Aging Cell (2010) 9, pp747760

Doi: 10.1111/j.1474-9726.2010.00601.x

BTG2 antagonizes Pin1 in response to mitogens and telomere disruption during replicative senescence
Keith Wheaton, Jennifer Muir, Weili Ma and Samuel Benchimol
Department of Biology, York University, 4700 Keele Street, Toronto, Ontario, Canada M3J 1P3

Summary
Cellular senescence limits the replicative capacity of normal cells and acts as an intrinsic barrier that protects against the development of cancer. Telomere shortening induced replicative senescence is dependent on the ATMp53-p21 pathway but additional genes likely contribute to senescence. Here, we show that the p53-responsive gene BTG2 plays an essential role in replicative senescence. Similar to p53 and p21 depletion, BTG2 depletion in human broblasts leads to an extension of cellular lifespan, and ectopic BTG2 induces senescence independently of p53. The anti-proliferative function of BTG2 during senescence involves its stabilization in response to telomere dysfunction followed by serum-dependent binding and relocalization of the cell cycle regulator prolyl isomerase Pin1. Pin1 inhibition leads to senescence in late-passage cells, and ectopic Pin1 expression rescues cells from BTG2-induced senescence. The neutralization of Pin1 by BTG2 provides a critical mechanism to maintain senescent arrest in the presence of mitogenic signals in normal primary broblasts. Key words: BTG2; p53; Pin1; replicative; senescence; telomeres.

Introduction
In response to many forms of cellular stress, the p53 tumor suppressor protein becomes active and is able to transactivate a variety of target genes that regulate diverse cellular processes including: cell cycle progression, senescence, DNA repair, metabolism and cell survival (reviewed in (Vousden & Lane, 2007). Through these processes, p53 protects cells from uncontrolled growth and genomic instability that lead to tumor devel-

Aging Cell

Correspondence Keith Wheaton and Sam Benchimol, Department of Biology, York University, 4700 Keele Street, Toronto, Ontario M3J 1P3, Canada. Tel.: +1 416 736 2100 Ext. 20893 (Keith Wheaton); +1 416 736 2100 Ext. 20726 (Sam Benchimol); fax: +1 416 736 5698; e-mails: kwheaton@ yorku.ca and benchimo@yorku.ca Accepted for publication 6 June 2010

opment. The divergent biological outcomes of p53 are thought to be due to differential transcription of p53 target genes. Promoter selection is regulated by posttranslational modications of p53 including phosphorylation as well as by the interaction of p53 with various protein cofactors (Vousden, 2006; Rozan & El-Deiry, 2007). Primary human broblasts have a nite replicative lifespan that terminates with the acquisition of a phenotype having distinct morphological and biochemical characteristics termed replicative senescence (Hayick, 1965). In this state, the cells accumulate primarily in the G1 phase of the cell cycle and remain viable but refractory to mitogenic signals. Thus, replicative senescence acts as an intrinsic barrier against unrestricted cell growth and provides a mechanism for tumor suppression. Recent studies indicate that senescence is as effective as apoptosis in reducing cancer incidence and that senescence bypass is an important step in the development of cancer (Dimri, 2005; Collado et al., 2007). At the molecular level, senescent cells exhibit elevated expression of p21, p16 and cyclin D1, and increased activity of p53 (Atadja et al., 1995; Vaziri et al., 1997), Rb (Stein et al., 1999) and PKC d (Wheaton & Riabowol, 2004). Replicative senescence is triggered by critically short telomeres. Telomeres are specialized nucleoprotein complexes that cap and protect the ends of linear chromosomes (Verdun & Karlseder, 2007). Telomeres shorten with each round of DNA replication because of the end-replication problem the inability of DNA polymerases to completely replicate the 3 end of linear DNA molecules (Harley et al., 1990). Shortening of telomeric DNA leads to uncapping of the telomeres, and this is believed to initiate an ATM-dependent DNA damage response that activates p53 (Karlseder et al., 2002; Herbig et al., 2004; Stewart & Weinberg, 2006). The p53 protein has been implicated as one of the key mediators of cellular senescence. In its absence, the replicative capacity of primary broblasts is extended 10-30 population doublings (Hara et al., 1991; Shay et al., 1991; Masutomi et al., 2003). Cells that bypass senescence as a result of p53 repression undergo further rounds of cell division even though they continue to lose telomeric DNA and eventually encounter a second block in proliferation known as crisis characterized by massive cell death. The identity of the transcriptional targets of p53 required to initiate and maintain the senescence phenotype is uncertain. Although the p53 target gene, p21WAF1, was originally considered to be central to senescence arrest (el-Deiry et al., 1993; Noda et al., 1994; Brown et al., 1997), subsequent studies have questioned whether the protein is essential (Wyllie et al., 2003) or if it is sufcient alone (Ma et al., 1999; Dulic et al., 2000). Recently, PAI-1 was identied as a p53-responsive

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

747

748 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

gene that contributes to replicative senescence through its ability to inhibit the urokinase-type plasminogen activator, leading to downregulation of PI(3)K-PKB signaling (Kortlever et al., 2006). Thus, only two p53-responsive genes have been characterized in the senescence program, neither of which can fully recapitulate p53-dependent senescence. Therefore, we wished to address the question of what other effector genes were required for p53-dependent replicative senescence. We screened p53 effectors previously described as being involved in cellular arrest and identied BTG2 and GAdd45a as being highly upregulated during senescence. Further functional and mechanistic analysis proved that BTG2 had a signicant role in the development of senescence. BTG2 is a member of the BTG Tob family of anti-proliferative genes and has been implicated in various cellular processes including cell cycle progression, differentiation and apoptosis. BTG2 was previously reported to be an effector of p53-dependent proliferation arrest (Rouault et al., 1996) and to act through repression of cyclin D1 and cyclin E1 mRNA (Guardavaccaro et al., 2000; Boiko et al., 2006; Kawakubo et al., 2006). BTG2 is induced by various cellular stresses through p53-dependent and p53-independent processes (Lim, 2006). The peptidyl-prolyl isomerase Pin1 regulates diverse cellular processes including cell cycle progression and apoptosis through its interaction with different phosphoproteins altering their conformation and stability (Yeh & Means, 2007). Two notable studies reported that Pin1 was required for efcient reentry into the cell cycle in response to mitogenic stimulation after G0 arrest (Fujimori et al., 1999; You et al., 2002). Furthermore, Pin1 overexpression has been correlated with oncogenesis (Yeh & Means, 2007). Here, we show that BTG2 plays a critical role in promoting p53-dependent replicative senescence in human cells through its ability to sequester Pin1. This mechanism is unique to primary cells, because BTG2 has been commonly reported to suppress cyclin D1 levels in transformed cell lines rather than neutralize Pin1-mediated cell cycle progression. BTG2 activity during senescence is regulated at three levels: transcriptional regulation by p53, protein stabilization in response to telomere disruption and by mitogenic signaling pathways. Thus, we have further explored the p53 genetic program leading to senescence by characterizing the role of BTG2.

was not due to cellular quiescence, since these gene transcripts were not elevated during contact inhibition or serum starvation, two conditions known to activate p53 (Itahana et al., 2002; Meerson et al., 2004) (Fig. 1A). We conrmed the upregulation of BTG2, Gadd45a and p21expression during the development of senescence by Northern blotting (Fig. 1B) and Western immunoblot analysis (Fig. 1C). These results are consistent with previous reports, indicating that p21 (Noda et al., 1994), Gadd45a (Jackson & Pereira-Smith, 2006) and BTG2 (Rouault et al., 1996) are upregulated during replicative senescence. The increased levels of cyclin D1 served as an additional molecular marker for cellular senescence (Dulic et al., 1993; Lucibello et al., 1993).

Extension of cellular lifespan by shRNA-mediated repression of p53, BTG2 and p21

To investigate the dependency of BTG2, Gadd45a and p21 expression on p53 during replicative senescence, we inhibited p53 expression in BJ and Hs68 broblasts using shRNA (Figs 2A,B and S1). p53 depletion suppressed the induction of BTG2, p21 and Gadd45a that is normally seen as BJ cells enter senescence (Fig. 2A,B). p53 shRNA-expressing cells (shp53 cells) also failed to induce p21 and BTG2 in response to doxorubicin treatment (Fig. S1A) or c-irradiation (Fig. S1C). As a consequence of sustained p53 inhibition, both BJ and Hs68 cells escaped senescence and grew an additional 10 MPDs compared with control cells expressing pSuper vector (Figs 2C and S1B). Hs68 and BJ broblast cell strains were derived from newborn human foreskin; we have used both cell strains throughout this study to conrm and validate our ndings and have not detected any differences in their molecular characterization or behavior in culture. To assess the contribution of BTG2, p21 and Gadd45a to the senescence program, we inhibited their expression using shRNA and developed stable shRNA-expressing BJ cells (shBTG2, shp21, and shGadd45a cells). The shBTG2 and shGadd45a cells failed to show an increase in BTG2 and Gadd45a protein, respectively, at the initiation of senescence and the shp21 cells exhibited a reduction in p21 protein induction at senescence (Fig. 2A,B). The replicative potential of these cells was compared with BJ shp53 and BJ pSuper control cells. The shp21 and shBTG2 cells exhibited increased proliferative potential compared with control cells but the extended lifespan was not as great as the shp53 cells (Fig. 2C). BJ cells expressing shRNA to both BTG2 and p21 exhibited little if any induction of BTG2 and p21 protein and had an extended lifespan similar to the shp21 cells (Fig. 2C). Thus, inhibition of p21 or BTG2 individually or together could not fully mimic the loss of p53 with respect to proliferative potential. The incomplete inhibition of p21 and BTG2 compared with the efcacy of the shRNA against p53, however, could account for the differences in replicative potential of these cells. shGadd45a cells did not exhibit an extended lifespan and underwent senescence at the same time as the BJ pSuper control cells even though Gadd45a was effectively repressed. This suggested that Gadd45a does not play a

Results
Expression of p53-responsive genes in senescence
To investigate the expression of p53 effector genes during cellular senescence, we measured the transcript levels of p53responsive genes previously associated with cellular arrest including BTG2, TOB1, 14-3-3r, Gadd45a, Reprimo and p21WAF1. We measured mRNA expression by semi-quantitative RTPCR (Fig. 1A) in young, cycling Hs68 human broblasts at a mean population doubling (MPD) of 45 and in senescent Hs68 cells (MPD 85). The mRNA levels for BTG2, GADD45a and p21 were elevated during replicative senescence. This upregulation

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al. 749

(A)

(B)

(C)

Fig. 1 Expression of p53 target genes in senescent cells. (A) Expression of various p53 target genes was assessed by semi-quantitative RTPCR. RNA was extracted from Hs68 broblasts that were cycling (MPD 45), contact inhibited (2 weeks), serum starved (48 h) or senescent (MPD 85). RNA levels were normalized using GAPDH as an internal control. Means and SD of three independent experiments are shown in the histogram. (B, C) Northern blot analysis (B) and Western blot analysis (C) of p53 target genes; cyclin D1 and p53s15 serve as markers of senescence. RNA and protein samples were obtained from Hs68 broblasts that were cycling (MPD 47), or 728 days after the initiation of senescence at MPD 85. The last lane shown in (B) represents RNA obtained from cycling Hs68 cells 3 h after c-irradiation with 6 Gy. MPD, mean population doubling.

signicant role in replicative senescence, and as a result, Gadd45a was not investigated further in this study. In the course of these studies, we noted that the BJ shp53 cells were not immortal (Fig. 2C) and that many cells exhibited an apoptotic morphology that was consistent with entry into crisis (data not shown). In contrast, the shp21, shBTG2 and shp21 shBTG2 cells exhibited a senescence phenotype upon reaching their replicative limit (data not shown).

Reinstatement of senescence in shp53 cells by ectopic expression of p53RR, BTG2 or p21

The ability of shp53 cells to bypass replicative senescence suggests that one or more p53-responsive genes are required to initiate the senescence program. To determine whether ectopic expression of p21, BTG2 or p53 would reinstate the senescence program in BJ shp53 cells that had bypassed their normal repli-

cative endpoint, cDNAs encoding BTG2, p21 and p53RR (resistant to p53 shRNA) were introduced individually by retroviral infection at MPD 72. Western blot analysis revealed that each of the cDNAs was expressed in the infected BJ shp53 cells and that p53RR promoted expression of endogenous p21 and BTG2 (Fig. 3A). Moreover, ectopic p53 was phosphorylated on Ser15, which serves as a marker for p53 activation (Fig. 3A). Importantly, ectopic expression of p21, BTG2 and p53RR led to the establishment of senescence as measured by the acidic b-galactosidase assay and by the accumulation of cells in the G1 phase of the cell cycle (Fig. 3B). Similarly, in Hs68 shp53 broblasts that had bypassed senescence as a result of p53 repression, ectopic BTG2 resulted in cell cycle arrest in G1 and b-galactosidase staining indicative of senescence (Fig. 3C). These results indicate that ectopic expression of BTG2, p21or p53 can promote senescence in cells that have escaped their normal replicative endpoint.

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

750 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

(A)

(C)

(B)

Fig. 2 p53, p21 and BTG2 shRNA-expressing cells have an extended proliferative lifespan. (A, B) Western blot analysis of BJ cells expressing various shRNAs directed to p53 and its targets p21, BTG2 and GADD45a at MPD 65 (cycling, presenescent) and at later MPDs as indicated. pSuper represents BJ cells transfected with the empty pSuper vector. (C) Measurement of the number of mean population doublings over the lifespan of BJ cells expressing various shRNAs as indicated. For each shRNA-expressing cell strain, the mean SD of three independent cultures is shown. See also Fig. S1. MPD, mean population doubling.

Sustained expression of p21 was recently shown to induce an irreversible senescent-like state in early-passage human broblasts (Sang et al., 2008). To determine whether BTG2 and p53 could also promote premature senescence in early-passage broblasts, we introduced BTG2 and p53RR cDNAs into young cells at passage numbers that were well below their established proliferative limit, BJ shp53 cells at MPD 63 or Hs68 shp53 cells at MPD 52. Remarkably, neither BTG2 (Fig. 3D,E) nor p53RR (Fig. 3D) promoted senescence or inhibited the growth of earlypassage broblasts. To investigate the inability of p53 to promote growth arrest in early-passage cells, we measured the amount of ectopic p53 and its phosphorylation by Western blotting in early-passage BJ shp53 cells (MPD 65) and in late-passage BJ shp53 cells (MPD 72). The amount of ectopic p53 protein was similar at both passage numbers but p53 phosphorylation on Ser15 was only observed at late passage (Fig. 3F), suggesting that p53 is functionally inactive in early-passage cells. One important difference between shp53 cells at early and late passage is the presence of intact protected telomeres in the former and short disrupted telomeres in the latter. Although shp53 cells bypass senescence because they lack p53, these cells continue to lose telomeric DNA until they enter crisis. Thus, one interpretation of these results is that p53RR is inactive in unstressed low-passage cells when telomeres are intact and capped; at high passage number, p53RR is posttranslationally activated by ATM-mediated signals emanating from disrupted short telomeres. The level of ectopic BTG2 protein was low in early-passage Hs68 pSuper and Hs68 shp53 cells but increased in the presence of the proteasome inhibitor MG132 (Fig. 3G), suggesting that BTG2 protein is normally unstable at early passages. This is consistent with a previous report showing that BTG2 is rapidly degraded through the ubiquitin proteasomal pathway (Sasajima et al., 2002). We expressed BTG2 cDNA in BJ shp53 cells before (MPD 65) and after (MPD 72) their normal replicative limit, and observed higher levels of BTG2 at MPD 72 compared with MPD

65 (Fig. 3H). The higher level of BTG2 protein at MPD 72 was not the result of differences in the level of ectopic BTG2 mRNA (Fig. 3H). As shown earlier in Fig. 2, p53 depletion prevents the induction of endogenous BTG2 mRNA in these cells. Together, these results suggest that BTG2 expression is regulated in senescent or late-passage cells through two distinct mechanisms: one is dependent on p53 and involves transcriptional regulation; the other is independent of p53 and involves protein stabilization. As BTG2 is stable and functional only in late-passage cells, it is possible that telomere disruption is also required for BTG2 function.

BTG2 is required for T-oligo-induced senescence

To test the idea that the anti-proliferative effect of BTG2 is dependent on disrupted telomeres, we used an experimental model in which exogenous oligonucleotides with a sequence identical to the telomere 3-overhang sequence (T-oligo) are used to induce senescence articially in human broblasts. Fibroblasts exposed to the T-oligo were reported to undergo p53-mediated senescence through a process that resembles the natural uncapping of telomeres in replicative senescence (Li et al., 2003). T-oligo treatment induced senescence in BJ pSuper control broblasts, but not in shp53, shp21 and shBTG2 BJ cells as determined by staining for acidic b-galactosidase (Fig. 4A) and by cell cycle analysis for G1 arrest (Fig. 4B). Cells treated with a control oligonucleotide (C-oligo) containing a sequence complementary to the T-oligo showed no b-galactosidase staining or G1 arrest (Fig. 4A,B). To support these results, BJ pSuper broblasts were treated with T-oligo or C-oligo and were analyzed over a 2 -week period for the expression of p21, BTG2 and p53 by Western blotting. The levels of these three proteins increased initially in response to T-oligo but not C-oligo treatment, and the amount of BTG2 and p21 remained elevated 2 weeks after T-oligo treatment (Fig. 4C). The accumulation of BTG2 protein upon T-oligo treatment was also seen by immunouorescence microscopy (Fig. S2). The amount of p53 protein

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al. 751

(A)

(B)

(C)

(D)

(E)

(F)

(G)

(H)

Fig. 3 BTG2, p21 and p53 can reinstate senescence in p53 shRNA-expressing cells. (A) p53 shRNA-expressing BJ cells (BJ shp53) at MPD 72 were infected with the indicated retroviral expression constructs or with the empty pBabe vector. Western blot analysis was performed with the indicated antibodies 1 week after infection. p53RR represents a p53 retroviral construct that is resistant to p53 shRNA. b-actin serves as a loading control. (B) Representative cell cycle proles obtained by ow cytometry after propidium iodide staining of BJ shp53 cells 2 weeks after infection with the indicated retroviral constructs. The G1 S ratios were determined from the cell cycle proles of cells from four independent viral infections. Staining for senescence-associated b-galactosidase was performed on BJ shp53 cells 2 weeks after retroviral overexpression of BTG2, p21 or p53RR. (C, D) Cell cycle proles and b-galactosidase staining of p53 shRNA-expressing Hs68 cells (Hs68 shp53) at MPD 90 and BJ shp53 cells at MPD 63. (E) Growth curve of Hs68 pSuper or Hs68 shp53 cells after retroviral expression of BTG2 or the pBabe.hygro control vector (MPD 57). Each cell strain was initially seeded at 50 000 cells and counted every day over a 6 -day period. (F) Western blot analysis of p53 and phospho-p53 S15 in BJ shp53 infected with p53RR at MPD 65 and MPD 72. (G) Cells as in (E) were treated with MG132 for 1 h before harvesting for Western blot analysis of BTG2. (H) Ectopic BTG2 protein and RNA expression in BJ shp53 cells after retroviral infection with a BTG2 cDNA expression constructs at MPD 65 or MPD 72. MPD, mean population doubling.

returned to basal level over a 2 -week period but the activated, Ser15 phosphorylated form of p53 remained elevated in T-oligo-treated BJ cells. These results indicate a role of p21 and BTG2 in the p53-dependent senescence pathway induced naturally by telomere shortening or articially by treatment with T-oligo. Next, we asked whether ectopic BTG2 could sensitize shp53 cells to undergo T-oligo-induced senescence. BTG2-expressing Hs68 shp53 cells at MPD 52 exhibited a senescent morphology and stained for b-galactosidase upon addition of T-oligo but not C-oligo (Fig. 4D). Notably, the level of ectopic BTG2 protein in the shp53 cells increased upon T-oligo treatment (Fig. 4E). In addition, cyclin D1 levels increased upon T-oligo treatment in BTG2-expressing shp53 cells, providing further support for entry into senescence. Residual p53 activity is unlikely to contribute to

senescence induced by BTG2 in shp53 cells because we do not detect the Ser15 phosphorylated form of p53 nor p21 induction in these cells after T-oligo treatment (Fig. 4E) or after DNA damage (Fig. S1A,C). These data support the view that uncapped telomeres represent the senescent-specic signal that promotes BTG2 stabilization and anti-proliferative activity.

BTG2 binds and colocalizes with Pin1 in senescent broblasts

Having found that BTG2 is a key effector of telomere-dependent replicative senescence and T-oligo-induced senescence, we next wanted to identify downstream effectors. Previous reports suggested that BTG2 represses cyclin D1 (Guardavaccaro et al.,

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

752 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

(A)

(D)

(B)

(E)

(C)

Fig. 4 BTG2 is required for T-oligo-induced senescence. (A, B) BJ cells expressing the indicated shRNAs were treated with a single dose of T-oligo (40 lM), C-oligo (40 lM), or vehicle (H2O). After 2 weeks, cells were xed and stained for b-galactosidase (A) or propidium iodide and analyzed by ow cytometry (B). Cells were collected at similar densities to ensure the measured growth arrest was not because of contact inhibition. The G1 S ratio was determined for three independent experiments. (C) Western blot analysis of p53, p53 Ser-15, p21 and BTG2 in BJ pSuper cells after treatment with T-oligo, C-oligo or vehicle at the times indicated. (D) b-galactosidase staining of Hs68 shp53 cells expressing BTG2 or empty pBabe vector, 2 weeks after treatment with T-oligo, C-oligo or vehicle at MPD 52. (E) Western blot analysis of p53 and BTG2 in Hs68 shp53 expressing BTG2 after oligo treatment at the times indicated. MPD, mean population doubling.

2000; Boiko et al., 2006; Kawakubo et al., 2006) and cyclin E expression (Lim et al., 1998). We show, however, that cyclin D1 is highly expressed and that cyclin E expression is unchanged during senescence (Figs 1B,C and 4E). Thus, it is unlikely that BTG2 promotes replicative senescence through suppression of cyclin D1 and cyclin E. BTG2 was also reported to serve as a regulator of Pin1 nuclear export in transformed human cells (Hong et al., 2005). To test the possibility that BTG2 might sequester Pin1 in the cytoplasm of senescent cells and neutralize its function, we expressed a mutant BTG2 protein (BTG2 S147A) that is unable to interact with Pin1 (Hong et al., 2005) in late-passage BJ shp53 cells and tested whether this mutation prevented BTG2 from inducing senescence. Unlike wild-type BTG2, BTG2 S147A was unable to promote senescence in shp53 cells that had bypassed their normal replicative limit (Fig. 3B). Next, we examined the interaction of BTG2 with Pin1 in young and senescent Hs68 cells by coimmunoprecipitation Western blot analysis. As the binding of Pin1 to BTG2 requires ERK1 2-dependent phosphorylation of BTG2 on Ser147 (Hong et al., 2005), we

deprived the cells of serum for 72 h and stimulated with serum for 24 h prior to cell harvesting. The levels of both Pin1 and BTG2 protein were elevated in senescent cells compared with young cells and these levels were unaffected by serum (Fig. 5A). BTG2 coimmunoprecipitated with Pin1 in both young and senescent cells, and the binding between these two proteins was greatly enhanced after serum stimulation (Fig. 5B). Together, these data indicate that BTG2 binds to Pin1 and they suggest that the interaction of these proteins could be important for the induction of senescence by BTG2.

BTG2 promotes nuclear export of Pin1

Next, we examined the expression and localization of endogenous Pin1 and BTG2 in young and senescent Hs68 cells by confocal microscopy. We deprived the cells of serum for 72 h and stimulated with serum for 24 h prior to immunostaining. As expected, young cells had no detectable BTG2 protein expression and showed nuclear Pin1 staining regardless of

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al. 753

(A)

(C)

(B)

Fig. 5 BTG2 binds and colocalizes with Pin1 in senescent broblasts. (A and B) Coimmunoprecipitation Western blot analysis of Pin1 and BTG2 in young (MPD 52) and senescent Hs68 broblasts (MPD 84). Cells were serum starved (SS) for 72 h or serum stimulated for 24 h. Panel A shows total levels of Pin1 and BTG2 by Western blot analysis and panel B shows the coimmunoprecipitation Western blot. (C) Immunouorescence staining of Pin1 and BTG2 in Hs68 cells, young (MPD 50) and senescent (MPD 82). Cells were serum starved for 72 h or serum stimulated for 24 h prior to xation. 4555% of cells examined showed cytoplasmic staining for Pin1 that colocalized with BTG2 after serum stimulation. Nuclear counterstaining used Draq5. Images show a single optical layer of a confocal image at 400 magnication. See also Fig. S2. MPD, mean population doubling.

serum stimulation. In serum-starved senescent cells, Pin1 was expressed primarily in the nucleus and BTG2 was expressed diffusely in the nucleus and cytoplasm. Upon serum stimulation, however, 4555% of cells examined showed cytoplasmic staining for Pin1 that colocalized with BTG2 (Fig. 5C). The cellular redistribution of Pin1 and its colocalization with BTG2 in the cytoplasm were also observed when cells were induced to undergo senescence using T-oligo (Fig. S2). To determine whether ectopic BTG2 affects the localization of endogenous Pin1, we expressed BTG2 and BTG2 S147A in latepassage BJ shp53 cells and monitored expression by immunouorescence microscopy (Fig. 6). Endogenous Pin1 is predominantly nuclear in unstimulated cells, while ectopic BTG2 and BTG2 S147A were expressed diffusely in both the cytoplasm and the nucleus of BJ shp53 cells. Upon serum stimulation of BTG2-expressing cells but not BTG2 S147A-expressing cells, Pin1 redistributed and colocalized with BTG2 in the cytoplasm. Nearly all serum-stimulated cells showed colocalization of BTG2 and Pin1. In contrast, there was minimal colocalization of BTG2 S147A with Pin1 (Fig. 6). These results suggest that BTG2 promotes senescence in shp53 cells through binding and nuclear export of Pin1 and that the neutralization of Pin1 contributes to cellular senescence.

Pin1 inhibition leads to senescence in p53 knockdown cells that have bypassed their normal proliferative limit
If the primary role of p53-induced BTG2 expression is to neutralize Pin1, we reasoned that Pin1 inhibition should lead to senescence in shp53 cells. Because these cells fail to induce BTG2

expression (Fig. 2A) and have an extended lifespan, they provide a good experimental model to investigate Pin1 function in the absence of BTG2. Pin1 promotes S phase entry in response to mitogenic stimulation (Fujimori et al., 1999; You et al., 2002); hence, we cultured BJ shp53 cells at MPD 67 or 73 in serumfree media for 48 h and stimulated with serum for 24 h in the absence or presence of the Pin1 inhibitor, diethyl-1,3, 6,8-tetrahydro-1,3,6,8-tetraoxobenzo[lmn][3,8]phenanthroline2,7-diacetate (PiB). Cell cycle progression was monitored by propidium iodide staining and ow cytometry. Unexpectedly, we observed that Pin1 was required for entry into S phase in the late-passage cells but not in the early-passage cells (Fig. 7A). PiB-treated late-passage cells (but not early-passage cells) accumulated in G0 G1 and stained for b-galactosidase indicative of a senescence phenotype (Fig. 7B). Because pharmacological inhibition of Pin1 with PiB could have nonspecic or off-target effects, we used shRNA specic for Pin1 to knockdown its expression. shRNA-mediated knockdown of Pin1 reduced the level of endogenous Pin1 in early- (MPD 63) and late-passage (MPD 73) BJ shp53 cells (Fig. 7C). Pin1 knockdown did not decrease the proliferative activity of early- or late-passage BJ shp53 cells in culture. Serum starvation of BJ shp53 and BJ shp53 shPin1 cells at early and late passage resulted in G0 G1 arrest without any evidence of b-galactosidase staining even after 2 weeks in serum-free media (Fig. 7D, upper panel). Upon serum stimulation, however, only the late-passage BJ shp53 shPin1 cells failed to enter S phase and stained for b-galactosidase (Fig. 7D, lower panel). Hence, Pin1 inhibition using PiB or shRNA reveals a role of Pin1 in promoting S phase entry only in late-passage human broblasts. Moreover, latepassage shp53 cells that are unable to enter S phase from

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

754 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

Fig. 6 The BTG2 A147S mutant does not colocalize with Pin1. BJ shp53 cells beyond their normal replicative limit were retrovirally infected with BTG2 or BTG2 A147S expression constructs and selected with hygromycin. Cells were serum starved for 72 h or serum stimulated for 24 h, xed and analyzed by immunouorescence staining for BTG2 and Pin1. Nuclear counterstaining used Draq5. Images show a single optical layer of a confocal image at 400 magnication.

G0 G1 because of Pin1 inhibition are redirected into a senescence program upon mitogenic stimulation.

Exogenous expression of Pin1 rescues BTG2mediated senescence in late-passage cells

Because Pin1 inhibition leads to senescence and BTG2 expression promotes senescence in late-passage cells, possibly through its interaction with Pin1, we tested whether ectopically expressed Pin1 could prevent BTG2-induced senescence in shp53 cells. Pin1 was coexpressed with BTG2 in late-passage shp53 cells (Fig. 8A). Approximately 80% of the cells expressing BTG2 alone exhibited b-galactosidase staining and attened morphology typical of senescent cells when compared with 10.4% of control shp53 cells infected with empty vector. Coexpression of Pin1 and BTG2 resulted in only 17.5% of the cells staining for b-galactosidase (Fig. 8B). These results show that Pin1 expression can rescue cells from BTG2-dependent senescence and serve to demonstrate a functional relationship between BTG2 and Pin1.

Discussion
The repression of p53 by shRNA allows normal human broblasts to bypass their normal replicative limit. While this demonstrates that p53 activation is a critical step in the development of senescence, the downstream p53 effectors required to induce senescence have not been fully established. In this study, we

show that the p53-responsive gene BTG2 plays an essential role in replicative senescence and in T-oligo-induced senescence (an oligonucleotide-based model that mimics the natural uncapping of telomeres during replicative senescence). Endogenous BTG2 protein levels rise during replicative and T-oligo-induced senescence and shRNA-mediated repression of BTG2 extends proliferative lifespan and prevents T-oligo-induced senescence. Moreover, ectopic BTG2 promotes senescence in cells that have bypassed their normal replicative limit because of shRNA-mediated silencing of p53 and restores the sensitivity of shp53 cells to undergo T-oligo-induced senescence. These results demonstrate that BTG2 can act independently of p53 to induce senescence in response to dysfunctional telomeres. One striking observation is the ability of ectopic BTG2 or p53 to promote senescence in shp53 cells that have bypassed their normal replicative limit and their inability to promote senescence in early-passage cells that have not yet reached their normal proliferative limit. This is unlike p21, which is capable of arresting cells at any point during their replicative lifespan (Sang et al., 2008). We nd that ectopic BTG2 protein is unstable in young cells and that BTG2 protein accumulates at higher passage number. One possible explanation is that uncapped telomeres activate a signaling pathway that promotes BTG2 protein stabilization. The activation of ectopic p53 in late-passage but not early-passage cells is likely because of telomere-dependent ATM activation. We nd that ectopic p53 is expressed at similar levels in early- and late-passage shp53 cells but that p53 Ser15 phosphorylation and p53 target gene expression (p21, BTG2)

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al. 755

(A)

(D)

(B)

(C)

Fig. 7 Pin1 inhibition leads to senescence in late-passage quiescent cells stimulated to reenter the cell cycle. (A) The G1 S ratios of BJ shp53 cells, 24 h after serum stimulation in the presence or absence of the Pin1 inhibitor, PiB (20 lM). (B) b-galactosidase staining of BJ shp53 cells, 2 weeks after serum stimulation in the presence of absence of PiB. The PiB in the culture medium was replenished every second day. (C) Western blot analysis of Pin1 expression in BJ shp53 cells expressing shRNA directed to Pin1 or empty pSuper vector (pS) at MPD 63 or 73. (D) Upper 2 panels: The cell cycle proles of BJ shp53 cells and BJ shp53 shPin1 cells, 72 h after serum withdrawal. The b-galactosidase staining of the cells, 2 weeks after serum withdrawal is shown immediately below. Lower 2 panels: The cell cycle proles of BJ shp53 cells and BJ shp53 shPin1 cells stimulated with serum for 24 h following serum starvation for 48 h. The b-galactosidase staining of the cells, 2 weeks after serum stimulation, is shown at the bottom. MPD, mean population doubling.

occur only in late-passage cells. Because telomeres continue to shorten in late-passage shp53 cells leading to crisis, the ATM pathway is expected to remain active but incompetent at promoting senescence in the absence of p53. A similar telomere dysfunction DNA damage sensing pathway is likely to be playing a role in the stabilization of BTG2 in late-passage cells. In addition to protein stabilization, BTG2 activation is dependent on mitogenic stimulation resulting in phosphorylation on Ser147. The dual regulation of BTG2 function in response to telomere disruption and mitogenic stimulation provides tight control over BTG2 expression at senescence. Moreover, the transcriptional regulation of BTG2 expression by p53 provides a third level of control to ensure that BTG2 levels remain elevated during senescence (see model, Fig. 8C). We demonstrate that BTG2 promotes senescence through its ability to bind and sequester Pin1. We show that Pin1 inhibition leads to senescence in late-passage cells and that ectopic Pin1 expression rescues cells from BTG2-induced senescence. Taken together, our ndings indicate that BTG2 and Pin1 interact physically and functionally in senescence. The mitogen-dependent binding and colocalization of BTG2 with Pin1 during senescence

suggest a model in which BTG2 promotes senescence by redistributing Pin1 in the cytoplasm and preventing Pin1 from interacting with proteins required for cell cycle progression. This is consistent with previous reports showing that Pin1 is required for mouse primary cells to escape quiescence in response to serum (Fujimori et al., 1999; You et al., 2002). Our results with human broblasts using PiB to inhibit the catalytic activity of Pin1 and shRNA to reduce endogenous Pin1 indicate that Pin1 is required for S phase entry only in late-passage cells. Inhibition of Pin1 leads to senescence in p53 knockdown cells only after these cells are prompted to reenter the cell cycle with serum after being held in G0 G1 by serum deprivation. It is notable that senescent cells do not proliferate in response to mitogenic stimulation even though mitogenic signaling pathways are intact (reviewed in (Wheaton et al., 1996). Moreover, persistent mitogenic stimulation is required for the development of the senescent phenotype (Satyanarayana et al., 2004). As Pin1 promotes S phase entry in response to mitogenic stimulation, these ndings suggest that the interaction between BTG2 and Pin1 provides a mechanism to neutralize Pin1 function to ensure that senescent cells remain in G1 in the presence of mitogenic

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

756 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

(A)

(B)

(C)

Fig. 8 Exogenous expression of Pin1 rescues late-passage shp53 cells from BTG2-mediated senescence. (A) p53 shRNA-expressing BJ cells (BJ shp53) at MPD 72 were infected with the indicated retroviral expression constructs or with the empty pBabe vector. Western blot analysis was performed with the indicated antibodies 1 week after infection. b-actin serves as a loading control. (B) Staining for senescence-associated b-galactosidase was performed on BJ shp53 cells 2 weeks after retroviral expression of BTG2 and Pin1. (C) Model showing the involvement of BTG2 during p53-dependent replicative senescence. p53 induces BTG2 mRNA expression. BTG2 protein is stabilized downstream of telomere-dependent signals and undergoes phosphorylation on Ser147 in response to mitogenic stimulation. Phosphorylated BTG2 binds Pin1 and promotes the nuclear export of Pin1. In this model, replicative senescence is dependent on telomere disruption, p53 activation and mitogenic stimulation. The model does not exclude the possibility that p53 promotes expression of other responsive genes such as p21 and PAI that function collectively to induce senescence. MPD, mean population doubling.

signals. Three observations support this idea: rst, binding to Pin1 requires MAPK-dependent phosphorylation of BTG2 on Ser147 (Hong et al., 2005); second, the BTG2 S147A mutant protein is unable to induce senescence in late-passage shp53 and is defective in promoting Pin1 nuclear export; and third, ectopic Pin1 expression rescues cells from BTG2-induced senescence. In this model, p53-dependent induction of p21 initiates senescence by arresting cells in G1 and p53-dependent induction of BTG2 inhibits Pin1, ensuring that cells remain in G1 during mitogenic stimulation. Although our study does not identify the Pin1 substrates that regulate S phase entry and senescence in late-passage cells, several candidates, among the many known Pin1 targets, may be considered including cyclin D1, cyclin E, b-catenin, Rb and Myc (Yeh & Means, 2007). Previous studies reported that Pin1 functions as a positive regulator of p53 through an interaction that is dependent on DNA damageinduced p53 phosphorylation on several sites including Ser 33, Thr 81 and Ser 315 (Zacchi et al., 2002; Zheng et al., 2002), and yet our studies suggest that Pin1 must be inhibited during p53-dependent senescence. This could reect temporal regulation of Pin1 during senescence, because Pin1 has been shown to have a dual role in regulating both

p53 activity and cell cycle progression. Pin1 protein accumulates at senescence and may be required to activate p53; however, upon activation of signaling cascades by serum, Pin1 needs to be neutralized to maintain G1 arrest. Pin1 in senescent cells is inactivated through interaction with BTG2 to block activation of target phosphoproteins required for cell cycle progression. Thus, BTG2 becomes a signicant Pin1 substrate only when cells are mitogenically stimulated to enter S phase. At other times in the cell cycle, Pin1 is free to interact with all its substrates including p53. It should also be noted that the involvement of Pin1 in regulating p53 is complex, being dependent on cell and tissue type; moreover, the requirement for Pin1 differs on different p53-responsive genes (Zacchi et al., 2002; Zheng et al., 2002). The Pin1-p53 interaction has been studied primarily in established cell lines treated with DNA damaging agents and the role of Pin1 in enhancing the transcriptional activation of p53-regulated genes during replicative senescence is not known. Recently, TRF1 was reported to be a substrate for Pin1, and the interaction between Pin1 and TRF1 was shown to regulate telomere length in telomerase-positive transformed human cells (Lee et al., 2009). Upon Pin1 inhibition, TRF1 protein stability

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al. 757

increased resulting in enhanced binding of TRF1 to telomeres and gradual telomere erosion in transformed cells. Pin1 knockdown, however, had no effect on telomere length in telomerase-negative normal human cells including human broblasts. Hence, there is no evidence for the TRF1 Pin1 interaction playing a role in telomere shortening during normal replicative senescence, and it is unclear whether Pin1 affects TRF1 stability in normal human cells. Several studies using transformed cells report that BTG2 promotes cell cycle arrest through suppression of cyclin D1 (Guardavaccaro et al., 2000; Boiko et al., 2006; Kawakubo et al., 2006) or cyclin E expression (Lim et al., 1998). In one study, BTG2 was reported to contribute to Ras-induced senescence in broblasts through suppression of cyclin D1 and E levels (Boiko et al., 2006). Consistent with previous reports, we found that neither of these cyclins was suppressed during replicative senescence in human broblasts. We provide an alternative mechanism in which BTG2 temporally antagonizes Pin1 function in response to serum. Thus, senescence induced in response to eroded telomeres or oncogenic stress requires BTG2, but the mechanisms are divergent. This may reect differences between normal and transformed cells or differences between telomeredependent replicative senescence and telomere-independent oncogene-induced senescence. Furthermore, oncogenic Ras delivers constitutive and deregulated signals for proliferation, whereas mitogens and growth factors deliver physiological signals to regulate cell cycle progression. Hence, BTG2-mediated cyclin D1 repression may be restricted to transformed cells while the interaction between BTG2 and Pin1 may be favoured in normal cells. The ability of BTG2 to neutralize Pin1-mediated entry in S phase is unique to normal senescent cells. Our study reveals a critical role for BTG2 in imposing the p53dependent senescence barrier that limits the proliferative capacity of human cells. The interaction of BTG2 with Pin1 promotes its relocation and neutralizes its function. The inability of Pin1 to modify nuclear proteins required for S phase entry contributes to the senescence program of human broblasts.

The p53RR construct was generated using 2 sets of primers that amplied the human p53 cDNA and overlapped in the region targeted by the shRNA (nt 775793 from the translation initiation site). The primers were designed to change the sequence of the p53 cDNA in the shRNA target region without changing the amino acid sequence. The 5-terminal fragment was amplied using cgggatccCATGGAGGAGCCGCAGT and CAAGTTGCCCGAGCTATCTTCCAGTGTGATGATGGTG, and the 3-terminal fragment was amplied using TAGCTCGGGCAACTTGCTGGGACGGAACAGCTTTG and ggaattcGAGTCAGTCTGAGTCAGG (underlined italics show the overlapping sequences that differ from wild-type p53 and lower case lettering indicates BamHI and EcoRI sites). A third PCR utilized the puried products of the rst two reactions as both substrate and primer to generate full-length p53RR with silent nucleotide changes in the 775793 region. The full-length product was digested with BamHI and EcoRI and cloned into pBabe.hygro. All constructs were veried by automated sequencing.

Cell culture and retroviral infection

Hs68 and BJ human broblast cell strains were maintained as previously described (Wheaton & Riabowol, 2004). The broblasts were infected with amphotropic isotyped virus (Phoenix-A packaging cells) containing the ecotropic receptor (pm5-Eco) and then selected with G418 (1 mg mL)1) for 2 weeks to generate Hs68 and BJ Eco strains. Ecotropic retroviral supernatants were produced by cotransfection of HEK 293 cells with the various pBabe or pSuper retroviral constructs and pCL Eco using Fugene. After 48 or 72 h, the medium was collected, supplemented with 0.8 lg mL)1 polybrene and used to infect Hs68 Eco or BJ Eco cells. Selection was performed 4872 h after viral infection using 1 lg mL)1 puromycin for 3 days (pSuper or pBabe.puro), 150 lg mL)1 hygromycin for 4 days (pBabe.hygro), or 80 ng mL)1 zeocin for 3 days (pBabe.zeo). The acidic bgalactosidase assay was performed as described (Dimri et al., 1995).

Experimental procedures
Plasmid constructs
The shRNA constructs were created using hairpin inserts with BglII and XhoI and ligated into pSUPER.retro.puro (Brummelkamp et al., 2002). The shRNA target sequences included: p53, GACTCCAGTGGTAATCTAC; p21, GGTGACTTCGCCTGGGAGCGT; BTG2, CTACGTGATGGCAGTCTCC; GADD45a, AGTCGCTACATGGATCAAT; and Pin1, GCCGAGTGTACTACTTCAA. cDNAs for human p21, BTG2 and Pin 1 were generated by PCR using the primers: ggaattcatgtcagaaccggctgg and cagcgtcgacttagggcttcctctt for p21, catgagccacgggaag and atggcagtctccagctagg for BTG2, and cgggatcccatggcggacgagg agaaagct and ggaattcctactcagtcggaggatga for Pin1. These products were cloned into pBabe.hygro or pBabe.zeo using BamHI and EcoRI.

Cell counting
BJ cells were virally infected at MPD 65, and Hs68 cells were infected at MPD 53. Every 7 days, cells were counted by coulter counter and replated at 1:10 or 1:20 dilution. The mean population doubling (MPD) was calculated by the formula: MPD = Log (Nf Ni) Log2, where Nf = the number of cells counted and Ni = the number of cells seeded. Growth rate experiments used Hs68 pSuper MPD 52 and Hs68 shp53 MPD 52 expressing either ectopic BTG2 or pBabe.hygro vector. The resulting cell strains were seeded at 50 000 cells in triplicate for each time point and harvested for counting daily.

Cell cycle analysis

Cells were xed on ice in 70% ethanol, washed with PBS containing 1% BSA, incubated with 100 lg mL)1 RNase A for

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

758 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

10 min at 37C and resuspended in PBS containing 50 lg mL)1 propidium iodide. Cell cycle distribution was examined by ow cytometry using a FACScalibur ow cytometer (Becton Dickinson, Mississauga, ON, Canada).

P-radiolabelled probes was performed using standard conditions. Labeled RNA was detected by autoradiography.

32

Western blots and immunoprecipitation

Cells were lysed directly in 2X Laemmli sample buffer (4% SDS, 25 mM TrisHCl [pH 6.8], 20% glycerol, 0.1 M DTT) or lysed in PBS containing 1% NP40 and complete protease inhibitor cocktail. Protein samples were quantied by Bradford assay, resolved by PAGE, transferred onto nitrocellulose and blocked overnight in 10% milk or 5% BSA TBS with 0.5% Tween 20. Primary or secondary antibodies were diluted in 5% BSA TBS with 0.5% Tween 20. The following antibodies were used: p53 (DO-1), phospho(S-15)-p53 (Cell Signaling, Danvers, MA, USA, #9284), BTG2 (Santa Cruz, CA, USA, sc-33775 and Aviva, ARP33561), cyclin E (Santa Cruz, sc-198), cyclin D1 (NeoMakers, Fremont, CA, USA, RB-010), p21 (Santa Cruz, sc-397), GADD45a (Santa Cruz, sc-797), Pin1 (Santa Cruz, sc-46660 and sc-15340) and b-actin (Sigma, Oakville, ON, Canada). Anti-rabbit and anti-mouse secondary antibodies were conjugated with HRP (Jackson IR, West Grove, PA, USA). Immunoprecipitations were performed using DSP crosslinked cell lysates (Thermoscientic, Nepean, ON, Canada) and precleared using Protein ASepharose beads. The mouse Pin1 antibody (sc46660) or control immunoglobulin (mIgG) was incubated overnight at 4C followed by the addition of Protein ASepharose beads for a further 60 min at 4C. IPs were washed three times using RIPA as previously described (Wheaton & Riabowol, 2004). The bead IP complexes were boiled for 15 min in protein sample buffer containing 50 mM DTT and 5% b-mercaptoethanol to reverse cross-linking. Analysis of bound BTG2 and Pin1 was performed by Western blotting using rabbit polyclonal antibodies sc-33775 and sc-15340, respectively.

T-oligo treatment
The T-oligo (GTTAGGGTTAG) or its compliment (C-oligo; CTAACCCTAAC) were added to cells at 40 lM as described previously (Li et al., 2003). Medium was changed after 1 week of treatment. Efcient T-oligo-induced senescence in broblasts depended on three variables: low cell density, timing of T-oligo treatment and the use of newborn calf serum. Cells were harvested 2 weeks after T-oligo treatment, and the C-oligo or vehicle (H2O) controls were harvested at a similar cell density of growth-arrested T-oligo-treated cells. In order to facilitate BTG2 detection, the cells were serum starved for 48 h and stimulated with serum for 24 h before harvesting.

Semiquantitative RTPCR
Total RNA was isolated using the TRIzol reagent (Gibco-BRL, Burlington, ON, Canada) according to the manufacturers instructions. Reverse transcriptionPCR (RTPCR) was performed on 1 lg of total RNA. The optimal annealing temperature for each primer set was determined empirically, and varying cycles of PCR were performed to determine the linear range of amplication. PCR was performed using the following primer sequences, annealing temperature and cycle number. p21: ctggagactctcagggtcgaaa and gattagggcttcctcttgagaa, 55C, 29 cycles; BTG2: gcgagcagaggcttaaggtc and aggccacttccaagcagctc, 55C, 34 cycles; Reprimo: gcaatctgctcatcaagtccgag and ccccgcattccaagtaagtagc, 55C, 43 cycles; 14-3-3r: gtgtgtccccagagccatgg and accttctcccggtactcacg, 55C, 47 cycles; Tob1: cacaggatcttagtgtttggatcga and ttcttcattttggtagagccgaact, 60C, 40 cycles; Gadd45a: gctctctccctgggcgacctg and ccatgtagcgactttcccggc, 55C, 34 cycles; and GAPDH: cggagtcaacggatttggtcgtat and agccttctccatggtggtgaagac, 55 or 60C, 22 cycles. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal loading control. To ensure linear GAPDH amplication, its primers were added for the nal 22 cycles of each reaction. The amplied products were resolved by agarose gel (2%) electrophoresis, stained with ethidium bromide, and band intensity was determined using UV illumination and IMAGEQUANT (GE Healthcare, Baie durfe, QC, Canada) software using GAPDH as an internal control.

Immunouorescence microscopy
Cells on glass coverslips were xed with 2% paraformaldehyde in PBS for 10 min and permeabilized with 0.5% Triton X for 15 min. Antibodies were diluted in 1% BSA TBS. BTG2 staining utilized anti-BTG2 (sc-30342; 1:50) for 1 h, followed by mouse anti-goat (Sigma; 1:200) for 1 hr and goat anti-mouse FITC-conjugated antibody (Sigma). Pin1 staining utilized anti-Pin1 (sc-15340; 1:200) for 1 hr, followed by anti-rabbit Cy-3 (Jackson IR; 1:800) for 30 min. Coverslips were washed 3 times with TBS with 0.5% Tween 20 between antibody incubations. The nuclei were stained with Draq5 (Enzolife Sciences International, Inc., Plymouth Meeting, PA, USA) according to the manufacturers instructions. Images were obtained using an Olympus FluoView 300 confocal laser-scanning microscope (Carsen Group, Markhan, ON, Canada), and a single 0.35 -lm optical section at 400 magnication of each sample is shown. Images were analyzed and superimposed using IMAGEJ (NIH, Bethesda, MD, USA) software.

Northern blot analysis

Fifteen micrograms of RNA was resolved on a denaturing agarose gel and transferred to a nylon membrane. Hybridization of

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al. 759

Acknowledgments
Rosalyn Fleites Garcia for technical assistance. This research is funded by the Canadian Cancer Society and the Canadian Institutes of Health Research. SB is supported by a Canada Research Chair.

Author contributions
KW & SB designed the experiments and wrote the manuscript. KW, WM & JM conducted the experiments.

References
Atadja P, Wong H, Garkavtsev I, Veillette C, Riabowol K (1995) Increased activity of p53 in senescing broblasts. Proc. Natl Acad. Sci. USA 92, 83488352. Boiko AD, Porteous S, Razorenova OV, Krivokrysenko VI, Williams BR, Gudkov AV (2006) A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation. Genes Dev. 20, 236 252. Brown JP, Wei W, Sedivy JM (1997) Bypass of senescence after disruption of p21CIP1 WAF1 gene in normal diploid human broblasts. Science 277, 831834. Brummelkamp TR, Bernards R, Agami R (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550553. Collado M, Blasco MA, Serrano M (2007) Cellular senescence in cancer and aging. Cell 130, 223233. el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, Vogelstein B (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817825. Dimri GP (2005) What has senescence got to do with cancer? Cancer Cell 7, 505512. Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O, Peacocke M, Campisi J (1995) A biomarker that identies senescent human cells in culture and in aging skin in vivo. Proc. Natl Acad. Sci. USA 92, 93639367. Dulic V, Drullinger LF, Lees E, Reed SI, Stein GH (1993) Altered regulation of G1 cyclins in senescent human diploid broblasts: accumulation of inactive cyclin E-Cdk2 and cyclin D1-Cdk2 complexes. Proc. Natl Acad. Sci. USA 90, 1103411038. Dulic V, Beney GE, Frebourg G, Drullinger LF, Stein GH (2000) Uncoupling between phenotypic senescence and cell cycle arrest in aging p21-decient broblasts. Mol. Cell. Biol. 20, 67416754. Fujimori F, Takahashi K, Uchida C, Uchida T (1999) Mice lacking Pin1 develop normally, but are defective in entering cell cycle from G(0) arrest. Biochem. Biophys. Res. Commun. 265, 658663. Guardavaccaro D, Corrente G, Covone F, Micheli L, DAgnano I, Starace G, Caruso M, Tirone F (2000) Arrest of G(1)-S progression by the p53-inducible gene PC3 is Rb dependent and relies on the inhibition of cyclin D1 transcription. Mol. Cell. Biol. 20, 17971815. Hara E, Tsurui H, Shinozaki A, Nakada S, Oda K (1991) Cooperative effect of antisense-Rb and antisense-p53 oligomers on the extension of life span in human diploid broblasts, TIG-1. Biochem. Biophys. Res. Commun. 179, 528534. Harley CB, Futcher AB, Greider CW (1990) Telomeres shorten during ageing of human broblasts. Nature 345, 458460.

Hayick L (1965) The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 37, 614636. Herbig U, Jobling WA, Chen BP, Chen DJ, Sedivy JM (2004) Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol. Cell 14, 501513. Hong JW, Ryu MS, Lim IK (2005) Phosphorylation of serine 147 of tis21 BTG2 pc3 by p-Erk1 2 induces Pin-1 binding in cytoplasm and cell death. J. Biol. Chem. 280, 2125621263. Itahana K, Dimri GP, Hara E, Itahana Y, Zou Y, Desprez PY, Campisi J (2002) A role for p53 in maintaining and establishing the quiescence growth arrest in human cells. J. Biol. Chem. 277, 18206 18214. Jackson JG, Pereira-Smith OM (2006) p53 is preferentially recruited to the promoters of growth arrest genes p21 and GADD45 during replicative senescence of normal human broblasts. Cancer Res. 66, 83568360. Karlseder J, Smogorzewska A, de Lange T (2002) Senescence induced by altered telomere state, not telomere loss. Science 295, 2446 2449. Kawakubo H, Brachtel E, Hayashida T, Yeo G, Kish J, Muzikansky A, Walden PD, Maheswaran S (2006) Loss of B-cell translocation gene2 in estrogen receptor-positive breast carcinoma is associated with tumor grade and overexpression of cyclin d1 protein. Cancer Res. 66, 70757082. Kortlever RM, Higgins PJ, Bernards R (2006) Plasminogen activator inhibitor-1 is a critical downstream target of p53 in the induction of replicative senescence. Nat. Cell Biol. 8, 877884. Lee TH, Tun-Kyi A, Shi R, Lim J, Soohoo C, Finn G, Balastik M, Pastorino L, Wulf G, Zhou XZ, Lu KP (2009) Essential role of Pin1 in the regulation of TRF1 stability and telomere maintenance. Nat. Cell Biol. 11, 97105. Li GZ, Eller MS, Firoozabadi R, Gilchrest BA (2003) Evidence that exposure of the telomere 3 overhang sequence induces senescence. Proc. Natl Acad. Sci. USA 100, 527531. Lim IK (2006) TIS21 ( BTG2 PC3) as a link between ageing and cancer: cell cycle regulator and endogenous cell death molecule. J. Cancer Res. Clin. Oncol. 132, 417426. Lim IK, Lee MS, Ryu MS, Park TJ, Fujiki H, Eguchi H, Paik WK (1998) Induction of growth inhibition of 293 cells by downregulation of the cyclin E and cyclin-dependent kinase 4 proteins due to overexpression of TIS21. Mol. Carcinog. 23, 2535. Lucibello FC, Sewing A, Brusselbach S, Burger C, Muller R (1993) Deregulation of cyclins D1 and E and suppression of cdk2 and cdk4 in senescent human broblasts. J. Cell Sci. 105(Pt 1), 123133. Ma Y, Prigent SA, Born TL, Monell CR, Feramisco JR, Bertolaet BL (1999) Microinjection of anti-p21 antibodies induces senescent Hs68 human broblasts to synthesize DNA but not to divide. Cancer Res. 59, 53415348. Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB, Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA, Stewart SA, Hahn WC (2003) Telomerase maintains telomere structure in normal human cells. Cell 114, 241253. Meerson A, Milyavsky M, Rotter V (2004) p53 mediates densitydependent growth arrest. FEBS Lett. 559, 152158. Noda A, Ning Y, Venable SF, Pereira-Smith OM, Smith JR (1994) Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp. Cell Res. 211, 9098. Rouault JP, Falette N, Guehenneux F, Guillot C, Rimokh R, Wang Q, Berthet C, Moyret-Lalle C, Savatier P, Pain B, Shaw P, Berger R, Samarut J, Magaud JP, Ozturk M, Samarut C, Puisieux A (1996) Identication of BTG2, an antiproliferative p53-dependent compo-

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland

760 BTG2 neutralizes Pin1 during replicative senescence, K. Wheaton et al.

nent of the DNA damage cellular response pathway. Nat. Genet. 14, 482486. Rozan LM, El-Deiry WS (2007) p53 downstream target genes and tumor suppression: a classical view in evolution. Cell Death Differ. 14, 39. Sang L, Coller HA, Roberts JM (2008) Control of the reversibility of cellular quiescence by the transcriptional repressor HES1. Science 321, 10951100. Sasajima H, Nakagawa K, Yokosawa H (2002) Antiproliferative proteins of the BTG Tob family are degraded by the ubiquitin-proteasome system. Eur. J. Biochem. 269, 35963604. Satyanarayana A, Greenberg RA, Schaetzlein S, Buer J, Masutomi K, Hahn WC, Zimmermann S, Martens U, Manns MP, Rudolph KL (2004) Mitogen stimulation cooperates with telomere shortening to activate DNA damage responses and senescence signaling. Mol. Cell. Biol. 24, 54595474. Shay JW, Pereira-Smith OM, Wright WE (1991) A role for both RB and p53 in the regulation of human cellular senescence. Exp. Cell Res. 196, 3339. Stein GH, Drullinger LF, Soulard A, Dulic V (1999) Differential roles for cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms of senescence and differentiation in human broblasts. Mol. Cell. Biol. 19, 21092117. Stewart SA, Weinberg RA (2006) Telomeres: cancer to human aging. Annu. Rev. Cell Dev. Biol. 22, 531557. Vaziri H, West MD, Allsopp RC, Davison TS, Wu YS, Arrowsmith CH, Poirier GG, Benchimol S (1997) ATM-dependent telomere loss in aging human diploid broblasts and DNA damage lead to the posttranslational activation of p53 protein involving poly(ADP-ribose) polymerase. EMBO J. 16, 60186033. Verdun RE, Karlseder J (2007) Replication and protection of telomeres. Nature 447, 924931. Vousden KH (2006) Outcomes of p53 activationspoilt for choice. J. Cell Sci. 119, 50155020. Vousden KH, Lane DP (2007) p53 in health and disease. Nat. Rev. Mol. Cell Biol. 8, 275283. Wheaton K, Riabowol K (2004) Protein kinase C delta blocks immediate-early gene expression in senescent cells by inactivating serum response factor. Mol. Cell. Biol. 24, 72987311.

Wheaton K, Atadja P, Riabowol K (1996) Regulation of transcription factor activity during cellular aging. Biochem. Cell Biol. 74, 523 534. Wyllie F, Haughton M, Bartek J, Rowson J, Wynford-Thomas D (2003) Mutant p53 can delay growth arrest and loss of CDK2 activity in senescing human broblasts without reducing p21(WAF1) expression. Exp. Cell Res. 285, 236242. Yeh ES, Means AR (2007) PIN1, the cell cycle and cancer. Nat. Rev. Cancer 7, 381388. You H, Zheng H, Murray SA, Yu Q, Uchida T, Fan D, Xiao ZX (2002) IGF-1 induces Pin1 expression in promoting cell cycle S-phase entry. J. Cell. Biochem. 84, 211216. Zacchi P, Gostissa M, Uchida T, Salvagno C, Avolio F, Volinia S, Ronai Z, Blandino G, Schneider C, Del Sal G (2002) The prolyl isomerase Pin1 reveals a mechanism to control p53 functions after genotoxic insults. Nature 419, 853857. Zheng H, You H, Zhou XZ, Murray SA, Uchida T, Wulf G, Gu L, Tang X, Lu KP, Xiao ZX (2002) The prolyl isomerase Pin1 is a regulator of p53 in genotoxic response. Nature 419, 849853.

Supporting Information
Additional supporting information may be found in the online version of this article: Fig. S1 Characterization of Hs68 cells expressing p53 shRNA, related to Fig. 2 (tif le). Fig. S2 The cellular redistribution of Pin1 and its colocalization with BTG2 in the cytoplasm of BJ cells induced to undergo senescence using T-oligo, related to Fig. 5 (tif le). As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be reorganized for online delivery but are not copyedited or typeset. Technical support issues arising from supporting information (other than missing les) should be addressed to the authors.

2010 The Authors Aging Cell 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland