September 30

September-28-11 12:49 PM

Nucleotides are only added to the 3' OH end Synthesis is 5' to 3' direction DNA polymerase reads template in the 3' to 5' direction

Reading 5' to 3; Reading 3' to 5'

Screen clipping taken: 30/09/2011 9:55 AM

Polymerase forms them in fragments, that are linked together later by DNA Ligase

Can synthesize a primer RNA 5' to 3' onto the template

Needs a 3' nucleotide to start working

Screen clipping taken: 30/09/2011 9:57 AM

Synthesis at replication forks 2 template strands DNA Antiparallel One strand 5' to 3' One strand 3' to 5' Therefore synthesis occurs in 2 ways i. Continuous synthesis 5' to 3' Leading strand Template is read 3' to 5' ii. Discontinuous synthesis 3' to 5' Lagging strand (because it has to wait until enough template strand is exposed for polymerase to sit down and start synthesis ing)
Biology Page 1

 Lagging strand (because it has to wait until enough template strand is exposed for polymerase to sit down and start synthesis ing) Synthesized as a series of short fragments (Okazaki) Template is read 3' to 5' Fragments linked by DNA ligase

Starting DNA synthesis DNA polymerase III can only add nucleotide to an existing strand of DNA/RNA Requires a free 3' OH group Initial nucleotide strand is a short primer Short stretch of RNA Primase (RNA polymerase) synthesizes primer Leading strand one primer Lagging strand many primers Primer is replaced with deoxyribonucleotudes DNA polymerase I

Biology Page 2

Screen clipping taken: 30/09/2011 10:15 AM

DNA replication is highly accurate: One mistake can create diseases like sickle cell anemia or new proteins DNA Polymerase proofreads each nucleotide added i. Incorrect pairing (using it's geometry / active sites, it can detect it) Removes necleotide Resumes synthesis ii. Mismatch repair Proofreading mistakes or error after synthesis (after synthesis e.g sun, radiation) Causes: Chemicals Radioactivity Most cases, can correct it, sometimes, it can't, and it passed on to generations of cells which can mean cancer Nucleotide excision Segment of DNA is cutout ( by nuclease) Gap filled with DNA polymerase and ligase

Screen clipping taken: 30/09/2011 10:23 AM

Biology Page 3

Screen clipping taken: 30/09/2011 10:23 AM

This means that with each replication, we lose genes and eventually It dies. Cancer cells don't loose'em cause they have really active Telomerase.

Screen clipping taken: 30/09/2011 10:34 AM

Replicating the ends of DNA: DNA polymerase only add nucleotides to the 3' end of a preexisting polynucleotide Removal of RNA primer leaves 5' PO 4 group No way to fill in 5' end Each replication results in shorter DNA Possible deletion of genes Limiting factor in life span of cell Eukaryotic DNA is flanked by telomers TELOMERS DON'T CODE FOR ANYTHING, THEIR LIKE A BUFFER, BEING PULLED OFF BEFORE THE PROTEIN-GENE DOES It protects the gene from premature deletion Repeats of short noncoding nucleotide sequences TTAGGG AATCCC Protects genes from being deleted Postpones deletion Added in germ cells by telomerase Comprised of RNA and protein ]Prokaryotes dont have this problem because they are circular

Gene for protein Telomer1 - Telomer2 - Telomer3 - AGCTCGA

Has to kill all these telo's, before getting to gene = Long ass time before gene deletes

Biology Page 4

October 4 & 11 & 12

October-04-11 9:47 AM

GENES TO PROTEINS This is talking about transcription and translation DNA -> RNA -> Protein Two processes 1. Transcription DNA -> RNA DNA -> mRNA 2. Translation mRNA -> to Protein Mechanism is similar in prokaryotes and eukaryotes Differences Prokaryotes no nucleus Transcription and translation coupled (don't have a nucleus to divide steps) Eukaryotes Transcription in nucleus, transaltion in cytoplasm Primary transcript modified in eukaryotes Transcription Synthesis of RNA using DNA as a template RNA Polymerase transcribes this DNA to RNA Enzyme RNA Polymerase Prokaryotes 1 type Eukaryotes 3 types Type II involved in mRNA synthesis Steps 1. Initiation RNA polymerase and transcription factors binds to promoter Promoter = region of DNA Includes: a. Start point b. TATA box TATAAAA ATATTTT ATATTTT STRAND IS THE TEMPLATE STRAND RNA polymerase unwinds DNA Only unwinds 10 - 20 bases

Decides a. Where to start b. Which strand to use as template

5' - AGCTTATAAACGCTAGCCCT - 3' TATAAA Box 3' - TCGAATATTTGCGATCGGGA - 5' TEMPLATE STRAND

5' - ACGTACGGTTAACGGTTTATA - 3' TEMPLATE STRAND 3' - TGCATGCCAATTGCCAAATAT - 5' Right to Left TATAAA Box

You can take the strand that isn't the template strand, and replace all the T's with U's and you'll get what your mRNA will look like, since it'll be a complimentary RNA to the template DNA strand

Screen clipping taken: 04/10/2011 10:11 AM

2. Elongation Ribonucleotides added to 3' end Synthesis 5' to 3' Read 3' to 5' 3. Termination

Screen clipping taken: 04/10/2011 10:16 AM

3. Termination RNA polymerase reaches a termination sequence Prokaryotic: RNA and DNA released immediatley mRNA IS READY FOR TRANSLATION Eukaryotic

Biology Page 5

Prokaryotic: RNA and DNA released immediatley mRNA IS READY FOR TRANSLATION
Eukaryotic Continues for 10 to 35 bases RNA and DNA are released Pre-mRNA must be processed

MODIFICATION OF PRE-mRNA (ONLY FOR EUKARYOTES) Eukaryotic cells Before mRNA leaves nucleus 3 types: a. 5' cap Modified guanine nucleotide is added to the 5' end of the RNA b. Poly A tail 50 to 200 adenines are added to the 3' end of the mRNA Functioning of 5' cap and poly A tail Facilitates transport out of the nucleus Protects against degradation Attachment to ribosomes c. RNA Splicing Removal of nucleotides from pre-mRNA Coding=exons Translated Not coding = introns Not translated Introns removed before exit from the nucleus Splicing removes introns and links exons Accomplished by spliceosomes RNA acts as an enzyme Ribozymes Functioning of introns a. Control of gene expressions b. Alternate splicing Single transcript -> more than one polypeptide c. Evolution of new proteins Exon shuffling Intron involved in cross-over events Final mRNA structure 5' CAP - untranslated region (5' UTR) - coding sequence - (3' UTR) - poly (A) Tail

Screen clipping taken: 11/10/2011 10:07 AM

5' Untranslated region (i.e 5' + AUG)

Screen clipping taken: 11/10/2011 10:19 AM

TRANSLATION Synthesis of a polypeptide directed by mRNA

Nucleotide -> Amino Acids 3' - TACACCAAACCGGCAAAA-5' DNA

5' - AUGUGGUUUGGCCGUUUU - 5' RNA H2N - Met-Trp-Phe-Gly-Arg-Phe-COOH Genetic code: Nucleotide triplets specify amino acids Codons Codon -> amino acid

AUG 1. Start Establishes reading frame 2. Code for methionine

3 codons code for termination Several codons for most amino acids Genetic code is redundant

Screen clipping taken: 11/10/2011 10:35 AM

TYPES OF RNA 1. Ribosomal RNA (rRNA) Associated with protein to form ribosome

i. Ribosome Comprised of two subunits

Contains mRNA binding site Three sites for tRNA binding a) P-Site Peptidyl-Trna tRNA containing growing

Biology Page 6

Contains mRNA binding site Three sites for tRNA binding a) P-Site Peptidyl-Trna tRNA containing growing polypeptide b) A-Site Aminocyl t-RNA tRNA carrying next amino acid c) E-Site Exit Empty Trna ii. Transfer RNA (Trna) Brings amino acids to ribosomes Anubi acud us attached to the 3' end Contains anti-codon (3 bases) opposite to 3' end Complimentary to the codon on mRNA

Screen clipping taken: 14/10/2011 9:58 AM

Attachment of amino acid: Catalyzed by aminoacyl-tRNA synthetase Each amino acid has a specific aminoacyl-tRNA synthetase Process is endergonic 45 distinct tRNAs: However 64 codons for translation Therefore some tRNAs recognize 2 or 3 codons for the same amino acid Base pairing rules are relaxed WOBBLE concept 3rd base of anticodon can base pair with more than one kind of base. Gly GGA CCC CCU( Anticodon) -> GGG( Anticodon) GGG<-Wobble CCU<-Wobble

U can base pair with A or G G can base pair with U or C ****************************************** ****************************************** EACH OF THESE GENE TO PROTEIN STEPS HAVE A: INITIATION ELONGATION Screen clipping taken: 11/10/2011 10:55 AM TERMINATION Phase ****************************************** ****************************************** Carboxylic Acid End
Screen clipping taken: 14/10/2011 10:03 AM

iii. Messenger RNA Template for protein synthesis Translation All steps require protein factors Aid mRNA, tRNA, and Ribosomes We don't talk much about this Requires energy GTP 1. Initiation Requires initiation factors a) Binding of small ribosomes to mRNA b) Binding of initiator Trna Base pairs with the start codon (AUG) on the mRNA Anti-Codon (UAC) Attached to methionine c) Attachment of larger ribosomal subunit Requires GTP Initiator tRNA

Amino End

Screen clipping taken: 14/10/2011 10:20 AM

2. Elongation Requires elongation factors Three-step process: a) Codon recognition A-Site mRNA codon form H-bonds with anti-codon of incoming tRNA Requires GTP b) Peptide bond formation Peptide bond is formed Amino terminus of new amino acid and the carboxyl end of the growing polypeptide Growing polypeptide transferred from tRNA in PSITE to tRNA in A-SITE c) Translocation Growing polypeptide in A-SITE is moved to P-site Next codon in a-site Empty Trna P site -> to E site Exits ribosome Requires GTP

Amino End

Carboxylic end

mRNA is read 5' to 3' 3. Termination Termination codon reaches A-site

Screen clipping taken: 14/10/2011 10:27 AM

Movement of the second tRNA (which is attached to mRNA) moves the mRNA to the left. Empty tRNA has to move to exit site to allow movement. All this movement needs energy

Biology Page 7

 Termination codon reaches A-site Release factor binds to the codon Hydrolysis of bond between tRNA and the polypeptide chain Polypeptide released Ribosome dissociates

movement needs energy

Screen clipping taken: 14/10/2011 10:42 AM

Polyribosomes Prokaryotes and eukaryotes 1 mRNA makes many copies of a polypeptide simultaneously Several ribosomes can translate the same Mrna AT ONCE Once a ribosome passes the AUG codon a second ribosomes can assemble

Screen clipping taken: 14/10/2011 10:50 AM

Signal Peptides

2 Types of Ribosomes: Free Bound to the edoplasmic reticulum Synthesis of all proteins on free ribosomes Secreted or membrane proteins are sunthesized via RER Signal peptide: - Found at the N-terminus of growing polypeptide - About 20 hydrophobic amino acids Binding of ribosomes of ER: i. Recognition of signal peptide Signal recognition particle (SRP) Comprised of protein and RNA II. SRP-Ribosomes bind to receptor, protein complex which is built into the ER membrane III. Protein synthesis continues
After synthesis a. Secreted proteins remain in ER lumen b. Membrane protein embedded in ER membrane If a protein does not contain a signal peptide the ribosomes stay free in the cytoplasm

RMBR: Free Ribosomes: Make proteins found in cell, initiates ALL proteins, secreted, integral or otherwise Bound Ribosomes: Makes proteins secreted or integral

INTRACELLULAR taken: 18/10/2011 9:49 CONTAIN SIGNAL PEPTIDES Screen clipping PROTEINS DO NOT AM

Protein Synthesis Prokaryotic versus Eukaryotic

- Processes of transcription and translation are similar Differences: 1. Eukaryotic RNA polymerase requires transcription factors 2. Prokaryotic cells, transcription and translation coupled 3. Eukaryotic mRNA hast to be process

Mutations Change in the genetic material of a cell Point Mutations - Change in one base pair in a single gene - (Change ONE nucleotide i.e GTT to GTA) - Sickle Cell Enemia is an example 2 TYPES: a. Base pair substitutions Replacement of one nucleotide with another b. Base pair insertions and or deletions

A. Base Pair substitutions 3 Types: 1. Silent mutations No change in amino acid sequence Due to redundancy of genetic code
Mutation

CCG -> CCA GGC -> GGU Gly Gly

DNA RNA Amino Acid

2. Missence a. New amino acid similar chemical properties CTA -> CTT DNA GAU -> GAA RNA Aspartic Guatamic Acid Acid Both negative charges/hydrophilic

b. New amino acid different chemical properties TAA -> TCA DNA AUU -> AGU RNA Isoleucine Serine
One is charged, the other isn't Isoleucine = Hydrophobic

Biology Page 8

TAA -> AUU -> Isoleucine

TCA AGU Serine

DNA RNA

One is charged, the other isn't Isoleucine = Hydrophobic Serine = Hydrophilic Can lead to major problems Depends on location

Screen clipping taken: 18/10/2011 10:31 AM

3. Nonsense New codon codes for a stop codon Translation is prematurely terminated Truncated Protein DNA: TACTTCAAACCGATT mRNA:AUGAAGUUUGGCUAA

Aminos : Met Lys Phe Gly DNA: TACATCAAACCGATT mRNA:AUGUAGUUUGGCUAA

Aminos: Met

B. Base Pair Insertion or Deletion Addition or loss of nucleotide in a gene Frame shift mutation Alter the reading frame of the Mrna Insertion or deletion is not a multiple of 3 All nucleotides downstream are missed grouped Mutagenesis Any insertion - Creation of mutations that's not a multiple of 1. Spontaneous three Errors during replication or repair nucleotide ends DNA recombination up with large effect 2. Mutagens Physical or chemical agents that interact with DNA

Screen clipping taken: 18/10/2011 10:37 AM

Control of Gene expression OPERON Control of gene expression in bacteria Jacob and Monod Structural openon Comprised of 2 elements Promoter RNA Binding Operator Site Repressor Protein can bind Turning it ALL off Only in procaryotes No Operons in eucaryotes

1. Promoter Contains on/off switch 2. Genes that will be control Genes for all the enzymes in a pathway Clustered together give rise to long mRNA species mRNA produced contains start/stop codons for each polypeptide Function a. Operon on: RNA polymerase binds to promoter Transcription occurs Produces one long mRNA Translation Production of all polypeptides in pathway b. Operon off: Repressor protein binds to operator Transcription is inhibited Advantage: all the enzymes in a pathway are turned on or of at once. Repressor protein Product of a regulatory gene Located upstream of operon Gene is always being transcribed Binding of repressor to promoter is reversible Contains allosteric site Active vonformation binds to operator Inactive conformation can not bind to operator Activity is dependent on metabolism in the cell

Screen clipping taken: 18/10/2011 10:47 AM

Promoter Grepressor G1 G2 G3 G4

Transcription

RNA Polymerase Binds to this part

Operator Repressor protein binds to it

Translation

1. trp operon: Produces all the enzyme involved in the production of tryptophan (amino acid) Repressible Repressor protein syntehsized inactive OPERON IS ON Repressor protein synthesized active OPERON IS OFF Low [tryptophan] Repressor protein is inacive Does not bind to operator Operon is turn on (transcription can occur) mRNA is produced All enzymes involved in the synthesis of tryptophan are produced We are no able to create tryptophan High [tryptophan] Tryptophan binds to repressor protein Allosteric site Causes conformation change in repressor Repressor active Repressor binds to operator Operon is turn off Transcription is inhibited None of the enzymes involved in the

Screen clipping taken: 21/10/2011 9:59 AM

Since the Repressor is inactive (can't bind to Operator) then polymerase is Going to move on and produce the gene. Converse is true.

Biology Page 9

Causes conformation change in repressor Repressor active Repressor binds to operator Operon is turn off Transcription is inhibited None of the enzymes involved in the synthesis of tryptophan are produced Repressor binds to operator Operon is turned off Transcription is inhibited None of the enzymes involved in the synthesis of tryptophan are produced

Screen clipping taken: 21/10/2011 10:09 AM

2. Lac operon Produces enzymes involved in lactose metabolism

Lactose -> glucose + galactose Enzyme: - galactose

Glucose -> ATP Inducible Repressor protein synthesized active Binds to operator Operon is off Transcription is inhibited No production of - galactosidase Absence of lactose: Repressor protein active BINDS TO OPERATOR Operon is turned off No production of - galactosidase

Permeates Breaks down membrane lactose into Glucose +Galactose

Evolutionary Remnant

Screen clipping taken: 21/10/2011 10:23 AM

Presence of lactose: Lactose binds to repressor protein Changes conformation Inactive Fallsoff operator Operon is on Transcription can occur Production of -glactosidase Repressible and inducible operons are example of negative control Active repressor inhibits transcription Positive gene regulation Stimulation Enhance transcription

Other than the fact that Lac produces active repressors this green spot is the only difference between lac and tryp inhibition

Screen clipping taken: 21/10/2011 10:23 AM

Negative control = Active repressor, inhibits transcription

Lac operon Presence of lactose Operon is on Rate of transcription dependent on [glucose] Promoter Comprised of: i. Region catabolite activator protein (CAP can bind to (not found in tryp) ii. Region RNA polymerase can bind to iii. Operator, repressor protein can bind to CAP Allosteric Inactive Does not bind to promoter Active Cyclic AMP (cAMP) binds to CAP Then CAP binds to promoter Stimulates transcription Presence of lactose Repressor protein is inactive RNA polumerase can bind to promoter Rate of transcription dependant on [glucose]

Proteins can bind to DNA, AMP and Enzymes they can bind to ALL KINDSA SHTUFF

i. High glucose -> low cAMP -> CAP inactive, cannot bind to promoter Rate of transcription is slow
ii. Low glucose -> high cAMP -> CAP active, binds to promoter Rate of transcription is enhanced
Screen clipping taken: 21/10/2011 10:39 AM

Screen clipping taken: 28/10/2011 10:16 AM

CONTROL OF GENE EXPRESSION EUKARYOTIC CELLS

All cells have the same genome but express different proteins Cells express only a small fraction of their genes

Missing Bi...
You forgot your computer one day, and had to write up your notes. Here are the scans of those notes

Biology Page 10

Missing Bi...
You forgot your computer one day, and had to write up your notes. Here are the scans of those notes

a. RNA processing Alternative splicing One pre-mRNA -> many mRNA species Cell specific regulators direct splicing b. Regulation of mRNA degradation (cytoplasm) Prokaryotic mRNA is degraded rapidly Minutes Eukaryotic mRNA exists for several hours or weeks Longer half life results in the production of more protein Hemoglobin mRNA in red blood cells 3' untranslated important in mRNA stability IV. Translational Control Repressor protein Binds to 5'-leader region of the mRNA Prevents ribosomal attachment EXAMPLE: Early embryonic development Before fertilization Ovum stores mRNA Repressor prevents translation Translation occurs V. Post-translational a. Protein processing Last level of control Modification are required before protein is functional

2-types of modification i. Chain length modification Amino acids are removed Single polypeptide can be cleaved into two pieces Insulin (Proinsulin divided into 2 insulin) ii. Chemical modification Addition of: Sugars, membrane proteins These get attached in the Golgi apparatus Phosphate groups (reversible) Activate or inactivate regulatory proteins b. Protein Degradation Cell limits the lifetime of proteins Cells attach ubiquitin to protein Marks it for degradation Proteasome recognize the ubiquitinprotein complex Protein is degrade
Viral Life Cycle Virus: Genome enclosed within a protective coat Genome can be different based on virus Single or double stranded DNA or RNA LINEAR or CIRCULAR Protective coat i. Capsid Rod-shaped or polyhedral Comprised of protein subunits Capsomeres ii. Envelope Found in some viruses Membrane that covers capsid Derived from the host membrane Comprised of proteins and glycoproteins Reproduction: Viruses can reproduce only within a host cell Obligate intracellular parasites Lack enzymes for metabolism No ATP Get it from host Lack ribosomes No Protein Get it from host Viruses are VERY host specific AIDS virus attacks White blood cells Influenza virus -> respitory tract

Screen clipping taken: 21/10/2011 10:57 AM

Screen clipping taken: 28/10/2011 10:41 AM

Screen clipping taken: 28/10/2011 10:39 AM

Steps of infection i. Virus recognizes cell Protein - protein interaction Capsid - cell surface proteins ii. Genome enters cell iii. Cell machinery Copies viral DNA and produces viral protiens Uses host's Enzymes Ribosomes tRNA Amino acids ATP iv. Self assembly Formation of viral particles Genome + capsid v. New viruses destroy host cell and are released

Biology Page 11

v. New viruses destroy host cell and are released

Screen clipping taken: 28/10/2011 10:51 AM

Screen clipping taken: 28/10/2011 10:49 AM

01/11/2011 9:46 AM

Life Cycles of Phages I. Lytic Cycle Results in the lysis of the host cell Example: T4 bacterium - Virulent phage Steps: 1. Phage attaches to cell surface 2. Phage injects DNA into cell - E.coli transcribes and translates viral genome - First proteins produced destroy host's DNA 3. Phage components produced by host cell - Makes many copies of the phage genome - Makes many copies of capsid - Phage components spontaneously assemble 4. Host cell lysis and releases new phage particles - Lysozyme produced from viral genome digest the host's cell wall - Osmotic swelling lysis the cell

Screen clipping taken: 01/11/2011 9:51 AM

II. Lysogenic cycle - Replication of viral genome without destroying host Example: lambda phage - Both lytic and lysogenic Called temperate phage because it contains both lytic and lysogenic Steps: 1. Phage attaches to cell surface and injects DNA into cell 2. Phage DNA circularizes - Can enter either the lytic or lysogenic cycle Lysogenic 3. DNA integrates into the bacterial chromosome - Prophage Genetic recombination - One prophage gene is expressed Codes for a repressor protein Inactivates other prophage genes 4. Prophage genes are replicated with host DNA 5. Prophage exits the bacterial chromosome - Radiation r chemical trigger - Lytic cycle initiated

Bacterial defenses: - Restriction endonucleases which degrade foreign DNA -

Screen clipping taken: 01/11/2011 10:04 AM

Retrovirus: - RNA serves as a template for DNA synthesis - Contains 2 copies - Enzyme involves is revers transcriptase - Virus contains 2 copies

Injection

Viral RNA + viral reverse transcripatase produces DNA

Reverse transcriptase produces double stranded DNA

Inserted into host chromosome Provirus Never leaves host cell

Screen clipping taken: 01/11/2011 10:22 AM

Biology Page 12

Screen clipping taken: 01/11/2011 10:22 AM

Produces viral RNA and viral proteins

New virus

Example: Human immunodeficiency virus (HIV), which becomes, Acquired immunodeficiency syndrome (AIDS)

-----> NEXT MIDTERM UP TO HERE <----Bacteria, which reproduce via binary fission, are exact copies of each other, which is bad for evolution.

Bacterial Genetics Bacterial chromosome - One double stranded, circular molecule of FNA - Found in nucleoid - Nonchromosomal DNA - Plasmid Small circular double stranded DNA molecule Not required for survival Contains few genes Important during changes in environment Some can reversibly incorporate into bacterial chromosome Episome Replication i. Same time as bacterial chromosome (Stringent) Or ii. Independently of bacterial chromosome (Relaxed) Cell Division - Binary fission - Daughter cells are clones - Bad for evolution (can't evolve, despite evolutionary pressures) - Single origin of replication Genetic recombination - Combining of DNA from two different sources - Produces new bacterial strains Three Methods: a. Transformation - Bacterial cells takes up naked foreign DNA - The foreign DNA is then incorporated into the Bacterial chromosome Recombination b. Transduction - Genes are transferred from one bacterium to another - Transporter = bacteriophage - Occurs during lytic cycle of a virus - Pieces of host DNA are packaged into bacteriophage - Phage infects a new host - Recombination occurs Homologous regions exchanged - Genes are transferred randomly c. Conjugation - The direct transfer of genes between two bacterial cells - Presence of F factor (fertility) Piece of bacterial DNA Episomal Part of: a) Bacterial chromosome Or b) Present as a free plasmid - Contains about 25 genes Involved in the sex pili Forms bridge between bacteria F+ Cells: - Contain F factor Produce sex pili F- Cells - Lack F factor - Called receptors 04/11/2011 10:20 AM Conjugation i) Formation of bridge between F+ and F- cells ii) F plasmid replicates - One parental strand of FNA transferred to F - cell - Replication of each strand of DNA in - F- cell becomes F+ cell Transfer of chromosomal DNA: When F factor is part of bacterial chromosome - These cells called high frequency of recombination - Hfr Cells During conjugation - Hfr cell forms bridge with F- cell - F Factor and some of the bacterial chromosomal DNA is transferred - Random movement of the bacteria disrupts the connection between bacteria - Only some of the Hfr DNA is transferred - Recombination occurs - Formation of new bacterial chromosome

Binary Fission

Fig 27.11

A.K.A Sex Pilli Fig. 27.13

Screen clipping taken: 04/11/2011 9:58 AM

Sex Pili is broken before replication Is complete

Screen clipping taken: 04/11/2011 9:57 AM

If they're similar enough/compatible, you can get An expression of the gene (A- to A+)

DNA Technology

- Method to study DNA

Biology Page 13

- Formation of new bacterial chromosome

DNA Technology

- Method to study DNA Cloning a gene - Make multiple copie - Uses: i. Produce a protein - Research - Clinical ii. Genetic Studies Tools: a) Plasmids b) Restriction Endonucleases (RE) - Hydrolyze phosphodiester bond - Cut at restriction sites - 4 to 8 bases long - Cut both strands of FNA - Can produce single stranded over hangs Sticky ends Screen clipping taken: 04/11/2011 10:16 AM - Produced by bacteria - Protect bacteria from foreign DNA - Bacterial DNA methylated therefore it is protected

Expressed gene

Palindromic

Sticky ends

Seen previously With Ogasaki

Screen clipping taken: 04/11/2011 10:28 AM

How to clone a gene

i. Isolate plasmid (vector) and DNA containing gene of interest - Plasmid from bacteria - DNA from cells or tissues ii. Insert DNA into plasmid (formation of recombinant DNA) - Digest vector and DNA with same RE DNA from cells gives many fragments Mix cut DNA and cut plasmid Sticky ends base pair Add DNA ligase Forms phosphodiester bonds between sticky end Results in the formation of recombinant and nonrecombinant plasmids iii. Transform bacterial with DNA - Some bacteria will take up DNA iv. Isolate cells which contain plasmid - Plate bacteria on plates containing antibiotic Ampicillin - Plasmid contains gene for antibiotic resistance Therefore only bacteria containing plasmid will grow v. Identify bacterial clones containing gene of interest - Nucleic acid hybridization

Fig. 20.4

Screen clipping taken: 04/11/2011 10:35 AM

Fig. 20.7

Fig.20.5 in 9th edition, Check that one out, it's Pretty cool. (And clearer)

Screen clipping taken: 04/11/2011 10:58 AM

Biology Page 14

Test Review
October-04-11 10:19 AM

42 - 45 multiple choice A-E Some questions on theory

Pigments in PSII and PSI are usually Chorlophyll - B and those in the reaction center are usually Chlorophyll - A In both CAM and C4 plants, CO2 is stored in Malate

GET INTIMATE WITH FUNCTIONAL GROUPS

Isomerase helps establish the equilibrium that limits the amount of Dehydroxyacetonephosophate and pulls it towards G3P Difference between lactic acid and ethanol fermantation Fermantation recycles the electrons that it can't get from O2 Alcohol fermentation

ADP in, ATP out Glucose -> Pyruvate NAD+ in, NADH out

CO2 in ->

NADH in, NAD+ out Acetaldehyde -> Ethanol

Glucose

ADP in, ATP out -> Pyruvate NAD+ in, NADH out

NADH in, NAD+ out -> Lacatate

Biology Page 15

November 15
November-15-11 9:56 AM

v. Identify bacterial clones containing gene of interest a. Nucleic acid hybridization Method: a) Transfer some cells to filter paper b) Open cells and denature DNA c) Produce nucleic acid probe Short piece of DNA or RNA Complementary to gene of interest d) Label probe with 32P e) ADD PROBE TO DENATURE dna Base pair with complementary sequence in gene f) Autoradiography
Sources of DNA to be used in cloning i) Genomic library Genome = total DNA in a cell Includes telomers Collection of DNA fragments of the entire genome Produced by restriction digest Each fragment is cloned into a plasmid ii) cDNA (complementary DNA) library Only coding sequences of the genome Method: - Isolate mRNA from cell - Make a complementary strand DNA Reverse transcriptase Doesn't contain introns Problems cloning in bacterium - Eukaryotic genes do not always function in prokaryotic cells i. Different regulatory elements Solution: expression vector - Vector containing bacteria control elements upstream of gene ii. Presence of introns - Bacterial cells cannot splice RNA iii. No posttranslational modification of proteins in bacteria - Addition of sugar or lipids Solution: use eukaryotic cells as host

I'm so much more badass than you, Stegasaurus

FUCK YOU T-REX, You wanna fight? Try punching me teeney hands...

Polymerase Chain Reaction (PCR)

- Quick amplification of any piece of DNA in a few hours - Highly specific - Only small amount of DNA required Method: Combine: - DNA - Contains sequence of interest - Primers - Short pieces of complementary DNA - Determines which sequence will be amplified - Nucleotides - DNA polymerase (Taq) - Derived from DNA Polymerase of a heat resistant bacteria 3 Step Cycle 1. Heat to denature (separate) DNA 2. Cool - Binding (annealing) of primer to DNA Opposite ends of DNA 3. DNA polymerase extends primers - Steps are repeated over and over Applications: 1. Amplification of ancient DNA fragments 2. Amplification of tiny amounts of DNA - Tissue or semen found at a crime scene - Analyze DNA from a single embryonic cell Prenatal diagnosis 3. DNA cloning

Screen clipping taken: 15/11/2011 10:23 AM

Restriction Fragment Analysis

- Detects differences in DNA sequences that affect restriction sites Homologous chromosome -> alleles = slightly different from one another, therefore may not have the same recognition sequences for restriction Restriction fragment length polymorphims (RFLPs): - Noncoding DNA from different individuals produce different restriction patterns - These differences are scattered throughout the genome Can be different between homologous chromosomes Different between individuals Inherited mendelian fashion

Uses: - Comparing two different DNA molecules i.e different alleles of a gene Example sickle cell anemia - Distinguish normal from sickle cell Provide a finger print - Very unlikely two indvidual would have same RFLPs
Screen clipping taken: 15/11/2011 10:40 AM

Biology Page 16

i.e different alleles of a gene Example sickle cell anemia - Distinguish normal from sickle cell Provide a finger print - Very unlikely two indvidual would have same RFLPs
Screen clipping taken: 15/11/2011 10:40 AM

Applications of DNA technology

i. Diagnosis of diseases ii. Human gene therapy - Wild type allele is inserted into dieased somatic cell - Cell overexpresses wild type allele - May overcome disease state Problems: - Genetic control - Does insertion effect other genes? - Ethical - Should we be tampering with human genes - Interfering with evolution

iii. Pharmaceutical products iv. Forensic technology v. Agricultural - Transgenic mice/cows - Genetically modified plants HOST DEFENSES - Body protect itself from unwanted intruders - Viruses, bacteria, abnormal cells - Two types of defenses I. Innate immunity - Non-specific - Doesn't distinguish one pathogen from another II. Acquired immunity - Immunity
External defenses

INATE IMMUNITY!!!!! a) External - First line 1. Skin Physical barrier Pathogens can not penetrate 2. Mucous membrane Line digestive, respiratory and genitourinary tract Physical barrier Produces mucus Traps microbes and other particles 3. Chemicals Sweat gland secrete acids Inhibit bacterial growth Saliva, tears and mucous secretions Wash away pathogens Contain lysozyme Destroys bacterial cell walls
Screen clipping taken: 18/11/2011 9:59 AM

When first line is penetrated, mast cells tell capillaries to let white cells and fluid loose

b) Internal defenses - Second line

1. Inflammatory response - Occurs when: Tissue is damaged Entry of microorganisms Damaged cells or microorganisms release chemicals Causes capillary dilation Increases permeability and blood flow to injured site Allow clotting factors to get to the site Allows migration of phagocytic cells to the site Results in swelling, redness and heat
Chemical signals - Histamine - Released by circulating basophils and mast cells (tissue basophils) - Prostaglandins - Released by white blood cells and damaged tissues - Chemokines (proteins) - Released by blood vessels and monocytes - Attract phagocytic cells 2. Phagocytosis - White blood cells ingest invading microbes Type of cells: a) Neutrophils - First at the site - Engulf and destroy microbes Self-destruct as they destroy foreign invaders Short lived b) Macrophages DON'T NESCESSARILY COME FROM BLOOD STREAM - Stronger phagocytic response - Long lived phagocytes Engluf microbes by pseudopodia Clean up damaged tissue and dying neutrophils - Develop from monocytes Circulate in the blood tissue and dying neutrophils Migrate to tissues Lymph nodes and spleen Develop into macrophage c) Dendritic cells - Present antigens to the T-helper cells Acquired immunity

- First thing to attack is platelets, then coagulation factors

Vacuoles + Molecules = Granules (In this case)

Basophiles that migrate into tissue = Mast cells

Screen clipping taken: 18/11/2011 10:15 AM

3. Antimicrobial proteins - Directly attack microbes or impede their growth a) Complement - 30 serum proteins

Biology Page 17

3. Antimicrobial proteins - Directly attack microbes or impede their growth a) Complement - 30 serum proteins - Post-translational regulation activates these proteins when near a microbe - Inactive in the absence of infection - Proteins on the surface of microbes cause activation Cascade of steps Leads to cell lysis b) Interferons - Cytokines - Defense against viral infection - Secreted by virus infected cells Doesn't help infected cell Prevents cell-cell spread Inhibits viral reproduction Nonspecific Short term resistance 4. Other Cells - Non-phagocytic a) Eosinophils - Discharge digestive enzymes against the wall of parasites b) Natural Killer cells (NK) - Destroy: Virus infected cells Cancer cells - Attach to cell membrane of infected cell Led to cell death Immune System (Acquired Immunity)

Screen clipping taken: 18/11/2011 10:28 AM

- Specific: Recognize and eliminate a single invader - Diversity: Respond to numerous types of invaders - Cells involved are lymphocytes Two Types: - Both develop from the same stem cell is bone marrow - B-Cells Mature in the bone marrow Involved in humeral immune response Produces antibodies - T-Cells Mature in the thymus

Antigen - Foreign molecule Protein or long polysaccharide Elicits a response by lymphocytes - Found on the surface, produced by or release from: Viruses Bacteria Fungi Protozoa Parasites Pollen (not pathogenic like the others Transplanted tissue (not pathogenic like the others) - Has a unique structure
Antigen Recognition
Screen clipping taken: 21/11/2011 12:22 PM

B CELL RECEPTORS - Contain thousands of antigen receptors - All identical - Y shaped polypeptide - Similar in structure to an antibody

Like an active site - unique to the - antigen No light chains, only the heavy chains

T CELL - Contain thousands of antigen receptors - All identical - 2 polypeptide chains held together by disulphide bridge - Recognize fragments of antigens express on the surface of cells

MAJOR HISTOCOMPATIBILITY COMPLEX (MHC)

- Cell surface glycoprotein - Express fragments of antigens Function: 1) Presentation of antigens to t-cells 2) Immune tolerance of self - Lymphocytes bearing MHC for self-molecules are destroyed - Failure leads to autoimmune diseases Two classes of MHC: - MHC I: most nucleated cells - Infected cells will express fragments of antigen on surface Cytotoxic T cells recognize - MHC II: dendritic cells, macrophages and B-cells (not neutrophils 'cuz they explode before this can happen) - Antigen presenting cell - Fragment of internalized antigen expressed on surface
- Unlikely any 2 people will have the same set of MHCs - 20 genes Numerous alleles for each gene - Steps involved in presentation of antigens on T-cells: 1) Invader has been internalized - Antigen is degraded 2) MHC are produced - Fragment of antigen is processed with MHC 3) MHC and antigen are expressed on surface of cell - Antigen presenting cell (APC) 4) Interact with T-cells

Screen clipping taken: 21/11/2011 12:26 PM

Two types of T-cells

Screen clipping taken: 21/11/2011 12:41 PM

Biology Page 18

- Fragment of antigen is processed with MHC 3) MHC and antigen are expressed on surface of cell - Antigen presenting cell (APC) 4) Interact with T-cells Two types of T-cells 1) Cytotoxic - React with cells expressing MHC I + antigen - Kill infected cells 2) Helper cells - React with cells expressing MHC II + antigen - Stimulate other cells Antibodies - Antigen-binding immunoglobulin (protein) - Recognizes a region of the antigen - Epitope - Secreted by activated B cells - Y shaped molecules - Comprised of 4 polypeptide chains 2 identical light chains 2 identical heavy chains Linked by disulphide bridges - All chains are comprised of: 1) Variable region - Amino acid sequence varies from antibody to antibody - Involved in antibody binding to antigen Resembles enzyme-substrate interaction 2) Constant region - Important in antigen disposal
Screen clipping taken: 21/11/2011 12:41 PM

Screen clipping taken: 21/11/2011 1:00 PM

Antibody disposal of antigens:

1) Neutralization - Blocks viral attachment - Coats bacteria Enhances phagocytosis (opsonization) 2) Agglutination (Insoluble) - Clumping of bacteria or virus - Enhances phagocytosis 3) Precipitation (Soluble) - Cross-linking of soluble molecules - Not cells - Enhances phagocytosis 4) Complement fixation - Antibody attaches to antigen - Complement links two bound antibodies - Attaches to pathogen membrane - Pore forms in membrane - Cell lysis

Screen clipping taken: 21/11/2011 1:08 PM

Response to the entrance of an antigen: Clonal selection: - Lymphocyte recognizes an antigen - Each lymphocyte will respond to only one antigen - Specificity of lymphocyte occurs during embryogensis - Before antigens are encountered

Steps: 1) Antigen enters body and binds to lymphocyte 2) Lymphocyte becomes activated - Divide and differentiates - Thousands of cells - All specific for and dedicated to eliminating the activating antigen 3) Produces two clones a) Effector cells - Short lived - Destroys activating antigen b) Memory cells - Not active - Long lived - Bare receptors for activating antigen

Screen clipping taken: 21/11/2011 1:21 PM

Primary immune response: - Body's first exposure to an antigen - Clonal selection of B Effector B-Cells - B-Cells-> plasma cells -> antibodies Memory cells - 10 to 17 days after exposure

Secondary immune response: - Exposure to previously encountered antigen - Memory cells activated - 2 to 7 days after exposure - Produces more effector cells

Biology Page 19

Secondary immune response: - Exposure to previously encountered antigen - Memory cells activated - 2 to 7 days after exposure - Produces more effector cells

Screen clipping taken: 21/11/2011 1:32 PM

ACQUIRED IMMUNE RESPONSE - Two pathways 1) Humural - Involves B cell activation - Free antigens - Produces antibodies 2) Cell mediated - Involves T-cells activation by - Intracellular antigens - Fungi, protozoa and parasitic woems - Transplanted tissues and cancer cells - Pathways are linked by helper T cells - Alert immune system
CELL MEDIATED

2 paths: a) Macrophages engulf invader i) Macrophage presents antigen on surface via MHC II - Antigen presenting cell (APC) ii) Helper T-cell interacts - Enhanced by CD4 on helper cells Integral membrane protein iii) 2 clones produced a) Effector (activated) - Secrete cytokines [e.g interleukin2 (IL2)] - Activates B and cytotoxic T-Cells b) Memory cells

Interleukin secreted, stimulates B cells, T cells and Self

Screen clipping taken: 22/11/2011 9:56 AM

- Helper cells are also regulated by cytokines IL1 secreted by macrophages IL2 feedback activation

Screen clipping taken: 22/11/2011 10:06 AM

b) Infected cell express foreign antigen on their surface - MHC I 1) Infected cell binds to cytotoxic cells - Enhanced by CD8 present on cytotoxic cells 2) Cytotoxic cell becomes activated - Releases perforin - Form pore in the cell membrane of infected cell - Cell lysis occurs - Exposes pathogen to antibodies - Removes site of reproduction

Humoral response: - Produces antibodies - Mediated by B ccells Antigen binds to receptor on Bcell Activated B cells give rise to a clone of plasma cells - Produces antibodies Immunity - Can be achieved naturally or artificially i) Active - Conferred by recovery from an infectious disease - Depends on the individual's own immune system - May be acquired from a natural infection or artificially (vaccination) - Vaccination - Inactivated toxin - Killed microbes - Parts of microbes - Organism cannot cause the disease - Acts as an antigen - A person vaccinated will show a rapid memory based response - Organism cannot cause the disease - Acts as an antigen - A person vaccinated will show a rapid memory based

Screen clipping taken: 22/11/2011 10:12 AM

Biology Page 20

- A person vaccinated will show a rapid memory based response ii) Passive - Antibodies transferred from on individual to another a) Natural - Mother to fettus - Across the placenta - Mother to infant - Nursing - Provides temporary protection Few weeks to months Until infants immune system develops
b) Artificially transferred - Inject antibodies into an individual - Rabies antibodies

Immune disease: i) Allergies - Hypersensitivity of the immune system to an allergen Allergen causes an immune response Antibodies produced attach to mast cells in connective tissue - Allergen binds to antibody-mast cell - Mast cell release histamine - Inflammatory response ii) Autoimmune diseases - Immune system acts against itself - Examples: Rheumatoid arthritis - Inflammation of joints due to autoantibodies Multiple Sclerosis - T-cells destroy myelin sheath Lupus - Autoantibodies; histones, DNA Diabetes - Cytotoxic cells attack cells of the pancreas iii) Immunodeficiency - Examples: a) Severe combine immunodeficiency (SCID) - Inborn - Both limbs of the immune system are none functional b) Hodgkin's disease - Cancer - Damage of the lymphatic system c) Physical and emotional stress - Hormones secreted by stressed individuals reduce the white blood cell count - Immune-nervous system links - Neurotransmitter receptors of lymphocytes d) Acquired immunodeficiency syndrome (AIDS) - Lethal disorder caused by HIV - Reduction in the number of T-helper cells - Glycoproteins on the surface of the virus bind to the CD4 receptor

Screen clipping taken: 22/11/2011 10:42 AM

Information processing: NEURONS Three steps 1. Sensory input - Response to external and internal stimuli - Peripheral nervous system (PNS)
2. Integration - Interpretation of sensory input Central nervous system (CNS) 3. Motor output - Conduction of signals from the integration center to the effector cells - PNS

Screen clipping taken: 25/11/2011 9:48 AM

- Signals are conducted through the body by nerves Neurons - Specialized for transmitting chemical and electrical signals Comprised 1. Large cell body 2. Firberlike extension - Two type: a) Dendrites - Receive signals - Short and numerous b) Axons - Conduct impulses away from the cell body - Long single processes Some axons insulated by myelin sheath - At the end have synaptic terminal Relay signals to other cells Release neurotransmitters - Forms synampses Junction between presynamptic and post synaptic neurons / Effector cells (like a muscle cell) - Glia - Supporting cells - Reinforce, protect, insulate neurons - Do not conduct impulses Types: 1. Astrocytes - CNS - Induce formation of tight junctions in the brain Blood brain barrier 2. Oligodendrocytes - CNS - Myelin sheath Electrical insulation - Increases the speed of nerve impulses 3. Schwann - PNS - Myelin sheath - (only difference is location) Nerve signals - Change in voltage across the plasma membrane - Caused by the movement of ions
Membrane potential - Voltage across the plasma membrane of all cells Small, numerous, getting the signals from stimuli

Screen clipping taken: 25/11/2011 9:53 AM

Screen clipping taken: 25/11/2011 9:59 AM

Biology Page 21

- Voltage across the plasma membrane of all cells -50 to -100 mV - Resting neuron about -70 Due to ionic gradients across the membrane

Ions: - Anions - Inside cell Proteins, amino acids, sulfate and phophate - Outside cell Cl- Cations - Inside cell High K+ (150 mM) Low Na+ (15 mM) - Outside cell Low K+ (15 mM) High Na+ (150 mM)

- Ions cross membranes by: Integral membrane proteins (b/c phospholipid membrane doesnt like the negative charge cause of the hydrophobic side chains) Ion Channels - Selective for ions a) Passive - Open all the time b) Gated - Require a stimulus or voltage change to open Resting potential - Due to diffuse of ions across the membrane - Separation of charge 1. K+ intracellular -> K+ extracellular - Down the concentration gradient - High number of passive K+ channels - +ve charges intra -> +ve charges extra - Increase in outside +ve charge - Decrease in +ve charge inside - Therefore inside is more negative 2. Na+ also moves down it's concetration gradient - Much slower movement than K+ - The net flux of K+ and Na+ results in the -70mV resting potential - The Na,K-ATPase maintains concentration gradients - Transports Na+ and K+ against their concentration gradient 3 Na+ out 2 K+ in ATP hydrolyzed Nerve Impulses - Excitable cells can change their membrane potential - Due to gated ion channels - Open or close in response to stimuli - Cause ion diffusion Changes in membrane potential due to stimuli 1. Hyperpolarization (more -ve inside) - Opening of K+ channels - K+ diffuses out of cell 2. Depolarization (less -ve inside_ - Opening of Na+ channels - Influx of Na+ Action potential (Nerve impulse): - Strong stimuli - Threshold potential reach

K+ goes out, cell is neg.

5 Phases: 1. Resting state - No gated channels are open 2. Depolarization - Stimulation causes Na+ gated channels to open - Na+ flows in - Results in depolarization 3. Action potential - If threshold potential reached - More gated Na+ channels open - Large influx of Na+ - Large depolarization occurs 4. Repolarization - Na+ channels close - K+ channels open - K+ flows out 5. Undershoot - K+ channels slow to close - Inside cell more negative than resting potential - Refractory period - Insensitive to stimuli

Prevents action potential from going the other way

Propagation of the action potential

Biology Page 22

Propagation of the action potential - action potential is a localized electrical event - Neurons are stimulated at dendrites - Action potential: axon -> synaptic terminal - Depolarization in neighbouring area - Undershoot Action potential can only move in one direction

Synapse: - A gap between the synaptic terminal and a signal receiving neuron or effector cell - Presynaptic cell: transmitting cell - Postsynaptic cell: receiving cell Chemical Synapses: - Pre-synaptic terminal Contains numerous synaptic vesicals - Contain neurotransmitter - Acetylcholine - Excitatory to skeletal muscle - Secreted by: - CNS and PNS - Neuromuscular junctions - Post-synaptic cell Contains neurotransmitter gated ion channels - Na+, K+, and Cl-

- Steps: 1. Action potential arrives at the synaptic terminal - Depolarization of the presynaptic membrane occurs - Causes Ca2+ influx 2. Ca stimulates synaptic vesicles to fuse with the presynaptic membrane - Release neurotransmitter into the synaptic cleft - Exocytosis 3. Neurotransmitters binds to ion channels on the postsynaptic membrane - Effect can be either excitatory or inhibitory - Excitatory: - Neurotransmitter binds to postsynaptic Na channels Causes depolarization of postsynaptic cell - Inhibitory - Neurotransmitter binds to postsynaptic K+ or Cl- channels Causes hyperpolarization of postsynaptic cell 4. Neurotransmitters are quickly degrade - Recycled to the presynaptic cell - Transmission of nerve impulses is in one direction only

Skeletal Muscle Contraction - Animal movement is due to muscle contraction - Skeletal muscle: - Bundle of long fibers running the length of the muscle - Attached to bone - Each fiber is a single cell with many nuclei - Each fiber is composed of smaller myofibrils - Bundles of protein filaments - Myofibrils are comprised of 1. Thin filaments a) 2 strands of actin b) Regulatory proteins 1. Tropomyosin - Blocks myosin binding sites 2. Troponin - Regulates position of tropomyosin 2. Thick filaments - Myosin molecules

Muscle movement: - Due to interaction between myosin and actin

Biology Page 23

- Regulates position of tropomyosin 2. Thick filaments - Myosin molecules

Muscle movement: - Due to interaction between myosin and actin Sliding filament model: - Each filament passes each other during contraction Steps 1. Action potential in neuron 2. Release of acetylcholine into synaptic cleft 3. Depolarization of post-synaptic muscle cell - Action potential 4. Release of Ca from sacroplasmic reticulum 5. Ca binds to troponin - Alters the structure of the tropomyosin-troponin complex - Exposes the mysosin binding sites on actin 6. Myosin can now interact with actin a) Myosin head bound to ATP - Cannot bind to actin b) Hydrolysis of ATP - Conformtional change in myosin head - Binds to actin - Forms cross-bridge c) Release of ADP and Pi - Myosin head changes conformation - Results in movement of actin d) Binding of ATP break myosin-actin crosslink - Actin returns to resting position 7. Contractions stop when Ca levels are returned to normal

Biology Page 24