Name ______________________________________________________ Period ______ DNA and History Who said that science and history have nothing

in common? The reality is that in order to understand scientific discoveries both in the past and present, you need to understand the history of that time period. The same is also true of history. New tools in science are making studying the past more exciting than ever before. The DNA that sits inside each and every one of your cells right now is a window into your own personal past as well as the history of all human beings. Lets explore the connection between past and present by using the tools of biology to study history. Part I: Archaeology A problem that a lot of archaeologists and anthropologists face is how to identify bones that they have found in the ground. In the past, those skeletons would remain unidentified. We didnt know what they were. Now, scientists can take DNA out of those bones, read the sequence of the DNA, and figure out what it is! I want you to do that right now.

Glen the skeleton is sad and lonely. He wants to find his own people. The problem is. hes been in the ground for over a million years and cant remember who his people are! Lets help him out.

I asked Glen for a DNA sample, and this is what he gave me: ATTCAGTACTTGCATCCAGT The problem is that he only gave me half of the sequence. Remember, DNA comes in two, opposite strands. Help him out by finishing up the sequence by writing the OPPOSITE part of the sequence. (Hint: A T and C G)

-------------------Great! Now we have his DNA sequence. Lets try to identify him using that strand that you just created. Here are the DNA strands of three different early hominids (a member of the early family of primates known as Hominidae) Figure out which one of these three that Glenn belongs to. Remember, DNA sequences are not always complete when you find them in skeletons in the ground. Look at the sequences of these hominids to see if you could find a match between Glenn and one of them. Homo Habilis AGGGGGGCTCGCCGCGTTGGCTAATCCTGGTACATCTTGTAATGAATATTCA GTAGAAAATTTGTGTTAGAAGGACGAGTCACCATGTACCAAAAGCGATAACG ATCGGTGGGAGTATTCATTGTGGTGAAGACGCTGGGTTTACGTGGGAAAGGT GCTTGTGTCCCAACAGGCTAGGATATAATGCTGAAGCCCTTCCCCAAGCGTTC A Neanderthal GCCTACCGCGATGCTGAATGACCCGGACTAAAGTGGCGAAAATTATGGCGTG TGACCCGTTATGCTCCAGTTCGGTCAGTGGGTCATTGCAAGTAGTCGATTGCA TTGTCAATCTCCGAGTGATTTAGCGTGACAGCCGCAGGGAACCCATAAAATG CGATCGTAGTCCATCCGATCGTACATAAGTCATGAACGTAGGTCATAGAAAT Australopithicene GTCAGCCGCACCTGTTCACTCGTCGTTTGCATTTAAGAGCCGCACGAACCAC AGAGCATAAAGAGGACCTCTAGCTCCTTTACAAAGTACTGGTTCCCTTTCCGG CGGGATGCCTTATCTAAACGCAATGACGGACGTATTCCTCTGGCCACATCGG TTCCTGCTTCCGCTGGGATCCAACATTGGCAGCCGAAGCCGCCATTCCATAGT G That was a lot of letters! Did you find which specie Glenn belongs to? ___________________________ How efficient was that? Was it easy to find? How could we make that easier to do? _______________________________________________________________________ _______________________________________________________________________

_______________________________________________________________________ ___ Part II: Analyzing the DNA of Groups using Genes and Mutations DNA can be used for more things than just identifying skeletons! It can be used to track the migrations of different people over time. Thousands of years ago, human beings were nomadic (they traveled from place to place a lot, never really settling in one place.) Back in the olden days, we had to rely on archaeologists to dig up tools and pottery to figure out where people were living and guess when it was. That is all fine and dandy, but now we can use DNA to do just that. How?!?!? Through the use of genes and chromosomes! Gene - the basic physical unit of heredity; a linear sequence of nucleotides along a segment of DNA that provides the coded instructions for synthesis of RNA, which, when translated into protein, leads to the expression of hereditary character Chromosome - any of several threadlike bodies that carry the genes in a linear order: the human species has 23 pairs *phew* That was a mouthful. So basically what is a gene? Well, its a piece of DNA that tells your body to build something. A chromosome is something that holds your DNA, so it contains all of your genes. For example, one of the genes for eye color is called marker rs12913832 and is located on chromosome 15. Here is Mr. Ks data for that portion of his chromosome: Who Genotype AA Mr K. AG GG What It Means In Europeans, 85% chance of brown eyes; 14% chance of green eyes; 1% chance of blue eyes. In Europeans, 56% chance of brown eyes; 37% chance of green eyes; 7% chance of blue eyes. In Europeans, 72% chance of blue eyes; 27% chance of green eyes; 1% chance of brown eyes.

Your gene is the sequence of letters in that spot in your DNA. My gene is AG on chromosome 15. Depending upon which letters are there, that determines what a trait is on my body. I have brown eyes because of my gene. But genetics is not easy! I could have gotten green or blue eyes if I had been lucky, I mean, if my DNA sequence had been different. Which letters get in those spots, you ask? Good question. Your parents each give you half of their own DNA sequence which then is combined to form you, a totally unique person that the world has never seen before. That is what makes them your parents; each one has given half of their own DNA to make you. Pretty cool huh?

So lets use genes to look at different ancient groups and how they moved. If two people share the same gene, that does not mean they are related. There are billions of possible combinations from only four letters (A T C G) so having the same sequence like AA, AG, or GG is not unique. However, having a long sequence of genes in common can make you related to someone else. For example, my third cousin twice removed share 19 million base pairs with each other. Think that is big? DNA is billions of base pairs long. Nineteen million is just a tiny bit of it. Lets look at three sample populations along with the DNA sequence of our friend, Hugh the Brit. Hugh has lived in Britain his whole life and believes that all of his ancestors came from Britain. Lets look at his DNA to see if that is true. I will give you Hughs DNA sequence along with the genes of other groups of people in history. See if you can find out which group Hugh is descended from. Hughs DNA sequence: AGTTGCCCACAGAACGTCAAGATTAGAGAACGGTCGTAGCATTATCGGAGGT TCTCTAACTACTATCAGTACCCGTGTCTCGACTCTGCCGCGGCTACCTATCGC CTGAAAGCCAGTTGGTGTTAAGGGGTGCTCTGTCCAGGACGCCACGCGTAGT GAGACTTACATGTTCGTTGGGTTCACCCGACTCGGACCTGAGTCGACCAAGG ACGCACTCGAGCTCTGAGCCCTACTGT Viking Gene: GGTGCTCTGTCC Roman Gene: ATTCCTTCTGCG French Gene: GAATTGTGCGAT Which gene does Hugh have that makes him belong to one of those groups? ____________________________________ By having that particular gene, it means that one of Hughs ancestors belonged to that group. Once we look at large populations of people and see that a lot of people have the same gene, then that means one group moved into that area in ancient history. Part III: DNA Mutations Having a mutation can make you special and related to other people who have that mutation. Mutation a sudden departure from the parent type in one or more heritable characteristics, caused by a change in a gene or a chromosome.

Meaning? Something went wrong when the DNA was duplicated in the cells of one of your ancestors. His or her DNA strand, instead of having A like it should in a particular spot, suddenly has a C or G. It means that either part of the DNA was lost, added, or substituted during DNA replication. However, that mutation was unique to that person, so if you have that mutation, then that proves you are descended from him or her. Are mutations bad? Not necessarily. Some mutations are good things. To use the eye color example, it was a mutation that happened in Scandinavia about 10,000 years that created blue eyes in human beings. That gene spread like wildfire throughout the world so that today millions and millions of people have blue eyes along with many other eye color shades. Mutations can be used to chart ancient movements of different groups in history. In fact, a collection of mutations is known as a haplogroup and is used to characterize different people from different places. That is how DNA can be used to determine where a persons ancestors came from. By looking at his or her haplogroup, then geneticists can see if a person has European, Asian, American, etc ancestry. This is very useful for people who have been adopted or come from a region of the world with a lot of genetic diversity such as Brazil or Sicily. Lets take a look at Mr. Ks genetic profile!