Plant Science 166 (2004) 703–709

Molecular basis and genetic characterisation of evolved resistance

to ALS-inhibitors in Papaver rhoeas
Laura Scarabel a , Nicola Carraro b , Maurizio Sattin a , Serena Varotto b,∗
a Istituto di Biologia Agroambientale e Forestale-CNR, Sezione Malerbologia di Legnaro, viale dell’Università 16, 35020 Legnaro (PD), Italy
b Dipartimento di Agronomia Ambientale e Produzioni Vegetali, Università degli studi di Padova, viale dell’Università 16, 35020 Legnaro (PD), Italy

Received 3 October 2003; received in revised form 10 November 2003; accepted 10 November 2003

Abstract

ALS gene from susceptible and field-selected Papaver rhoeas populations resistant to ALS-inhibitor herbicides was studied. The full-length
cDNA and genomic sequence coding for acetolactate synthase (ALS) of a susceptible population of poppy was cloned and sequenced. Some
peculiarities in poppy ALS gene were identified aligning the sequences in GenBank. Southern analysis using a 800 bp fragment of ALS showed
that poppy possesses a single copy of the gene. Partial ALS genomic DNAs from nine poppy populations resistant to ALS-inhibitor herbicides
and four susceptible populations, collected in central and southern Italy where resistance to ALS-inhibitors is increasing due to repeated use
of sulfonylureas, were amplified and sequenced. Comparison of the coding sequences identified three independent point mutations leading
to different amino acid substitutions in the deduced polypeptide sequence. The three point mutations, all at proline 197 (CCT) (based on
Arabidopsis numbering) in the conserved domain A of the gene, included a change of Pro to His (CAT), to Thr (ACT) or to Ser (TCT). These
mutations cause similar cross-resistance patterns. Analysis of the progeny of two crosses between resistant (R) and susceptible (S) biotypes
indicated that resistance is inherited as a dominant monogenic trait, although seed dormancy may interfere with a correct segregation of R and
S biotypes in the progeny. These are the first mutations completely characterised in poppy ALS gene that confer resistance to ALS-inhibitor
herbicides.
© 2003 Elsevier Ireland Ltd. All rights reserved.

Keywords: Poppy; Acetolactate synthase (ALS); Herbicide resistance; Sulfonylureas; Point mutations

1. Introduction being developmentally regulated in a tissue specific manner

Acetolactate synthase (ALS), also known as acetohydrox-
yacid synthase (AHAS) catalyses the first set of parallel re-
actions in the biosynthesis of the branched chain amino acids
valine, leucine and isoleucine, found in bacteria, yeast and
higher plants, but not in mammals. Yeast possesses a single
ALS protein in the mitochondria, whereas bacteria have mul-
tiple ALS isozymes [1]. Higher plants have a variable num-
ber of ALS genes, mainly depending on the level of ploidy:
diploid Arabidopsis thaliana has one constitutive copy [2],
allotetraploid Nicotiana tabacum has two unlinked ALS loci,
whose genes are expressed in a co-ordinated manner in all
tobacco organs [3]; Zea mays, which has been defined a
cryptic allopolyploid, has two very similar ALS isozymes
[4]; Brassica napus, an amphidiploid of B. campestris and
B. oleracea, has five ALS genes, with the different isoforms
∗ Corresponding author. Fax: +390498272839.
E-mail address: serena.varotto@unipd.it (S. Varotto).
[5]. ALS is encoded by nuclear genes usually characterised
by a putative chloroplast transit peptide sequence that con-
firms localisation of their product activity in the chloroplast
[5]. No introns have yet been found in ALS genes.
ALS is the target site of five herbicide families known
as ALS-inhibitors: sulfonylureas (SU), imidazolinones (IM),
triazolopyrimidines (TP), pyrimidinylthiobenzoates (PTB)
and sulfonylaminocarbonyltriazolinones (SCT). During the
past 20 years use of these herbicides has increased rapidly
worldwide because of their excellent selective control of
major broadleaf weeds at low dosages. ALS-inhibitors also
show negligible mammalian toxicity, and with a few excep-
tions (e.g. chlorosulfuron in high pH soil), acceptable soil
residual activity. In the foreseeable future their use in cereal
crops may well increase even more due to the introduction
of graminicide SU [6–9].
Unfortunately, ALS-inhibiting herbicide use has been
plagued by the evolution of herbicide resistance, which can
be defined as “the inherited ability of a weed to survive a

0168-9452/$ – see front matter © 2003 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.plantsci.2003.11.006
704 L. Scarabel et al. / Plant Science 166 (2004) 703–709

rate of herbicide which would normally result in effective 2. Materials and methods
control” [10]. The first case of resistance was observed in
Lactuca serriola [9,11] only 5 years after the SU (chlor- 2.1. Plant material and pollinations
sulfuron) appeared on the market in 1982. Since then there
has been a steady increase in the number of species af- To characterise susceptible and resistant populations, as
fected by ALS resistance (to date at least 25 monocot well as the resistance pattern, greenhouse dose-response and
and 55 dicot species [12]) mainly due to the repetitive enzyme activity experiments had previously been performed
use of ALS-inhibitor herbicides and monoculture cropping (Sattin et al., unpublished data).
systems. . Table 1 gives the complete list of P. rhoeas populations
In most cases, field-selected ALS-inhibitor resistance is used in the experiments. Mature capsules of all popula-
linked to an altered ALS enzyme that is no longer sensi- tions were sent to the Italian Herbicide Resistance Working
tive to the herbicide (target-site resistance). However, a re- Group based at the Weed Science Section of the Italian Re-
sistance mechanism based on herbicide detoxification has search Council Institute of Agro-environmental Biology and
been observed in some biotypes of grass weeds (Lolium Forestry. To break dormancy, seeds were stratified for eight
rigidum and Alopecurus myosuroides) [13]. In these cases days at 4 ◦ C in Petri dishes on wet filter paper in darkness.
the ALS-inhibitors were not the selecting agent. Target-site They were then sown in Petri dishes on a medium containing
resistance is inherited as a Mendelian dominant (or partially 0.6% agar with the addition of 0.2% KNO3 and placed in a
dominant) single gene in all biotypes characterised geneti- germination cabinet at a 12 ◦ C/23 ◦ C night/day with a 12 h
cally so far. In all resistant (R) biotypes described, a point photoperiod. After 10 days, seedlings were transplanted in
mutation in the gene sequence that determines an amino 16 cm diameter pots filled with the following substrate: silty
acid change in the protein is causing ALS enzyme insensi- loam soil 60% (w/v), sand 30% (w/v), peat 10% (w/v). Six
tivity to the herbicide [14]. Five different amino acids sub- seedlings were sown per pot and after one week they were
stitutions in different very conserved regions of ALS have reduced to five per pot.
been identified in R biotypes: Ala122 [15], Pro197 [16–19], Ten pots per population were treated at the three-leaf-stage
Ala205 at the amino-terminal end [20], Trp574 [15,18,21–23] with tribenuron-methyl (Granstar, Dupont), which in most
and Ser653 [23] at the carboxy-terminal end, based on amino cases had been the resistance-selecting agent. Leaves from
acid positions in Arabidopsis. Eight different amino acid plants that survived the herbicide treatment (at field rate)
substitutions for Pro197 and two for Ser653 have also been were collected for amplification of the ALS gene sequence.
reported in R populations. It has been postulated that each Leaves from untreated susceptible plants were also collected
substitution is associated with a particular pattern and level for molecular characterisation.
of resistance to different ALS-inhibitors. Even if data for One hundred crosses were done using plants of resistant
cross-resistance to ALS-inhibiting herbicides and ALS sub- biotype 02–19 that had survived a treatment at recom-
stitution combinations are far from being complete, several mended field-dose with tribenuron methyl and plants from
trends have been noted. Substitutions of Ala122 or Ser653 the 01–17 susceptible biotypes. The mating scheme for
result in IMI but not SU resistance, while substitutions of each plant was as follows: one selfing event, one resistant
Pro197 usually result in a high SU resistance and no, or low (R) × susceptible (S) and the reciprocal, one resistant (R)
to moderate, IMI resistance, as summarised by Tranel and × resistant (R) crossing. Due to the length of flowering in
Wright, 2002. Substitution of Trp574 results in high levels P. rhoeas, crosses covered a period of 6 weeks. As soon as
of resistance to both IMI and SU herbicides. each flower opened it was hand pollinated then immediately
The species that have evolved populations resistant to
ALS-inhibitors in Italy are: Alisma plantago-aquatica, Scir- Table 1
pus mucronatus [24] and more recently Cyperus difformis Location (province), nucleotide substitution and amino acid change at Pro
[12] in rice fields, and Papaver rhoeas infesting durum wheat 197 in P. rhoeas populations
crops in central and southern Italy. Code Location Biotype Codon Amino acid
Papaver rhhoeas is an insect-pollinated diploid dioic
98–7 Bari Susceptible CCT Pro
species (2n = 14). Seed dormancy [25], along with a well- 00–8 Padova Susceptible CCT Pro
characterised gametophytic incompatibility system [26], 00–10 Roma Resistant ACT Thr
have been shown to govern poppy population dynamics 01–9 Bari Resistant CAT His
[25,27]. This paper reports the molecular basis and genetic 01–17 Bari Susceptible CCT Pro
characterisation of ALS-inhibitor resistance in Italian pop- 01–18 Terni Susceptible CCT Pro
02–19 Foggia Resistant TCT Ser
ulations. We show that poppy possesses a single copy ALS 02–20 Potenza Resistant CAT His
gene and that three different independent point mutations 02–21 Potenza Resistant CAT His
in the gene sequence have conferred resistance to ALS in- 02–22 Potenza Resistant CAT His
hibiting herbicides. We also report that in poppy, resistance 02–23 Potenza Resistant CAT His
to the selecting agent SU is inherited as a single dominant 02–24 Foggia Resistant CAT His
02–26 Grosseto Resistant TCT Ser
monogenic trait.
 L. Scarabel et al. / Plant Science 166 (2004) 703–709 705

covered with a pollination bag to prevent the arrival of any fied a fragment at the 3 end of the gene. Amplifications
undesirable pollen. The bag was removed only when the were done in 50 ␮l with 100 ng of genomic DNA tem-
capsule was mature and open, which was then collected plate, 0.6 ␮M of each primer, 0.2 mM of each dNTP, 3 mM
and the seeds from 15 of these germinated as described of MgCl2 and 1.5 units of AmpliTaq Gold Polymerase
above. After transplanting, the seedlings were grown in the (Perkin-Elmer). A pre-PCR incubation was done in a Ther-
greenhouse and their leaves used for DNA extraction. mal Cycler 2400 (Perkin-Elmer) for 2 min at 95 ◦ C then
amplification proceeded with 40 cycles at 94 ◦ C for 30 s,
2.2. Nucleic acid extraction 1 min at 53 ◦ C and 1 min 30 s at 72 ◦ C. Final extension time
was 12 min at 72 ◦ C. Primers AHAS-1 and AHAS-2 were
Genomic DNA was extracted from 10 individual plants of used to amplify a genomic fragment of 1206 bp at 5 of the
each of the populations reported in Table 1, 10 plants from gene. Primers AHAS-3 and AHAS-4 produced a fragment
the cross 01–17A (S) × 02–19A (R) and 25 from the cross of 879 bp at 3 of the gene.
02–19A (R) × 01–17A (S) using the Nucleon Phytopure After sequencing the genomic ALS amplified fragments,
extraction kit (Amersham Pharmacia). All extractions using specific primers for P. rhoeas were constructed (Table 2).
0.1–0.2 g of fresh plant tissue were conducted according to Amplifications with specific primers were performed as fol-
the manufacturer’s instructions except for the addition of lows: pre-PCR incubation for 5 min at 95 ◦ C, then 30 cycles
twice the suggested volume of suspension resin. The final of 30 s at 95 ◦ C, annealing for 1 min at 58 ◦ C and extension
elution step was performed in 100–200 ␮l sterile water. Total for 1 min 30 s at 72 ◦ C. After the last cycle, amplification
RNA was extracted from 1 g of fresh tissue from single was extended for 10 min at 72 ◦ C. Primers PAP-1 and PAP-2
plants belonging to the 98–7 and 00–8 populations using amplified a fragment of 834 bp at the 5 end of the gene,
the same kit. Selective precipitation was with 8 M LiCl at whereas primers PAP-3 and PAP-4 produced a 810 bp frag-
4 ◦ C overnight, final elutions were done in 80–100 ␮l of ment at 3 of the gene. The combination of primers PAP-6
diethylpyrocarbonate (DEPC)-treated water and the RNA and PAP-7 allowed the amplification of 1209 bp: this frag-
immediately stored at −80 ◦ C. ment overlapped with PAP-1/PAP-2 fragment at 5 and with
PAP-3/PAP-4 product at 3 of the gene, thus producing a
2.3. DNA amplification, cloning and sequence analysis unique contig.
Sequencing was done by an ABI PRISM 3700 DNA
Degenerate specific primers (see Table 2) were designed Analyzer (Applied Biosystems) on both cloned fragments
on regions of high homology among the ALS gene sequences and PCR products. Clones and PCR fragments were se-
available in GenBank: Arabidopsis thaliana X51514, Bras- quenced in both strands to exclude amplification errors.
sica napus M60068 M37786, Brassica scoparia AF094326, Genomic DNA fragments were cloned using a TOPO
Nicotiana tabacum X07644 and Xanthium spp U16279. TA Cloning® kit (Invitrogen) following the manufacturer’s
These primers were used for amplifying ALS genomic frag- instructions and sequences were obtained using T7 and
ments from susceptible population 98–7 and resistant pop- SP6 universal primers. PCR fragments were extracted
ulation 00–10. The primer combination AHAS-1/AHAS-2 from 1% agarose gel and purified using Ultrafree® DNA
produced a genomic fragment at the 5 end of the ALS centrifugal filter devices (Millipore). Specific extension
gene, whereas the combination AHAS-3/AHAS-4 ampli- primers PAP-6 and PAP-2 were used for sequencing the
PCR product. Sequences were edited by Chromas 1.3 soft-
ware. Nucleotide sequences assembly, alignment, compar-
Table 2
ison and translation were done using Lasergene software
List of primers designed for the amplification of the ALS gene of P.
rhoeas DNASTAR.
Primer Sequence 5 → 3a Direction
2.4. Southern blotting
AHAS-1 CCWAGDAARGGDGCDGAYGT Forward
AHAS-2 GTYGTRGTYTACACCCGNCG Reverse Extracted genomic DNA was quantified using a spec-
AHAS-3 ATGYTNGGNATGCAYGGNAC Forward
AHAS-4 GGWGTRGTYCTYGTWCAV Reverse
trophotometer (ULTRASPED 2600 Pharmacia) and 5 ␮g
PAP-1 CCTAGTAAAGGTGCGGATGTTCTC Forward were digested with HindIII and EcoRI for 5 h at 37 ◦ C.
PAP-2 GTCTACAGCATAGTTTGCGTATAC Reverse Digested DNA was separated by electrophoresis in 0.8%
PAP-2N3 GGATGCTGTCGAGCAATGCATCGG Reverse agarose gel in TAE buffer, transferred to a nylon mem-
PAP-3 GGGACTGTATACGCAAACTATGC Forward brane (Hybond-N Amersham) using the capillary blotting
PAP-4 GGACCAGGTGTGTCCAACATCT Reverse
PAP-3N TAGCACGGGTGTTGGGCAGCATCA Forward
technique and cross-linked under UV light. It was then
PAP-6 CTTGTTAGCGGTCTTGCCGATGC Forward pre-hybridised in a buffer containing 5 × SSC, 0.1%
PAP-7 ATAAAACCGATCCTCCCACTG Reverse N-lauroylsarcosine, 0.02% SDS, 1% blocking reagent
a The IUPAC–IUB codes for mixed bases are used: R is (AG), M is (Roche) and hybridised at 68 ◦ C for 16 h in the same solu-
(AC), Y is (CT), W is (AT), K is (GT), N is (ACTG), V is (ACG), and tion with 100 ng ml−1 of digoxigenin-labelled ALS cDNA
D is (AGT). fragment of 800 bp cloned by real time PCR. The membrane
706 L. Scarabel et al. / Plant Science 166 (2004) 703–709
was washed twice in 2 × SSC 0.1% SDS at 68 ◦ C for 15 min
and then twice for 10 min in 1 × SSC 0.1% SDS and 0.5
× SSC 0.1% SDS at 68 ◦ C. CDP-star (Roche) was used for
digoxigenin-detection following the manufacturer’s proto-
col for visualisation of the hybridisation signal. Finally the
filter was exposed on chemiluminescent-film (Pierce) for
2 h at room temperature.
2.5. cDNA synthesis, 3 and 5 -rapid amplification
(RACE)
A SMART RACE cDNA amplification kit (Clontech) was
used to obtain the 3’ and 5’ ends of the ALS gene of suscep-
tible biotype 98–7 according to the manufacturer’s protocol.
Primer PAP-3N was designed based on the 3 end se-
quence of the fragment obtained using primers PAP-3 and
PAP-4 and primer PAP-2N3 was designed based on the 5
end sequence of the fragment obtained using primers PAP-1
and PAP-2.
The 3’RACE cDNA was synthesised starting with 0.9 ␮g
of total RNA and using a reverse transcriptase proce-
dure with a special oligo (dT) primer provided in the kit.
PCR reactions were made with primer UPM provided
in the kit and primer PAP-3N at a final concentration
of 0.2 ␮M and the cycling programme was a touchdown
PCR: 5 cycles of 5 s at 94 ◦ C and 1 min 30 s at 72 ◦ C, fol-
lowed by 5 cycles of 5 s at 94 C, 10 s at 70 ◦ C and 1 min
30 s at 72 ◦ C and terminated by 24 cycles of 5 s at 94 C,
10 s at 68 ◦ C and 1 min 30 s at 72 ◦ C. A single amplicon
of about 800 bp was obtained, cloned and sequenced as
before.
For amplification of the ALS gene 5 end, first-strand
cDNA was prepared starting with 900 ng of total RNA
and using a modified lock-docking oligo (dT) primer and
SMART II A oligo. Primers UPM and PAP-2N3 at a final
concentration of 0.2 ␮M were used for PCR reactions with
the same cycling programme as for the 3’RACE PCR re-
actions. A single fragment of about 600 bp was obtained,
cloned and sequenced as before.
3. Results
3.1. Identification of ALS gene of P. rhoeas
In the ALS enzyme sequence, mutations conferring resis-
tance are usually located in five conserved regions. These
regions, or domains, are of a size of between 12 and 57 bp
and are named from A to E. Domains C, A and D in this
order from the ATG starting codon are located at 5 of the
ALS gene sequence, whereas domains B and E are highly
conserved regions at 3 of the gene [28]. The combina-
tion of degenerate primer AHAS-1/AHAS-2 was initially
used to amplify a DNA fragment of 1206 bp by genomic
PCR, which comprised domains A, C and D from resistant
population 00–10 and two susceptible populations 98–7
DOMAIN A
191 203
98-7S Ala Val Thr Gly Gln Val Pro Arg Arg Met Ile Gly Thr
98-7S GCT GTA ACT GGT CAA GTA CCT AGG AGG ATG ATT GGT ACT
02-22R — — — — — — CAT — — — — — — His
00-10R — — — — — — ACT — — — — — — Thr
02-19R — — — — — — TCT — — — — — — Ser
Fig. 1. Nucleotide and deduced amino acid sequence of ALS gene domain
A of a susceptible (98–7) and three resistant biotypes (02–22, 00–10 and
02–19) of P. rhoeas showing a different point mutation at the same codon.
The amino acid positions refer to the Arabidopsis thaliana sequence;
—indicates identical codon.
and 00–8. A second combination of degenerate primers
AHAS-3/AHAS-4 was used to amplify a genomic fragment
of 897 bp containing domain B from the three populations.
The amplified genomic fragments of the expected size were
sequenced. A homology search in GenBank confirmed that
the sequences coded for poppy ALS protein. Sequences
were then aligned to identify specific primers for further
PCR amplifications and to perform RACE–PCR reactions.
Sequence alignments identified two nucleotide substitutions
in the genomic fragment comprising domains C, A, and D.
Referring to Arabidopsis precursor ALS, one mutation was
synonymous (ATC → ATT) at position 211 in suscepti-
ble population 98–7. The second mutation at position 197
(CCT → CAT) in domain A was not synonymous and deter-
mined a Pro to Thr substitution in resistant population 00–10
(Fig. 1).
3.2. Structure of P. rhoeas ALS gene
A sequence of 2357 bp was assembled after RACE reac-
tions and deposited in the EMBL database (Accession num-
ber: AJ577316). The sequence comprised an ORF of 1988
nucleotides starting at position 88. The TGA stop codon
was identified at position 2073. Alignment of poppy ALS
deduced amino acid sequence revealed the highest level of
identity with Solanum ptycanthum (83%) and Gossypium
hirsutum (82%) ALS protein sequences. The amino acid se-
quence of the ALS protein of A. thaliana showed 80% iden-
tity with the poppy ALS. These identity percentages did not
include the putative transit peptide of about 80 amino acids at
N-terminal end of the protein sequence. The signal peptide is
particularly rich in hydroxylated amino acids threonine and
serine (35%) and in small hydrophobic amino acids. Consid-
ering the sequences of the four domains (A to D), the poppy
ALS protein sequence highlighted the presence of a valine
at position 192 in domain A (Fig. 1). The same substitution
was observed in all poppy biotypes reported in Table 1. In-
terestingly, all other plant amino acid sequences deposited
in GenBank have an isoleucine at this position. A further
peculiar substitution in poppy deduced amino acid sequence
was in conserved domain E, where mutations determining
resistance were observed only in laboratory selections [29].
Poppy, like Xanthium spp and Ambrosia artemisiifolia [14],
has an alanine at position 653 instead of the more usual ser-
ine in plant ALS sequences.
 L. Scarabel et al. / Plant Science 166 (2004) 703–709
Fig. 2. Southern analysis. Genomic DNA of poppy was digested with
HindIII (lane 1) and EcoRI (lane 2), separated by electrophoresis, blotted
on a nylon membrane and probed with ALS cDNA fragment of 800 bp.
The sequence analysis also revealed that P. rhoeas ALS
gene had no introns. Numerous heterozygous nucleotide
bases were observed, mainly at 3 of the gene sequence.
The identified ALS cDNA clone was used as probe in
Southern blotting experiments with HindIII, and EcoRI di-
gested total genomic DNA. A single hybridisation band was
observed, suggesting that ALS is a single copy gene in P.
rhoeas genome (Fig. 2).
3.3. Resistance assessment among screened populations
The ALS gene sequence fragments including domain A
of plants from all the populations were determined using
primer combination PAP-6/PAP-2. The sensitive biotypes
had a CCT codon encoding Pro. The resistant biotypes had
three different point mutations affecting the same codon
(Table 1). In six populations a CCT to CAT mutation that
changes a Pro to His (Accession number: AJ577318 in Gen-
Bank) was observed. In two populations a CCT to TCT sub-
stitution determined a Pro to Ser change and finally in one
population a CCT to ACT changed a Pro to Thr (Accession
number: AJ577317 in GenBank). The four resistant biotypes
from Potenza (00–20 to 00–23) came from the same farm
and proved to have the same point mutation.
This is the first report on the characterisation of ALS
alleles resistant to SU identified in P. rhoeas.
3.4. ALS-inhibitors resistance is inherited as a
dominant allele
P. rhoeas possesses a well-characterised gametophytic
self-incompatible mechanism that prevents self-fertilisation
[26]. This was confirmed by the fact that no seeds were
produced by self-pollinated resistant and susceptible plants,
and therefore all seeds contained in capsules were produced
by cross-pollination. In population 02–19 ALS-inhibitor
707
resistance was associated to polymorphism at position 197
of the ALS coding sequence, determining an amino acid
substitution (Pro → Ser). The susceptible biotype belonged
to population 01–17 and was homozygous at the ALS lo-
cus. The seeds produced by 15 capsules were germinated to
characterise the plant progeny. However, as a consequence
of seed dormancy, only one cross-combination and its re-
ciprocal produced sufficient plants to perform segregation
analysis: the cross-combination (S) × (R) yielded 10 plants
and the reciprocal combination (R) × (S) produced 25. The
ALS genomic fragments containing the point mutation re-
sponsible for herbicide resistance were amplified from these
35 hybrids using specific primers PAP-6 and PAP-2. All
amplified fragments were sequenced in both strands and the
two strands aligned. Twenty-two plants were heterozygous
at codon 197. At the first position of triplet 197 in the nu-
cleotide sequence both a T and a C were present, resulting
in proline being replaced by serine in the deduced amino
acid sequence. Thirteen plants resulted as homozygous at
the same codon, always having the CCT codon for Proline
at position 197. These results indicate that the parental
(R) biotype was heterozygous at codon 197, otherwise all
the progeny would have presented the polymorphism. It
can also be inferred that the mutation is a dominant one
and can be successfully transmitted from one generation
to the next, conferring the same genotype as the (R) par-
ent. Assuming a monogenic inheritance of the resistance
trait, Chi-square analysis showed that the segregation of the
progeny fits the 1:1 ratio expected from the cross between a
susceptible homozygous and a resistant heterozygous plant
(χ2 = 2.31; P = 3.841).
4. Discussion
The sequencing and alignment of P. rhoeas ALS full
length cDNA with the other ALS full length sequences re-
ported in GenBank confirmed the presence of five conserved
domains from A to E, in which the mutation(s) conferring
resistance to ALS-inhibitors is usually located [28]. Two
amino acid substitutions in conserved domains A and E were
found in all poppy ALS deduced amino acid sequences.
These substitutions are not involved in herbicide resistance
[14].
The sequence of putative signal peptide which targets the
ALS mature peptide to the chloroplast showed no signifi-
cant similarity, nor with the homologous amino acid stretch
of ALS sequences deposited in GenBank, which is typical
for transit peptides [30]. A recently reported exception to
this “rule” is the sequence of chloroplastic ACCase protein
of Setaria italica, whose transit peptide showed 89% iden-
tity with the transit peptide sequence of chloroplastic AC-
Case from closely related maize [31]. Despite the increasing
number of plant sequences available, a common mechanism
underlying the function of the targeting sequences has not
yet been deciphered [30].
708 L. Scarabel et al. / Plant Science 166 (2004) 703–709
Three different point mutations in P. rhoeas ALS gene
sequence determining the substitution of Pro 197 by His,
Thr or Ser were identified. Comparing these mutations
with the resistance pattern of the same populations, previ-
ously determined in greenhouse dose-response experiments
and confirmed by enzyme activity experiments (Sattin et
al, unpublished data), they all conferred a common re-
sistance pattern to the biotypes: high resistance to tribe-
nuron, metsulfuron, sulfumeturon and chlorsulfuron (SU),
low to imazethapyr (IM) and little or none to florasulam
(TP).
The substitution of Pro197 with His was reported in Lac-
tuca serriola [16] and the substitution of the same Pro
with a Thr or a Ser was also found in Kochia scoparia,
where all six possible amino acid substitutions at the same
codon were reported [17]. In both species the correspond-
ing cross-resistance pattern was not fully determined [14].
The substitution of Pro197 by a Ser in Amaranthus bli-
toides conferred resistance to SU and TP but not to IM
[32]. Cross-resistance patterns caused by amino acid sub-
stitution in the ALS protein sequence have been broadly
classified into three types: SU and TP resistance, IMI
and PTB resistance and SU, IMI, TP and PTB resistance
(broad-cross-resistance) [14]. Resistance to the selective
agents is usually extremely high, while resistance to her-
bicides of different families inhibiting ALS depends on
the species considered. This trend, i.e. a cross-resistance
pattern more associated with species than “standard” types,
seems to be shown by the data from characterisation of the
cross-resistance pattern in an increasing number of weeds
[14].
The characterisation of three resistance alleles in P. rhoeas
landraces from different and distant Italian sites indicates
multiple mutation events rather than the spread of a single
mutation conferring resistance to ALS-inhibitors. However
the four biotypes from the same farm showed the same point
mutation and this might indicate that a single mutation event
is responsible for resistance.
A main goal in weed molecular biology is the rapid iden-
tification of single nucleotide changes responsible for resis-
tance without the need to sequence specific gene fragments.
A suitable procedure for the rapid screening of a large num-
ber of plants and/or populations is the allele specific PCR
assay [33] and recent reports have dealt with its application
for the rapid screening of resistant biotypes in weed man-
agement [34,31]. The structure of the poppy ALS gene is
particularly suitable for allele specific assays: it has no in-
trons and is a single copy gene of a diploid species. Despite
the many primer combinations and PCR conditions tested, it
was not possible to develop a reliable procedure for the rapid
identification of resistant biotypes, mainly due to unspe-
cific amplification products and false-positive results. Since
rapid screening tests could help to monitor resistance alleles
spreading in weed populations, we intend to use the molec-
ular data to develop reliable molecular procedures based on
Real Time PCR.
The mutated allele responsible for resistance to ALS-
inhibitors was transmitted to the progeny. Although the data
do not provide definitive evidence that the mutated allele
is completely dominant, it is clear from the progeny that
the resistant parent was heterozygous for the resistance al-
lele. Furthermore, the resistant parent was randomly cho-
sen from a batch of treated plants that survived the SU her-
bicide treatment with no apparent biomass reduction com-
pared to the untreated plants. Given this, it appears that the
resistant alleles behave as completely dominant. Segrega-
tion analysis of the progeny produced by the cross between
a heterozygous (R) parent and homozygous (S) genotype
showed an unequal (R) allele frequency, which however does
not depart significantly from the expected 1:1 ratio. Sev-
eral hypotheses can be proposed to account for this. Seed
dormancy is probably the main cause of the non-random
allele distribution, since it strongly reduces the number of
progeny [25]. A second cause of (R) allele frequency devi-
ation might be the gametophytic incompatibility system in
poppy [26]. Finally, in analysing unequal S-allele frequen-
cies in a British population of P. rhoeas it was proposed that
linkage of the S-gene to genes controlling seed dormancy
and albinism could cause the non-random allele distribution
[27].
Acknowledgements
The authors thank Paolo Parrini and Giuseppe Zanin for
helpful comments on a earlier version of the manuscript and
Alison Garside for revising the English.
References
[1] S.J. Keeler, P. Sanders, J.K. Smith, B.J. Mazur, Regulation of tobacco
acetolactate synthase gene expression, Plant Physiol. 102 (1993)
1009–1018.
[2] B.J. Mazur, C.F. Chui, J.K. Smith, Isolation and characterization of
plant genes coding for acetolactate synthase the target enzyme for
two classes of herbicides, Plant Physiol. 85 (1987) 1110–1117.
[3] S.J. Keeler, P. Sanders, J.K. Smith, B.J. Mazur, Regulation of tobacco
acetolactate synthase gene expression, Plant Physiol. 102 (1993)
1009–1018.
[4] L.Y. Fang, P.R. Gross, P.H. Chen, M. Lillis, Sequence of two ace-
tohydroxyacid synthase genes from Zea mays, Plant Mol. Biol. 18
(1992) 1185–1187.
[5] T. Oullet, R.G. Rutledge, B.L. Miki, Members of the acetohydrox-
yacid synthase multigene family of Brassica napus have divergent
patterns of expression, Plant J. 2 (1992) 321–330.
[6] D.L. Shaner, B.K. Singh, Acetohydroxyacid synthase inhibitors, in:
M.R. Roe, J.D. Burton, RJ Kuhr (Eds.), Herbicide Activity: Tox-
icology Biochemistry and Molecular Biology, IOS Press, Ohmsha,
1997, pp. 69–110.
[7] E. Hacker, H. Bieringer, L. Willms, O. Ort, H. Koecher, H. Kehne,
RC. Fisher, Iodosulfuron plus mefenpyr-diethyl: a new foliar her-
bicide for weed control in cereals, in: Proceedings of the Brighton
Crop Protection Conference, 1999, pp. 15–22.
[8] E. Hacker, H. Bieringer, L. Willms, K. Lorenz, H.P. Huff, G. Borrod,
R. Brusche, Mesosulfuron-methyl a new active ingredient for grass
 L. Scarabel et al. / Plant Science 166 (2004) 703–709
weed control in cereals, in: Proceedings of the Brighton Crop Pro-
tection Conference, 2001, pp. 43–48.
[9] L.L. Saari, J.C. Cotterman, D.C. Thill, Resistance to acetolactate
synthase inhibiting herbicides, in: S.B. Powles, J.A.M. Holtum Lewis
(Eds.), Herbicide Resistance in Plants Biology and Biochemistry,
CRC Press, Boca Raton, FL, 1994, pp. 83–139.
[10] S.R. Moss, Herbicide-resistant weeds, in: R.E.L. Naylor (Ed.), Weed
Management Handbook, Blackwell Science, UK, 2002, pp. 225–252.
[11] C.A. Mallory-Smith, D.C. Thill, M.J. Dial, Identification of sulfu-
nilurea herbicide-resistant prickly lettuce (Lactuca serriola), Weed
Technol. 4 (1990) 163–168.
[12] I. Heap, The International Survey of Herbicide Resistant Weeds.
Online, Internet. July 26, 2003. Available www.weedscience.com.
[13] J.T. Christopher, S.B. Powles, D.R. Liljegren, J.A.M. Holtum,
Cross-resistance to herbicides in annual ryegrass Lolium rigidum.
Part II. Chlorsulfuron resistance involves a wheat-like detoxification
system, Plant Physiol. 100 (1991) 1036–1043.
[14] P.J. Tranel, T.R. Wright, Resistance of weeds to ALS-inhibiting
herbicides: what have we learned? Weed Sci. 50 (2002) 700–712.
[15] P. Bernasconi, A.R. Woodworth, B.A. Rosen, D.L. Subramaniam,
A. Siehl, A naturally occurring point mutation confers broad range
tolerance to herbicides that target acetolactate synthase, J. Biol.
Chem. 270 (1995) 17381–17385.
[16] M.J. Guttieri, C.V. Eberlein, C.A. Mallory-Smith, D.C. Thill, D.L.
Hoffman, DNA sequence variation in domain A of the acetolactate
synthase genes of herbicide-resistant and susceptible weed biotypes,
Weed Sci. 40 (1992) 670–677.
[17] M.J. Guttieri, C.V. Eberlein, D.C. Thill, Diverse mutations in the
acetolactate synthase gene confer chlorsulfuron resistance in Kochia
(Kochia scoparia) biotypes, Weed Sci. 43 (1995) 175–178.
[18] P. Boutsalis, J. Karotam, S.B. Powles, Molecular basis of resistance
to acetolactate synthase-inhibiting herbicides in Sisymbrium orientale
and Brassica tournefortii, Pestic. Sci. 55 (1999) 507–516.
[19] M. Sibony, A. Michel, H.U. Haas, B. Rubin, K. Hurle, Sulfume-
turon-resistant Amaranthus retroflexus: cross-resistance and molecu-
lar basis for resistance to acetolactate synthase-inhibiting herbicides,
Weed Res. 41 (2001) 509–522.
[20] A.R. Woodworth, P. Bernasconi, M. Subramanian, B. Rosen, A sec-
ond naturally occurring point mutation confers broad-base tolerance
to acetolactate synthase inhibitors, Plant Physiol. 111 (1996) S 105.
[21] A. Woodworth, B.A. Rosen, P. Bernasconi, Broad range resistance
to herbicides targeting acetolactate synthase (ALS) in a field isolate
of Amaranthus sp. is conferred by a Trp to Leu mutation in the ALS
gene, Plant Physiol. 111 (1996) 1353.
709
[22] M.J. Foes, L. Liu, G. Vigue, E.W. Stoller, L.M. Wax, P.J. Tranel,
A kochia (Kochia scoparia) biotype resistant to triazine and
ALS-inhibiting herbicides, Weed Sci. 47 (1999) 20–27.
[23] W.L. Patzoldt, P.J. Tranel, Molecular analysis of cloransulam resis-
tance in a population of giant ragweed, Weed Sci. 50 (2002) 299–
305.
[24] M. Sattin, D. Berto, G. Zanin, M. Tabacchi, Resistance to ALS-
inhibitors in weeds of rice in north-western Italy in: Proceed-
ings of the Brighton Crop Protection Conference on Weeds, 1999,
pp. 783–790.
[25] C.C. Baskin, P. Milberg, L. Anderssons, J.M. Baskin, Non-deep sim-
ple morphophysiological dormancy in seeds of the weedy facultative
winter annual Papaver rhoeas, Weed Res. 42 (2002) 194–202.
[26] De Nettancourt, Stigmatic monofactorial multiallelic GSI in Papaver
rhoeas, Incompatibility and incongruity in wild and cultivated plants,
Springer-Verlag, Berlin, 2001, pp. 113–121.
[27] M.D. Lane, M.J. Lawrence, The population genetics of the
self-incompatibility polymorphism in Papaver rhoeas. X. An associ-
ation between incompatibility genotype and seed dormancy, Heredity
75 (1995) 92–97.
[28] M.D. Devine, C.V. Eberlein, Physiological, biochemical and molec-
ular aspects of herbicide resistance based on altered target sites. in:
M.R. Roe, J.D. Burton, R.J. Kuhr (Eds.), Herbicide Activity: Tox-
icology Biochemistry and Molecular Biology, IOS Press, Ohmsha,
1997, pp. 159–185.
[29] K. Sathasivan, G.W. Hagh, N. Murai, Nucleotide sequence of a mu-
tant acetolactate synthase gene from imidazolinone resistant Ara-
bidopsis thaliana var Columbia, Nucleic Acids Res. 18 (1990) 2188.
[30] B.D. Bruce, The paradox of plastid transit peptides: conservation of
function despite divergence in primary structure, Biochim. Biophys.
Acta 1541 (2001) 2–21.
[31] C. Délye, T. Wang, H. Darmency, An isoleucine-leucine substitution
in chloroplastic acetyl–CoA carboxylase from green foxtail (Setaria
viridis L Beauv) is responsible for resistance to the cyclohexanedione
herbicide sethoxydim, Planta 214 (2002) 421–427.
[32] M. Sibony, B. Rubin, Molecular basis for multiple resistance to ace-
tolactate synthase-inhibiting herbicides and atrazine in Amaranthhus
blitoides prostrate pigweed, Planta 216 (2003) 1022–1027.
[33] B.L. Pearson, R.H. Heflich, Genotypic selection methods for the
direct analysis of point mutations, Mutat. Res. 387 (1997) 97–
121.
[34] J. Wagner, H.U. Haas, K. Hurle, Identification of ALS inhibitors
resistant Amaranthus biotypes using polymerase chain reaction am-
plification of specific alleles, Weed Res. 42 (2002) 280–286.