Mechanisms of Development 113 (2002) 9598 www.elsevier.

com/locate/modo

Gene expression pattern

Molecular cloning and expression of the chromatin insulator protein CTCF in Xenopus laevis
Les J. Burke a,*, Thomas Hollemann b, Tomas Pieler b, Rainer Renkawitz a
b

Institute for Genetics, Justus-Liebig-Universitat Giessen, Heinrich-Buff-Ring 58-62, D-35392 Giessen, Germany Georg-August-Universitat Gottingen, Institute for Biochemistry and Molecular Cell Biology, Humboldtallee 23, D-37073 Gottingen, Germany Received 8 November 2001; received in revised form 21 December 2001; accepted 21 December 2001

Abstract The zinc nger protein CTCF has been shown to mediate multiple functions connected to gene repression. Transcriptional inhibition as well as enhancer blocking and chromatin insulation are documented for CTCF in men, mice and chickens. Additionally, hCTCF has been linked to epigenetics and disease. In line with these basic cellular functions, CTCF has been found to be expressed in every cell type and adult tissue tested and has thus been deemed an ubiquitous protein. Here, we report the identication of the CTCF homologue from Xenopus and the analysis of the spatio-temporal expression of xCTCF during embryogenesis. Within the DNA binding domain, xCTCF is virtually identical to other identied vertebrate CTCF proteins. Homology also extends to other conserved regions that are important for CTCF function. Although xCTCF mRNA is present during all stages of early Xenopus development, a remarkable increase in expression is observed in neuronal tissues. Early in development, xCTCF is highly expressed in the neural plate and later in the neural tube and developing brain. By tailbud stage, elevated expression is also seen in the developing sensory organs of the head. This is the rst detailed description of the expression pattern of a vertebrate insulator protein during embryogenesis. q 2002 Elsevier Science Ireland Ltd. All rights reserved.
Keywords: CTCF; Insulator; Xenopus laevis; Embryogenesis; Nervous system

1. Results and discussion In the genome of higher eucaryotes, differentially regulated genes, specic for different tissues or developmental stages, may be adjacent to each other. Since regulatory mechanisms controlling gene expression can act over large distances, possibly including more than one gene, boundaries between active and inactive loci have evolved. Within vertebrates, a number of different boundary or insulator elements have been described but until now, only a single nuclear factor has been identied to be required for this insulator activity (Bell et al., 1999). This CCCTC binding factor, CTCF, was originally discovered in chicken as a transcriptional repressor protein (Baniahmad et al., 1990; Lobanenkov et al., 1990). In vitro binding assays showed that chicken CTCF can bind not only mammalian and chicken insulator sequences, but also a ribosomal DNA insulator element from Xenopus (Bell et al., 1999). In addition, CTCF has been shown to mediate mono-allelic expression of imprinted genes (Bell and Felsenfeld, 2000; Hark et
* Corresponding author. Tel.: 149-641-993-5479; fax: 149-641-9935469. E-mail address: leslie.burke@gen.bio.uni-giessen.de (L.J. Burke).

al., 2000; Kanduri et al., 2000). Mammalian imprinting is conferred by specic methylation patterns throughout the genome. One of the factors reading this imprint is CTCF (for review see (Ohlsson et al., 2001)). Although CpG methylation of the Xenopus genome has been demonstrated (Stancheva and Meehan, 2000), examples of imprinted genes have not been found. Mammalian and chicken CTCF are expressed in a wide range of adult tissues and cell lines (Filippova et al., 1996, 1998; Klenova et al., 1993). However, a detailed analysis of CTCF distribution during development has never been performed. We sought to determine whether CTCF is conserved in Xenopus, and if CTCF has a distinct embryonic expression prole. 1.1. xCTCF and mammalian CTCF are highly homologous Screening of a Xenopus cDNA library by a combination of polymerase chain reaction (PCR) and traditional hybridization methods led to the identication of two identical cDNAs containing a sequence homologous to the entire open reading frame of human, chicken, rat and mouse CTCF. This was designated xCTCF. The DDBJ/EMBL/ GenBank accession no. of xCTCF is AF305695. xCTCF is highly conserved showing 83, 84, 83 and 84% overall

0925-4773/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0925-477 3(02)00005-9

96

L.J. Burke et al. / Mechanisms of Development 113 (2002) 9598

Fig. 1. (A) Alignment of the predicted amino acid sequences of Xenopus CTCF (GenBank accession No. AF305695) to CTCF homologues from rat (GenBank accession No. AF133731), mouse (GenBank accession No. MMU51037), human (GenBank accession No. HSU25435) and chicken (GenBank accession No. Z22605). Dots represent identical amino acids. Dashes represent gaps introduced for optimal alignment. The zinc nger region as determined from hCTCF is boxed in yellow, a phosphorylation motif for casein kinase II in green, and an AT-hook motif in blue. (B) Structural diagram of CTCF with the same color code as in (A).

amino acid identity to human, chicken, rat and mouse CTCF, respectively. Within the eleven zinc nger DNA binding domain, vertebrate CTCF amino acid sequences are almost identical (98% identity) (Fig. 1). xCTCF shows only ve amino acid deviations which do not affect the general zinc nger structure containing a pair of cysteine residues separated by 12 amino acids from a pair of histidines. The N- and C-terminal domains conferring transcriptional repression (Filippova et al., 1996; Lutz et al., 2000) also contain regions of high conservation. Within the Cterminal domain, two motifs, a KRRGRP-type AT-hook which is involved in DNA binding and a casein kinase II (CKII) site which is phosphorylated on four serines of chicken CTCF both in vivo and in vitro (Klenova et al.,

2001) are conserved in Xenopus. In xCTCF one of the serines in the CKII site is changed to a threonine (Fig. 1A). 1.2. xCTCF expression during early Xenopus development is high in neuronal tissues Reverse transcriptase (RT)-PCR of RNA isolated from Xenopus embryos of developmental stages 544 shows CTCF expression in all stages analyzed including maternal transcripts at stage 5 before the mid-blastula transition (stage 8) (Fig. 2). Since this analysis does not resolve possible region-specic differences, we carried out whole-mount in situ hybridization with staged embryos. In embryos before stage 14, a weak homogeneous stain-

L.J. Burke et al. / Mechanisms of Development 113 (2002) 9598

97

Fig. 2. Temporal expression of xCTCF during Xenopus development. The expression of xCTCF was analyzed using RNA isolated from embryos at the indicated Nieuwkoop-Faber stages (Nieuwkoop and Faber, 1967) by RT-PCR. Histone H4 was used as an internal control. Lane W, no RNA.

ing signal of xCTCF is observed. The rst region-specic expression of xCTCF is seen in stage 14 embryos in the whole open neural plate with high levels of expression in the anterior neural plate and lower levels in the midline (Fig. 3A). At early tailbud stage (stage 26), CTCF transcripts are found in two stripes in the neural tube and in the mid-/ hindbrain, with higher levels in the midbrain (Fig. 3B). Lower levels of expression are also found in the forebrain. CTCF is also strongly expressed in the eye vesicles and detectable in the branchial arches. At stage 38 (Fig. 3C E), CTCF expression is found in all derivatives of these domains. Strong CTCF expression is detected in the midand hindbrain, in the dorsal and ventricular regions of the brain. Interestingly, at stage 38, xCTCF expression is also found in all the sensory organs of the head (eye, otic vesicle and nasal placode). In the eye, CTCF transcripts are found in the ciliary marginal zone, the inner nuclear layer and in the anterior lens epithelium (Fig. 3D). Furthermore, CTCF transcripts are detected in a few mesodermal derivatives, notably the head mesenchyme and in the intersomitic veins. Weak expression is also detected in the tailtip. It is important to note that, of the described domains, many are found in areas of high proliferative activity including the ciliary marginal zone, anterior lens epithelium, neural tube, ventricular regions of the brain and the tailtip. Thus, although detectable in all embryonic stages, it is clear that CTCF is differentially expressed during development with a dramatic increase in expression in neuronal tissues and sensory organs of the head.
Fig. 3. Spatial expression of xCTCF during Xenopus development. Wholemount in situ hybridization was performed with xCTCF antisense RNA and staged Xenopus embryos. Nieuwkoop-Faber stages of embryogenesis are indicated. (A) Anterior view of stage 14; (B) dorsal view of stage 26; and (C) lateral view of stage 38. (C 0 ) details as indicated by the box with broken lines in (C). (D, E) transversal vibratome sections as indicated by red dashed lines across the embryo in (C). Abbreviations: ahc, anterior hepatic cavity; ale, anterior lens epithelium; anp, anterior neural plate; ba, branchial arches; cmz, ciliary marginal zone; den, diencephalon; ev, eye vesicle; fg, frontal gland; hb, hindbrain; hm, head mesenchyme; inl, inner nuclear layer; isv, intersomitic veins; mb, midbrain; nc, notochord; np, nasal placode; nt, neural tube; ov, otic vesicle; and vz, ventricular zone.

2. Methods A cDNA fragment was amplied by RT-PCR from stage 8 total RNA with the primers, CCATCACCGGTCCATCATGCTGAG and TACTGTGATGCTGTGTTTCATGAGCG, and cloned into pGEM-T (Promega) to produce pGEM-xCTCF-CT. Sequencing of this insert allowed production of xCTCF specic primers GCGTTATGCAC-

98

L.J. Burke et al. / Mechanisms of Development 113 (2002) 9598 win, G., Neiman, P.E., Collins, S.J., Lobanenkov, V.V., 1996. An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc ngers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. Mol. Cell. Biol. 16, 28022813. Filippova, G.N., Lindblom, A., Meincke, L.J., Klenova, E.M., Neiman, P.E., Collins, S.J., Doggett, N.A., Lobanenkov, V.V., 1998. A widely expressed transcription factor with multiple DNA sequence specicity, CTCF, is localized at chromosome segment 16q22.1 within one of the smallest regions of overlap for common deletions in breast and prostate cancers. Genes Chromosomes Cancer 22, 2636. Hark, A.T., Schoenherr, C.J., Katz, D.J., Ingram, R.S., Levorse, J.M., Tilghman, S.M., 2000. CTCF mediates methylation-sensitive enhancerblocking activity at the H19/Igf2 locus. Nature 405, 486489. Hollemann, T., Schuh, R., Pieler, T., Stick, R., 1996. Xenopus Xsal-1, a vertebrate homolog of the region specic homeotic gene spalt of Drosophila. Mech. Dev. 55, 1932. Hollemann, T., Bellefroid, E., Pieler, T., 1998. The Xenopus homologue of the Drosophila gene tailless has a function in early eye development. Development 125, 24252432. Kanduri, C., Pant, V., Loukinov, D., Pugacheva, E., Qi, C.F., Wolffe, A., Ohlsson, R., Lobanenkov, V.V., 2000. Functional association of CTCF with the insulator upstream of the H19 gene is parent of origin-specic and methylation-sensitive. Curr. Biol. 10, 853856. Klenova, E.M., Nicolas, R.H., Paterson, H.F., Carne, A.F., Heath, C.M., Goodwin, G.H., Neiman, P.E., Lobanenkov, V.V., 1993. CTCF, a conserved nuclear factor required for optimal transcriptional activity of the chicken c-myc gene, is an 11-Zn-nger protein differentially expressed in multiple forms. Mol. Cell. Biol. 13, 76127624. Klenova, E.M., Chernukhin, I.V., El-Kady, A., Lee, R.E., Pugacheva, E.M., Loukinov, D.I., Goodwin, G.H., Delgado, D., Filippova, G.N., Leon, J., Morse 3rd, H.C., Neiman, P.E., Lobanenkov, V.V., 2001. Functional phosphorylation sites in the C-terminal region of the multivalent multifunctional transcriptional factor CTCF. Mol. Cell. Biol. 21, 22212234. Lobanenkov, V.V., Nicolas, R.H., Adler, V.V., Paterson, H., Klenova, E.M., Polotskaja, A.V., Goodwin, G.H., 1990. A novel sequence-specic DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC-motif in the 5 0 -anking sequence of the chicken c-myc gene. Oncogene 5, 17431753. Lutz, M., Burke, L.J., Barreto, G., Goeman, F., Greb, H., Arnold, R., Schultheiss, H., Brehm, A., Kouzarides, T., Lobanenkov, V., Renkawitz, R., 2000. Transcriptional repression by the insulator protein CTCF involves histone deacetylases. Nucleic Acids Res. 28, 17071713. Nieuwkoop, P.D., Faber, J., 1967. Normal Table of Xenopus laevis (Daudin), North Holland, Amsterdam, The Netherlands. Ohlsson, R., Renkawitz, R., Lobanenkov, V., 2001. CTCF is a uniquely versatile transcription regulator linked to epigenetics and disease. Trends Genet. 17, 520527. Stancheva, I., Meehan, R.R., 2000. Transient depletion of xDnmt1 leads to premature gene activation in Xenopus embryos. Genes Dev. 14, 313 327.

TAATCCAGCACC and GAGCTTCCTCAACTACCTCTGCTTC. A randomly primed ZAP express cDNA library prepared from isolated heads of stage 32 embryos (Hollemann et al., 1998) was screened by PCR using these xCTCF-specic primers. Positive pools were plated and screened by lter hybridization using a radiolabeled cDNA probe cut from pGEM-xCTCF-CT. Identied clones were helper-excised from lambda phage and the inserts in pBK-CMV were sequenced. Preparation of total RNA from embryos, whole-mount in situ hybridization and vibratome sections were done as described previously (Hollemann et al., 1996). To assess and remove possible DNA contamination, RNA was rst used in a PCR reaction with primers for histone H4, CGGGATAACATTCAGGGTATCACT and ATCCATGGCGGTAACTGTCTTCCT. Any samples containing an ampliable fragment were extensively digested with RNase free DNase (Roche) and repuried. RT-PCR on RNA was then carried out with a Gene Amp RNA PCR kit (Perkin-Elmer) using xCTCF-specic primers or primers for histone H4. To generate xCTCF antisense RNA, the pGEM-xCTCF-CT clone was linearized and then transcribed using SP6 polymerase. Acknowledgements We would like to thank Marco Winkler for excellent technical assistance and Helmut Dotzlaw for reading the manuscript. The work was supported by a grant from the Sonderforschungsbereich SFB 397 of the Deutsche Forschungsgemeinschaft and by the Fonds der Chemischen Industrie. References
Baniahmad, A., Steiner, C., Kohne, A.C., Renkawitz, R., 1990. Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site. Cell 61, 505514. Bell, A.C., Felsenfeld, G., 2000. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482 485. Bell, A.C., West, A.G., Felsenfeld, G., 1999. The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98, 387 396. Filippova, G.N., Fagerlie, S., Klenova, E.M., Myers, C., Dehner, Y., Good-