Analytical Biochemistry 383 (2008) 3137

Contents lists available at ScienceDirect

Analytical Biochemistry
journal homepage: www.elsevier.com/locate/yabio

A two-step quantitative pathogen detection system based on capillary electrophoresis

Gi Won Shin a, Yang Sook Cho b, Hee Sung Hwang a, Jin Hyun Park b, Gyoo Yeol Jung a,c,*
a

School of Interdisciplinary Bioscience and Bioengineering, Pohang University of Science and Technology, Pohang 790-784, Republic of Korea Bio-Medical Engineering Laboratory, Foodscience, Inc., Pohang 790-784, Republic of Korea c Department of Chemical Engineering, Pohang University of Science and Technology, Pohang 790-784, Republic of Korea
b

a r t i c l e

i n f o

a b s t r a c t
Rapid identication of bacterial pathogens is important for patient management and initiation of appropriate antibiotic therapy in the early stages of infection. Among the several techniques, capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis combined with small subunit rRNA gene-specic polymerase chain reaction (PCR) has come into the spotlight owing to its sensitivity, resolution, and reproducibility. Despite the advantages of the method, the design of PCR primers and optimization of multiplex PCR conditions remain to be studied so that as many pathogens as possible can be analyzed in a single run. Here we describe a novel two-step technique involving multiplex PCR pathogen detection by CE-SSCP analysis followed by singleplex PCR pathogen quantication by CE-SSCP. Specic PCR primers were designed for optimal separation of their products by CE-SSCP based on molecular weight. PCR conditions were then optimized for multiplex analysis of the targets. Subsequently, detected pathogens were quantied by PCR with specic primers. Eight clinically important strains were simultaneously identied under the optimized conditions. Each individual pathogen was then quantied at a level of sensitivity of tens of cells per milliliter. In conclusion, the two-step pathogen detection method based on CE-SSCP described here allows for sensitive detection of pathogens by multiplex PCR (rst step) and quantication by specic PCR (second step). The results illustrate the potential of the method in clinical applications. 2008 Elsevier Inc. All rights reserved.

Article history: Received 27 May 2008 Available online 26 August 2008 Keywords: Pathogen Capillary electrophoresis single-strand conformation polymorphism Infectious disease Diagnosis Multiplex polymerase chain reaction

Early detection of pathogens in the diagnosis of infectious disease is one of the most important considerations in the development of a diagnostic method. High sensitivity and accuracy are also necessary features [14]. Among the conventional techniques, biochemical identication requires a time-consuming cultivation process [5], and immunoassay has low sensitivity [2]. PCR1-based pathogen quantication is the most sensitive method because it allows marker genes of specic pathogens present at extremely low levels to be detected by exponential amplication [6]. However, selective amplication of a target gene from the pathogen of interest and its accurate measurement are the major drawbacks of PCRbased diagnosis [4,68]. Capillary electrophoresis (CE) is a highly sensitive and reproducible separation method for nucleic acids or proteins with widespread applications. When combined with single-strand
* Corresponding author. Address: Department of Chemical Engineering, Pohang University of Science and Technology, Pohang, Gyeongbuk 790-784, Republic of Korea. Fax: +82 54 279 5528. E-mail address: gyjung@postech.ac.kr (G.Y. Jung). 1 Abbreviations used: PCR, polymerase chain reaction; CE, capillary electrophoresis; SSCP, single-strand conformation polymorphism; ssu, small subunit; HEX, hexachloro derivative of uorescein; BSA, bovine serum albumin. 0003-2697/$ - see front matter 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2008.08.021

conformation polymorphism (SSCP) analysis, CE enables separation of single-stranded DNA molecules by their folded conformation as well as by molecular weight, because electrophoresis is performed under neutral conditions. This allows many different versions of DNA separation depending on the application [9]. In our previous studies, we demonstrated that SSCP with CE technologies can be used for precise quantication of mRNA [10] and simultaneous antimicrobial activity assay in a microbial community coupled with PCR specic to the ssu rRNA gene [11]. However, to analyze as many pathogens as possible in a single run, PCR based on a common primer set to amplify a variable region of each ssu rRNA gene is not appropriate, because the PCR products thus amplied are not different enough to be separated by CE. Therefore, multiplex PCR using species-specic primers to yield a range of product sizes that can be effectively separated is a potentially powerful method for diagnosis of multiple species in a single sample. In this study, we developed a simple, sensitive, and accurate pathogen diagnostic technique using CE-SSCP combined with multiplex PCR specic to the target pathogen in a mixture of microorganisms. PCR primers were designed for optimal separation of their products by CE-SSCP by referring to the sequence alignment of the

32 Quantitative pathogen detection by PCR-based capillary electrophoresis single-strand conformation polymorphism analysis / G.W. Shin et al. / Anal. Biochem. 383 (2008) 3137

ssu rRNA genes of the target pathogens. Multiplex PCR conditions, including composition and concentrations of the primers, cycles of PCR, and concentration of genomic DNA, were optimized for the sensitive detection of eight clinically important pathogens. By subsequent PCR with primers specic for the individual pathogens and further CE-SSCP analysis, the pathogens were precisely quantied. Materials and methods Strains as a model set As a model set, eight strains were used: Mycoplasma genitalium G-37 ATCC 33530D, Neisseria gonorrhoeae ATCC 700825D, Trichomonas vaginalis ATCC 30001D, Campylobacter jejuni ATCC 33560, Clostridium perfringens ATCC 3624, Escherichia coli O157:H7 EDL933 ATCC 700927D, Bacillus anthracis KCTC 3561, and Borrelia burgdorferi ATCC 35210D. The rst three of these eight strains are related to sexually transmitted diseases. M. genitalium G-37 is a Gram-positive bacterium and is believed to be the cause of nongonococcal urethritis (NGU) [12]. N. gonorrhoeae is the species of Gram-negative bacteria responsible for gonorrhea [13]. T. vaginalis, an anaerobic, parasitic, agellated protozoan, is the causative agent of trichomoniasis, and is the most common pathogenic protozoan infection of humans in industrialized countries [14]. The next three microbes listed are foodborne pathogens. C. jejuni is a curved, rodshaped, Gram-negative microaerophilic bacterium commonly found in animal feces. C. jejuni is one of the most common causes of human gastroenteritis in the world [15]. C. perfringens is a Grampositive, rod-shaped, anaerobic, spore-forming bacterium. Type A strains of C. perfringens cause gas gangrene (clostridial myonecrosis) as well as necrotic enteritis and mild diarrhea in humans [16]. E. coli O157:H7 is an enterohemorrhagic strain of E. coli and a cause of foodborne illness [17]. The last two bacteria listed are also causes of infectious diseases. B. anthracis is a Gram-positive bacterium and the causative agent of anthrax [18]. B. burgdorferi is a bacterial species of the spirochete class (Gram-negative bacteria) and the agent of Lyme disease [19]. Reagents and primers Pfu DNA polymerase was purchased from Stratagene, Inc. (La Jolla, CA, USA). Unlabeled primers and primers 50 -labeled with a hexachloro derivative of uorescein (HEX primers) were synthesized by Bioneer, Inc. (Daejeon, Korea) and by Applied Biosystems, Inc. (Foster City, CA, USA), respectively. All other reagents were obtained from SigmaAldrich, Inc. (St. Louis, MO, USA). To amplify the ssu rRNA coding region of each bacterial strain, we designed forward primers using the Primer3 website (http:// frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for optimizing melting temperature of each specic primer design and the

ClustalW2 website (http://www.ebi.ac.uk/Tools/clustalw2/index.html) for nding the specic priming regions. An oligonucleotide, 50 HEX-ATTACCGCGGCTGCTGGC 30 [20], that corresponds to the conserved sequence bordering the variable region (V2 region) of the 16S rRNA gene was picked as a reverse primer. In addition, we also included a eukaryotic strain, T. vaginalis; we designed the primers for T. vaginalis on the 16S-like rRNA sequences, which also have the V2 region [21] (Table 1). Genomic DNA isolation and multiplex PCR Genomic DNAs of all strains except C. perfringens were purchased from ATCC, KCCM, or KCTC. C. perfringens was grown anaerobically for 24 h in 10 ml of trypticase soy blood medium at 37 C, and then the genomic DNA was isolated with a DNeasy kit (Qiagen, Inc., Valencia, CA, USA). For each reaction, pathogen genomic DNA as a template, 20 pmol of each primer for amplifying the region, 0.5 U Pfu DNA polymerase, 250 lM concentrations of each of the four dNTPs, and 5 ll of the 10 buffer provided by the manufacturer were mixed, and sterile H2O was added to achieve a 50-ll total volume. PCR was performed with an initial denaturation for 2 min at 95 C; followed by 30 cycles of denaturation for 30 s at 95 C, annealing for 30 s at 55 C, and extension for 30 s at 72 C; and a nal extension at 72 C for 7 min. PCR products were diluted in nuclease-free water appropriately and then used for CE-SSCP. CE-SSCP analysis CE-SSCP analysis was performed as described in our previous publications [10,11]. Briey, 1 ll of sample from the amplied ssu rRNA gene of each species was mixed with 13.5 ll of deionized formamide (Applied Biosystems, Inc.) and 0.5 ll of ROX 500 size standard (Applied Biosystems, Inc.) for measuring the position of the peak. Then the sample mixtures were denatured at 95 C for 4 min and immediately cooled on ice. CE-SSCP analysis was performed on an ABI Prism 310 genetic analyzer (Applied Biosystems, Inc.). The genetic analyzer was set up in accordance with the manufacturers instructions. The capillary used in this study was 47 cm 50 lm and purchased from Applied Biosystems. The nondenaturing polymer matrix used was 3.5% GeneScan polymer and the buffer was 1 TBE10% glycerol (Applied Biosystems, Inc.). Electrophoresis conditions were as follows: injection voltage = 15.0 kV, electrophoresis voltage = 13.0 kV, syringe pump time = 210 s for lling the capillary with fresh polymer and running buffer to clean up the capillary between samples, constant temperature = 35 C, and collection time = 18 min. A CCD camera on the ABI 310 Genetic Analyzer was used to detect uorescence wavelengths from 525 to 650 nm. Virtual lter sets were optimized for the ABI PRISM dye set such as HEX, and dyes were excited with a 10-mW argon ion laser at 488 and 514 nm. The signal was automatically analyzed, and the positions of the peaks were deter-

Table 1 Primers used in this study for the polymerase chain reaction Microbial name Mycoplasma genitalium G-37 Neisseria gonorrhoeae Trichomonas vaginalisb Campylobacter jejuni Clostridium perfringens Escherichia coli O157:H7 EDL933 Bacillus anthracis Borrelia burgdorferi Porphyromonas gingivalis
a b

Top primer (50 30 ) GGAAGTAGCAATACTTTAGAG CAGGGAAGCTTGCTTCTC GCGACCAACAGGTCTTAAAT CAAGAGGACAACAGTTGGA AATAGCCTTCCGAAAGGAAGA GAACGGTAACAGGAAGAA CGGCTTCGGCTGTCACTT GATGAAAGGAAGCCTTTAAAG CACTTGTATTATTGCATGATAT

Bottom primer (HEX-50 30 )a ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC ATTACCGCGGCTGCTGGC

Product size (bp) 463 459 387 367 365 471 330 340 349

All strains share the bottom primer, which is labeled with HEX at the 50 end. T. vaginalis is a eukaryotic strain, but it has the 16S-like rRNA gene.

Quantitative pathogen detection by PCR-based capillary electrophoresis single-strand conformation polymorphism analysis / G.W. Shin et al. / Anal. Biochem. 383 (2008) 3137 33

mined using DNA analysis software (GeneMapper, Applied Biosystems, Inc.). Data point values on the x axis of the chromatograms represent the elution time in arbitrary units provided by GeneMapper. Results and discussion Design of PCR primers specic to the target pathogens for CE-SSCP analysis The ssu rRNA gene is generally used for identication of microorganisms because it contains several variable regions with sequence variations that permit microbes to be differentiated at the subspecies level [7,11,22,23]. Previously, it had been reported that PCR products obtained from a mixture of microorganisms using universal primers could be separated and quantied by CE-SSCP analysis [11,23]. In this study, we carried out PCR using universal primers specic for the V2 region, which is the most variable region in bacterial species. Fig. 1 illustrates the results of CE-SSCP analysis of the ssu rRNA gene-specic PCR product amplied using universal primers for the V2 region. The PCR products for B. burgdorferi and T. vaginalis exhibited multiple peaks in CE-SSCP analysis due to nonspecic binding of the universal primers (Fig. 1A). Peak locations for other strains were similar and were in two groups located at around 22402260 and 23302370, respectively (Figs. 1B and C). Poor separation of the peaks for the ssu rRNA gene-specic PCR products amplied using the universal primers is commonly observed in CESSCP analysis, because the sequences of the PCR products are not variable enough. Therefore, PCR primers suitable for CE-SSCP analysis should be designed. According to previous research on the contribution of both molecular weight and thermodynamic parameters affecting the secondary structure of single-stranded DNA to the mobility of DNA molecules subjected to CE-SSCP analysis [24], molecular weight was found to be the major factor contributing to strand mobility. This indicated that PCR primers should be designed to produce PCR products of various lengths to obtain clear separation of the peaks in CE-SSCP analysis. To achieve this in the present study, forward primers were designed to anneal to a unique region upstream of the priming site of the universal reverse primer for the V2 region. Specic PCR primers were designed using ClustalW and Prime3 to be used to obtain PCR products of various lengths as listed in Table 1. With these primers, PCR products generated for each of the eight microbial strains were analyzed by CE-SSCP. As depicted in Fig. 2, all the peaks were well separated within the 26703075 range of data points, and every reaction except that of N. gonorrhoeae generated a single peak. A minor peak of N. gonorrhoeae was too small to interfere with the detection of major peaks. Therefore, multiplex PCR using this set of specic primers should enable simultaneous detection of the eight microbial species.

Optimization of multiplex PCR conditions Unlike typical PCR with a single pair of primers, the reaction

"
Fig. 1. Electropherogram of the PCR products for each target pathogen generated using universal primers specic to the V2 region. Data points, which are normalized retention time points, are indicated on the x axes, and uorescence intensities is indicated on the y axes. There are three groups of peaks: (A) B. burgdorferi and T. vaginalis, which have multiple peaks; (B) C. perfringens and C. jejuni, the peaks of which are located at 22402260; (C) B. anthracis, E. coli O157, N. gonorrhoeae, and M. genitalium, the peaks of which are located at 23302370. Strain names are indicated at the top of each electropherogram, and numbers in parentheses indicate the data points of the peaks. For the electropherogram with multiple peaks, the data point of the peak is indicated by a question mark (?) instead of a number.

34 Quantitative pathogen detection by PCR-based capillary electrophoresis single-strand conformation polymorphism analysis / G.W. Shin et al. / Anal. Biochem. 383 (2008) 3137

Fig. 2. Electropherogram of the PCR products for each target pathogen using specic primers designed based on specicity and separation of the peaks. Strain names and peak locations are represented as in Fig. 1, and are shown at the left side of the electropherograms. x and y axes represent data point and uorescence intensity, respectively.

Quantitative pathogen detection by PCR-based capillary electrophoresis single-strand conformation polymorphism analysis / G.W. Shin et al. / Anal. Biochem. 383 (2008) 3137 35

Fig. 3. Electropherogram of the multiplex PCR products for the eight pathogens of interest using the mixture of specic PCR primers designed in this study. Multiplex PCR conditions were optimized as described under Materials and methods. Strain names and peak locations are represented as in Fig. 1. x and y axes represent data point and uorescence intensity, respectively.

Table 2 Amounts of genomic DNA used in simultaneous detection by multiplex PCR Microbial name Mycoplasma genitalium G-37 Neisseria gonorrhoeae Trichomonas vaginalis Campylobacter jejuni Clostridium perfringens Escherichia coli O157:H7 EDL933 Bacillus anthracis Borrelia burgdorferi Amount of gDNA per reaction (pg) 1.5 4.5 5.0 200 6.5 2.5 2.5 10

conditions for multiplex PCR should be carefully optimized; otherwise, unexpected PCR products can be produced [25]. Reaction conditions affecting the specicity of annealing between primers and templates include the concentrations of salts, dNTPs, MgCl2, and DNA polymerase, as well as the presence of various adjuvants to improve both PCR sensitivity and specicity [26,27]. Adjuvants known to improve the sensitivity of multiplex PCR include dimethyl sulfoxide, glycerol, and bovine serum albumin (BSA), which enhance DNA relaxation to allow the templates to be denatured more easily. We tested dimethyl sulfoxide, glycerol, and BSA and

Fig. 4. Correlation between peak area and genomic DNA concentration for each pathogen. Quantitative PCRs were carried out using the mixture of genomic DNAs for the eight pathogens and a pair of specic primers for the pathogen of interest. Subsequently, PCR products were analyzed by CE-SSCP. Strain names are shown at the top of each graph, and the linear correlation between genomic DNA concentration and peak area for each strain is represented by the equation in each graph. x and y axes represent genomic DNA concentration and peak area, respectively. R is the correlation coefcient.

36 Quantitative pathogen detection by PCR-based capillary electrophoresis single-strand conformation polymorphism analysis / G.W. Shin et al. / Anal. Biochem. 383 (2008) 3137

found BSA (640 ng/ll) to be the most effective PCR additive. In addition, the concentrations of dNTPs, MgCl2, PCR buffer, enzyme, and primers were all optimized for multiplex PCR using a mixture of genomic DNAs of the eight microbial strains of interest and the mixture of strain-specic primers as described under Materials and methods. Annealing temperature, another important PCR parameter, was also examined in an effort to enhance the efciency of multiplex PCR [28]. In the range of 5060 C, we found 53 C to be the best temperature for both maintaining the sensitivity of the reaction and minimizing the nonspecic products; 53 C is also 34 C lower than the annealing temperature generally used for PCR of a single target gene [26]. A mixture of the eight pathogens was subjected to the optimized multiplex PCR, and CE-SSCP analysis was performed as shown in Fig. 3. The minimum amounts of pathogen DNAs used for multiplex PCR are listed in Table 2. The peaks for all eight target pathogens were located at the same positions as those obtained from the individual PCRs. Several minor peaks were also noted among the multiplex PCR products; however, their presence did not affect detection of the target pathogens, as the locations of the minor peaks are quite different from those of the diagnostic peaks of the pathogens of interest. Quantitative analysis of pathogens by CE-SSCP Under the optimized conditions for multiplex PCR developed in this study, eight target pathogens could be detected simultaneously. In a follow-up study, quantitative PCRs for the detected pathogens were performed and analyzed by CE-SSCP. Because multiplex PCR is less quantitative than PCR with a single pair of primers, owing to lower sensitivity and specicity, and/or preferential amplication of certain targets [29], quantitative analyses were performed by singleplex PCR. Fig. 4 illustrates the correlation between the peak area of the each individual PCR product and the genomic DNA of the target strains. These results demonstrate that genomic DNAs can be sensitively and linearly quantied from samples containing one to hundreds of picograms per microliter, which is equivalent to tens to thousands of cells per milliliter. In practical terms, this is sensitive enough to enable pathogen detection in a variety of samples [3032]. Furthermore, precise quantitative data obtained by this method can provide additional information for diagnosis of infectious diseases. Concluding remarks In this study, we developed a sensitive pathogen detection method based on CE-SSCP coupled with multiplex PCR. Instead of using common primers targeting the variable region of the ssu rRNA gene, as in the conventional method, specic PCR primers appropriate for subsequent CE-SSCP analysis were designed based on the specicity and length of the corresponding PCR products. After optimization of multiplex PCR conditions, such as adjuvant type and annealing temperature, we found that target pathogens could be sensitively quantied by CE-SSCP analysis. In conclusion, CE-SSCP analysis combined with multiplex PCR using the properly designed primers developed in this study is a sensitive and precise method for detection of pathogens, and has huge potential in the diagnosis of infectious diseases. Acknowledgments This work was supported by POSTECH BSRI Research Fund2006, POSTECH Core Research Program, MOST via MGAC and AEBRC (R11-2003-006-04003-0), MOCIE via the Program for the Training of Graduate Students in Regional Innovation, and

MOEHRD via a Korea Research Foundation Grant (KRF-2006-331D00116). References

[1] J. Schlundt, New directions in foodborne disease prevention, Int. J. Food Microbiol. 78 (2002) 317. [2] R.H. Hall, Biosensor technologies for detecting microbiological foodborne hazards, Microbes Infect. 4 (2002) 425432. [3] H. Hebart, J. Lofer, C. Meisner, F. Serey, D. Schmidt, A. Bohme, H. Martin, A. Engel, D. Bunje, W.V. Kern, U. Schumacher, L. Kanz, H. Einsele, Early detection of aspergillus infection after allogeneic stem cell transplantation by polymerase chain reaction screening, J. Infect. Dis. 181 (2000) 1713 1719. [4] T. Briese, G. Palacios, M. Kokoris, O. Jabado, Z. Liu, N. Renwick, V. Kapoor, I. Casas, F. Pozo, R. Limberger, P. Perez-Brena, J. Ju, W.I. Lipkin, Diagnostic system for rapid and sensitive differential detection of pathogens, Emerg. Infect. Dis. 11 (2005) 310313. [5] E. de Boer, R.R. Beumer, Methodology for detection and typing of foodborne microorganisms, Int. J. Food Microbiol. 50 (1999) 119130. [6] Y.W. Tang, G.W. Procop, D.H. Persing, Molecular diagnostics of infectious diseases, Clin. Chem. 43 (1997) 20212038. [7] A. Backman, P. Lantz, P. Radstrom, P. Olcen, Evaluation of an extended diagnostic PCR assay for detection and verication of the common causes of bacterial meningitis in CSF and other biological samples, Mol. Cell. Probes 13 (1999) 4960. [8] G.J. Vora, C.E. Meador, D.A. Stenger, J.D. Andreadis, Nucleic acid amplication strategies for DNA microarray-based pathogen detection, Appl. Environ. Microbiol. 70 (2004) 30473054. [9] P.S. Andersen, C. Jespersgaard, J. Vuust, M. Christiansen, L.A. Larsen, Capillary electrophoresis-based single strand DNA conformation analysis in highthroughput mutation screening, Hum. Mutat. 21 (2003) 455465. [10] Y.S. Park, H.S. Chu, S.H. Hwang, J.H. Seo, C.Y. Choi, G.Y. Jung, A precise mRNA quantication method using CE-based SSCP, Electrophoresis 27 (2006) 3836 3845. [11] J.H. Chung, Y.S. Park, J. Kim, G.W. Shin, M.H. Nam, M.K. Oh, C.W. Kim, G.Y. Jung, J. Hyun Park, Parallel analysis of antimicrobial activities in microbial community by SSCP based on CE, Electrophoresis 28 (2007) 24162423. [12] J.S. Jensen, E. Bjornelius, B. Dohn, P. Lidbrink, Use of TaqMan 50 nuclease realtime PCR for quantitative detection of Mycoplasma genitalium DNA in males with and without urethritis who were attendees at a sexually transmitted disease clinic, J. Clin. Microbiol. 42 (2004) 683692. [13] Y.T. van Duynhoven, The epidemiology of Neisseria gonorrhoeae in Europe, Microbes Infect. 1 (1999) 455464. [14] D. Soper, Trichomoniasis: under control or undercontrolled?, Am J. Obstet. Gynecol. 190 (2004) 281290. [15] S.F. Altekruse, N.J. Stern, P.I. Fields, D.L. Swerdlow, Campylobacter jejuni: an emerging foodborne pathogen, Emerg. Infect. Dis. 5 (1999) 2835. [16] C.L. Hatheway, Toxigenic clostridia, Clin. Microbiol. Rev. 3 (1990) 6698. [17] H. Karch, P.I. Tarr, M. Bielaszewska, Enterohaemorrhagic Escherichia coli in human medicine, Int. J. Med. Microbiol. 295 (2005) 405418. [18] T.C. Dixon, M. Meselson, J. Guillemin, P.C. Hanna, Anthrax, N. Engl. J. Med. 341 (1999) 815826. [19] C.M. Fraser, S. Casjens, W.M. Huang, G.G. Sutton, R. Clayton, R. Lathigra, O. White, K.A. Ketchum, R. Dodson, E.K. Hickey, M. Gwinn, B. Dougherty, J.F. Tomb, R.D. Fleischmann, D. Richardson, J. Peterson, A.R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M.D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fuji, M.D. Cotton, K. Horst, K. Roberts, B. Hatch, H.O. Smith, J.C. Venter, Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi, Nature 390 (1997) 580586. [20] A. Wilmotte, G. Van der Auwera, R. De Wachter, Structure of the 16S ribosomal RNA of the thermophilic cyanobacterium Chlorogloeopsis HTF (Mastigocladus laminosus HTF) strain PCC7518, and phylogenetic analysis, FEBS Lett. 317 (1993) 96100. [21] J. Gunderson, G. Hinkle, D. Leipe, H.G. Morrison, S.K. Stickel, D.A. Odelson, J.A. Breznak, T.A. Nerad, M. Muller, M.L. Sogin, Phylogeny of trichomonads inferred from small-subunit rRNA sequences, J. Eukaryot. Microbiol. 42 (1995) 411 415. [22] H.S. Eom, B.H. Hwang, D.H. Kim, I.B. Lee, Y.H. Kim, H.J. Cha, Multiple detection of food-borne pathogenic bacteria using a novel 16S rDNAbased oligonucleotide signature chip, Biosens. Bioelectron. 22 (2007) 845853. [23] L.M. Gillman, J. Gunton, C.Y. Turenne, J. Wolfe, A.M. Kabani, Identication of Mycobacterium species by multiple-uorescence PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene, J. Clin. Microbiol. 39 (2001) 30853091. [24] D. Glavac, U. Potocnik, D. Podpecnik, T. Zizek, S. Smerkolj, M. RavnikGlavac, Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis, Hum. Mutat. 19 (2002) 384394. [25] E.M. Elnifro, A.M. Ashshi, R.J. Cooper, P.E. Klapper, Multiplex PCR: optimization and application in diagnostic virology, Clin. Microbiol. Rev. 13 (2000) 559570.

Quantitative pathogen detection by PCR-based capillary electrophoresis single-strand conformation polymorphism analysis / G.W. Shin et al. / Anal. Biochem. 383 (2008) 3137 37 [26] O. Henegariu, N.A. Heerema, S.R. Dlouhy, G.H. Vance, P.H. Vogt, Multiplex PCR: critical parameters and step-by-step protocol, Biotechniques 23 (1997) 504 511. [27] M.M. Blanchard, P. Taillon-Miller, P. Nowotny, V. Nowotny, PCR buffer optimization with uniform temperature regimen to facilitate automation, PCR Methods Appl. 2 (1993) 234240. [28] Y. Hongoh, H. Yuzawa, M. Ohkuma, T. Kudo, Evaluation of primers and PCR conditions for the analysis of 16S rRNA genes from a natural environment, FEMS Microbiol. Lett. 221 (2003) 299304. [29] P. Markoulatos, N. Siafakas, M. Moncany, Multiplex polymerase chain reaction: a practical approach, J. Clin. Lab. Anal. 16 (2002) 4751. [30] U. Banik, A.K. Adhikary, E. Suzuki, T. Inada, N. Okabe, Multiplex PCR assay for rapid identication of oculopathogenic adenoviruses by amplication of the ber and hexon genes, J. Clin. Microbiol. 43 (2005) 1064 1068. [31] S. Tamarapu, J.L. McKillip, M. Drake, Development of a multiplex polymerase chain reaction assay for detection and differentiation of Staphylococcus aureus in dairy products, J. Food Prot. 64 (2001) 664 668. [32] J.A. Vet, A.R. Majithia, S.A. Marras, S. Tyagi, S. Dube, B.J. Poiesz, F.R. Kramer, Multiplex detection of four pathogenic retroviruses using molecular beacons, Proc. Natl. Acad. Sci. USA 96 (1999) 63946399.