FILL IN YOUR NAME AND STUDENT ID ON YOUR SCANTRON RIGHT NOW!!

NAME___________________________________ Last First ID#_____________________________

BIO SCI 97, Lecture Section D, MWF 10-11a

EXAM 1, OCT. 9, 2009

RECORD ALL ANSWERS ON YOUR SCANTRON FORM HANDED OUT IN CLASS. YOU MUST USE THIS FORM. MAKE SURE THAT YOU BUBBLE IN YOUR STUDENT ID # AND THE VERSION OF THE EXAM (A, B, C) AS ANSWER #1 ON THE SCANTRON. Also write your name on at least the first page of the exam. You must turn in your exam before you leave. You may tear off the last page of your exam and take it with you so that you know how you answered each question when the key is posted. AT THE END OF THE EXAM: (a) Be sure your name and ID are on the first page of the exam and your Scantron. (b) Make sure that your test version (A, B, C) is bubbled in on your Scantron as the answer to Question #1. (c) Bring your exam to the front, show your ID to the person collecting exams. (d) Leave through the lower doors, and remain silent until you leave the room. The exam key will be posted by the end of the day. Grading concerns: A reasoned description of why you feel your chosen answer is correct and/or why the posted answer is deficient should be E-MAILED to Dr. Abbott. Academic dishonesty (cheating) will not be tolerated in any form. The following are the EXAM RULES: 1) You must sit in your assigned seat with your ID on the desk and face up. 2) The ONLY items allowed on your desk in addition to the exam are: student ID (removed from any covers/cases) pencil, and an eraser. NO calculators. YOU MAY NOT BRING NOTES INTO THE EXAM IN ANY FORM. 3) You may not leave your seat (unless directed by a proctor) except to turn in your exam. 4) No questions will be answered by proctors or the instructors during the exam. 5) Your exam must be completed by you alonekeep your eyes on your own paper and no discussion with other students. Shield your own answers from other students. 6) NO baseball caps, phones, pagers, waterbottles, or bookbags are to be out during the exam. TURN RINGERS AND ALARMS OFF. These items must be UNDER your seat. 7) When the instructor declares the exam is over, there is to be NO WRITING. 8) You must sign this page to indicate that you understand these rules. IF YOU DO NOT SIGN BELOW, WE WILL NOT GRADE YOUR EXAM. FAILURE TO FOLLOW ANY OF THESE RULES MAY RESULT IN AN F ON THE EXAM OR IN THE COURSE FOR INSTANCES OF EXCEPTIONAL DISHONESTY. DO NOT TEST OUR RESOLUTION TO ADMINISTER A FAIR EXAM BY CHEATING. I UNDERSTAND THESE RULES AND AGREE TO FOLLOW THEM: _________________________________

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

INSTRUCTIONS: There is only one correct answer for each question. There are 22 questions (21 really, question 1 is your exam version) and 7 pages in the exam.

1. You have exam version A. Fill in A as the answer to question 1.

2. Which of the following statements about PCR is TRUE? a) PCR depends on fluorescently labeled dideoxynucleotides to amplify the signal. b) PCR uses a bacterial polymerase to synthesize DNA. c) PCR uses short RNA primers. d) The melting point of PCR primers determines the temperature of the extension stage. e) PCR can only be performed on eukaryotic DNA. 3. Which of the following statements about frameshift mutations is TRUE? a) They cause the ribosomal subunits to treat four nucleotides as a codon rather than using the normal three nucleotide codons. b) They are caused by mutations in tRNA that lead to the wrong amino acid being covalently linked to the tRNA molecule. c) They cause the RNA polymerase to shift to using the sense strand as the template. d) They occur when one or two nucleotides are inserted or deleted from an exon. e) They cause protein synthesis to shift from the cytoplasm to the nucleus.

4. RNA polymerase knows where to start transcribing because: a) It finds an AUG start codon and begins synthesizing RNA 35 nucleotides upstream from that codon. b) It recognizes a double-stranded DNA sequence called the promoter. c) RNA polymerase uses the 3OH of the transcriptional primer to start polymerizing RNA. d) Every gene possesses the exact same nucleotides before the transcriptional start site. e) It compares the upstream sequence to a consensus RNA that is part of the RNA polymerase complex.

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

5. A piece of double stranded DNA with no mismatches is 15% cytosine. What are the percentages of the other nucleotides? a) b) c) d) e) 15% guanine, 70% adenine, 70% thymine 70% guanine, 35% adenine, 15% thymine 35% guanine, 15% adenine, 35% thymine 15% guanine, 35% adenine, 35% thymine None of the above are correct

6. Which of the following statements about DNA replication is TRUE? a) RNA primase adds a uracil when the template DNA base is a thymine. b) DNA polymerase III adds DNA nucleotides to the 3 phosphate of the RNA primer. c) DNA polymerase I replaces the RNA primer with DNA. d) DNA polymerase proofreads by removing an incorrectly base paired nucleotide from the template DNA strand. e) DNA ligase adds an adenine nucleotide when it seals the nick in the newly synthesized DNA. 7. You would like to amplify the DNA sequence shown below using PCR. Only the sense strand is shown. Design oligonucleotide primers that are 8 base pairs long to use in a PCR reaction that amplifies this whole piece of double stranded DNA. What are the melting temperatures (Tm) of the primers that you designed? DNA sequence: 5-ATGCTGTGCAAATGCGTAGTTCCGTATGTCGTTGACACATACATGTCAT-3 a) b) c) d) e) 30C and 30C 30C and 26C 18C and 16C 50C and 65C 24C and 22C

8. The sequence of an RNA transcript is 5 AUGUCGACCAGUUUCCCGA 3. The sequence of the template DNA strand 5 to 3 is: a) b) c) d) e) AGCCCTTTGACCAGCTGTA ATGTCGACCAGTTTCCCGA TACAGCTGGTCTTTGGGCT TCGGGAAACTGGTCGACAT TCGGGTTTCTGGTCGTCT

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

9. The following mRNA has been isolated from a new species of sea slug collected from a deep sea vent. Determine the sequence of the protein encoded by this mRNA. The sequence shown begins with the first RNA nucleotide after the 5 cap. mRNA: 5 CGUUUAGCAUGUUCUCCUCUGGUUAUAAGUGAG 3

a) b) c) d) e)

Met-Leu-Leu-Leu-Trp-Leu Met-Arg-Leu-Ala-Cys- Ser-Pro-Leu-Val-Ile-Ser-Glu Arg-Leu-Ala-Cys- Ser-Pro-Leu-Val-Ile-Ser-Glu Met-Phe-Ser-Ser-Gly-Tyr-Lys The protein sequence cannot be determined because every species uses a different genetic code.

10. Which of the following statements about telomeres is FALSE? a) Telomeres are produced using an RNA template that is part of the telomerase enzyme complex. b) Because telomerase is not expressed in most human cells, the telomeres become longer with each cell division. c) Telomeres protect chromosome ends from degradation. d) When telomeres are lost, chromosome fusions can occur. e) Proteins bind to telomeres and stabilize a structure called a t-loop.

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

11. Which of the following statements about the human genome is FALSE? The human genome is about 3 million base pairs of DNA. Each cell in your body contains your entire genome. Your genome matches that of your neighbor at 99.5% of the nucleotides. SNPs, or single nucleotide polymorphisms, can be used to track disease causing genes and to predict an individuals response to a drug. e) Only about 2% of your genome codes for proteins. a) b) c) d)

12. Which statement about DNA sequencing is TRUE? a) One sequencing reaction can provide the sequence of about 500-800 base pairs of DNA. b) Fluorescent nucleotides are used in DNA sequencing because they eliminate the need for electrophoresis to separate the products of the reaction. c) Automated DNA sequencers eliminate the need for primers in sequencing reactions allowing the genome to be sequenced more rapidly. d) DNA sequencing reactions are used amplify DNA 33 million fold. e) Chain terminating bases are RNA nucleotides that terminate the DNA sequencing reaction because they have a 2 hydroxyl group.

13. A DNA replication bubble is shown below:

Which of the following CORRECTLY identifies each of the components marked with letters? a) A: 5 end, B: leading strand, C: lagging strand, D: lagging strand b) A: 3 end, B: lagging strand, C: leading strand, D: lagging strand c) A: 5 end, B: lagging strand, C: leading strand, D: leading strand d) A: 3 end, B: lagging strand, C: leading strand, D: leading strand e) A: 5 end, B: leading strand, C: lagging strand, D: leading strand

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

14. Which of the following statements about tRNA is TRUE? a) b) c) d) e) A given tRNA can be charged with a variety of different amino acids. Aminoacyl tRNA synthetases are the translators of the genetic code. tRNA are transcribed by RNA polymerase II. The codon is found on the tRNA and the anti-codon is on the mRNA. There are 3 different STOP tRNA as there are 3 different STOP codons.

15. The Exon shuffle model refers to: a) The fact that alternative splicing shuffles the exons around and changes the order in which exons occur in the mature mRNA b) A mechanism for creating new genes over the course of evolution because exons generally encode discrete folding units or protein domains c) How over the course of evolution, exons are shuffled between species d) The fact that most of the primary transcript is discarded and shuffled into the degradative pathway e) The fact that introns are shuffled to a different area of the nucleus to prevent them from being translated into protein by the ribosome

16. Which of the following statements about centromeres is TRUE? a) Centromeres can be seen in interphase nuclei without special stains. b) Centromeres are single stranded but stabilized in loops by proteins. c) Centromeric genes are transcribed by DNA polymerase II and expressed only during metaphase. d) Centromeres are a form of heterochromatin. e) Centromeres are at the center of the DNA sequences that bind to histones. 17. Which of the following statements about the Human Genome Project is FALSE? a) b) c) d) Only protein coding genes were sequenced. The human genome sequence is accessible online for free. The shotgun sequencing technique was used to sequence the genome. Automated DNA sequencing machines were very important in sequencing the genome quickly. e) Overlapping fragments of DNA were lined up by computers to determine the complete sequence of each chromosome.

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

18. Which of the following statements is TRUE? a) In the cell, dideoxynucleotides are utilized to stop DNA polymerization on the lagging strand at the next Okazaki fragmentthis is very similar to how we use them to terminate chains in a sequencing reaction. b) DNA sequencing is most efficient when the concentration of dideoxynucleotides is much higher than the concentration of deoxynucleotides. c) Unlike PCR, you do not need any sequence information about the template DNA in a DNA sequencing reaction. d) The DNA sequence can be read from the chromatogram. e) Unlike DNA replication in the cell, DNA sequencing reactions copy DNA without breaking the hydrogen bonds between the two strands of DNA.

19. Which of the following statements is FALSE? a) Although tRNA are transcribed by RNA polymerase III, they are translated by the same ribosomes as mRNA. b) Spliceosomes remove non-coding introns. c) Like DNA, RNA can be double-strandedRNA molecules can fold to allow intramolecular base pairing. d) The deoxyribose sugar in a DNA nucleotide is linked to the nitrogencontaining base by a covalent bond. e) Ribosomes are composed of both RNA and protein.

20. Which statement is TRUE? a) Alternative splicing is a mechanism by which exons can be discarded along with the introns. b) Alternative splicing means that introns are sometimes retained in the mature mRNA. c) Alternative splicing is the splicing that occurs in rRNA and tRNA molecules. d) Alternative splicing is the scientific name for the Exon Shuffle Model. e) Alternative splicing occurs when the promoter is excised from the primary transcript.

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

21. Which of the following statements is FALSE? a) All SNPs cause changes in protein sequence. b) SNP stands for single nucleotide polymorphism. c) Knowing what SNPs a patient carries will someday allow individualized medicine. d) There are at least 1 million SNPs in the Human Genome. e) Some SNPs are more common in certain ethnic groups.

22. Which of the following statements about chromatin is FALSE? a) b) c) d) e) Proteins are an important component of chromatin. Chromatin is present in all stages of the cell cycle. 75-90% of the DNA in a human cell is associated with histones. Histones have a negative charge to attract DNA. The 30 nm fiber is one form of chromatin.

Midterm 1 VERSION A BIO97 Section D MWF 10-11am

NAME: ________________________________ ID#: _________________________________

ANSWER SHEET: This is the only page of the exam that you may take with you. Please tear it off the back and turn in the rest of your exam with your Scantron. Your Scantron will not be graded unless we also have your exam! 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. a a a a a a a a a a a a a a a a a a a a a b b b b b b b b b b b b b b b b b b b b c c c c c c c c c c c c c c c c c c c c d d d d d d d d d d d d d d d d d d d d e e e e e e e e e e e e e e e e e e e e 22. a b c d e