DPhil Transfer Report

Allele-specific silencing of proteins of the neuromuscular junction

Angie Biba October 2007 Supervisor: Prof. David Beeson

Contents

Page Abbreviations Introduction Aims Results 1 Results 2 Results 3 Discussion Future Experiments Appendix References 3 4 10 11 24 34 47 51 57 61

Abbreviations

ACh AChR AD CMS miRNA pri-miRNA qRT-PCR RISC RNAi RT-PCR SCCMS shRNA siRNA

Acetylcholine Acetylcholine receptor Autosomal dominant Congenital myasthenic syndrome Micro RNA Primary micro RNA Quantitative real-time PCR RNA induced silencing complex RNA interference Reverse transcription PCR Slow channel congenital myasthenic syndrome Short hairpin RNA Small interfering RNA

Introduction

RNA interference (RNAi) is a mechanism of gene regulation mediated by RNA. In nature, RNAi is initiated with the transcription of relative small noncoding DNA sequences in the nucleus named primary microRNAs (primiRNAs) (Lee et al. 2002). These are then cleaved in the nucleus by the nuclear RNase III Drosha to produce ~70 nt long pre-miRNAs (Lee et al. 2003), the secondary structure of which is characterised by bulges and hairpin forms. Pre-miRNA is exported from the nucleus to the cytoplasm by Exportin 5 (Yi et al. 2003; Bohnsack et al. 2004). Once in the cytoplasm pre-miRNA is cleaved by the RNase III Dicer to produce 21-22 nt long double stranded miRNAs (Bernstein et al. 2001; Provost et al. 2002). The antisense strand of miRNAs is then used as a guide by the cytoplasmic protein RNA-induced silencing complex (RISC) to identify cognate mRNA (Hammond et al. 2000; Ameres et al. 2007). Partial complementarity between miRNA and target mRNA leads to translational suppression while absolute complementarity results in degradation of the target mRNA by RISC (Figure 1).

It is widely hypothesized that RNAi has evolved as an intracellular defence mechanism against infections and transposons (Fire 2005). In this instance, it is the presence of long double stranded RNA (dsRNA) during viral replication that activates RNAi machinery. Although post-transcriptional gene silencing (PTGS) has previously been described in plants (Ratcliff et al. 1997), RNAi was first observed in invertebrate animals in C.elegans (Fire et al.,1998). In mammalian cells, however, the introduction of long dsRNA

triggers interferon response leading to non-specific mRNA degradation and cell death (Stark et al. 1998). Interferon response in mammalian cells was evaded when chemically synthesized 21 nt short interfering RNA duplexes (siRNAs) were used, without compromising the specificity and the efficiency of endogenous and heterologous gene silencing (Elbashir et al. 2001). The effects of siRNas may be short-lived due to their fast degradation in the cytoplasm. Plasmid or viral vectors expressing short hairpin RNAs (shRNAs) often under polymerase III (Pol III) promoters, that are then processed by Dicer, may provide longer term gene silencing (Paddison et al. 2002) (Figure 1).

Figure 1

Figure 1 Graphic representation of the miRNA pathway of gene regulation. At each stage of RNAi experimental molecules can be introduced and exploit the RNAi The specificity and the efficiency of RNAi have enabled it to be used as machinery. 6

a new tool for studying gene function, especially for genes where knock-outs produce a lethal phenotype. RNAi also holds a promise as a potential therapy for human disease. One possible application could be in the treatment of dominant diseases. RNAi technology can potentially be employed to silence specifically the pathogenic allele at post-trancriptional level while maintaining expression from the normal allele. Dominantly inherited diseases such as Huntingtons disease, familial Alzheimers disease and frontotemporal dementia caused by tau mutations could potentially be treated with allelespecific RNAi (Miller et al. 2004). Given that use of RNAi in vivo still faces a series of limitations including delivery, off target effects and safety, targeting the CNS is a challenging goal. By contrast, diseases of the neuromuscular junction, such as congenital myasthenic syndromes, provide a more readily accessible model for study. Slow channel congenital myasthenic syndrome (SCCMS) is a primarily autosomal, dominantly inherited disorder of the neuromuscular transmission caused by mutations in the acetylcholine receptor (AChR) (Croxen et al. 2002). AChR is a pentameric ligand gated cation channel located in the post-synaptic muscle cell membrane (Figure 2a). It consists of four homologous subunits at a ratio of 2 :1 :1 :1 2 :1 :1 :1 for foetal AChR (Figure for adult AChR and subunit has 4

2b).Each

transmembrane domains; mutations in each of these subunits can cause prolonged opening of the channel leading to focal endplate myopathy, prolonged decay of the miniature endplate potentials/currents and clinical fatiguable muscle weakness (Sine et al. 1995; Engel et al. 1996; Croxen et al. 1997; Shen et al. 2006) (Figure 3). Chemically synthesized siRNAs and in

vitro synthesized shRNAs using the T7 promoter have been successfully used to silence a point mutation in the -subunit in transiently transfected HEK 293T cells in a sequence specific manner, establishing the proof of principle for use of RNAi in the disorder (Abdelgany et al. 2003; Shen et al. 2006)

Figure 2

A)

B)

Figure 3

Figure 2 a) Simplified representation of the neuromuscular junction. ACh is released in the synapse cleft by the presynaptic nerve terminal. ACh binding to AChR opens the ion channel leading to muscle contraction. ACh remaining in the synapse is inactivated by acetylcholinesterase (AChE). b) Foetal and adult forms of ACh receptor. -bungarotoxin binds to the interface between the - and - subunits and - and - (adults) or subunits (foetal). Figure 3 Mutations causing slow-channel congenital myasthenic syndrome have been found in all the AChR subunits. Many of them are located in the M2 transmembrane domain that lines the channel lumen, but mutations in other domains have also been 8 described.

Aims

1. Replicate previous findings of allele-specific silencing of a pathogenic mutation of AChR using a tissue culture model and investigate the ability of modified siRNA with increased stability to silence the same mutation. 2. Characterise an animal model of SCCMS using weight and strength measurements. 3. Investigate the ability of RNAi to silence in an allele-specific way a previously not targeted pathogenic mutation in a tissue culture model in vitro.

Results 1

10

Comparison of down regulation of AChR expression by siRNA and stabilised siRNA.

At least 22 different mutations have been identified that can cause the slow channel myasthenic syndrome. Previously, in our laboratory RNAi was used to demonstrate allele-specific gene silencing of the mutation S226F in transiently transfected HEK 293T cells (Abdelgany et al. 2003). In the light of the objective of testing siRNA technology in an in vivo animal model, I first wanted to establish that allele specificity would be retained by siRNA species that had been modified to increase in vivo stability. The S226F slow channel missense mutation is the result of a C to T transition at nucleotide 677 in the -subunit of AChR, 677C>T. siRNA 19mers were designed that perfectly matched the mutant sequence (si226) but had a single nucleotide mismatch with the wild-type sequence (Figure 4). Modified siRNA (modified si226) is composed of a sense strand containing 2fluoro substitutions on all pyrimidine positions, deoxyribose in all purine positions, with 5 and 3 inverted abasic end caps. The antisense strand contains 2-fluoro substitutions in all pyrimidine positions, all purines are 2-Omethyl substituted, and the 3 terminal linkage is a single phosphorothioate linkage. The above modifications dramatically increased the stability of siRNA in human serum (Morrissey et al. 2005). Both unmodified and modified siRNA were provided by SIRNA (Merck & co, NJ, USA). Positive control siRNA (siGFP), that targets green fluorescence protein (GFP), and negative control siRNA (siNeg), that has no significant sequence similarity to mouse, rat, or human gene sequences, were bought from Ambion (Warrington, UK).

11

Figure 4

Figure 4 19nt long double stranded siRNA against the -subunit were designed to perfectly match the mutated S226F sequence while having a mismatch with the WT at position 10. Mammalian HEK 293T cells were transiently transfected with 3 ug/well plasmid DNA expressing either the mutant S226F or WT subunit tagged with EGFP (WT EGFP, S226FEGFP) and the -, -, and - subunits of AChR at a ratio 2 :1 :1 :1 using PEI (Sigma). EGFP tagged -subunit provided visualization of transfection efficiency. Additionally, EGFP was used as target for siGFP (Figure 5). si226, Mod si226, siGFP or siNeg were cotransfected with the AChR subunits at a 100 nM concentration using siPORT (Ambion). Figure 5

Figure 5 Graphic representation of the -subunit of the AChR transfected into HEK 293T Visualization of EGFP expressing cells trans-membrane domain. EGFP cells. The S226F mutation is located in the M1 48 h post transfection provided was ligated into the intracellular -subunit expression. si226 reduced the expression of an initial estimation of loop between the M3 and M4 trans-membrane domains.

12

the mutant allele while rendering the wild-type allele unaffected. Modified si226 was less efficient in down regulating the expression of the -subunit. siRNA against GFP most successfully decreased the expression of its target, whereas negative control siRNA did not have an effect on AChR expression (Figure 6). Cell surface
125

I- -bungarotoxin (125I- -BuTx) binding measurements

125

were used to estimate the cell surface AChR expression.

I- -BuTx binds

specifically and with high affinity to AChR providing a highly sensitive assay that allows cell surface AChR expression to be quantified. Total
125

I- -BuTx

binding to the surface of HEK 293T cells was measured 48 h posttransfection, with results normalized for
125

I- -BuTx binding to S226FEGFP

AChR or WT EGFP AChR respectively. si226 down regulated the expression of S226FEGFP AChR by approximately 60%, whereas it did not affect the expression of the wild type receptor. In contrast modified si226 failed to decrease the expression of both mutant and wild type AChR. The positive and negative controls behaved as expected in both cases (Figure 7). Next, the effect of siRNA concentration on the expression of AChR was examined. HEK293T cells were transiently transfected with either

S226FEGFP mutant or WT EGFP AChR subunits and 12.5 nM, 25 nM, 50 nM or 100 nM of siRNA respectively using PEI and siPORT as before. si221 had a concentration effect on reducing the expression of S226FEGFP AChR, although it reaches a plateau effect at 25-50 nM. By contrast, it did not reduce the expression of wild type AChR (Figure 8). Modified si226 did not affect the expression of WT EGFP in any concentration, whereas it reduced 13

the expression of the mutant allele by up to approximately 25% at 25 nM. However, this concentration effect was not linear and higher siRNA amounts did not decrease mutant AChR expression (Figure 9). siGFP reduced the expression of both S226FEGFP and WT EGFP AChR in a concentration dependant way (Figure 10). siNeg did not affect the expression of either S226FEGFP and WT EGFP AChR in a systematic way (Figure 11).

14

Figure 6 Example fields of HEK 293T cells expressing EGFP-tagged AChR. HEK 293T cells were transfected with 3 g of either mutant S226FEGFP or WT EGFP AChR subunits at a 2 :1 :1 :1 ratio and 100nM of the appropriate siRNA. Plasmid DNA was transfected using PEI and siRNAs were transfected using siPORT. 48 h post transfection cells were visualized with fluorescent microscopy.

15

Figure 7

150

100

50

No siRNA si226Mod si226 siGFP siNeg

WTEGFP AChR S226FEGFP AChR

Figure 7 Surface Total

15 2

15 2

I- -BuTx binding of AChR containing S226F mutant and WT

subunits in HEK 293 cells co-transfected with 100 nM siRNA using PEI and siPORT. I- -BuTx binding to surface of HEK 293 cells was measured 48 h post15 2

transfection. Results are expressed as a percentage of experiments in triplicate.

I- -BuTx binding to

S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3

16

Figure 8

150

100

50

0nM 12.5nM 25nM 50nM 100nM

WT EGFP AChR S226FEGFP AChR

Figure 8 Surface

15 2

I- -BuTx binding of AChR containing S226F mutant and

WT subunits in HEK 293 cells co-transfected with increasing amounts of si226. Results are expressed as a percentage of 125 I- -BuTx binding to S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in triplicate.

17

Figure 9

150

100

50

0nM 12.5nM 25nM 50nM 100nM

WTEGFP AChR S226FEGFP AChR

Figure 9 Surface

15 2

I- -BuTx binding of AChR containing S226F mutant and

15 2

WT subunits in HEK 293 cells co-transfected with increasing amounts of modified si226. Results are expressed as a percentage of in triplicate. I- -BuTx binding to S226F

AChR or WT AChR, respectively. Bars represent mean ( SD) of 3 experiments

18

Figure 10

150

100

50

0nM 12.5nM 25nM 50nM 100nM

WTEGFP AChR S226FEGFP AChR

Figure 10 Surface

15 2

I- -BuTx binding of AChR containing S226F mutant and

WT subunits in HEK 293 cells co-transfected with increasing amounts of siGFP. Results are expressed as a percentage of 125 I- -BuTx binding to S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in triplicate.

19

Figure 11

150

100

50

0nM 12.5nM 25nM 50nM 100nM

WTEGFP AChR S226FEGFP AChR

Figure 11 Surface

15 2

I-BuTx binding of AChR containing S226F mutant and WT

15 2

subunits in HEK 293 cells co-transfected with increasing amounts of siNeg. Results are expressed as a percentage of I--BuTx binding to S226F AChR or WT

AChR, respectively. Bars represent mean ( SD) of 3 experiments in triplicate.

20

In conclusion with this first set of experiments the modified siRNA obtained from SIRNA does not appear to reduce the expression of AChR. SIRNA, the supplier of the siRNA, has been using Lipofectamine 2000 (Invitrogen) as a transfecting reagent, whereas PEI (Sigma) and siPORT (Ambion) were used in this instance. To test if the transfection reagent and method were affecting in any way the efficiency of siRNA in silencing AChR expression, a second set of experiments was conducted. Both plasmid DNA expressing AChR and siRNAs were transiently transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturers instructions. The ratio of AChR subunits and the amounts of siRNA were the same as in PEI and siPORT transfections (Figure 12). When transfected with Lipofectamine 2000 si226 equally down regulate both the WT EGFP AChR and the S226FEGFP AChR, thus abating its ability to distinguish between wild type and mutant -subunit. In addition, modified si226 also exhibited some efficiency in reducing the expression of both the WT EGFP AChR and the S226FEGFP AChR, though less successfully (Figure 13). The differences of the silencing efficiency of both si221 and modified si221 when transfected with different transfection agents, namely siPORT (Ambion) and Lipofectamine 2000 (Invotrogen), are hard to interpret. Cotranfection of plasmid DNA and si226 using PEI (Sigma) and siPORT respectively resulted in allele specific silencing of the expression of the mutant S226FEGFP AChR. When si226 and plasmid DNA were co-transfected using Lipofectamine 2000 the allele specific effect was lost but the silencing efficiency remained at similar levels. These discrepancies could be due to the efficiency of the transfection agent to deliver siRNA into the cells. If Lipofectamine is more efficient in delivering siRNA, flooding of the RNAi system could decrease the specificity of the system for its target. Modified siRNA, also, exhibited some silencing efficiency when transfected with Lipofectamine but not when transfected with siPORT. Chemical modifications of si221, that increase stability of siRNAs in vivo, could interfere with the efficiency of PEI but not Lipofectamine to deliver them into cells. The inherent difficulty of siRNA delivery in these experiments is

21

additionally complicated by the need for co-transfection of plasmid DNA and siRNA, two nucleic acid molecules with different properties. In both cases fluorescein (FITC) conjugated si226 and modified si226 would provide a useful tool for visualization and comparison of siRNA delivery efficiency.

22

Figure 12 Example fields of HEK 293T cells expressing EGFP-tagged AChR. HEK 293T cells were transfected with 3 g of either mutant S226FEGFP or WT EGFP AChR subunits at a 2 :1 :1 :1 ratio and 100nM of the appropriate siRNA. Both plasmid DNA and siRNA were transfected using Lipofectamine 2000. 48 h post transfection cells were visualized with fluorescent microscopy.

23

Figure 13

150

100

50

Figure 13 0 Surface

15 2

WT EGFP subunits in HEK 293 cells co-transfected with 100 nM siRNA using Lipofectamine WTEGFP AChR -BuTx binding to the surface of HEK 293 cells was 2000. Total 125 I- S226FEGFP AChR measured 48 h post-transfection. Results are expressed as a percentage of
15 2

No siRNAUnM si226 Mod si226 siPos

I-BuTx binding of AChR containing S226FEGFP mutant and

siNeg

I- -

BuTx binding to S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in triplicate. Figure 13 Surface 2000. Total
15 2 15 2

I-BuTx binding of AChR containing S226F mutant and WT

subunits in HEK 293 cells co-transfected with 100 nM siRNA using Lipofectamine I- -BuTx binding to surface of HEK 293 cells was measured 48 h
15 2

post-transfection. Results are expressed as a percentage of experiments in triplicate.

I- -BuTx binding to

S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3

24

Results 2 An animal model of slow channel congenital myasthenic syndrome (SCCMS).

RNAi is widely used as a tool for studying gene function. In addition, RNAi holds a promise as a potential therapy for human disease, especially dominantly inherited diseases. Towards such a prospect, the use of diseases of the neuromuscular junction, such as congenital myasthenic syndromes as a disease model is highly appealing, because it provides a more readily accessible model when compared to dominant diseases of the central nervous system. In consequence, a well established animal model of SCCMS, a dominantly inherited congenital myasthenia, will provide an appropriate in vivo animal model for RNAi. In this second chapter of results, measurements of weight and strength were used to characterise a mice model expressing a human pathogenic mutation causing SCCMS, previously generated in the laboratory. The weight gain is a general marker of growth and well-being of mice, while strength is used as a marker of fatiguable muscle weakness, a clinical symptom of SCCMS. Preceding the characterization of SCCMS mice a brief description of their generation is given.

Generation of L221F mice Mice expressing the EGFP-tagged human -subunit of the AChR harbouring the L221F were generated by Dr J. Cossins. Briefly, the purified expression cassette (Figure 14) was microinjected into the pronucleus of the 25

F2 hybrid oocytes from C57BL/6J x CBA/CA parents to generate mice expressing one (heterozygous) copy of the human -subunit of the AChR harbouring the L221F mutation along with two copies of the mouse -subunit (h L221F+/-/m
+/+

). These mice were crossed with mice heterozygous for the

+/-

mouse AChR -subunit (m

) kindly provided by Prof. J. Sanes (Harvard

+/-

Medical School). Progeny with the genotype h L221F+/-

were crossed to

generate litters containing mice that were homozygous for the h L221F transgene and heterozygous for the mouse AChR -subunit knock-out mutation (h L221F+/+/m
+/-

). These were then mated either with siblings of

+/-

the same genotype or with m h h

+/+

mice, resulting in 6 distinct genotypes: i)

+/+

/m

+/+

, ii) h

+/+

/m

+/-

, iii) h

/m

-/-

, iv) h

+/-

/m

+/+

, v) h

+/-

/m

+/-

, vi)

+/-

/m

-/-

Figure 14
Expression cassette
NheI SfiI SfiI

BGH pA

AChR human -subunit (genomic sequence) promoter

human cDNA

EGFP
Figure 14. Graphic representation of the expression cassette used to create the mice expressing human -subunit harbouring the L221F mutation that causes congenital slow-channel myasthenic syndrome. The human genomic DNA for -subunit contained the first ten exons and nine introns. EGFP was inserted between the M3 and M4 membrane spanning domains of the subunit, resulting in expression of AChREGFP. Human cDNA encoding the last 26 two exons of the -subunit were ligated downstream of EGFP. Figure kindly provided by Dr Judy Cossins.

Functional expression of the h L221FEGFP-subunit in mice was determined by tetramethylrhodamine -BuTx staining by Dr Judy Cossins. Tetramethylrhodamine -BuTx binds to the interface between the - and - subunits and - and - subunits and has been used as a highly sensitive way to visualize AChR at the muscle endplate. Muscles from L221F mice were incubated with tetramethylrhodamine -BuTx. Excess

tetramethylrhodamine -BuTx was removed and muscle mounted on slides for fluorescent microscopy. The muscles used were fast-twitch extensor digitorum longus (EDL), slow-twitch soleus (SOL) were from a he+/-/me-/- 20 week-old male and diaphragm muscle from a he+/+/me+/- 10 week-old female. Red stained endplates were visualized with fluorescent microscopy to identify cell surface -expressed AChRs. EGFP was localised to the endplates confirming expression of h L221F-EGFP. Merge of the images shows successful incorporation of h L221F-EGFP expressing AChRs in functional AChRs in the endplates of L221F mice (Figure 15).

27

Figure 15

EDL

SOL

Diaphragm

-BuTx

L221F-EGFP

merge

Figure 15 Fluorescent microscope pictures of L221F mice endplates. Red= AChRs stained with tetramethylrhodamine -bungarotoxin ( -BuTx) to identify cell surface -expressed AChRs. Green= endplates expressing h L221F-EGFP (green). Yellow= merge of red and green shows the incorporation of EGFP expressing AChR in functional AChRs. Experiments were done by Dr Judy Cossins.

28

Phenotypic assessment of the transgenic mice focused on weight and strength performance according to the inverted screen test. Data for the male and female, and homozygous and heterozygous mice was analysed separately in this preliminary analysis.

Weight

In order to assess the rate of growth and general well-being of L221F mice, mice were weighted every two weeks up to six months of age. Mice with no mouse AChR -subunit gained weight more slowly than littermates with one or two copies of mouse subunit. Although they put on weight they did

not reach the weight of mice with one or two alleles of mouse -subunit. This was observed for mice with one and with two copies of the transgene (Figures 16, 17). Mice homozygous for h put on more weight than heterozygous

mice. Female mice were lighter than male mice, as expected, but put on weight in a similar way.

29

Figure 16

h L221F+/+
A)

45 40 35 30 25 20 15

Male

8 10 12 14 16 18 20 22 24 26 Age in weeks

h221+/+/m+/+ (n=3)

h221+/+ /m+/-(n=7)

h221+/+ /m-/-(n=7)

B)

45 40 35 30 25 20 15

Female

8 10 12 14 16 18 20 22 24 26 Age in weeks
h221+/+ /m+/- (n=7) h221+/+ /m-/- (n=7)

h221+/+/m+/+ (n=3)

Figure 16 Mice were weighed every two weeks up to six months of age. Points represent average weight at each time point ( STD). a) Graph of growth of male 30 mice homozygous for L221F transgene. b) Graph of growth of female mice

Figure 17 A)

45 40 35 30 25 20 15

h L221F+/Male

8 10 12 14 16 18 20 22 24 26 Age in weeks

h221+/-/m+/+ (n=6)

h221+/-/m+/-(n=7)

h221 +/-/m-/-(n=8)

B)

45 40 35 30 25 20 15

Female

8 10 12 14 16 18 20 22 24 26 Age in weeks
h221+/-/m+/-(n=7) h221+/-/m-/-(n=6)

h221+/-/m+/+ (n=5)

Figure 17 Mice were weighed every two weeks up to 6 months of age. Points represent average weight at each time point ( STD). a) Graph of growth of male 31 mice heterozygous for L221F transgene. b) Graph of growth of female mice heterozygous for L221F transgene.

Strength Fatigable muscle weakness, a clinical symptom of SCCMS, was evaluated in mice using an inverted screen test (Contet, Rawlins and Deacon 2001). The inverted screen was a 50 cm2 screen of wire mesh consisting of 12 mm2 squares of 1 mm diameter wire surrounded by a 4 cm deep wooden frame. The mouse was placed in the centre of the wire mesh screen and the screen was rotated to the inverted position over 2 s, with the mouse's head declining first. The stopwatch was started and the time at which the mouse fell was recorded, to a maximum of 5 min. h
+/+

/m

-/-

mice were not able to hold onto the inverted screen for 5
+/+

minutes at any age tested. In contrast, h

/m

+/+

and h

+/+

/m

+/-

mice

remained on the inverted screen for the full 5 minutes. However, one male h
+/+

/m

+/+

mouse failed the inverted screen test at 16 weeks of age and

continued deteriorating thereafter (Figure 18a). In general, similar results were obtained for both male and female mice (Figure 18b). Both male and female h
+/-

/m

+/+

mice held on to the inverted screen

+/-

for the full 5 minutes. The strength of male h

/m

+/-

mice varied highly and

started deteriorating progressively from 14 weeks of age onwards, unlike female h

+/-

/m

+/-

mice that always reached the target of 5 minutes,

suggesting a gender effect. When looked closer, however, the male data revealed that 3 of the 7 mice deteriorated; therefore the gender difference was not further pursued. These three male mice are currently been used for

32

breeding in order to test if their offspring will also be characterised by fatiguable muscle weakness. Both male and female h
+/-

/m

-/-

mice did not

reach the 5 minutes limit at any given age (Figure 19a, b). Figure 18

h L221F+/+
A)

Male

300 250 200 150 100 50 0

8 10 12 14 16 18 20 22 24 26 Age in weeks

h221+/+/m+/+ (n=3)

h221+/+/m+/- (n=7)

h221+/+ /m-/-(n=7)

B)

Female

300 250 200 150 100 50 0

10 12 14 16 18 20 22 24 26 Age in weeks
h221+/+ /m+/-(n=7) h221+/+ /m-/-(n=7)

h221+/+/m+/+(n=3)

Figure 18 Mice were tested on the inverted screen every two weeks up to 6 months of age. The time they hung on the inverted screen was recorded up to 5 33 minutes a) Graph of male homozygous mice strength. b) Graph of female homozygous mice strength.

Figure 19

h L221F +/A)

Male

300 250 200 150 100 50 0

10 12 14 16 18 20 22 24 26 Age in weeks
h221+/-/m+/-(n=7) h221+/-/m-/-(n=8)

h221 +/-/m+/+ (n=6)

B)

Female

300 250 200 150 100 50 0

10 12 14 16 18 20 22 24 26 Age in weeks
h221+/-/m+/-(n=7) h221+/-/m-/-(n=4)

h221 +/-/m+/+(n=3)

Figure 19 Mice were tested on the inverted screen every two weeks up to 6 months of age. The time they hung on the inverted screen was recorded up to 34 5 minutes a) Graph of male heterozygous mice strength. b) Graph of female heterozygous mice strength.

Results 3 Can L221F-EGFP AChR expression be down regulated by siRNA?

RNAi has been used to successfully down regulate the S226F mutant allele while preserving the expression of the wild type (WT ) allele in transiently transfected HEK 293T cells, providing the proof of principal for the use of RNAi in allele-specific gene silencing (Abdelgany et al. 2003). The aim of this set of experiments is to apply RNAi for allele-specific silencing of a different pathogenic mutation of SCCMS, namely L221F, which is present in our transgenic disease model. L221F is a pathogenic mutation resulting from a C to T transition at nucleotide position 661 of the -subunit of the AChR, 661C>F. Pathogenicity of the mutation was confirmed by electrophysiology studies, by Dr R. Webster. HEK 293 cells were transiently transfected with either wild type AChR cDNA or with wild type and L221F

AChR cDNA. EGFP was also transfected as a marker of transfection. 48 h after transfection green cells were studied using cell-attached patch technique. Patch pipette contained 100 nM ACh to produce AChR activations in bursts. Downward deflections are brief openings of individual channels. Bursts of openings were separated by a critical closed duration, which defined them as closures within a burst. Bursts from L221F AChR (lower

35

trace) were longer than those from wild type transfected cells (Figure 20).

Figure 20

Normal

Slow channel ( L221F-EGFP)

Figure 20 Single-channel activity of HEK 293 cells transfected with either wild-type or L221F-EGFP AChR. Channel openings, represented by downward deflections, demonstrate that L221F-EGFP AChR have longer opening times compared to wild type AChR. Electrophysiology experiments were done by Dr Richard Webster.

Transient expression of AChR

21mer siRNA against the -subunit of AChR were designed to perfectly match the mutant sequence L221F (si221), therefore harbouring a mismatch with the WT protein (Figure 21). Modified siRNA (Mod si221) is composed of a sense strand containing 2-fluoro substitutions on all pyrimidine positions, deoxyribose in all purine positions, with 5 and 3 inverted abasic end caps. The antisense strand contains 2-fluoro substitutions in all pyrimidine positions, all purines are 2-O-methyl substituted, and the 3 terminal linkage is a single phosphorothioate linkage. The above modifications dramatically

36

increased the stability of siRNA in human serum (Morrissey et al. 2005). Both unmodified and modified siRNA were provided by SIRNA (Merck & co, NJ, USA). Positive control siRNA (siGFP), that targets GFP, and negative control siRNA (siNeg), that has no significant sequence similarity to mouse, rat, or human gene sequences, were bought from Ambion (Warrington, UK).

Figure 22

Figure 21 21nt long double stranded siRNA against the -subunit were design to perfectly match the mutated L221F sequence while having a mismatch with the WT at position 11. HEK 293T cells were transfected with 3 g of AChR and 100 ng of dsRed expressing vector per well of a 6-well plate. DsRed expressing vector was used as efficiency of transfection control. Plasmid DNA expressing WT , WT and WT subunits was transfected along with either WT or L221F subunit at a ratio 2 :1 :1 :1 . Plasmid DNA expressing the epsilon subunit was tagged with EGFP between the M3 and the M4 transmembrane spanning domains (Figure 22) in order to visualize the AChR in transfected cells. Expression of similar levels of dsRed in each condition demonstrated that plasmid DNA transfection was equally successful (Figure 23). Expression of EGFP was used as an initial estimation of AChR expression. Both WT EGFP and L221FEGFP expressing AChR were efficiently transfected. siRNA against the L221F mutation were co-transfected with the plasmid DNA at 50 nM concentration. si221 and Mod si221 were used. si221 reduced

37

the expression of both the wild type and the mutant allele. Modified si221 was less efficient in down regulating the expression of the -subunit. siRNA against GFP most successfully decreased the expression of its target, whereas negative control siRNA did not have an effect on AChR expression (Figure 24).

Figure 22

Figure 22. AChR -subunit was tagged with EGFP expressed in the intracellular loop between the M3 and M4 trans-membrane domains. The L221F mutation is located at the M1 trans-membrane domain.

38

Figure 23 HEK 293T cells were transfected with 3 g of AChR subunits at a 2 :1 :1 :1 , 10ng of dsRed expressing plasmid and 50 nM of the appropriate siRNA. 48 h after transfection cells were visualized with fluorescent microscopy. dsRed expressing cells suggests successful transfection for each condition.

39

Figure 24 HEK 293T cells were transfected with 3 g of AChR subunits at a 2 :1 :1 :1 , 10 ng of dsRed expressing plasmid and 50nM of the appropriate siRNA. 48 h after transfection cells were visualized with fluorescent microscopy. Down regulation of EGFP expressing cells shows successful knock down of WT EGFP and L221FEGFP AChR.

40

Previously, quantitative analysis of the silencing of the S226F mutant subunit was based on surface binding
125

I-BuTx assays. Given that the -

subunit, unlike the -subunit, is not essential for surface expression of AChR in transiently transfected HEK cells, this assay would not provide an accurate measurement of -subunit silencing. Thus, fluorescence of whole protein cell extract and western blots were used for the evaluation of silencing at protein level and qRT-PCR for evaluation at mRNA level. Fluorescence of whole protein extract was measured as an initial quantitative estimation of -subunit down regulation by siRNA. si221 reduced the expression of the mutant subunit by approximately 50 percent, while reducing wild type expression by 30 percent. Modified si221 did not affect the expression of the either WT EGFP or L221FEGFP AChR. Positive and negative control siRNA affected the expression of both WT and 221 as expected (Figure 25).

Figure 25

150 100 50 0 No siRNA si221

WTEGFP AChR

Mod si221 siGFP

L221FEGFP AChR

siNeg

Figure 25 Graph of fluorescence of whole cell protein extract measured in a fluorescent plate reader. Results are expressed as a percentage of fluorescence of 221FEGFP AChR or WT EGFP AChR, respectively. Bars represent mean ( SD) of 7 experiments in 41 triplicate.

In order to estimate the subunit down-regulation by siRNA at protein level more accurately, western blots of whole cell protein were performed. Antibodies against both the epsilon AChR subunit and the fluorescent marker EGFP were used. anti-GFP (ab6556, Abcam, Cambridge, UK) antibody successfully identified the AChR -subunit EGFP fusion at the correct molecular weight of ~82kDa , although there was also high unspecific binding of the antibody. si221 reduced the density of the band for both WT and

L221F, while modified si221 appears to not have a major effect on protein band density. Positive control siRNA minimized the protein expression of EGFP-subunit and negative control siRNA did not affect the expression of EGFP subunit (Figure 26a). For quantification of protein bands both proteins ware normalized against the amount of -tubulin. Quantification of the band densities shows that si221 reduced that expression of 221EGFP by ~60% and the expression of WT EGFP by ~35%. Modified si221 does not appear to affect the expression of WT EGFP (though its effect varies highly from experiment to experiment as indicated by the SD bar) and reduces the expression of 221EGFP by ~25% (Figures 26b).

42

Figure 26
A)

GFP antibody
B)
WTEGFP AChR

150

221EGFP AChR

100

50

No siRNAUnM siRNA Mod siRNA siPos

siNeg

Figure 26 a) Western blots with antibody against GFP. GFP antibody recognised the EGFP fusion protein for both WT EGFP and 221EGFP. When HEK 293T cells are transfected with the AChR subunits, a band appears at ~81.5 kDa (arrow) (epsilon subunit 54.697 Da, GFP 26.886 Da). b) Graph of density quantification of western blot bands recognised by anti-GFP antibody. Results were normalized against the density of -tubulin bands. Bars represent the mean ( SD) of 3 experiments. 43

Anti-

antibody (goat polyclonal, Santa Cruz, CA, USA), with an

epitope within the last 50 amino acids of the C-terminus of AChR -subunit of human origin, also identified the AChR -subunit EGFP fusion at ~82kDa (Figure 27a). si221 noticeably reduced the density of the band for both WT and 221, while modified si221 had a weaker effect on protein band density. Positive control siRNA minimized the protein expression of EGFP-subunit and negative control siRNA did not affect the expression of EGFP subunit. Quantification of the band densities shows that unmodified si221 reduced that expression of both WT EGFP and 221EGFP by ~50 %. Modified si221 down regulated the expression of WT EGFP by ~20% (though its effect varies highly from experiment to experiment as indicated by the SD bar) and reduced the expression of 221EGFP by ~40% (Figure 27b).

44

Figure 27
A)

B)

anti- antibody
WTEGFP AChR 221EGFP AChR

150

100

50

No siRNAUnM siRNA Mod siRNA siPos

siNeg

Figure 27 a) Antibody against the -subunit recognised the -EGFP fusion protein for both WT EGFP and 221EGFP. When HEK 293T cells were transfected with the AChR subunits, a band appeared at ~81.5 kDa (arrow) (epsilon subunit 54.697 Da, GFP 26.886 Da). b) Graph of density quantification of western blot bands recognised by anti- antibody. Results were 45 normalized against the density of -tubulin bands. Bars represent the mean ( SD) of 3 experiments.

Quantitative estimations for the effect of siRNA on the expression of -subunit on mRNA level were provided from real-time quantitative PCR (RTqPCR). Both probes against EGFP (Figure 28) and the -subunit (Figure 29) were used to quantify the expression of -subunit EGFP fusion. GAPDH expression was the reference gene used to normalize the EGFP and subunit data.

Figure 28
Real Time PCR EGFP
120 100 80 60 40 20 WTeEGFP AChR e221EGFP AChR

Percentage of control RNA

0

no siRNA

si221 UnM

si221 Mod

siPos

siNeg

Figure 28 si221 reduced the expression of L221F by ~65%, but modified si221 did not affect the expression of L221F. In contrast, both si221 and modified si221 reduced expression of WT by ~40 %.

46

Figure 28
Real Time PCR Human Epsilon
140 120 100 80 60 40 WTeEGFP AChR e221EGFP AChR

Percentage of control RNA

0

20

no siRNA

si221 UnM

si221 Mod

siPos

siNeg

Figure 29 Unmodified si221 reduced the expression of 221 by ~65%, but modified si221 did not affect the expression of 221. In contrast, both unmodified and modified si221 reduced expression of WT by ~ 50% and ~60% respectively.

In general unmodified si221 appears to be more successful in reducing the expression of -subunit than modified si221, although it does not appear to strongly differentiate between WT and 221 alleles.

47

Discussion

The aim of this project is to use RNAi in an allele-specific way to silence dominantly inherited mutations of the AChR causing SCCMS. Previously, proof of principal for the use of RNAi has been provided by the allele-specific down regulation of the S226F mutant allele while preserving the expression of the wild type (WT) allele in transiently transfected HEK 293T cells (Abdelgany et al. 2003). In this project we first replicated the above result and further tested the ability of an siRNA, which has been modified in order to increase its stability to allele specifically silence S226F. Modified siRNA did not silence either WT or S226F expressing AChR when tranfected using PEI and siPORT. However, it down regulated the expression of both WT and S226F AChR, albeit moderately, when transfected using Lipofectamine 2000. Chemical modifications of the siRNA molecule, which enable it to resist degradation in vivo, appear to interfere with the transfection method and efficiency. These modifications highly increase the stability of siRNA, which is essential for their use in vivo. Further studies using different transfection agents will be essential to test their efficient transfection and silencing capacities. In vivo application of RNAi in dominantly inherited diseases requires a robust animal model. As discussed above, RNAi still faces a series of limitations related to effective delivery, off-target effects and specificity. Therefore dominantly inherited disorders of the neuromuscular junction 48

provide a more readily accessible model for allele-specific silencing when compared with CNS dominantly inherited disorders. The second result chapter of this project introduced a transgenic animal model of SCCMS, previously generated in our lab. In addition a set of experiments was performed to characterise the model at the level of general growth and wellbeing and at the level of strength. Mice expressing the human L221F transgene in a KO mouse -subunit grow more slowly and weigh noticeably less than littermates expressing both the human transgene and the WT subunit. However, mice survive and have normal life expectancy. The strength of L221F transgenic mice was also monitored. Fatiguable muscle weakness is a prominent clinical symptom of SCCMS. General mice strength, as measured by the inverted screen test, was employed as a marker of fatiguable muscle weakness. Mice expressing the human L221F transgene in a KO mouse -subunit were significantly weaker than littermates expressing both the human transgene and the WT subunit. Additionally, a group of h L221F+/-/m
+/-

also exhibited weakness at

around 14 weeks and continued deteriorating thereafter, possibly mirroring the dominantly inherited nature of the human disease. Our results suggest that our model is in general a useful model for in vivo application of allelespecific RNAi; human L221F is expressed and functionally integrated in mouse AChR at the neuromuscular junction and mice exhibit a major characteristic of the clinical picture of the disease while preserving their general health. The third part of this report focuses on in vitro silencing of the L221F mutation. si221 against L221F down regulated L221F AChR by ~50% but 49

also down regulated WT AChR by ~25%. Designing siRNAs with more than one mutation against the WT appears to improve the discriminative ability of siRNA and it will be used in the future to increase the specificity of si221. The results from the modified siRNA are again more difficult to interpret. It appears that the modified siRNA might act more slowly because it did not noticeably decrease the expression -subunit at protein level but appeared to decrease mRNA levels. However, no conclusions can be drawn from this set of experiments for the effectiveness of modified siRNA against L221F. Replication of qRT-PCR and transfections using PEI and siPORT are essential before any conclusions can be made. This project report is an account of three sets of experiments towards RNAi use for allele-specific silencing of mutant AChR subunits causing SCCMS. The future goal of this project will be to improve the effectiveness and specificity of allele-specific silencing of L221F mutation in vitro and next use optimized siRNA molecules in order to induce RNAi in vivo, using our animal model of SCCMS.

50

51

Future Plans S226F Repeat dose response for si226 and mod si226 to obtain definitive results on allele-specific silencing of S226F. In vitro transient transfection of HEK cells using PEI and siPORT will approximately require 2 weeks. Results will be assessed by surface binding of BuTx. The above experiments will further secure the finding that the S226F mutation can be silenced in an allele specific way and that modified siRNA does not produce silencing in vitro. L221F Transient co-transfection of HEK cells of plasmid DNA expressing WT EGFP or L221FEGFP AChR and siRNA against L221F. So far si221 does not provide allele specific silencing of L221FEGFP AChR. In order to increase both the specificity and silencing ability of si221 an siRNA with an extra mismatch between the wild-type and siRNA will be designed. The extra mismatches will be introduced either at the 3-prime end/ or the 5-prime end of the anti-sense strand of si221. The results will be assessed qualitatively using microscopy and quantitatively using western blots (assessment at protein level) and qRT-PCR (assessment at mRNA level). These experiments should approximately take a week and will be repeated three times (therefore 3 weeks total). The siRNA species that will have the best allele-specific silencing ability will be modified using the locked nucleic acid technology (LNA) in order to improve its stability. Transient co-transfection of HEK cells of plasmid DNA expressing WT EGFP or L221FEGFP AChR and LNA will demonstrate if the LNA modification interferes with the allele52
125

I- -

specific silencing. The results will be assessed qualitatively using microscopy and quantitatively using western blots (assessment at protein level) and qRT-PCR (assessment at mRNA level). These experiments should approximately take a week and will be repeated three times (therefore 3 weeks total). The above experiments will determine the most effective and allele specific siRNA sequence that will then be used in further in vitro and in vivo experiments. L221F transgenic mice In vitro:
-/-

1. Establish primary muscle cell culture from L221F+/+/m

mice.

Mouse muscle will be trypsinized and mechanically triturated. Muscle cells and fibroblasts are initially grown together. After 5-6 divisions muscle cells are separated using N-CAM antibody. This procedure is easy but the establishment of the primary cells culture depends primarily on the growth rate of the cells. However, 4 weeks is an estimation based on the general experience of lab members with primary muscle cell lines. Establishing a primary muscle cell line will allow me to work on a cell model that most accurately mirrors the in vivo condition of the L221F mouse. 2. The above cell model will be used to optimize the transfection method for delivering siRNA molecules and shRNA expressing vectors into primary muscle cells. A Cy3 conjugated siRNA and a dsRed expressing vector will be used to monitor the efficiency of transfection agents. These experiments should take approximately a week and will pinpoint the most effective method for transfecting primary muscle cells. 3. Transient transfection of L221F+/+/m
-/-

cells with siRNA against

GFP, and L221F. This experiment will show us if siGFP and si221 can effectively knock down the expression of L221FEGFP. The

53

results

will

be

assessed

qualitatively

using

microscopy

and

quantitatively using western blots (assessment at protein level) and qRT-PCR (assessment at mRNA level). These experiments should approximately take a week and will be repeated three times (therefore 3 weeks total). 4. Transient transfection of L221F+/+/m
-/-

cells with vectors expressing

shRNA against GFP and L221F. These experiments will show us if the vectors are as efficient as the siRNA in silencing the mutant L221FEGFP and the results will be assessed qualitatively using microscopy and quantitatively using western blots (for protein knock down) and qRT-PCR (for mRNA knock down). These experiments should take a week and will be repeated three times (therefore 3 weeks total). 5. Time course transient transfection of L221F+/+/m
-/-

cells with vectors

expressing shRNA against GFP and L221F. These experiments will show us if the vectors provide more long lasting silencing of the mutant L221FEGFP and the results will be assessed qualitatively using microscopy and quantitatively using western blots (for protein knock down) and qRT-PCR (for mRNA knock down). These experiments should require a week and will be repeated three times (therefore 3 weeks total). 6. Establish immortal muscle cell culture from L221F+/+/m -/-. Primary mouse muscle cells will be immortalized by infection with a temperature-sensitive mutant of SV40, which will allow the cells to grow undifferentiated at 33C and differentiate when grown at 40C. These cells are easier to maintain than primary cell lines, therefore once establish they will be preferably used. This kind of immortalization has not been done in our lab before therefore, estimating time required for this experiment is precarious. However, the time required should be similar to the time required for the establishment of a stably transfected cell line, that depends primarily on the growth rate of the cells. 7. Immortal L221F+/+/m -/- cells will be used to optimize the transfection method for delivering siRNA molecules and shRNA

54

expressing vectors into primary muscle cells. A Cy3 conjugated siRNA and a dsRed expressing vector will be used to monitor the efficiency of transfection agents. These experiments should take approximately a week and will pinpoint the most effective method for transfecting immortalized muscle cells. 8. Transfection of immortalized L221F+/+/m
-/-

cells with siRNA against

GFP, and L221F. This experiment will show us if siGFP and si221 can effectively knock down the expression of L221FEGFP. The results will be assessed qualitatively using microscopy and quantitatively using western blots (assessment at protein level) and qRT-PCR (assessment at mRNA level). These experiments should approximately take a week and will be repeated three times (therefore 3 weeks total). 9. Transfection of immortalized L221F+/+/m
-/-

cells with vectors

expressing shRNA against GFP and L221F. These experiments will show us if the vectors are as efficient as the siRNA in silencing the mutant L221FEGFP and the results will be assessed qualitatively using microscopy and quantitatively using western blots (for protein knock down) and qRT-PCR (for mRNA knock down). These experiments should take a week and will be repeated three times (therefore 3 weeks total). 10. Time course transfection of immortalized L221F+/+/m vectors expressing shRNA against GFP and
-/-

cells with These

L221F.

experiments will show us if the vectors provide more long lasting silencing of the mutant L221FEGFP and the results will be assessed qualitatively using microscopy and quantitatively using western blots (for protein knock down) and qRT-PCR (for mRNA knock down). These experiments should require a week and will be repeated three times (therefore 3 weeks total). The above experiments are planned for primary and immortalized mouse muscle cell lines. We do not expect to see differences between the results from primary and immortalized cell lines of the same genotype. The

55

reason for designing the same experiments on two different cell line models depends on the success of immortalizing the primary muscle cells and the amount of time it might require, which is unknown to me as this way of immortalizing cells has not been used in our lab before. In vivo: tibialis anterior (TA) muscle of transgenic mice. First inject TA with negative control siRNA labelled with Cy3 or dsRed expressing vector. Repeat the above with electroporation. The results will tell us if siRNA and vectors can be delivered into the cells without electroporation and if electroporation improves the delivery of nucleic acid into muscle cells. The contra-lateral TA muscle in each mouse will be used as control and will be injected with saline. Results will be assessed 24 hours post tranfection for siRNA and 48 hours post tranfection by microscopy. 2. Demonstrate knock down of expression of EGFP expressed at the neuromuscular junction by L221FEGFP AchR. Using the optimal method as defined by the delivery optimization experiment, siGFP and pRS-shGFP (commercial vector expressing a short hairpin against GFP) will be delivered to the TA of L221F+/+/m
-/-

1. Optimize the delivery of siRNAs and shRNA expressing vectors into

mice. The results

will be assessed 2 weeks post injection. The results of the first experiment will be assessed by microscopy. If the first experiment is successful protein and mRNA extracts from subsequent experiment will be used to assess the knock down of EGFP at protein (with western blots) and mRNA (qRT-PCR) levels. These experiments should take approximately 6 weeks. 3. Demonstrate knock down of expression of L221F expressed at the neuromuscular junction by L221FEGFP AchR. Using the optimal method as defined by the delivery optimization experiment, si221 will be delivered to the TA of L221F+/+/m
-/-

mice. The results will be

assessed 2 weeks post injection. The results of the first experiment will be assessed by microscopy. If the first experiment is successful protein

56

and mRNA extracts from subsequent experiment will be used to assess the knock down of EGFP at protein (with western blots) and mRNA (qRT-PCR) levels. These experiments should take approximately 6 weeks.

57

Appendix Materials and Methods

Cell culture Human embryonic kidney (HEK 293T) cells were grown in Dulbeccos Modified Eagle Medium (DMEM) without Phenol Red (GIBCO), supplemented with 20mM L-Glutamine, 110 g/mL Sodium Pyruvate, 10% foetal calf serum (FCS), antibiotics (penicillin G 100 units/mL, streptomycin sulfate 0.1 mg/mL) and an antimycotic (amphotericin 0.25 g/mL). Cells were incubated at 37 C in 5% CO2. siRNA design. 21mer siRNA against the -subunit of AChR were design to perfectly match the mutant sequence L221F, therefore harbouring a mismatch with the WT protein (Figure 1). Both unmodified and modified siRNA were provided by siRNA. siRNA against GFP and negative control siRNA were bought from Ambion. Figure 1

Figure 4 19nt long double stranded siRNA against the -subunit were design to perfectly match the mutated S226F sequence while having a mismatch with the WT at position 10. Figure 2

Figure 1 21nt long double stranded siRNA against the -subunit were design to perfectly match the mutated sequence while having a mismatch with the WT at position 11.

58

Transient Cell Transfection 24 h prior to transfection cells were plated in poly-l-lycine coated 6-well plates at a concentration 4 x 105 per well. Cells were transiently transfected with 3 g plasmid DNA and the desired amount of siRNA with Lipofectamine 2000 (Invitrogen) per well according to the manufacturers instructions. Alternative plasmid DNA was transfected using PEI. 3ug of pDNA at a concentration 0.8 ug/ul was mixed with 1.25ul/well 20% glucose and 1.5 ul/well PEI. The mix was then added to 1mL of growing medium. siRNA was tranfected using siPORT (Ambion) according to manufacturers instructions. Plasmid and siRNA transfection mixes were combined before aliquoted to replicate well. Whole Cell Protein Extraction 48 h after transfection media was removed from the cells and 400 L of extraction buffer (10mM Tris, 100mM NaCl, 1mM EDTA, 1% Triton-X, pH 8.0) was added to each well of a 6-well plate. Proteolytic activity was prevented by the addition of Protease Inhibitor Cocktail (Sigma-Aldrich) to the protein extract (1:100 dilution), which was then incubated at 4C for 1 h with gentle rotation. The resulting homogenate was spun, the supernatant removed and stored at -20C. A bicinchoninic acid (BCA) protein kit (Pierce) was used to measure whole cell protein concentration. RNA extraction and cDNA preparation RNA was extracted from HEK 293T cells using RNAeasy (Qiagen) according to the manufacturers instructions. Possible plasmid DNA contamination of cell extracted RNA was removed by DNase treatment as follows. 17 L RNA, 2 L 10 x DNAse Buffer (Ambion) and 1 L DNAse (Ambion) were incubated at 37C for 30 min. The reaction was stopped with addition of 2 L DNAse inactivation reagent (Ambion) and incubation at RT for 15 min while flicking every couple of minutes to increase the DNAse inactivation reagent activity. After centrifugation at 13 krpm the supernatant containing the DNA-free RNA was removed in an RNAse-free tube. RNA was then quantified by OD assessment (Ultrospec 2100 pro, Amersham Biosciences) and diluted to 1 g/ l. Reverse transcription of RNA was done with RETROscript (Ambion) according to the manufacturers instructions. In short, 1 g of RNA was mixed with 2 L 50uM OligodT and 9 L RNAsefree water. The mix was heated at 80C for 3 min and then immediately placed on ice for 2 min. After addition of 2 L 10 x RT Buffer, 4 L dNTPs Mix (2.5 mM each dNTP), 1 L RNase Inhibitor (10 units/L) and 1 L MMLV-RT (100 units/L), the reaction was incubated at 50C for 1 h and then at 92C for 10 min. cDNA was stored at -20C.

59

Plate Readings Typically 300 g of protein was made up to 200 l with protein extraction buffer. Fluorescence was measured on Molecular Devices Max Gemini XS plate reader. The wavelengths used were as follows: EGFP excitation: 472, emission: 512, dsRed excitation: 556, emission: 583. Each experiment was run in duplicate or triplicate. Western blotting 20 g of protein from each sample was typically loaded in a pre-cast 4-12% Bis-Tris NUPAGE gel and run in 1 x MES SDS running buffer for ~45 min at 200V. The protein was transferred to Nitrocellulose (Protran) membrane for ~2 h at 30V. Successful transfer of protein was visualized with Ponceau Red (0.1% in 5% acetic acid). Membranes were then blocked in PBS with 0.1 % Tween and 5% milk powder (Marvel) with agitation at RT for 1 h. The primary antibody (Table 1) was applied overnight at 4 C in PBS with 0.1% Tween and 2% milk powder (Marvel). The membrane was washed (3 x 5 min) in PBS with 0.1% Tween and the secondary antibody (Table 1) applied for 1 h at RT in PBS with 0.1% Tween and 2% milk powder (Marvel). ECL Plus Western Blotting Detection Reagents (Amersham) were used to detect HRP conjugated secondary antibodies. Pictures were taken with GDS-8000 System (UVP Bioimaging Systems) and band optical density was quantified with Labworks Analysis Software (UVP). Table 1 Antibodies used in western blotting Primary Antibodies GFP antibody (ab6556, Abcam) AChR antibody (sc-1454, Santa Cruz) anti- -tubulin antibody (T-5168, Sigma) Secondary Antibodies Anti-rabbit IgG-HRP (P0448, Dako) Anti-mouse IgG-HRP (P0447, Dako) Anti-goat IgG-HRP (P0449, Dako) Animal raised/clonality Rabbit polyclonal Goat polyclonal Mouse monoclonal Animal raised/clonality Goat polyclonal Goat monoclonal Rabbit monoclonal Dilution 1:2,000 1:1,000 1:100,000 Dilution 1:2,000 1:1,000 1:1,000

60

Real-Time quantitative PCR (RT-qPCR) RT-qPCR was used to quantify the mRNA levels of AChR -subunit. Both EGFP and AChR -subunit were used as probe targets. Sequences for primers and probes for EGFP and AChR -subunits are listed in table 2. For both targets the TaqMan-based probe system was used with TAMRA quencher at the 5 and FAM dye at the 3 prime end of the probe. RT-qPCR reactions were run in the GeneAmp 5700 system (Applied Biosystems) and the baseline and threshold were set manually. Human GAPDH (primers/probes from Applied Biosystems) was used as a reference gene for relative quantification. Equal amounts of each sample were combined to create a standard curve for each probe/primer set (named pooled standard curve). Table 2 Primers and Probes for Real-Time PCR EGFP Forward Primer Reverse Primer Probe AChR -subunit Forward Primer Reverse Primer Probe 5 GGGCACAAGCTGGAGTACAACT 3 5 CACCTTGATGCCGTTCTTCTG 3 5 CCACAACGTCTATATCATGGCCGA 3 5 CTTCGATTGGCAGAACTGTT 3 5 TGTGTCGATGTCGATCTTGT 3 5 CTCTCAGACGTACAATGCCGAAG 3

61

References Abdelgany A, Wood M, Beeson D (2003) Allele-specific silencing of a pathogenic mutant acetylcholine receptor subunit by RNA interference. Human Molecular Genetics 12: 2637-2644 Ameres SL, Martinez J, Schroeder R (2007) Molecular basis for target RNA recognition and cleavage by human RISC. Cell 130: 101-112 Bernstein E, Caudy A, Hammond S, Hannon G (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409: 363-366 Bohnsack M, Czaplinski K, Gorlich D (2004) Exportin 5 is a RanGTPdependent dsRNA-binding protein that mediates nuclear export of premiRNAs. RNA 10: 185-191 Contet, C., J. N. P. Rawlins & R. M. J. Deacon (2001) A comparison of 129S2/SvHsd and C57BL/6JOlaHsd mice on a test battery assessing sensorimotor, affective and cognitive behaviours: implications for the study of genetically modified mice. Behavioural Brain Research, 124, 33-46. Croxen R, Hatton C, Shelley C, Brydson M, Chauplannaz G, Oosterhuis H, Vincent A, Newsom-Davis J, Colquhoun D, Beeson D (2002) Recessive inheritance and variable penetrance of slow-channel congenital myasthenic syndromes. Neurology 59: 162-168 Croxen R, Newland C, Beeson D, Oosterhuis H, Chauplannaz G, Vincent A, NewsomDavis J (1997) Mutations in different functional domains of the human muscle acetylcholine receptor alpha subunit in patients with the slow-channel congenital myasthenic syndrome. Human Molecular Genetics 6: 767-774 Elbashir S, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494-498 Engel AG, Ohno K, Milone M, Wang HL, Nakano S, Bouzat C, Pruitt JN, Hutchinson DO, Brengman JM, Bren N, Sieb JP, Sine SM (1996) New mutations in acetylcholine receptor subunit genes reveal heterogeneity in the slow-channel congenital myasthenic syndrome. Human Molecular Genetics 5: 1217-1227 Fire A (2005) Nucleic acid structure and intracellular immunity: some recent ideas from the world of RNAi. Q Rev Biophys 38: 303-309 Fire A, Xu S, Montgomery M, Kostas S, Driver S, Mello C (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806-811 Hammond S, Bernstein E, Beach D, Hannon G (2000) An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404: 293-296 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Rdmark O, Kim S, Kim V (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature 425: 415-419 Lee Y, Jeon K, Lee J, Kim S, Kim V (2002) MicroRNA maturation: stepwise processing and subcellular localization. EMBO J 21: 4663-4670 Miller V, Gouvion C, Davidson B, Paulson H (2004) Targeting Alzheimer's disease genes with RNA interference: an efficient strategy for silencing

62

mutant alleles. Nucleic Acids Res 32: 661-668 Paddison P, Caudy A, Bernstein E, Hannon G, Conklin D (2002) Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16: 948-958 Provost P, Dishart D, Doucet J, Frendewey D, Samuelsson B, Rdmark O (2002) Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J 21: 5864-5874 Ratcliff F, Harrison BD, Baulcombe DC (1997) A similarity between viral defense and gene silencing in plants. Science 276: 1558-1560 Shen XM, Deymeer F, Sine SM, Engel AG (2006) Slow-channel mutation in acetylcholine receptor alpha M4 domain and its efficient knockdown. Annals of Neurology 60: 128-136 Sine SM, Ohno K, Bouzat C, Auerbach A, Milone M, Pruitt JN, Engel AG (1995) Mutation of the acetylcholine-receptor alpha-subunit causes a slow-channel myasthenic syndrome by enhancing agonist bindingaffinity. Neuron 15: 229-239 Stark G, Kerr I, Williams B, Silverman R, Schreiber R (1998) How cells respond to interferons. Annu Rev Biochem 67: 227-264 Yi R, Qin Y, Macara I, Cullen B (2003) Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17: 3011-3016

63