LS4 Problem Set 1, 2010 Complementation testing, fine mapping by recombination, biochemical pathways, reading frames, mutations Corresponding

Lectures: October 30, November 2, 4, 6 Corresponding Reading: Hartwell et al., 224-238, 255-265 Corresponding Quizzes: Nov 2-6 (simple quiz on complementation); Nov 9-13 If you want additional problems, try these from the book: Chapter 7: 16-19, 21, 23, 32; Chapter 8: 3-7, 16. Problem 1.
1. What is the purpose of a complementation test? To determine if two mutations with the same phenotype occur in the same gene or in different genes 2. What is one criterion that must be met in order for a complementation test to be a valid experiment? Mutations must be recessive 3. How do complementation tests differ between animals, bacteria and viruses? Most eukaryotes are diploid or are sometimes diploid as a part of their life cycle (Also accept easier to score phenotypes) 4. Is this an example of complementation or of failure to complement? Complementation

Problem 2. You have 3 turtles, each with a mutation that causes them to have a strange polka dotted pattern on their shells. You dont know if the mutations are in the same gene or in different genes. Assume that all 3 mutations are homozygous recessive. a) turtle1 X turtle2 turtle2 X turtle3 turtle3 X turtle1 b) Turtle3 x turtle2 Complementation, wild type phenotype Turtle1 x turtle3 No complementation, mutant phenotype

Problem 3. You have performed a mutagenesis screen in Drosophila and have found 5 recessive loss-of-function mutants with an essential role in the neural pathway that allows flies to jump. You perform a complementation test and get the following results. + = wildtype, - = non-jumpers There are three complementation groups Group 1: mutations 1, 3, and 4 Group 2: mutation 2 Group 3: mutations 5 and 6 Problem 4. Four rII- recessive point mutations were discovered. Coinfections of bacteria with all possible combinations of rII- mutant T4 phages were performed, and the following results were obtained. Fill in the chart 1 1 2 3 4 2 + 3 + 4 + + + -

A. How many genes are identified by this analysis? From row 1, we see that mutation 1 fails to complement mutation 3, so they are in the same gene. Mutations 2 and 4 complement mutation 1, so they are not in the same gene as mutation 1. 2 and 4 are not necessarily in the same gene, we must keep looking at the chart to figure that out. All we know so far is that mutations 2 and 4 are not in the same gene as mutation 1 and 3. From row 2, we see that mutation 2 complements mutation 4, so they must also be in different genes. B. Which mutants belong to the same complementation groups? 1 complementation group (mutations in same gene) mutations 1 and 3 mutation 2 is in a different gene than 4 and (1 and 3) mutation 4 is in a different gene than 2 and (1 and 3)

Problem 5. Its a very well known fact that most dragons do not breathe fire, and its also well known that alleles that enable fire breathing are recessive to the wild-type Sweet Breath phenotype. However, its unclear how many different genes when mutated cause the fire breathing phenotype. To answer this question you use four different strains of dragon and perform a series of crosses. Your strains are the Hungarian Horntail (Strain A), the Norwegian Ridgeback (Strain B), the Romanian Longhorn (Strain C), and the Swedish Shortsnout (Strain D). All strains are true breeding for a single homozygous recessive mutation that allows them to breathe fire. Cross #1 Hungarian Horntail (A) X Norwegian Ridgeback (B) = F1: All Sweet Breath Cross #2 Romanian Longhorn (C) X Swedish Shortsnout (D) = F1: All Sweet Breath Cross #3 Swedish Shortsnout (D) X Norwegian Ridgeback (B) = F1: All Firebreathing Cross #4 Romanian Longhorn (C) X Hungarian Horntail (A) = F1: All Firebreathing How many genes are involved in creating a firebreathing phenotype? Group the dragons (A, B, C, and D) as to which contain mutations in the different genes. There are 2 genes, A and C have mutations in the same gene, as do B and D. Problem 6. A) Construct a map of the deletions that fits the data in this table 1 _________ 2 __________ 3 _______________ 4 ______ 5 ___________________ B) Draw a map that includes both the deletion and point mutations. 1 _________ 2 __________ 3 _______________ 4 ______ 5 ___________________ c e,d a b C) Why do d and e point mutants yielded the same result? Which of the following are the possible explanations for this? Circle all the possible answer. i. They are point mutations in the same nucleotide ii. They are not in the same complementation group iii. They are point mutations in different nucleotides but they both overlap with the same deletion mutants. iv. It just happened by chance that they yielded the same result

Problem 7. You have four known deletion mutants for a single gene: W, X, Y and Z. Point mutations 1, 2, 3, 4, 5, and 6 are all mutations in the same complementation group. Based on the recombination tests shown in the table below, draw map showing the deletions and point mutations. Please make the map as accurate as possible.

_____________*____*___*__*__________*___*___________ X______ Y_________________ Z_________________ W ______

Problem 8. A) Take those strains that did not grow in minimal media and try to grow them in minimal media + lysine. If they now grow, you know that they are auxotrophic for lysine. B) Complementation tests can reveal how many different genes there are. C) 1 3 2 4 B > D > A > C > lysine Problem 9. A) Mutant Strains arg-F arg-G arg-H arg-F; arg-G arg-F, arg-H arg-G, arg-H arg-F, arg-G, arg-H

Compounds supplementing minimal media Ornithine Citrulline Arg-Succ Arginine + + + + + + + + + + +

B) You have mixed up the vials of your double and triple mutant strains (which have been growing in complete media) and discover that there is one vial that you forgot to label. You find that spores from that vial grow on minimal media supplemented with arginine, but not on media supplemented with ornithine, citrulline or arginino-succinate. List all of the possible strains that this could be. 1. arg-F, arg-H 2. arg-G, arg-H 3. arg-F, arg-G, arg-H C) You cross this mystery strain to the Arg-F single mutant to create a diploid. This diploid grows on minimal media. What was the mystery strain? The strain is arg-G, arg-H D) If you cross the mystery strain to the Arg-G mutant, which compounds will the resulting diploid be able to grow on? Arginino-Succinate and Arginine

Problem 10. If you insert an extra nucleotide at position A, what will be the phenotype of an animal homozygous for this mutation? (Please do not invoke any obscure phenomena or concepts we have not talked about in classthese questions are just as straight-forward as they appear!) Defective tail, but otherwise wild-type If you insert a nucleotide at position C, what will be the homozygous phenotype? Wild-type If you insert a nucleotide at position D, what will be the homozygous phenotype? Infertile If you insert a nucleotide at position C, and take one away from position D, what will be the homozygous phenotype? Infertile If you insert a nucleotide at positions A and C, what will be the homozygous phenotype? Defective tail B) If you insert a nucleotide at position A, how might you be able to suppress the mutant phenotype at position B? Remove a nucleotide at position B If you add two nucleotides at position B, name two distinct alterations you could make at position A that would suppress the phenotype. 1. Add a nucleotide at position A 2. Remove two nucleotides at position A C) You find that you can suppress a mutation at position D by removing a nucleotide at position E, but not by removing one at position F. What does this tell you about the structure of the Fertilin gene? The region between E and F is critical for function, but the region between D and E is not.

Problem 11.
The cylons were created by man. They rebelled. They evolved. There are many copies. And they have a plan Cylon models affectionately known as skinjobs are part machine, part organic they look and feel human. In order to increase our knowledge about cylons (and perhaps spot sleeper agents hiding among us), Dr. Gaius Baltar has given you DNA samples of known cylons. You run a series of experiments to learn about cylon gene expression. 1) You discover the cylons do not have a triplet genetic code. Four nucleotides make up a codon in the cylon genome. How many possible cylon codons are there? 256 2) Stop codons have the same first three letters as in humans; the fourth is a wobble position (i.e. stop codons = UAAN, UAGN, UGAN). How many stop codons are in the following DNA sequence? 5 GTACGTGCCTTATTCGATCGATC 3 3 CATGCACGGAATAAGCTAGCTAG 5 One stop codon 3) The following mRNA sequence encodes the polypeptide His-His-Glu-Lys: CAUGCACGGAAUAAGC A mutation is induced that encodes the polypeptide His-His-STOP. What kind of mutation is responsible?

Insertion of U at position 9 or substitution G > U at position 9

Problem 12. While working in the lab, you find six deletion mutants of Neurospora crassa that are auxotrophic for lysine. The A and spores for each mutant are mated with each other to form a dikaryon (a diploid cell) and plated on minimal media. A) Assuming you made no errors while performing the crosses, fill in the expected outcomes of yet to be completed complementation tests. (+ = growth on minimal media, - = no growth on minimal media)

1 2 3 4 5 6 1 - 2 - - 3 + + - 4 + + + - 5 + + - + - 6 - - + + + -

How many genes are important for lysine production? _____3_______

B) You find four new mutants in the same complementation group that are auxotrophic for lysine and appear to be deletions, and cross these mutants pair wise to make diploids that are heterozygous for both deletions. You induce recombination in these mitotically dividing diploid cells by exposing them to UV light, and find that now some cells can grow on minimal media. Construct a map of the four deletions based on results in the table below. (+ = growth on minimal media, - = no growth on minimal media) (4 points)

I II III IV

I - + - +

II + - - -

III - - - +

IV + - + -

IV ______ II _________________ III _____________ I ______

Problem continues on the next page

C) You were also able to find 6 point mutants (a-f) in the same gene that were also lysine auxotrophs. You crossed them with the deletions found in part B and plated the diploids on minimal media. The results are shown in the chart below. Construct a map with both deletions and point mutations.

I II III IV

a + - - +
B E

b + - + -
A

c - + - +
D,F

d + + - +
C

e + - + +

f + + - +

IV ______ II _________________ III _________________ I ______

D) The relative locations of point mutants d and f cannot be distinguished from the experiments youve done. How could you do an experiment, involving recombination, to distinguish the order of d and f on the chromosome? Describe this briefly. (Hint: youll have to use two different diploids in this experiment) Mate point mutations d and f separately to another point mutation and look for the recombination between the new point mutation and d and the new point mutation and f. If the recombination frequencies are the same, d and f are mutations in the same nucleotide. If the recombination frequencies are different, then d and f are mutations in different nucleotides of within deletion III and you can tell the relative order because the one with the higher recombination frequency is further away from the other mutation. This would also work if you looked for recombination between d and f and another deletion.

Problem 13. You discover a new compound that yeast require for survival. To find genes involved in the synthesis of this compound (compound X) you have screened for mutants that cannot grow on minimal media, but can grown on minimal media + compound X. You find 10 mutants and perform a complementation tests. The results are shown below (+ = growth, - = no growth). 1 2 3 4 5 6 7 8 9 10 1 2 + 3 + 4 + + 5 + + + + 6 + + + + 7 + + + + 8 + + + + + + + 9 + + + + + + 10 + + + + + + + + -

A) How many genes are in your mutant collection? 4 genes B) Which mutations are in the same genes? 1, 4 2, 3, 7 5, 6, 9 8, 10 You know that the earliest precursor for compound X is compound Y. There are 5 other compounds that could potentially be involved in the pathway (L, M, N, O, P). To determine if, and in what order, these compounds are involved in the pathway you grow your mutants from above on minimal media + one of the compounds. The results are below. L M N O P X Y 1 + + 2 + + + 3 + + + 4 + + 5 + + + + 6 + + + + 7 + + + 8 + 9 + + + + 10 + Problem continues on the next page

C) Given the results reported in the chart on the previous page, draw the biosynthetic pathway for compound X indicating which mutations correspond to which genes in the pathway. 5,6,9 2,3,7 1,4 P M 8,10 X

D) You have constructed several double mutant strains. Indicate whether or not these double mutants would grow on minimal media + the following compounds. (3 points) L M N O P X Y 1, 2 + + 1, 4 5, 10 + + + -

Problem 14. On a planet in a galaxy far away you discover life. Proteins on this planet are constructed from 200 unique amino acids; however, DNA on this planet is made up of the same 4 nucleotides as ours. A) What is the minimum number of bases per codon necessary for this system? 4 (4x4x4x4=256, which is more than enough to make 200 amino acids) B) Assuming the number of base pairs per codon you calculated in part A is true for the organisms on this planet, how many possible reading frames are there in double stranded DNA? In other words, if you dont know where a start codon is, how many possible ways could you potentially read a double stranded piece of DNA? (3 points) 8 (4 possible reading frames per strand) Coding sequence of Gene X

C) Again assuming the number of base pairs per codon in part A is accurate, how many base pairs would you need to add at position B in the gene above to rescue the insertion of a base pair at position A? 3 (1+3=4, restoring the frame) D) You find that the precise sequence of the region between C and D is vitally important for the function of protein X encoded by this gene. If a base pair is deleted at A, list all of the positions where insertions of nucleotides could rescue the function of the protein B and C, although full credit was given for the answer A, B, and C or anywhere between A and C. E) Again assuming the codon length in Part A, if you generated deletions in Gene X, which would be more likely to destroy the function of Protein X? Circle the best answer below. 1. A 12 base pair deletion between A and B 2. A 9 base pair deletion between B and C (This would throw the messasge out-of-frame before the important part of the gene) 3. A 5 base pair deletion upstream of the start codon 4. An 11 base pair deletion between E and the end of the gene