Sie sind auf Seite 1von 6

Pesticide Biochemistry and Physiology 92 (2008) 24–29

Pesticide Biochemistry and Physiology 92 (2008) 24–29 Contents lists available at ScienceDirect Pesticide

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology

journal homepage: www.else vier.com/locate/ypest

journal homepage: www.else vier.com/locate/ypest Self-EcoTILLING to identify single-nucleotide mutations in

Self-EcoTILLING to identify single-nucleotide mutations in multigene family

Guang-Xi Wang a, * , Toshiyuki Imaizumi a , Wei Li b , Hiromasa Saitoh c , Ryohei Terauchi c , Takanori Ohsako d , Tohru Tominaga a

a Laboratory of Weed Science, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502, Japan

b Wuhan Botanical Garden, The Chinese Academy of Sciences, Hubei 430074, PR China

c Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan

d Laboratory of Agroecology, Graduate School of Agriculture, Kyoto Prefectural University, Kyoto 619-0244, Japan

article info

Article history:

Received 28 June 2007 Accepted 14 May 2008 Available online 28 May 2008

Keywords:

EcoTILLING Multigene family Polyploid plant Self-EcoTILLING Single-nucleotide mutation

abstract

TILLING (Targeting Induced Local Lesions IN Genomes) is a low-cost, high-throughput reverse genetic technique that employs a mismatch-specific endonuclease CEL-1 to discover induced point mutations in the genes of interest. The use of the TILLING technique to survey natural variation in genes is called EcoTILLING. Here, we report a modified EcoTILLING method for the discovery of mutations in multigene family, which we coin ‘‘Self-EcoTILLING” by using an allotetraploid Monochoria vaginalis ALS multigene family as an example. The mutations could be detected by TILLING of PCR products resulting from the primers specific to both Als1 and Als3 without involving the experimental step of mixture of reference and query DNA. Either of the two co-amplified loci could serve as reference DNA to the other. We demonstrate with this example that Self-EcoTILLING is a fast, reliable and economical technique of detecting single-nucleotide mutations in polyploid plants containing multigene family.

2008 Elsevier Inc. All rights reserved.

1. Introduction

TILLING (Targeting Induced Local Lesions IN Genomes) is a low- cost, high-throughput reverse genetic technique that employs a mismatch-specific endonuclease CEL-1 to discover induced point mutations in the genes of interest [1–3] . A run of Li-Cor gel ana- lyzer TM can study up to 1.5-kb region for 96 DNA samples, and by pooling of DNA samples one can probe over 2000 individuals per day. The use of the TILLING technique to survey natural variation in genes is called EcoTILLING [4] . Genomic DNA of an individual to be queried is mixed with a reference DNA and used to amplify the target region of DNA with the two primers that are labeled with different fluorescent dyes. The amplified DNA is heat dena- tured and reannealed. If any DNA polymorphism present between the query and reference DNAs, heteroduplex fragments with mis- matches are generated in half of the duplex molecules. These het- eroduplexes are nicked at mismatched sites by the endonuclease CEL-1 and resulting fragments are separated in a denaturing PAGE gel. Finally these fragments are visualized by fluorescent dyes at- tached to the primers. Putative polymorphisms detected as a band in one fluorescence channel can be verified by the appearance of corresponding band in the other channel [4] . EcoTILLING should be the most efficient technique for screening hundreds to thou-

* Corresponding author. Fax: +81 75 753 6062. E-mail address: WANG@weed.mbox.media.kyoto-u.ac.jp (G.-X. Wang).

0048-3575/$ - see front matter 2008 Elsevier Inc. All rights reserved.

doi:10.1016/j.pestbp.2008.05.001

sands of individuals for rare single-nucleotide polymorphisms (SNPs) 1 , because screening 1.5-kb fragments by this method allows confident detection and mapping of polymorphisms in a DNA sample whereby DNAs from 10 individuals are pooled. This level of throughput cannot practically be achieved by full sequencing with conventional methods [5]. After the report of Comai et al. [4] , EcoTILLING method has been applied as an efficient SNP discovery tool to survey genetic varia- tion in wild populations of the western black cottonwood, Populus trichocarpa [6] , wild and cultivated Oryza species [7] as well as to detect single-nucleotide mutations in acetolactate synthase (ALS, EC 4.1.3.18; also called acetohydroxyacid synthase) genes of a pad- dy weed, Monochoria vaginalis [8] . In all cases, EcoTILLING revealed useful information about SNPs in the studied populations. Here, we report a modified EcoTILLING method for the discov- ery of mutations in multigene family, which we coin ‘‘Self-EcoTILL- ING” by using an allotetraploid M. vaginalis ALS multigene family as an example. ALS is the first common enzyme in the biosynthesis of the branched chain amino acids valine, leucine and isoleucine. Several classes of herbicides are known to inhibit ALS by binding to a relic

1 Abbreviations used: ALS, acetolactate synthase; ASPCR, allele-specific PCR; BSM, bensulfuron-methyl; DGGE, denaturing gradient gel electrophoresis; PASA, PCR amplification of specific alleles; PCR, polymerase chain reaction; R, resistant; S, susceptible; SNP, single-nucleotide polymorphisms; SSCP, single strand conformation polymorphism; SU, sulfonylurea.

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 24–29

25

quinone-binding site, including sulfonylureas (SUs), imidazolinon- es, triazolopyrimidine sulfonanilides and pyrimidinyl oxybenzo- ates [9] . These highly selective ALS-inhibiting herbicides are very valuable for weed management in a wide range of crops world- wide. However, biotypes resistant (R) to the ALS-inhibiting herbi- cides have been reported in 95 plant species [10]. R biotypes in many cases have modified ALS genes with one or more point muta- tions causing reduced sensitivity to the ALS-inhibiting herbicides [9,11–15]. Substitution in any of the six conserved amino acids (Ala 122 , Pro 197 , Ala 205 , Asp 376 , Trp 574 , or Ser 653 : numbering stan- dardized to Arabidopsis sequence) is known to result in the resis- tance to ALS-inhibitor [16,17]. SU-herbicides are commonly used for weed control in rice fields in Japan. SU-R biotypes have been found in many weeds in the rice fields [18–21]. The first DNA anal- ysis of SU-R biotype of M. vaginalis is that of Wang et al. [22] . They surveyed nucleotide sequences of a partial region of the ALS genes of two individuals, one R and the other susceptible (S) to SU, and found a mutation that changes Pro 197 to Ser in the SU-R biotype. The second DNA study of SU-R biotypes of this species was carried out by Ohsako and Tominaga [23] who isolated four distinct classes of nucleotide sequences from each of the individuals investigated. These sequence classes are thought to be derived from an ALS multigene family consisting of four members named Als1 , Als2 , Als3 and Als4 , among which Als1 and Als3 share extensive homol- ogy. In this research, the two loci Als1 and Als3 were analyzed for association with SU-R phenotype because no nucleotide substitu- tion has been detected in loci Als2 and Als4 [23] . Previously Wang et al. [8] used EcoTILLING to detect causal mutations of Als1 and Als3 loci that confer SU resistance to M. vag- inalis . M. vaginalis (Burm. f.) Kunth is often gregarious and typically found in inundated places or at the edges of pools, ditches and ca- nals, or in swamps. It is particularly common and almost character- istic of rice fields [24] . Chromosome numbers of M. vaginalis are 2 n = 4 x = 52, which is an allotetraploid plant [25] . In that study, the authors treated Als1 and Als3 separately by employing gene- specific primers. Query DNA of SU-R plant was mixed with refer- ence DNA of SU-S plant in 1:1 ratio, and the region was polymerase chain reaction (PCR) amplified by Als1 - or Als3 -specific primers, and mismatch between query and reference DNA was detected separately for the two loci. This experiment identified mutations responsible for SU resistance in either Als1 or Als3 . DNA changes causing amino acid changes in Pro 197 in Als1 or Als3 indeed con- ferred SU resistance to M. vaginalis [8] . During the study, we came to know that Als1 and Als3 sequences are quite similar. This finding prompted us to test whether the mutations could be detected by TILLING of PCR products resulting from the primers specific to both Als1 and Als3 without involving the experimental step of mixture of reference and query DNA. We hypothesized that either of the two co-amplified loci will serve as reference DNA to the other. Indeed our experiment showed that this was possible, and we coined this method ‘‘Self-EcoTILLING”. We demonstrate with this example that Self-EcoTILLING is a fast, reliable and economical technique of detecting SNPs in polyploid plants containing multigene family.

2. Materials and methods

2.1. Plant lines

Sulfonylurea-resistant and -susceptible biotypes of M. vaginalis used in this research are shown in Table 1 . Samples A and B were collected from non-R populations from fields in Miyazu City and Maizuru City, Kyoto Prefecture, respectively. In addition, Samples C, D and E were from Kasai City of Hyogo Prefecture, Kyotango City of Kyoto Prefecture and Daisen City of Akita Prefecture, respec- tively, which both non-resistance and resistance were confirmed

Table 1 Plant materials used in the present research and the sequence context of single- nucleotide mutations

Location of population

Sample Resistance

Pro 197 codon in ALS gene a

code to SU

Als1

Als3

Miyazu, Kyoto Prefecture, Japan

A SU-

susceptible

CCT (Pro) b

CCT (Pro)

 
 

(AB266530) c (AB266526)

Maizuru, Kyoto Prefecture, Japan

B SU-

susceptible

CCT (Pro) CCT (Pro)

 

(AB266529) (AB266524)

C C T T ( Leu )

SU-resistant

CCT (Pro)

Kasai, Hyogo Prefecture, Japan

(AB266521) (AB266522)

D CCT (Pro)

SU-resistant

T CT ( Ser )

Kyotango, Kyoto Prefecture, Japan

(AB266528) (AB266520)

E C A T ( His )

SU-resistant

CCT (Pro)

Daisen, Akita Prefecture, Japan

(AB266527) (AB266518)

a Number is standardized to Arabidopsis sequence.

b Nucleotide substitutions and the resulting amino acid changes are shown with boldface letters, which were obtained from sequencing done in this study.

c Numbers in parentheses are DDBJ Accession numbers.

by pot experiments by applying SU-herbicide: bensulfuron-methyl [methyl-a -(4,6-dimethoxypyrimidin-2-yl-carbamoylsulfamoyl)- o - toluate](BSM), the first SU-herbicide used in Japan. BSM was ap- plied at a concentration of 150 g a.i. ha 1 as granules, twice the rec- ommended field dose, to two- to three-leaf seedlings. These plants that survived the bensulfuron-methyl treatment were used for molecular analysis as R plants.

2.2. Self-EcoTILLING

A flowchart of the Self-EcoTILLING experiment is summarized in Fig. 1 . Total DNA was isolated from 40 mg of young leaves ob- tained from a single plant by a modified CTAB method [26] , and its concentration determined on a 1% agarose gel using lambda DNA (Invitrogen) as a reference. DNAs from all samples were nor- malized to a final concentration of 20 ng l l 1 . The target regions of the two loci ( Als1 and Als3 ) of Als multigene family in M. vaginalis were simultaneously amplified using a set of loci-specific primers, designed based on Ohsako and Tominaga [23] (DDBJ/EMBL/Gen- Bank Accession Nos.: AB243606–AB243639) ( Table 2 ), The forward and reverse primer sequence (upper case in Table 2 ) is tagged at the 5 0 end with the sequence, gctacggactgacctcggac and ctgacgtg atgctcctgacg, respectively, to serve for the annealing site of the common labeled primers used in the second PCR. PCR and CEL-1 (Transgenomics Surveyor TM ) reactions were carried out according to Rakshit et al. [7] with some modifications. PCR amplification was performed in a 20 l l volume containing 1.5 ng genomic DNA, 1 Ex-Taq buffer (2.0 mM Mg 2+ plus, TaKaRa), 0.2 mM dNTPs, 0.3 l M primers, 0.02 U Ex-Taq DNA polymerase (TaKaRa). PCR was conducted using a thermal cycler (MJ Research) as follows: heat denaturation at 95 C for 2 min, followed by 35 cycles of PCR (95 C for 1 min, 60 C for 1 min, 72 C for 1 min), and an additional extension step (72 C for 7 min). The PCR products from the first amplification were purified with ‘‘MILLPORE multi screen” system and diluted 20-fold (5 l l purified products +95 l l sterilized water) and used as template for the second PCR. The ‘common tag’ se- quence (lower case in Table 2 ) for the forward and reverse primers were labeled with IRD700 dye and IRD800 dye (LI-COR), respec- tively, and used in the second PCR using the diluted DNA from the first PCR as template. PCR amplification was performed in a

26

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 24–29

/ Pesticide Biochemistry and Physiology 92 (2008) 24–29 Total DNA Two of four genes, ALS1 and

Total DNA

Two of four genes, ALS1 and ALS3, were amplified by PCR using fluorescently tagged two-loci-specific primers.

3’ by PCR using fluorescently tagged two-loci-specific primers. 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

Cut upper strand

No SNP SNP No SNP SNP 421 bp 300 bp 121 bp IR DYE 700
No SNP
SNP
No SNP
SNP
421
bp
300
bp
121
bp
IR DYE 700
IR DYE 800

Uncut strandsSNP SNP 421 bp 300 bp 121 bp IR DYE 700 IR DYE 800 Cut lower

Cut lower strandbp 300 bp 121 bp IR DYE 700 IR DYE 800 Uncut strands Primer dimers Fig.

Primer dimersbp IR DYE 700 IR DYE 800 Uncut strands Cut lower strand Fig. 1. Flowchart of

Fig. 1. Flowchart of Self-EcoTILLING. For details see Section 2 .

10 l l volume containing 2 l l purified and diluted product of first PCR, 1 Ex-Taq buffer (2.0 mM Mg 2+ plus, TaKaRa), 0.2 mM dNTPs, 0.02 l M primers, 0.02 U Ex-Taq DNA polymerase. PCR was con-

cle). Next, 10 l l of PCR was incubated with 0.0375 l l of CEL-1 en- zyme solution in a total volume of 20 l l (buffered in 10 mM Hepes at pH 7.5, 10 mM MgSO 4 , 10 mM KCl, 0.002% Triton X-100, 0.2 l g/

ducted using a thermal cycler (MJ Research) as follows: heat dena-

ml

BSA) at 45 C for 15 min. Reaction was stopped by the addition

turation at 95 C for 2 min, followed by 35 cycles of PCR (95 C for

of

stop solution (5 l l of 0.15 M EDTA, pH 8.0). Fragments were

1 min, 60 C for 1 min, 72 C for 1 min), and an additional extension step (72 C for 7 min). Heteroduplex formation was then per- formed by incubating at 99 C for 10 min, followed by 70 cycles of 70 C for 20 s with decreasing the temperature 0.3 C each cy-

purified using Sephadex G50 (medium coarse) minicolumns in 96-well filter plates (Multiscreen HV; Millipore) and eluted into plates prefilled with 5 l l of 1 TILLING loading buffer per well. Samples were concentrated to about 1.5 l l by heating at 85 C

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 24–29

27

Table 2 Two-loci-specific primers designed for the PCR amplification of partial regions of Als1 and Als3 of M. vaginalis

Primer name

DNA sequence a

Reference position

 

(AB266521)

(AB266522) b

(AB266527)

(AB266518)

(AB266528)

(AB266520)

(AB266529)

(AB266524)

(AB266530)

(AB266526)

ALS1 + 3fw

gctacggactgacctcggac

Nt. 1–17

TCTGCATCGCCACCTCG

ALS1 + 3rv

ctgacgtgatgctcctgacg

Nt. 402–421

TGAAGCAGATGGAGGGCAGG

a DNA sequence in lower case is a common tag sequence for the second PCR and nucleotide positions were referenced for the DNA sequence in upper case.

b Numbers in parentheses are DDBJ Accession numbers.

for 50–60 min without cover. A total of 0.75 l l was applied to a 100-tooth membrane comb (The Gel Company) and loaded on 6.5% KB plus Gel (20 ml of 6.5% KB plus , 150 l l of 10% ammonium per- sulfate (APS) and 15 l l of TEMED). Electrophoresis was done in 1 TBE running buffer at 1500 V, 40 mA and 40 W settings on a LI-COR Model 4300 DNA Analyzer (LI-COR). Images were analyzed visually for the presence of cleavage products using Adobe Photoshop soft- ware (Adobe Systems Inc.).

2.3. DNA sequencing

Fragments of ALS genes were amplified from the extracted genomic DNA of Samples A–E, respectively, by PCR with gene-spe- cific primers for locus Als1 (ALS1fw: 5 0 -TCTGCCCTGGCTGACGCCCT-

3 0 , ALS1rv:

[8] or Als3 (ALS3fw: 5 0 -TCTGCATCGCCACCTCG-3 0 , ALS3rv: 5 0 -GAC- CCATTAGTGTACTCGC-3 0 ; according to Wang et al. [8] . The genomic sequences were determined directly from the amplified PCR frag- ments after purification of the fragments using a centrifuge filter device (Montage PCR, Millipore Corp. Bedford, USA). ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) was used for the se- quence analysis.

5 0 -ACCCATCAATGTACTCGC-3 0 ; according to Wang et al.

3. Results

3.1. Mutation detection using Self-EcoTILLING

Assay using primer pairs that target both loci Als1 and Als3 de- tected mutations in Domain A of Samples C, D and E. This is indi- cated by the cleavage at the mismatch nucleotide by the CEL-1 enzyme giving rise to 2 fragments, 122 bp and 299 bp in Samples C and E, and 121 bp and 300 bp in Sample D, respectively ( Fig. 2 ). The sizes of the 2 fragments indicate the accurate position of the mismatch and thus the site of the mutation or nucleotide change.

3.2. ALS sequence of M. vaginalis

Two distinct Als loci, Als1 and Als3 , from a section of the mature, protein-coding region of Samples A–E of M. vaginalis were se- quenced. As shown in Table 1 , amino acid substitutions were de- tected in SU-R biotypes at Pro 197 in either Als1 or Als3 . The biotypes from Kasai City, Hyogo Prefecture, Japan (Sample C, DDBJ/EMBL/GenBank Accession Nos.: AB266521 and AB266522) showed a leucine codon replacing Pro 197 in Als1 , Kyotango City, Kyoto Prefecture, Japan (Sample D, DDBJ/EMBL/GenBank Accession Nos.: AB266528 and AB266520) showed a serine codon replacing Pro 197 in Als3 and Daisen City, Akita Prefecture, Japan (Sample E, DDBJ/EMBL/GenBank Accession Nos.: AB266527 and AB266518) showed a histidine codon replacing Pro 197 in Als1 , respectively.

C & E: 122 bp D: 121 bp

400

364

350

300

255

200

145

100

50

& E: 122 bp D: 121 bp 400 364 350 300 255 200 145 100 50

421 bp

C & E: 299 bp

D: 300 bp

Fig. 2. Electrophoresis on a 6.5% KB plus Gel of CEL-1-digested products of a PCR fragment of 421 bp in a Li-Cor model 4300 DNA Analyzer (LI-COR). The sample in each lane is indicated by its code ( Table 1 ). The IR Dye 700 and IR Dye 800 channels are shown at left and right , respectively. CEL-1-cleaved heteroduplexes appear as intense bands [arrowed in blue (IR Dye 700 channel) and in red (IR Dye 800 channel)]. The sizes of the IR700 labeled and the IR800 labeled cleaved fragments add up to the size of the PCR fragment. The fragment sizes also indicate the position of the single-nucleotide mutation present in the locus Als1 or locus Als3 of SU-R plant samples of M. vaginalis collected from Kasai City, Hyogo Prefecture, Japan (Sample C), Kyotango City, Kyoto Prefecture, Japan (Sample D) and Daisen City, Akita Prefecture, Japan (Sample E). This is illustrated by the arrows on the double- stranded fragment above the gel. No cleavage was detected in the SU-S plant samples (Samples A and B).

No mutation was detected in both loci in both non-R populations collected from Miyazu (Sample A, DDBJ/EMBL/GenBank Accession Nos.: AB266530, AB266526) and Maizuru (Sample B, DDBJ/EMBL/ GenBank Accession Nos.: AB266529, AB266524).

4. Discussion

Single-nucleotide mutations in ALS genes of SU-R M. vaginalis has previously been studied by conventional EcoTILLING in which genomic DNA of an SU-R plant (target DNA) was mixed with the DNA of an SU-S plant (reference DNA). The EcoTILLING has been demonstrated to be a fast, reliable, economical method for detect- ing single-nucleotide mutations in genes arising from herbicide selection [8] . However, it needs both DNAs (query and reference) for EcoTILLING to be done by mixing them so that discovery of sin- gle-nucleotide mutations was difficult when only having one type of the plant material, wild type or mutation type. In Japan, several paddy weeds have rapidly diminished those distributional ranges and are now listed as vulnerable species. SU-R biotypes are found in some of those vulnerable species, such as Monochoria korsakowii

28

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 24–29

and Limnophila sessiliflora , and collecting wild type of the plant materials may be difficult in these cases. Self-EcoTILLING, on the other hand, uses the two-loci-specific primers that precisely match two genes of multigene family and the DNA of an only SU-R plant, for example Als1 and Als3 in only one individual (SU-R biotype or SU-S biotype) of the allotetraploid M. vaginalis used in this re- search. Moreover, it is sometimes difficult to finding primers and PCR conditions that can amplify particular locus specifically in a multigene family. Although finding these primers and PCR condi- tions may be easy to do using flanking non-coding region, a run

of Li-Cor gel analyzer TM cannot study more than 1.5-kb of PCR frag- ments. Therefore, flanking non-coding region will not be used for finding primers of EcoTILLING. Self-EcoTILLING does not need the locus-specific-primers. SU-R biotypes with a multigene family have been found extensively in paddy fields in Japan, especially in Lindernia spp. [21] , Schoenoplectus juncoides [27] and M. vaginalis [8,23] in which the mutations in either Als1 or Als2 (or Als3 ) con- ferred resistance to herbicides suggesting that both genes are func- tional. Therefore, as a method, two genes in the multigene family can be used as the query or the reference each other.

 

10

20

30

40

50

60

70

80

|

|

|

|

|

|

|

|

|

|

|

|

|

|

|

|

ALS1_A tctgcatcgccacctcgggccccggagctaccaacctcgtctctgccctggctgacgccctcctcgattctatacccatg

ALS3_A

a

ALS1_B

ALS3_B

a

ALS1_C

ALS3_C

a

ALS1_D

ALS3_D

a

ALS1_E

ALS3_E

a

Domain A

Domain D

 

90

100

110

120

130

140

150

160

|

|

|

|

|

|

|

|

|

|

|

|

|

|

|

|

 

ALS1_A gtcgccatcaccggccaggtccctcgccgcatgatcggcactgacgccttccaggagacgcccatcgtcgaggtcacgcg

ALS3_A

ALS1_B

ALS3_B

ALS1_C

 

t

ALS3_C

 

ALS1_D

ALS3_D

t

ALS1_E

 

a

ALS3_E

 

|

170 180

|

|

|

|

190

|

|

200

|

|

210

|

|

220

|

|

230

|

|

240

|

ALS1_A ctccatcaccaagcacaactaccttgtcctcgacgtcgatgacattcccaggataataaaggaggcatttttcatcgcca

ALS3_A

t

ALS1_B

ALS3_B

t

ALS1_C

ALS3_C

t

ALS1_D

ALS3_D

t

ALS1_E

ALS3_E

t

|

250 260

|

|

|

|

270

|

|

280

|

|

290

|

|

300

|

|

310

|

|

320

|

ALS1_A ccagcggccgtcccggtccagtgctcgtggacatcccgaaagacatccaacagcagctcgcggtgcccgtctggaatcca

ALS3_A

t

t

t

a

g

a

a

g

ALS1_B

ALS3_B

t

t

t

a

g

a

a

g

ALS1_C

g

ALS3_C

t

t

t

a

g

a

a

g

ALS1_D

ALS3_D

t

t

t

a

g

a

a

g

ALS1_E

g

ALS3_E

t

t

t

a

g

a

a

g

 

330

340

350

360

370

380

 

|

|

|

|

|

|

|

|

|

|

|

|

ALS1_A ccagttcgtttgcctggttatgtctcccgcctccccaagccgcctgccctccatctgcttca

ALS3_A

c

ALS1_B

ALS3_B

c

ALS1_C

ALS3_C

c

ALS1_D

ALS3_D

c

ALS1_E

ALS3 _ E

c

Fig. 3. Alignment of partial DNA sequences from Samples A–E. Dots indicate the nucleic acids are the same as ALS1_A. The numbers on the top line showed the size o f fragments, and the size of tag sequence labeled in primers (40 bp) should be added on when collating this figure with Fig. 2 .

G.-X. Wang et al. / Pesticide Biochemistry and Physiology 92 (2008) 24–29

29

Self-EcoTILLING using the two-loci-specific primers that pre- cisely match two genes of multigene family has detected the pres- ence of mutations ( Fig. 2 ) without reference DNA. The nucleotide change in each of the two loci was determined by sequencing the amplified target fragments. The changes resulted in the disrup- tion of the Pro 197 codon in the conserved Domain A of the ALS gene. Although there are the other mismatches between ALS1 and ALS3 , which also cause shorter fragments (see Figs. 2 and 3 ), they can be ignored because they are not in the conserved regions: Domain A and D, the target sites. This method can be applied to any species as long as the organism has a multigene family. But more mis- matches might make the bands fainter under the incomplete nick recognition condition. Herbicide resistance in many cases has been attributed to single point mutations, which can occur at multiple sites in the ALS gene, resulting in a variable pattern of cross-resistance between the clas- ses of ALS-inhibitors. Base changes in at least four protein domains have been associated with in vivo resistance in field plants. The most common in biotypes selected by SUs is in the highly con- served Domain A site that codes for 13 amino acids, where any alteration of the codon for Pro confers resistance, primarily to the SUs and triazolopyrimidines [9] . The Pro in Domain A of ALS is con- served in SU-S plants, bacteria and yeast [28] . The deduced amino acid encoded by the Als1 and Als3 clones of the S biotypes of M. vag- inalis plants found the Pro residue in Domain A to be similarly con- served ( Table 1 ). The Pro residue in Domain A was substituted by Leu (CTT) in the SU-R biotype collected from Kasai City, Hyogo Pre- fecture, by Ser (TCT) in the SU-R biotype collected from Kyotango City, Kyoto Prefecture and by His (CAT) in the SU-R biotype col- lected from Daisen City, Akita Prefecture. A number of techniques for detecting base mutations have been developed. Assays based on gel mobility, like denaturing gradient gel electrophoresis (DGGE) and single strand conformation poly- morphism (SSCP), detect possible base changes but do not indicate the location or type of polymorphism in the DNA fragment [29] . Techniques that rely on denaturation kinetics and quantitative PCR only work for small fragments of DNA [30] . Sequencing of can- didate genes from multiple genotypes is an accurate alternative to these methods, but is relatively expensive and laborious when ap- plied to multiple loci in large numbers of individuals [6] . Since the first publication describing the technique of TILLING in 2001, this method of reverse genetics is now underway in diverse plant species. As the extension of TILLING, EcoTILLING allows natural alleles at a locus to be characterized across many germplasm acces- sions, enabling both SNP discovery and haplotyping at these loci [4] . PCR amplification of specific alleles (PASA) is another mutation detection method. This technique thus detects mutation without prior sequence information whereas the allele-specific PCR method (ASPCR) [31] is based on the use of available sequence information to design allele-specific primers that will anneal with the R biotype and not the wild type. We think EcoTILLING can be used in single-nucle- otide mutation detection of herbicide-R genes as a powerful, low- cost and high-throughput reverse genetic method that cannot be practically achieved by full sequencing [8] but we demonstrate with this example that Self-EcoTILLING is a faster, more reliable and eco- nomical method detecting single-nucleotide mutations in poly- ploidy plants with a multigene system.

Acknowledgments

R. Terauchi thanks B. Till, L. Comai and S. Henikoff, Washington University, Seattle, USA for training him with TILLING technique. The authors are grateful to Yukako Kuriyama of Water Plant Soci- ety, Japan for drawing the graph of the plant in Fig. 1 , and Hiroe Utsushi and Chikako Mitsuoka at Iwate Biotechnology Research Center for their excellent technical assistance and advice.

References

[1] T. Colbert, B.J. Till, R. Tompa, et al., High-throughput screening for induced point mutations, Plant Physiol. 126 (2001) 480–484. [2] C.M. McCallum, L. Comai, E.A. Greene, S. Henikoff, Targeting Induced Local Lesions IN Genomes (TILLING) for plant functional genomics, Plant Physiol. 123 (2000) 439–442. [3] C.M. McCallum, L. Comai, E.A. Greene, S. Henikoff, Targeted screening for induced mutations, Nat. Biotech. 18 (2000) 455–457. [4] L. Comai, K. Young, B.J. Till, et al., Efficient discovery of DNA polymorphisms in natural populations by Ecotilling, Plant J. 37 (2004) 778–786. [5] L. Comai, S. Henikoff, TILLING: practical single-nucleotide mutation discovery, Plant J. 45 (2006) 684–694. [6] E.J. Gilchrist, G.W. Haughn, C.C. Ying, et al., Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa , Mol. Ecol. 15 (2006) 1250–1261. [7] S. Rakshit, A. Rakshit, H. Matsumura, et al., Large-scale DNA polymorphism study of Oryza sativa and O. rufipogon reveals the origin and divergence of Asian rice, Theor. Appl. Genet. 114 (2007) 731–743. [8] G.-X. Wang, M.-K. Tan, S. Rakshit, et al., Discovery of single-nucleotide mutations in acetolactate synthase genes by Ecotilling, Pestic. Biochem. Physiol. 88 (2007) 143–148. [9] M.-K. Tan, R.W. Medd, Characterisation of the acetolactate synthase (ALS) gene of Raphanus raphanistrum L. and the molecular assay of mutations associated with herbicide resistance, Plant Sci. 163 (2002) 195–205. [10] I. Heap, International survey of herbicide-resistant weeds. 2007. Available from: <http://www.weedscience.com> . [11] P.J. Tranel, T.R. Wright, I. M. Heap, ALS mutations from herbicide-resistant weeds. September 29, 2006. Available from: <http://www.weedscience.org/ mutations/MutDisplay.aspx> . [12] M.J. Guttieri, C.V. Eberlein, D.C. Thill, Diverse mutations in the acetolactate synthase gene confer chlorsulfuron resistance in kochia ( Kochia scoparia ) biotypes, Weed Sci. 43 (1995) 175–178. [13] T.R. Wright, N.F. Bascomb, S.F. Sturner, D. Penner, Biochemical mechanism and molecular basis for ALS-inhibition herbicide resistance in sugarbeet ( Beta vulgaris ) somatic cell selections, Weed Sci. 46 (1998) 13–23. [14] P. Boutsalis, J. Karotam, S.B. Powles, Molecular basis of resistance to acetolactate synthase-inhibiting herbicides in Sisymbrium orientale and Brassica tournefortii , Pestic. Sci. 55 (1999) 507–516. [15] C.V. Eberlein, M.J. Guttieri, P.H. Berger, et al., Physiological consequences of mutation for ALS-inhibitor resistance, Weed Sci. 47 (1999) 383–392. [16] P.J. Tranel, T.R. Wright, Resistance of weeds to ALS-inhibiting herbicides: what have we learned? Weed Sci. 50 (2002) 700–712. [17] C.M. Whaley, H.P. Wilson, J.H. Westwood, A new mutation in plant ALS confers resistance to five classes of ALS-inhibiting herbicides, Weed Sci. 55 (2007) 83–90. [18] G.-X. Wang, H. Kohara, K. Itoh, Sulfonylurea resistance in a biotype of Monochoria korsakowii , an annual paddy weed in Japan, The 1997 Brighton Crop Prot. Conf.: Weeds 1 (1997) 311–318. [19] K. Itoh, G.-X. Wang, S. Ohba, Sulfonylurea resistance in Lindernia micrantha , an annual paddy weed in Japan, Weed Res. 39 (1999) 413–423. [20] G.-X. Wang, H. Watanabe, A. Uchino, K. Itoh, Response of a sulfonylurea (SU)- resistant biotype of Limnophila sessiliflora to selected SU and alternative herbicides, Pestic. Biochem. Physiol. 68 (2000) 59–66. [21] A. Uchino, H. Watanabe, Mutations in the acetolactate synthase genes of sulfonylurea-resistant biotypes of Lindernia spp., Weed Biol. Manag. 2 (2002)

104–109.

[22] G.-X. Wang, Y. Lin, W. Li, M. Ito, K. Itoh, A mutation confers Monochoria vaginalis resistance to sulfonylureas that target acetolactate synthase, Pestic. Biochem. Physiol. 80 (2004) 43–46. [23] T. Ohsako, T. Tominaga, Nucleotide substitutions in the acetolactate synthase genes of sulfonylurea-resistant biotypes of Monochoria vaginalis (Pontederiaceae), Genes Genet. Syst. 82 (2007) 207–215. [24] C.D.K. Cook, A revision of the genus Monochoria , in: K. Tan, R.R. Mill, T.S. Elias (Eds.), Plant Taxonomy, Phytogeography and Related Subjects, Edinburgh University Press, Edinburgh, 1989, pp. 149–184. [25] G.-X. Wang, T. Kusanagi, Cytotaxonomic analyses of the genus Monochoria in Asia, Acta Phytotax. Geobot. 47 (1996) 105–111. [26] N. Escaravage, S. Questiau, A. Pornon, B. Doche, P. Taberlet, Clonal diversity in a Rhododendron ferrugineum L. (Ericaceae) population inferred from AFLP markers, Mol. Ecol. 7 (1998) 975–982. [27] A. Uchino, S. Ogata, H. Kohara, S. Yoshida, T. Yoshioka, H. Watanabe, Molecular basis of diverse responses to acetolactate synthase (ALS)-inhibiting herbicides in sulfonylurea-resistant biotypes of Schoenoplectus juncoides , Weed Biol. Manag. 7 (2007) 89–96. [28] L.L. Saari, J.C. Cotterman, D.C. Thill, Resistance to acetolactate synthase inhibiting herbicides, in: S.B. Powles, J.A.M. Holtum (Eds.), Herbicide Resistance in Plants: Biology and Biochemistry, Lewis Publishers, Boca Raton, 1994, pp. 83–139. [29] L. DeFrancesco, J.M. Perkel, In search of genomic variation: a wealth of technologies exists to find elusive genetic polymorphisms, Scientist 15 (2001) 24. [30] C.N. Gundry, J.G. Vandersteen, G.H. Reed, et al., Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes, Clin. Chem. 49 (2003) 396–406. [31] C.L. Corbett, F.J. Tardif, Detection of resistance to acetolactate synthase inhibitors in weeds with emphasis on DNA-based techniques: a review, Pest Manag. Sci. 62 (2006) 584–597.