as isolation protocols can lead to
metabolic disturbances [13] that could potentially compro-
mise RNA integrity.
Though LCM has been successfully employed to capture
endothelial cells comprising the walls of brain microvessels,
a commonly reported caveat is contamination of this cellular
material with that of perivascular astrocytes, a serious
complication that has precluded unequivocal determination
of endothelial gene expression. The nature of this problem
 ARTICLE IN PRESS
2 K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
lies in the fact that foot processes of astrocytes very closely
appose the abluminal surface of brain microvessels, form-
ing, in association with deeper lying neuronal processes,
what has been referred to as the ‘‘neurovascular unit’’ [14].
Additionally, previous reports have resorted to identifying
brain microvessels histochemically, either by expression of
endogenous alkaline phosphatase activity [2], or reactivity
with fluorescently labeled lectins [17]. While these staining
methods have the benefit of being rapid, and thus
importantly sustain RNA integrity for gene expression of
captured material, their applicability is constrained by virtue
of producing variable labeling of different microvascular
branches. For example, alkaline phosphatase activity exhib-
its graded expression along the brain microvascular tree,
significantly depreciating as one proceeds from arterioles to
capillaries to venules [7,24]. Staining for this activity clearly
reveals only a portion of the entire brain microvessel
population [7], and thus, if used as the sole method of
vascular identification, may lead to a failure to appreciate
aspects of gene expression by the venular end of the
microvasculature. Likewise, binding sites for RCA-1 have
been described as being uniformly distributed on both
luminal and abluminal endothelial surfaces of brain capil-
laries, while displaying a less intense and lesser regular
luminal localization on arteriolar endothelial cells [24].
RCA-1 decoration of brain venular endothelial surfaces has
further been observed to be less than that of capillaries.
Another lectin, GSA-1, preferentially binds to the endothe-
lium of larger microvessels but not of capillaries [22].
Numerous additional lectins also show preferential binding
to select microvascular segments [24], urging caution of
their exclusive usage in LCM protocols.
Given these obstacles, our objective was to develop a
staining protocol that enabled rapid identification and
physical resolution of brain microvascular endothelial and
perivascular cells, and further supported RNA analysis of
LCM-acquired material. To this end, herein we describe an
immunocytochemical method for quickly resolving these
cell types within all ramifications of the microvascular tree.
This method further sufficiently conserves RNA integrity,
allowing for RNA analysis of relatively pure cell popula-
tions retrieved by LCM. It is expected that this technology
will offer unique opportunities to investigate gene expres-
sion by the different cellular elements of the neurovascular
unit, and thus assist in elaborating the mechanisms under-
lying normal and pathological cerebrovascular function.
2. Time required—5 h
1. Removal and freezing of brain tissue: 15 min.
2. Sectioning, staining, and dehydration: 60 min.
3. RNA extraction/isolation: 60 min.
4. Reverse transcription-polymerase chain reaction (RT-
PCR): 2 h.
5. Gel electrophoresis: 45 min.
3. Materials
3.1. Animals
CD-1 mice (female) were obtained from Charles River
Laboratories, Inc. (Wilmington, MA), and used typically at
6 – 10 weeks of age. Only female mice were used at this time
to avert variability possibly due to gender-based endothelial
cell heterogeneity. Animals were sacrificed by CO2 inhala-
tion, in accordance with measures stipulated by the Animal
Care and Use Guidelines of the University of Connecticut
Health Center (Animal Welfare Assurance # A3471-01).
3.2. Chemicals and molecular biology reagents
All alcohols and xylenes used for LCM were from
Arcturus (Mountain View, CA), and acetone was purchased
from Fisher Scientific (Pittsburgh, PA). RNA was extracted
from LCM samples using the Pico-Pure RNA isolation kit
from Arcturus, and reverse transcription was performed
using the One-Step kit from Qiagen (Valencia, CA).
Diethylpyrocarbonate (DEPC) and polyethylenesorbitan
monolaurate (Tween 20) were obtained from Sigma
Chemical Co. (St. Louis, MO).
3.3. Equipment
LCM was performed with a PixCell IIe microscope
equipped with epifluorescent optics, using high sensitivity
(HS) caps (Arcturus). PCR was carried out on a Robocycler
Gradient 40 (Stratagene; La Jolla, CA). Brain sections were
cut on a Microm HM 505 M cryostat (Mikron Instruments,
Inc.; Oakland, NJ), using fresh, disposable Accu-Edge
blades (Sakuraa Finetek U.S.A., Inc.; Torrance, CA) for
each new tissue specimen.
3.4. Tissue preparation
Upon removal, brains were cut mid-sagittally, and each
piece immediately snap-frozen in liquid nitrogen and then
stored at 80 -C. Frozen brain tissue was removed from
80 -C and embedded in OCT compound (Miles, IN) just
prior to sectioning, and no tissue block was subject to
sectioning more than once. Tissue sections were adhered to
uncoated, pre-cleaned Superfrost glass slides (Fisher
Scientific).
4. Detailed protocol
4.1. Cutting and fixation of tissue sections
Brain sections were cut in sagittal orientation at 5 Am
thickness, affixed to glass slides, and then immediately
placed on dry ice until the cutting session was complete.
Cutting in this manner allowed for the greatest cortical
 ARTICLE IN PRESS
K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
surface area to be exposed for LCM. Thereafter, slides were
placed in a plastic slide-box containing silica desiccant, and
stored at 80 -C until processed for RNA. The slide-box
and the fine brush used to retrieve the sections were rinsed
with RNase Away (InVitrogen; Carlsbad, CA) prior to
usage. Upon removal from 80 -C storage, slides were
allowed to thaw 30 s at room temperature, and then were
fixed in acetone (4 -C) for 3 min and immediately
immunostained.
4.2. Immunostaining of sections
Sections were circumscribed with a Pap Pen (RPI; Mt
Prospect, IL) to ensure maximum contact with antibodies.
All antibody and substrate solutions to which sections were
exposed prior to LCM contained 0.4 U/AL RNase Protector
(Roche; Indianapolis, IN), to lessen RNA degradation.
Rapid, yet thorough, washing of sections by complete
immersion (10 s) in phosphate-buffered saline (PBS), pH
7.4 (treated with DEPC and autoclaved to eliminate RNase
activity), was performed between antibody incubations to
ensure maximal specificity of staining. Slides were dipped
several times during this wash period to facilitate removal of
unbound antibody.
For LCM assessment of endothelial cells and perivas-
cular cells, a combination immunoperoxidase/immunofluor-
escent protocol was used. Immunoperoxidase staining of
endothelial cells using the Vectastain Elite ABC kit (Vector
Labs; Burlingame, CA) was carried out first, with mod-
ifications made to the manufacturer’s recommended proto-
col in order to significantly shorten the staining process and,
thereby, limit RNA loss. Specifically, antibody to CD31 was
used to label endothelial cells, as this antigen has been
reported to be expressed within all branches of the
peripheral microvascular axis [27]. Monoclonal rat anti-
mouse CD31 (BD Pharmingen; San Diego, CA) was diluted
1:10 in blocking buffer 1 (supplied in the Vectastain ABC
kit; 3 drops normal serum in 10 mL PBS) and applied to
sections for 3 min. Following PBS wash, sections were
incubated in anti-rat biotinylated secondary antibody (1
drop in 1 mL blocking buffer 1) for 2 min. Sections were
then washed and reacted with ABC reagent (1 drop A and B
in 2.5 mL PBS) for 3 min, followed by 3 min incubation
with diaminobenzidine (DAB) substrate (Vector Labs).
Following endothelial staining, astrocytes or smooth
muscle cells/pericytes were immunofluorescently labeled.
Astrocyte labeling was carried out by incubating sections
with a monoclonal anti-GFAP antibody directly conjugated
to AlexaFluor 488 (Molecular Probes; Eugene, OR), diluted
1:20 in blocking buffer 2 (5% normal goat serum, 0.2%
Tween 20), for 3 min. For smooth muscle cell/pericyte
labeling, sections were reacted with a monoclonal anti-a-
smooth muscle actin antibody conjugated to FITC (Sigma
Chemical Co.), diluted 1:10 in blocking buffer 2, for 4 min.
After astrocyte or smooth muscle cell/pericyte labeling,
sections were washed a final time in PBS prior to
3
dehydration. This double-staining method, employing
chromogen-based immunoperoxidase together with fluores-
cence detection, uniquely enabled endothelial cells and
perivascular cells to be viewed simultaneously with
epifluorescent illumination and bright light during LCM.
4.3. Dehydration
Immediately after immunostaining, sections were dehy-
drated in the following series of solutions: 75% EtOH (10
s), 95% EtOH (10 s), 100% EtOH (30 s), 100% EtOH (5
min), xylene (3 min), and a final xylene (4 min). This
extended xylene treatment, instead of rapid dipping [2],
created and/or enlarged a physical separation of endothelial
cells from astrocyte processes and other parenchymal
elements. Such an effect was critical in preventing astrocyte
contamination of endothelial samples during LCM, and
enhanced the overall lifting efficiency. Subsequent to
chemical dehydration, sections were placed in a fume hood
for 1 min for further desiccation, then directly subject to
LCM.
4.4. Laser capture microdissection
As stated above, combined use of bright light with
epifluorescence (blue filter cube; excitation at 455 –495 nm,
emission at 510 nm) was used to demarcate endothelial and
astrocyte boundaries in the cerebral cortex. Efforts were
focused on cortical microvessels, as most reports in the
literature use this particular source for the generation of
endothelial cultures to assess BBB function. LCM was
conducted in a dehumidified room (humidity 35%), and
was kept to less than 30 min per slide. Preliminary studies
revealed that capture sessions in excess of 30 min lead to
precipitous loss in recovery of intact RNA. A 7.5 Am laser
spot size was used to capture identified cells, at a power
range of 65– 80 mW and pulse duration of 550 – 750 As.
This combination of parameters allowed for efficient
retrieval of samples while minimizing the area lifted per
laser shot (thus limiting cross-contamination of endothelial
and perivascular cells). The number of laser Fshots_ used for
each sample was kept constant at 1400, and capture sessions
were routinely no longer than 25 min. Under the operating
conditions employed, lifting efficiency was consistently
>80%. These parameters secured a sufficient and near
constant amount of input RNA for comparative RT-PCR
analyses. All experiments were performed no less than five
times with five different animals, to lessen the likelihood of
making erroneous assumptions based on animal-selective
phenomena.
4.5. RNA isolation
Immediately following LCM, RNA was extracted from
HS caps using the Picopure RNA isolation kit (Arcturus)
and following the protocol provided by the manufacturer.
 ARTICLE IN PRESS
4 K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
Briefly, after connecting the Extractsure ring (Arcturus) to
the Capsure HS cap, 10 AL of Picopure extraction buffer
was added to the fill port of the Extractsure ring, and a thin-
walled PCR tube (GeneAmp, Applied Biosystems; Foster
City, CA) secured over the port to prevent spillage or
evaporation. The sample was then incubated at 42 -C for 30
min to solubilize captured material from the HS cap.
Following solubilization, the sample was spun at 1000  g
for 10 s. The remainder of the isolation protocol was carried
out immediately thereafter. To preclude DNA contamination
as much as possible, the column used for RNA purification
was treated with DNase, and the final elution volume was
20 AL. Isolated RNA was either used directly for RT-PCR or
stored at 80 -C until further needed.
4.6. RT-PCR
The One-Step RT-PCR kit (Qiagen) was used for reverse
transcription of RNA and amplification of DNA, according
to the protocol provided by the manufacturer. In this
protocol, reverse primers selected for DNA amplification
also served to prime DNA synthesis from specific RNA
transcripts. GeneAmp thin-walled tubes (Applied Biosys-
tems) were used for all reactions. Below are listed the
forward (FWD) and reverse (REV) primers, annealing
temperatures used in the reactions, and the approximate
amplicon sizes generated:
CD-31
FWD 5VCAGTGATGCTGAACAACAAGGA3V
REV 5VATGATGCTACTGGCTTTGGAGA3V56 -C;
¨220 bp
VE-Cadherin
FWD 5VTTCAAGCTGCCAGAAAACCAGA3V
REV 5V AACTCGCCCTGCTCGTTGCA3V 59 -C;
¨450 bp
GFAP
FWD 5VCTTGTCTCGAATGACTCCTCCA3V
REV 5VACTGCCTCGTATTGAGTGCGAA3V59 -C;
¨450 bp
AQP4
FWD 5VGGAAGGCTAGGTTGGTGACTTC3V
REV 5VTGGTGACTCCCAATCCTCCAAC3V59 -C;
¨460 bp [26]
a-smooth muscle actin
FWD 5VGAGAAGCCCAGCCAGTCG3V
REV 5V CTCTTGCTCTGGGCTTCA3V 53 -C;
¨320 bp
4.7. Gel electrophoresis
A volume of 15 AL from each PCR reaction was resolved
electrophoretically on a 1.2% agarose gel in 1 Tris-acetic
acid-EDTA running buffer for 35 min at 75 V-110 V. The
gel was stained with ethidium bromide and photographed on
a transilluminator.
5. Results
5.1. Anti-CD31 immunostaining of all microvessel classes
The extremely close apposition of astrocytic foot proces-
ses to endothelial cells of brain microvessels has proven a
significant obstacle to the selective retrieval of brain endothe-
lial tissue by LCM [2,17]. So too, has been the lack of com-
prehensive histochemical staining of endothelial cells
throughout all branches of the microvascular axis [17]. To
minimize or avert these problems, we developed a quick-
staining protocol in which brain sections were immuno-
stained to discriminate between endothelial cells and perivas-
cular astrocytes, and then subjected to relatively extensive
dehydration with xylene. Antibody to CD31 was used to label
endothelial cells throughout the brain microvascular tree
[27], and antibody to GFAP was employed to demarcate
astrocytic processes surrounding the microvessels. The objec-
tive of the robust xylene treatment was to create an artificial
and exaggerated fault line, stemming from excessive dehy-
dration, between the endothelial cells and perivascular pro-
cesses—physically separating the two as much as possible.
Before proceeding with LCM, it was important to first
confirm that anti-CD31 ubiquitously labeled endothelial
cells within variable-sized microvascular branches in the
brain. Fig. 1 reveals that, indeed, brain microvessels of
varying diameter (ranging from <8 Am to approximately 60
Am), stained with anti-CD31 antibody. Those 8 Am in
diameter were recognized as capillaries, and were by far the
preponderant branches detected. Of the microvessels >8 Am
in diameter, some contained a tunic of smooth muscle cells,
as shown by staining with anti-a-smooth muscle actin,
indicating they are arterioles. Other microvessels, devoid of
such a smooth muscle layer, but larger than capillaries, are
likely to be venules. It is thus clear from this profile that all
three major classes of microvessels—arterioles, capillaries,
and venules—are stained in the brain by anti-CD31 antibody.
5.2. Selective dissection of endothelial cells by LCM
Double immmunoperoxidase/immunofluorescent label-
ing coupled with LCM of endothelial cells is shown in Fig.
2. The ability to explicitly capture anti-CD31/peroxidase-
labeled endothelial tissue, while leaving behind anti-GFAP/
fluorescently labeled astrocyte material, is clearly depicted
here. Specifically, a near intact endothelium has been
excised from a microvessel in cross-section and transferred,
in whole, to a collecting cap. Despite this extensive removal
of tissue, the repertoire of astrocyte foot processes ensheath-
ing the microvessel vessel was apparently left undisturbed,
as judged by the virtually identical patterns of perivascular
anti-GFAP staining before and after endothelial retrieval by
LCM, and the absence of any anti-GFAP staining on the
cap. Being able to visualize endothelial cells and astrocytes
simultaneously during the LCM procedure uniquely pro-
vided the opportunity to avoid astrocytic foot processes.
 ARTICLE IN PRESS
K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx 5

captured material identified by anti-CD31 staining expresses

Fig. 1. Anti-CD31 stains all microvessel classes in brain. A 5 Am section of
frozen mouse brain was double-immunostained as described in the Detailed
protocol. Top row shows peroxidase/DAB staining with anti-CD31
antibody, and bottom row fluorescent staining of the same views with
anti-a-smooth muscle actin antibody. The tic marks in each of the scale bars
represent 10 Am. (A) Shows vessel branches that are all approximately 8
Am in diameter in either longitudinal section (arrowheads) or x-section
(arrows), and which are considered capillaries. (B) Shows a larger
microvessel in x-section at the left (*), which is approximately 20 Am in
diameter and does not stain with anti-a-smooth muscle actin antibody, and
is thus likely a venule. Smaller diameter structures to the right of this, in
longitudinal section, are capillaries. (C) Reveals two larger microvessel
branches, the top one between 60 and 70 Am at its widest diameter, and the
one at the bottom approximately 25 Am in diameter. Both of these clearly
display a tunic of a-smooth muscle actin+ cells, and thus in all probability
are arterioles.
5.3. RT-PCR analysis: purity of endothelial capture
Confirmation of the precision of this LCM procedure
was provided by RT-PCR analyses of the retrieved samples,
which indicated no discernable contamination of endothelial
RNA with astrocyte RNA or vice versa. Fig. 3 shows that
RNA for CD31 and VE-cadherin, both of which are
adhesion-associated molecules that are also recognized
endothelial markers [10,23]. However, the same material
failed to express a detectable level of GFAP RNA,
indicating that GFAP-bearing astrocyte foot processes did
not appreciably contaminate the sample. In complete
reversal of this scenario, material captured from a similar
number of anti-GFAP-stained cells revealed expression of
GFAP RNA but not RNA for CD31 or VE-cadherin. Hence,
this LCM protocol apparently afforded a means to effec-
tively discriminate between endothelial cells and perivas-
cular, GFAP-bearing astrocytes.
The staining of astrocytic foot processes clearly provided
a guide for selective retrieval of endothelial cells. However,
the ability to avoid contamination by astrocytic material
may also stem from the prolonged dehydration with xylene.
This condition may exaggerate the Virchov –Robins space
surrounding brain microvessels, with the result that the
arrays of glial foot processes forming the glia limitans are
caused to retract somewhat from the abluminal endothelial
surface [8].
Though clearly showing enrichment of endothelial cells
by LCM, these observations alone could not be taken as
evidence of a complete lack of astrocytic contamination.
This is because it has recently been observed that those
astrocytic foot processes specifically ensheathing larger
microvessels display immunoreactivity to both GFAP and
the water channel protein aquaporin-4, while astrocytic
processes terminating on capillaries exhibit immunodetec-
tion of aquaporin-4 but not GFAP [21]. Hence, to ensure
that astrocytic processes appended to all types of micro-
vessels were excluded from our capture process, anti-
CD31-stained material captured by LCM was also

Fig. 2. Selective retrieval of brain microvascular endothelial cells by LCM. A 5 Am thick frozen section of mouse brain was double-immunostained with
antibodies to CD31 and GFAP. CD31 immunoreactivity was visualized by peroxidase and DAB substrate, and GFAP was detected by immunofluorescence.
CD31/DAB, pre-lift: Endothelial tissue stained with anti-CD31, viewed by bright-field microscopy prior to LCM. Arrowheads denote inner layer of stained
endothelial cells. GFAP fluorescence, pre-lift: Same tissue stained with anti-GFAP by immunofluorescence, with arrows highlighting the perivascular
distribution of astrocytic end feet. Overlay: CD31 image and GFAP image viewed simultaneously by bright-field and epifluorescence optics, respectively, with
same pattern of arrows marking perivascular astrocytic processes. Tissue post-lift: Tissue remnants after LCM, revealing that the entire endothelial layer was
removed. Cap: Tissue transferred to cap after LCM, showing intact endothelium (in center) was deposited. GFAP fluorescence, post-lift: Tissue after LCM,
showing that the fluorescent distribution of astrocytic end feet was not disturbed. GFAP fluorescence, cap: Tissue transferred to cap, revealing no detection of
astrocytic end feet.
 ARTICLE IN PRESS
6 K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
Fig. 3. Expression of endothelial markers, but not astrocyte markers, by
CD31+ tissue captured by LCM. A frozen 5 Am section of mouse brain was
double-immunostained with anti-CD31 and anti-GFAP antibodies. Material
captured by LCM was analyzed by RT-PCR for expression of endothelial
(CD31), astrocyte (GFAP, AQP-4). (top) CD31+ endothelial material was
captured by LCM and probed for the indicated endothelial and astrocyte
RNAs. (bottom) GFAP+ astrocyte processes were captured and probed for
the indicated endothelial and astrocyte RNAs. The right-most lane
represents a DNA ladder.
evaluated for aquaporin-4 expression. Fig. 3 additionally
shows that RNA for this astrocyte marker was also absent
from captured material identified as endothelial. As with
the case with GFAP, aquaporin-4 RNA was only detected
in material captured from anti-GFAP-stained cells. That
neither marker of astrocytic end feet was detectable in
captured material from CD31-stained cells, underscores
that astrocyte contamination was negligible or non-existent
in these samples. This is particularly remarkable, as the
vast majority of microvessel branches that were stained
with anti-CD31 and subjected to LCM were of small
caliber; i.e., 8 Am in diameter, consistent with the
preponderance of capillaries in comparison to venules and
arterioles [3]. Of course, we recognize the possibility,
however remote, that there may still be a subset of
perivascular astrocytic foot processes that express neither
GFAP nor aquaporin-4, and thus may have contaminated
our LCM protocol without being detected. It is of further
importance to note that the absence of detectable
astrocyte-specific RNA from the vascular samples, and
endothelial-specific RNA from the astrocyte samples,
validates the specificity of the RT-PCR procedures
employed.
To further assess the relative contamination of endothe-
lial material retrieved by LCM, we also probed samples for
RNA encoding a-smooth muscle actin (Fig. 4), which is
expressed by two types of mural cells closely associated
with the walls of CNS microvessels: pericytes and smooth
muscle cells [9]. As was the case for GFAP and aquaporin-4
RNA, a-smooth muscle actin RNA was not detectable in
captured endothelial material, though expression of CD31
RNA was observed. Nor was any a-smooth muscle actin
immunoreactivity detected on captured endothelial material
transferred to collection caps (data not shown). On the other
hand, expression of a-smooth muscle actin RNA was
detectable from a similar amount of retrieved smooth
muscle cells that had been identified by immunostaining
with a-smooth muscle actin antibody. Apparently, just as it
did for astrocyte processes, the dehydration conditions also
caused effective separation of a-smooth muscle actin-
expressing cells from endothelial cells.
Collectively, these results reveal that dual-label immu-
nocytochemistry of frozen sections to identify the different
cells comprising brain microvessels, followed by extended
dehydration with xylene, enables endothelial cells and
perivascular cells to be selectively retrieved by LCM with
little-to-no detectable RNA contamination from each other.
6. Discussion
Recent reports provided the first evidence of utilizing
LCM to investigate gene expression by brain microvesssels
in situ [2,17,28], though with the significant caveat that
retrieved endothelial material was appreciably contaminated
with contents from perivascular astrocytes. In this report, we
described an extended dehydration step with xylene that
apparently serves to displace perivascular cells normally
tightly adherent to the abluminal endothelial surface—thus,
minimizing or eliminating the risk of cross-contaminating
endothelial and perivascular cell samples during the
retrieval process. Moreover, immunocytochemical, as
opposed to histochemical, staining was employed to clearly
identify and resolve endothelial and perivascular cells
present throughout the panorama of different-sized brain
microvessels. And most importantly for gene expression
analysis, this new protocol demonstrated for the first time
sufficiently intact mRNA from immunolabeled, endothelial,
and perivascular cell types to enable detection by RT-PCR.
The capability to immunolabel both endothelial and
perivascular cells, in a manner that adequately sustains RNA
integrity, provides a significant advantage over pre-existing
Fig. 4. Lack of detectable a-smooth muscle actin expression by CD31+
tissue captured by LCM. A frozen 5 Am section of mouse brain was double-
immunostained with anti-CD31 and anti-a-smooth muscle actin (a-SMA)
antibodies. a-SMA+ and CD31+ cells were captured separately and probed
for indicated RNAs.
 ARTICLE IN PRESS
K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
LCM protocols, in that it allows for clear demarcation of
cellular boundaries. Thus, even in cases where physical
separation of these cell types is not achieved or extensive,
cross-contamination can still be mitigated by virtue of easily
recognizing which areas to avoid. Insofar as the histochem-
ical procedures previously employed identified only endo-
thelial cells within brain microvessels [2,17,28], the
opportunity to clearly elude non-desired cells during LCM
was not available.
Immunostaining with antibody to CD31 was the method
specifically selected to identify endothelial cells, as this
antigen is reported to be expressed by endothelial cells in
normal and pathologic vessels, irrespective of vessel size and
organ location [6,10]. In contrast, Factor VIII related antigen,
long considered an endothelial marker [20], tends to be little-
or non-expressed by capillaries in vivo, and displayed
mainly by larger microvessels [26]. Likewise, angiotensin-
converting enzyme, another well-recognized endothelial
marker, has been found to exhibit significant regional
variation, with comparatively less expression in brain [11].
Use of anti-CD31 immunocytochemistry is thus critical in
confirming microvessel identity when performing LCM, as it
is a means to ensure that all types of vessel tributaries are
examined. By extension, this will allow for appreciation of
the entire microvascular network of the brain when attempt-
ing to couple LCM to analysis of gene expression.
Besides highlighting the capability of this LCM protocol
to retrieve relatively pure populations of brain endothelial
and perivascular cells, and permit RNA analysis from these
cell types, our results also strongly indicate that aquaporin-
4 gene expression within the neurovascular unit is
exclusively or largely restricted to astrocytes. It is of
interest to note, in this regard, that Amiri-Moghaddam et al.
[1] recently reported immunogold localization of aqua-
porin-4 within brain endothelial cells, as well as perivas-
cular astrocytes. A priori, these collective results might
suggest that while aquaporin-4 protein is synthesized by
astrocytes, some may be transported to endothelial cells in
order to effect water transport at more than one cellular site
along the BBB.
With the ability to clearly resolve endothelial and
perivascular cells, and avoid cross-contamination between
these groups, the LCM protocol described here, when
combined with gene microarray analysis, offers the unique
opportunity to investigate the full extent of gene expression
by the differing cell types comprising the neurovascular unit
at all points along the brain microvascular tree. Conceivably,
this approach could also be extended to protein microarrays
[5]. Though such an application typically requires protein
input in the 50 Ag range, this amount could theoretically be
achieved by pooling samples. In this regard, preliminary
work from this laboratory has established that Arcturus HS
caps containing retrieved tissue can be stored at 80 -C,
and extraction of protein performed at a later date.
Extending this LCM method to both global RNA and
protein analytic platforms will allow for determination of
7
broad metabolic changes that occur in select cellular
elements of the cerebral microvasculature during various
normal, pathologic, and therapeutic episodes.
7. Troubleshooting
Time is an extremely critical variable when employing
LCM for the purpose of RNA analysis. Thus, we have
drastically shortened the immunostaining phase, compared
to conventional staining methods, and kept the LCM aspect
to less than 30 min. In addition to minimizing the time of
immunostaining, inclusion of an RNase inhibitor in all
antibody steps is imperative. Because capture sessions
longer than 30 min were found to result in precipitous RNA
loss, efforts to maximize the amount of RNA obtained by
LCM, e.g., for microarray analysis, should be carried out
by pooling samples from different captures. In the case of
the Picopure RNA isolation kit, described here, this is
easily accomplished by combining samples after their
initial solubilization in extraction buffer, and making
proportional dilution adjustments prior to application to
the spin column.
In addition to time, the extent of dehydration is another
significant variable in the LCM process. Dehydration with
xylene serves two purposes: (1) providing sufficient
desiccation of the section so that effective lifting of the
targeted tissue is achieved; and (2) effecting separation of
the endothelium from perivascular cell processes, due to
shrinkage-induced cellular retraction. Though acknowledg-
ing that this causes altered morphology, the clearly
beneficial trade-off is higher purity of the captured material.
A cautionary note, however, is that prolonged dehydration
in xylene much beyond the time suggested here can lead to
dissolution and loss of the DAB reaction product. As
recommended by Ball et al. [2], anhydrous alcohols should
be used, prior to xylene treatment, and we also strongly
encourage the use of a dehumidifier to keep humidity level
constant and low.
8. Alternative and support protocols
We chose to use a combined immunoperoxidase/immu-
nofluorescent approach as, in our estimation, this provided
the best contrast between endothelial cells and perivascular
astrocytic processes in a live image, and thus best facilitated
selective endothelial retrieval. Alternatively, one could use
two different chromogenic procedures (e.g., peroxidase and
alkaline phosphatase conjugates) and forgo fluorescence.
While certainly feasible, the caveat here would be the extra
time needed for the ABC procedure, as compared to using
primary antibody-fluorophore conjugates. And, though it is
possible to conserve time by carrying out the immunolabel-
ing of different cell types simultaneously, we have not found
this approach to yield suitable results.
 ARTICLE IN PRESS
8 K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
9. Essential literature cited
The use of LCM to garner to brain microvascular
material for RNA analysis was first described by Ball et
al. [2], and subsequently by Mojsilovic et al. [17] and Zheng
et al. [28].
10. Quick procedure
1. Euthanize mouse and quickly remove brain; split
brain into hemispheres and drop immediately into
liquid N2. Store at 80 -C.
2. Section at 5 Am onto pre-cleaned slides and store with
desiccant at 80 -C.
3. Fix in acetone for 3 min and incubate with primary
antibody (anti-CD31) for 3 min.
4. Wash with PBS and incubate with biotinylated
secondary antibody for 2 min.
5. Wash with PBS and incubate with ABC solution for 3
min.
6. Wash with PBS and incubate with DAB for 3 min.
7. Apply second primary antibody (anti-GFAP- or anti-
a-SMA-fluorescent conjugate) for 4 min.
8. Thoroughly wash in PBS and dehydrate in 75% EtOH
for 15 s.
9. Subsequently dehydrate section in 95% EtOH for 15 s
and 100% EtOH for 30 s.
10. Finally, dehydrate slide in 100% EtOH for 5 min
followed by incubation in xylene for 3 min, and a
second xylene for 4 min.
11. Dry briefly in a fume hood.
12. Perform LCM for no longer than 30 min using 7.5 Am
spot size, 65 – 80 mW power and 550 – 750 As
duration.
13. Add extraction buffer to the cap and incubate for 30
min at 42 -C.
14. Centrifuge at 1000  g for 10 s and immediately
proceed with RNA isolation (Arcturus Picopure RNA
isolation protocol).
15. Carry out RT-PCR using the Qiagen One-step
protocol.
16. Resolve PCR products on a 1.2% agarose gel.
Acknowledgments
This work was supported in part by grants from the
National Institutes of Health (RO-1-MH54718) and the
National Multiple Sclerosis Society (R G2633) to J.S.P. The
authors extend their deep gratitude to Dr. Stefan Brocke, of
the University of Connecticut Health Center, for graciously
allowing us unrestricted use of his Arcturus PixCell IIe.
Additionally, we are indebted to Ms. Virginia Espina, of the
National Cancer Institute, for sharing her considerable
expertise during the early stages of this work, and to Dr.
Kirk Dzenko, of the University of Connecticut Health
Center, for providing additional assistance in LCM. We are
also thankful to Ms. Nancy Ryan for assistance in slide
preparation.
References
[1] M. Amiri-Moghaddam, R. Xue, F.M. Huag, J.D. Neely, A. Bhardwaj,
P. Agre, M.E. Adams, S.C. Froehner, S. Mori, O.P. Ottersen, Alpha-
syntrophin deletion removes the perivascular but not endothelial pool
of aquaporin at the blood – brain barrier and delays development of
brain edema in an experimental model of acute hyponatremia,
FASEB J. 18 (2004) 542 – 545.
[2] H.J. Ball, B. McParland, C. Driussi, N.H. Hunt, Isolating vessels
from mouse brain for gene expression analysis using laser capture
microdissection, Brain Res. Protoc. 9 (2002) 206 – 213.
[3] R.M. Berne, M.N. Levy, The cardiovascular system: the circuitry, in:
R.M. Berne, M.N. Levy (Eds.), Physiology, 2nd edition, The C.V.
Mosby Co., St. Louis, 1988, pp. 395 – 397.
[4] S. Curran, J.A. McKay, H.I. McCleod, G.I. Murray, Laser capture
microscopy, J. Clin. Mol. Pathol. 53 (2000) 64 – 68.
[5] V. Espina, K.A. Dettloff, S. Cowherd, E.F. Petricoin III, L. Liotta,
Use of proteomic analysis to monitor responses to biological
therapies, Expert Opin. Biol. Ther. 4 (2004) 83 – 93.
[6] D. Feng, J.A. Nagy, K. Pyne, H.F. Dvorak, A.M. Dvorak, Ultra-
structural localization of platelet endothelial adhesion molecule
(PECAM-1, CD-31) in vascular endothelium, J. Histochem. Cyto-
chem. 52 (2004) 87 – 101.
[7] S. Ge, L. Song, J.S. Pachter, Where is the blood – brain bar-
rier. . .really? J. Neurosci. Res. 79 (2005) 421 – 427.
[8] J.M. Herr Jr., An analysis of methods for permanently mounting
ovules cleared in four-and-a-half type cleaning fluids, Stain Technol.
57 (1982) 161 – 169.
[9] S. Hughes, T. Chan-Ling, Characterization of smooth muscle cell and
pericyte differentiation in the rat retina in vivo, Invest. Opthamol.
Vis. Sci. 45 (2004) 2795 – 2806.
[10] N. Ilan, J. Madri, PECAM-1: old friend, new partners, Curr. Opin.
Cell Biol. 15 (2003) 515 – 524.
[11] K. Jandeleit-Dahm, B. Jackson, D. Paxton, R. Perich, C.I. Johnston,
Characterization of angiotensin converting enzyme from different
vascular beds, Blood 4 (1995) 170 – 176.
[12] F. Kamme, R. Salunga, J. Yu, D.-T. Tran, J. Zhu, L. Luo, A. Bittner,
H.-Q. Guo, N. Miller, J. Wan, M. Erlander, Single-cell microarray
analysis in hippocampus CA1: demonstration and validation of
cellular heterogeneity, J. Neurosci. 23 (2003) 3607 – 3615.
[13] F. Lasbennes, J., Gayet, Capacity for energy metabolism in micro-
vessels isolated from rat brain, Neurochem. Res. 9 (1984) 1 – 10.
[14] E.H. Lo, J.P. Broderick, M.A. Moskowitz, tPA and proteolysis in the
neurovascular unit, Stroke 35 (2004) 354 – 356.
[15] L. Lu, F. Neff, Z. Dun, B. Hemmer, W.H. Oertzel, J. Schlegel, A.
Hartmann, Gene expression profiles derived from single cells in
human postmortem brain, Brain Res. Protoc. 13 (2004) 18 – 25.
[16] L. Luo, R.C. Salunga, H. Guo, A. Bittner, K.C. Joy, J.E. Galindo, H.
Xiao, K.E. Rogers, J.S. Wan, M.R. Jackson, M.G. Erlander, Gene
expression profiles of laser-captured adjacent neuronal subtypes, Nat.
Med. 5 (1999) 117 – 122.
[17] J. Mojsilovic-Petrovic, M. Nesic, A. Pen, W. Zhang, D. Stanimirovic,
Development of rapid staining protocols for laser-capture micro-
dissection of brain vessels from human and rat coupled to gene
expression analyses, J. Neurosci. Methods 133 (2004) 29 – 48.
[18] M. Nakada, J.A. Niska, H. Miyamori, W.S. McDonough, J. Wu, H.
Satao, M.E. Berens, The phosphorylation of EphB2 receptor
regulates migration and invasion of human glioma cells, Cancer
Res. 64 (2004) 3179 – 3185.
[19] M. Prosniak, A. Zborek, G.S. Scott, A. Roy, T.W. Phares, H.
 ARTICLE IN PRESS
K. Kinnecom, J.S. Pachter / Brain Research Protocols xx (2005) xxx – xxx
Koprowski, D.C. Hooper, Differential expression of growth factors
at the cellular level in virus-infected brain, Proc. Natl. Acad. Sci.
U. S. A. 100 (2003) 6765 – 6770.
[20] M. Sehested, K. Hou-Jensen, Factor VIII-related antigen as an
endothelial marker in benign and malignant tissues, Virchows Arch.
A: Pathol. Anat. Histol. 391 (1981) 217 – 225.
[21] M. Simard, G. Arcuino, T. Takano, Q.S. Liu, M. Nedergaard,
Signaling at the gliovascular interface, Int. J. Neurosci. 223 (2003)
9254 – 9262.
[22] O. Smolkova, A. Zavadka, P. Benkston, A. Lutsyk, Cellular
heterogeneity of rat vascular endothelium as detected by HPA and
GS I lectin-gold probes, Med. Sci. Monit. 7 (2001) 659 – 668.
[23] P.A. Vincent, K. Xiao, K.M. Buckley, A.P. Kowalczyk, VE-cadherin:
adhesion at arm’s length, Am. J. Physiol.: Cell Physiol. 286 (2004)
C987 – C997.
[24] A.W. Vorbrodt, Ultrastructural cytochemistry of blood – brain barrier
endothelia, Prog. Histochem. Cytochem. 18 (1988) 1 – 99.
9
[25] Z. Wang, G. Trillo-Pazos, S.Y. Kim, M. Canki, S. Morgello, L.R.
Sharer, H.A. Gelbard, Z.Z. Su, D.C. Kang, A.I. Brooks, P.B. Fisher,
D.I. Volsky, Effects of immunodeficiency virus type 1 on astrocyte
gene expression and function: potential role in neuropathogenesis,
J. NeuroVirol. 10 (Suppl. 1) (2004) 25 – 32.
[26] S. Zelenin, E. Gunnarson, T. Alikina, A. Bondar, A. Aperia,
Identification of a new form of AQP4 mRNA that is developmentally
expressed in mouse brain, Pediatr. Res. 48 (2000) 335 – 339.
[27] E.G. Zhang, S.K. Smith, D.S. Charnock-Jones, Expression of
CD105 (endoglin) in arteriolar endothelial cells of human endome-
trium throughout the menstrual cycle, Reproduction 124 (2002)
703 – 711.
[28] P.-P. Zheng, A.M. Sieuwerts, T.M. Luider, M. van der Weiden, P.A.E.
Sillevis-Smitt, J.M. Kros, Differential expression of splicing variants
of the human caldesmon gene (CADL1) in glioma neovascularization
versus normal brain microvasculature, Am. J. Pathol. 164 (2004)
2217 – 2228.