Veterinary Immunology and Immunopathology 103 (2005) 101111 www.elsevier.

com/locate/vetimm

Cytokine mRNA quantication in histologically normal canine duodenal mucosa by real-time RT-PCR
I.R. Petersa,*, C.R. Helpsa, E.L. Calvertb, E.J. Halla, M.J. Daya
a

School of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK b WALTHAM Centre, Waltham on the Wolds, Leicestershire LE14 4RT, UK Received 23 December 2003; received in revised form 2 July 2004; accepted 26 August 2004

Abstract CD4+ T helper cells are important for the regulation of immune responses in the intestinal mucosa and they exert their effects through the secretion of pro-inammatory and immunomodulatory cytokines. Human patients with inammatory bowel diseases (IBD) such as Crohns disease and ulcerative colitis have alterations in the normal intestinal cytokine prole. These cytokine abnormalities have been shown at both the protein and messenger RNA (mRNA) level. The role that mucosal cytokines play in the pathogenesis of canine IBD has only been investigated using semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) analysis of gut tissue, as cytokine antisera are not available for this species. Real-time RT-PCR has been recognised to be a more accurate and sensitive method of quantifying mRNA transcripts, so in this study TaqMan real-time RT-PCR assays for the quantication of mRNA encoding IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL18, IFN-g, TNF-a and TGF-b in canine intestinal mucosa were developed. The amount of these templates was quantied in normal canine duodenal mucosa (n = 8). IL-18, TGF-b and TNF-a were found to be the most abundant transcripts, with IL-10 and IFN-g present at levels approximately 10-fold less. IL-2, IL-4, IL-5, IL-6 and IL-12 were the least abundant templates, with some RNA samples having no detectable mRNA copies. The methods developed in this study will form the basis of further work investigating the expression of mRNA encoding cytokines in mucosa from dogs with chronic enteropathies. In addition, these real-time PCR assays can also be used for the quantication of canine cytokine mRNA in other diseases. # 2004 Elsevier B.V. All rights reserved.
Keywords: Real-time RT-PCR; TaqMan assays; Dog; Duodenum; Cytokine; Interleukin

Abbreviations: CD, Crohns disease; cDNA, complementary DNA; Ct, threshold cycle; gDNA, genomic DNA; IBD, inammatory bowel disease; mRNA, messenger RNA; RT-PCR, reverse transcriptase polymerase chain reaction; UC, ulcerative colitis * Corresponding author. Tel.: +44 117 928 9230; fax: +44 117 928 9505. E-mail address: i.r.peters@bristol.ac.uk (I.R. Peters).

1. Introduction Cytokines play an important role in mucosal humoral and cell-mediated immune responses. These proteins alter the pattern of gene expression within a target cell upon interaction with a specic receptor on

0165-2427/$ see front matter # 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2004.08.020

102

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

its surface (Husband et al., 1999). CD4+ T helper cells are important for the regulation of immune responses in the intestinal mucosa and they play a role in the pathogenesis of human IBD (Groux et al., 1997; Papadakis and Targan, 2000; Strober et al., 1997, 2002). These cells exert their effects through the secretion of pro-inammatory (Th1: IL-2, IL-12, IFN-g and TNF-a; Th2: IL-4 and IL-6) or immunomodulatory (IL-10 and TGF-b) cytokines (Papadakis and Targan, 2000; Strober et al., 1997, 2002). Study of cytokine proles within the gut mucosa has led to new insights into the immunopathogenesis of the human inammatory enteropathies Crohns disease and ulcerative colitis. Crohns disease (CD) has been associated with a predominance of Th1 cytokines whereas ulcerative colitis (UC) has been associated with a Th2 response (Fuss et al., 1996; Niessner and Volk, 1995; Plevy et al., 1997). Studies describing a cytokine prole difference (Th1 versus Th2) between normal gut mucosa and that from CD and UC patients have utilised both molecular and protein-based approaches. The latter techniques are not presently available for canine studies as only a few antibodies to canine cytokines have been described and their utility has not yet been completely assessed. To date, the role that mucosal cytokines play in the pathogenesis of canine IBD has been determined using semi-quantitative RT-PCR with gel-based quantication to measure cytokine mRNA from mucosal biopsies (German et al., 2000; Ridyard et al., 2002). Real-time RT-PCR has been recognised to be a more accurate and sensitive method of quantifying messenger RNA (mRNA) transcripts (Bustin, 2000, 2002) as this method allows the detection of amplicon accumulation as it is formed rather than by conventional end-point analysis. Real-time measurement of amplicon accumulation also allows determination of reaction efciency and thus permits the selection of more sensitive assays. This technique has been used to measure cytokine proles in tissue from human patients with ulcerative colitis (UC) and Crohns disease (CD) (Autschbach et al., 2002). The aim of the present study was to develop TaqMan real-time RT-PCR assays for the quantication of mRNA encoding IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, IFN-g, TNF-a and TGF-b in canine

intestinal mucosa. These assays were subsequently used to quantify the amount of these templates present within normal canine duodenal mucosa.

2. Materials and methods 2.1. Patients Samples of duodenal mucosa were obtained from eight dogs presented to the School of Clinical Veterinary Science, University of Bristol for clinical investigation. Six of these dogs had primary gastrooesophageal disease and the duodenum was sampled by endoscopic biopsy as part of the diagnostic investigation. In two further cases, duodenal tissue was collected from dogs euthanased for non-GI disease and examined postmortem. None of these animals had a history of diarrhoea and microscopic examination of contemporaneously collected tissue samples revealed normal gut histology in each case. Breeds represented included one each of rough collie, lurcher, greyhound, West Highland white terrier, whippet, golden retriever, Staffordshire bull terrier and crossbred. The median age was 24 months (range: 696 months) with four females (two neutered) and four males (three neutered). The diagnoses for the six dogs sampled by endoscopy were chronic gastritis (n = 5) and megaoesophagus (n = 1). 2.2. Sample collection Dogs were prepared for endoscopy by withholding food for 1824 h. Gastroduodenoscopy was performed under general anaesthesia using a GIFXQ230 exible video endoscope (Olympus Keymed, Southend-on-Sea, UK). Multiple mucosal biopsies were taken at the level of the caudal duodenal exure using FB-25K biopsy forceps (Olympus Keymed). Samples for histology were placed in 10% neutral buffered formalin. Biopsies for mRNA analysis were placed in a 1.0 ml cryotube (NUNC, Fischer Scientic Ltd., Loughborough, Leicestershire), snap frozen in liquid nitrogen and stored at 70 8C. In the case of two control dogs, samples were obtained from the descending duodenum within 5 min of euthanasia. Samples were taken with biopsy forceps from the equivalent area to the vital samples, snap

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

103

frozen and stored as above. Full thickness samples were taken for histological examination. 2.3. RNA isolation Two endoscopic biopsies (total tissue mass 10 19 mg) were added to 800 ml of lysis buffer (from isolation kit) in a green Ribolyser tube (Ribolyser System, Thermo-Hybaid Ltd.) and processed for 45 s at 6.0 m/s to homogenise biopsies. An aliquot of 600 ml of this homogenate was added to a nucleasefree Eppendorf tube and the sample was processed through the RNeasy Isolation System (Qiagen Ltd., Crawley, UK) as per the manufacturers protocol. The RNA was eluted in 2 ml 30 ml of nuclease-free water. DNase digestion of the RNA solution was carried out using amplication grade DNase I (Invitrogen Ltd., Paisley, Scotland) as per the manufacturers instructions with the sample incubated for 15 min at room temperature prior to addition of the EDTA. In order to remove any residual DNase and EDTA from the puried RNA, it was passed a second time through the RNeasy Isolation System (Qiagen Ltd.) using the RNA clean-up protocol. An on-column DNase digestion step was included during this process using the RNase-Free DNase Set (Qiagen Ltd.). The nal RNA was eluted in 2 ml 50 ml of nuclease-free water and stored at 70 8C before use. A sample containing genomic DNA (gDNA) was obtained by omitting the DNase digestion steps from the RNA isolation protocol. 2.4. Primer and probe design Primers and probes were designed using primer 3 (Rozen and Skaletzky, 2000) (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) using the canine specic GenBank sequences for IL-2 (D30710), IL-4 (AF187322), IL-5 (AF331919), IL-6 (U12234), IL-10 (U33843), IL-12p40 (AF091134), IL-18 (Y11133). IFN-g (AF126247), TNF-a (Z70046) and TGF-b (L34956). The G3PDH specic assay was the same as that used previously (Peters et al., 2003). The primer and probe sets were designed such that the annealing temperatures of the primers were 60 8C and the probes 810 8C higher, and that a product of

between 80 and 200 bases pairs in length would be obtained (Table 1). In order to minimise primer dimer formation, the maximum self-complementarity was 6 and the maximum 30 self-complementarity was 2. The targets amplied by the primer pairs were characterised using M-fold (SantaLucia, 1998) (http:// bioinfo.math.rpi.edu/$mfold/dna/form1.cgi) in order to predict the nature of any secondary structures which may form at the site of primer or probe binding. Primer or probe sequences, which bound at the site of a predicted loop, were discarded. Primers were synthesised by Invitrogen Ltd. and probes by Cruachem Ltd. (Glasgow, Scotland) or Oswell Laboratory (Southampton, UK) (IL-4, IL-10 and IL-18). Primers and probes were reconstituted in nuclease-free water before use. 2.5. One tube/two enzyme RT-PCR Gene specic RT-PCR amplication of G3PDH, TNF-a and TGF-b was performed using the platinum quantitative RT-PCR thermoscript one-step system (Invitrogen Ltd.) using 5 ml of RNA and 0.2 mM of the reverse primer, 0.1 mM of probe and 3 mM MgSO4 in a nal volume of 25 ml. All reactants were mixed together as a master mix and aliquotted into a 96 well PCR plate (Thermofast, Abgene) prior to addition of 5 ml of the sample RNA. No-RT reactions were made up in a similar manner except the thermoscript enzyme mix was substituted with 2 units of platinum Taq DNA polymerase (Invitrogen Ltd.). Each sample was run in triplicate, as well as noRT controls for G3PDH in triplicate and TNF-a/TGFb singly with the reactions for each target performed in the same plate. All reactions were made up on ice and placed in the thermocycler held at the initial incubation temperature to minimise primerdimer formation. The samples were placed in an MJ Research PTC200 DNA engine (GRI) heated to 50 8C for 20 min, then 85 8C for 5 min and quenched on ice. The reactions were opened and 0.2 mM of the forward primer was added in a suitable volume of RT buffer and nuclease free water to increase the reaction volume to 30 ml. The samples were resealed and placed in an iCycler IQ (Bio-Rad Laboratories Ltd.) at 95 8C for 5 min and then 45 cycles of 95 8C for

104 I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

Table 1 Primer and probe sequences used for cytokine quantication by real-time RT-PCR Primer set Product Forward primer (50 30 ) length G3PDHa IL-2a IL-4b IL-5a IL-6a IL-10b IL-12p40a IL-18b IFN-ga TNF-aa TGF-ba 90 86 123 158 102 101 109 139 113 84 96 TCAACGGATTTGGCCGTATTGG GCATCGCACTGACGCTTGTA GCTCCAAAGAACACAAGCGA GACTGGTGGCAGAGACCTTGA CTCTCCACAAGCGCCTTCTC CGACCCAGACATCAAGAACC CAGCAGAGAGGGTCAGAGTGG TTAAAGCGGAAAGTGATGAAGG TCAACCCCTTCTCGCCACT CTGGAGTCGTGAGGCAGTG CTGGAGTCGTGAGGCAGTG Reverse primer (50 30 ) TGAAGGGGTCATTGATGGCG TTGCTCCATCTGTTGCTCTGTT CATGCTGCTGAGGTTCCTGT CGTGGGCAGTTTGGTTCTTC TGAAGTGGCATCATCCTTGG CACAGGGAAGAAATCGGTGA ACGACCTCGATGGGTAGGC TCGGGCATATCCTCAAATACA GCTGCCTACTTGGTCCCTGA AGGGCTCTTGATGGCAGAGA GCAGTGTGTTATCTTTGCTGTCA Probe sequence (50 30 ) 50 Fluorophore Hex FAM Texas red FAM FAM FAM FAM Texas red FAM FAM FAM CAGGGCTGCTTTTAACTCTGGCAAAGTGGA TCGCAAACAGTGCACCTATTACTTCAA TGCAGAGCTGCTACTGTACTGCGGC CGAACTTGGCTGATAGGCGATGG TGGGGCTGCTCCTGGTGATG TCCCTGGGAGAGAAGCTCAAGACCC TGGAGTGTCAGGAGGGCAGTGC GAAATTTGAACGACCAAGTCCTCTTCG CCCCACCCGAACCTCTTCCT CGCTTCGCCGTCTCCTACCA TTTCGCCTCAGTGCCCACTG 30 Quencher BHQ-1 BHQ-1 ELLE BHQ-1 BHQ-1 Methyl-Red BHQ-1 ELLE BHQ-1 BHQ-1 BHQ-1

The combinations of forward and reverse primers as well as the probe used in the RT-PCR reactions. All primers were desalted when puried and the probes were HPLC puried. a Primers were synthesised by Invitrogen Ltd. and probes by Cruachem Ltd. b Primers were synthesised by Invitrogen Ltd. and probes by Oswell Laboratory.

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

105

10 s and 60 8C for 15 s during which the uorescence data were collected. Threshold cycle (Ct) values were calculated as the cycle when the uorescence of the sample exceeded a threshold level corresponding to 10 S.D. from the mean of the baseline uorescence. The nuclease-free water passed through the RNA isolation was analysed in a similar manner as all other samples to control for sample contamination. Negative results were conrmed by repetition of the RT-PCR procedure. A negative control of nuclease-free water and a positive control sample with a known Ct value were included with all sample runs. 2.6. Two tube/two enzyme RT-PCR Two-step real-time RT-PCR was used to amplify IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, IFN-g and G3PDH. First strand complementary DNA (cDNA) synthesis was carried out using 500 ng of random hexamers using the ImProm-II Reverse Transcription System (Promega Corporation) using 10 ml RNA in a nal volume of 20 ml. All reactions were set up according to the manufacturers instructions giving a nal magnesium chloride concentration of 3 mM. cDNA synthesis was carried out by mixing 10 ml of RNA with the random primers in a reaction tube. Samples were heated to 70 8C for 5 min in the PTC200 DNA engine (GRI) before cooling to 4 8C for 5 min. Tubes were placed in a cold block before addition of the reaction buffer, dNTPs, magnesium chloride, reverse transcriptase enzyme mix and water to make a total volume of 20 ml. Reverse transcription was completed by heating the samples to 25 8C for 5 min, 47 8C for 30 min and nally 75 8C for 10 min in the PTC-200 DNA engine (GRI). No-RT controls were performed by omitting addition of the reverse transcriptase enzyme, and no template controls were performed by addition of nuclease-free water. Duplicate RT reactions were performed for each RNA sample. All products were diluted to a nal volume of 100 ml (1:5 dilution) using EB Buffer (10 mM Tris HCl pH 8.4, Qiagen Ltd.) and then stored at 20 8C for future use. Real-time PCR was performed using HotStar-Taq Master mix (Qiagen Ltd.). Gene specic amplication

was performed using 0.2 mM of each primer, 0.1 mM of probe and 5 ml of diluted cDNA in a nal volume of 25 ml. Magnesium chloride concentrations were adjusted to 4.5 mM in the nal reaction by addition of 25 mM MgCl2. Sample incubations were performed in an iCycler IQ (Bio-Rad Laboratories Ltd.) at 95 8C for 15 min and then 45 cycles of 95 8C for 10 s and 60 8C for 15 s during which the uorescence data were collected. Ct values were calculated as before. Positive and negative controls were performed as detailed above. Samples were grouped together to minimise the number of sample runs with only a single cytokine quantied on each plate. Duplicate PCR reactions were run for each RT repeat resulting in a total of four Ct values for each RNA sample. A mean Ct value was calculated for each sample using all measurable values. 2.7. Reaction efciency Using the platinum quantitative RT-PCR thermoscript one-step system, a 10-fold serial RNA dilution curve was produced in triplicate to calculate the reaction efciency for TNF-a, TGF-b and G3PDH (Fig. 1). The ImProm-II reverse transcription system combined with the HotStar-Taq Master mix with a 10fold serial RNA dilution curve was used to calculate the reaction efciency for IL-18 and G3PDH (Fig. 1). Ten-fold serial dilution curves of puried PCR product were produced for IL-2, IL-4, IL-5, IL-6, IL-10, IL12p40 and IFN-g using the HotStar-Taq Master mix with the standard PCR protocol in triplicate for each reaction product (Fig. 2). A master mix was made up and aliquotted into the PCR plate prior to addition of the template into each reaction tube individually. A graph of threshold cycle (Ct) versus log10 relative copy number of the sample from the dilution series was produced. The slope of this graph was used to determine the reaction efciency: efficiency 101=slope 1 2.8. Relative copy number calculation G3PDH mRNA was quantied using both the onestep and two-step protocols. The G3PDH correction

106

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

Fig. 1. RNA standard curves for TNF-a, TGF-b, G3PDH and IL-18. Standard curves were produced from triplicate reactions for TNF-a, TGFb, G3PDH and IL-18 with a 10-fold serial dilution of RNA isolated from duodenal mucosal biopsies. The one tube/two enzyme protocol was used for TNF-a, G3PDH (not shown) and TGF-b, whereas the two tube/two-step RT-PCR protocol was used for G3PDH and IL-18. The G3PDH assay produced similar reaction efciencies and dilution curves when assayed with the two protocols.

value was determined by normalising all measurements to a Ct of 20 to give a G3PDH correction value. The Ct measurement for each gene product was then corrected by adding the G3PDH correction value to the mean Ct value: G3PDH correction value 20 mean Ct G3PDH RT-PCR corrected target Ct mean Ct G3PDH correction value The RT-PCR was run for a maximum of 45 cycles, therefore a relative copy number for a sample with this value was set as 1. Samples with no measured Ct were assigned a value of 0. All corrected Ct values were less than 45. The relative number of gene copies in the sample was calculated using the following equations,

as all the reactions were approximately 100% efcient: DCt 45 corrected Ct value of the sample relative copy number 2DCt for a 100% efficient reaction This method of relative copy number calculation allowed comparison between dogs for a single gene product but also gave an impression of the relative abundance of the target in relation to the others. It is important to note that direct comparison of copy number cannot be made as the same Ct value in separate RT-PCR assays does not necessarily indicate the same number of copies in the samples, although they are likely to be in the same order of magnitude (e.g. a gene target with a mean Ct of 20 is much more abundant than one with a mean Ct of 30).

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

107

Fig. 2. Standard curves for IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p40 and IFN-g. Standard curves were produced from triplicate reactions with a 10-fold dilution series of puried PCR products. This template was used due to the lack of an RNA sample with sufcient gene copies. The HotStar-Taq Master mix was used with the standard PCR protocol.

108

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111 Table 2 Cytokine primer and probe sets with genomic DNA Sample DNA 1 DNA 2 16.9 25.7 28.2 Negative 25.5 Negative 26.7 Negative 25.7 Negative Negative

3. Results 3.1. RT-PCR optimisation A range of primer annealing temperatures was tested for each primer set in the range from 55 to 70 8C using the gradient function on the iCycler. All reactions were 100% efcient at 60 8C with no improvement in sensitivity at higher or lower annealing temperatures. The magnesium sulphate concentration was not increased from 3 mM in the thermoscript one-step system as this increased primerdimer formation (data not shown). The HotStar-Taq Master mix was tested with magnesium chloride concentrations of 3, 4.5 and 6 mM and a concentration of 4.5 mM was found to improve the change in uorescence of the probes leading to an earlier Ct value when tested on the primer and probe sets (data not shown). The primer and probe sets were tested against a sample which had not been treated with DNAse and thus contained gDNA (Table 2). The intron structure of the cytokine templates was unknown, therefore this allowed identication of those reactions which could detect gDNA. The assays for IL-5, IL-10, IL-18, TNFa and TGF-b gave negative results when tested against gDNA. Assays for IL-2, IL-4, IL-6 and IFN-g were able to detect genomic DNA but the Ct values were approximately eight cycles later than that of the G3PDH assay.

G3PDH IL-2 IL-4 IL-5 IL-6 IL-10 IL-12 IL-18 IFN-g TNF-a TGF-b

25.5 31.6 36.3 Negative 33.8 Negative 32.4 Negative 34 Negative Negative

The primer and probe sets were tested against two samples known to contain gDNA using the HotStar-Master mix. The G3PDH assay had a Ct value approximately eight cycles earlier than any of the other transcripts reecting the presence of pseudogenes. No-RT control reactions were run for all targets during the RT-PCR assay to control against quantication of gDNA.

Primerdimer formation was a problem with the cytokine assays run with the one tube/two enzyme RTPCR protocol, despite the delayed addition of the forward primer. This was likely due to primerdimer formation involving the reverse primer alone, as well as incomplete inactivation of the RT-enzyme by incubation at 85 8C for 5 min. This was not a problem with the TNF-a and TGF-b assays as these transcripts

Fig. 3. Relative copy number for cytokines in normal duodenal mucosa. The relative copy number for each of the RNA samples is shown for each cytokine target. The horizontal line corresponds to median of each group. The samples with a relative copy number of 0 had no detectable template but they had quantiable amounts of G3PDH mRNA.

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

109

were present at relatively high copy numbers. The two tube/two enzyme RT-PCR protocol was used for quantication of the other transcripts because random hexamers were used with the RT enzyme and the genespecic primers were not added until after it was inactivated, therefore preventing primerdimer formation. 3.2. Clinical samples Transcripts for IL-10, IL-12p40, IL-18, TNF-a and TGF-b could be quantied in all samples (Fig. 3). mRNA encoding IL-2, IL-4, IL-5, IL-6 and IFN-g was detected in 7/8, 7/8, 6/8, 6/8 and 7/8 samples, respectively. The samples with no detectable copies were not the same for each gene target. The 10 cytokine mRNA transcripts quantied in this study were present at different levels within the canine duodenal mucosa (Fig. 3). IL-18, TGF-b and TNF-a were the most abundant transcripts within canine duodenal mucosa. IL-10 and IFN-g were present at levels approximately 10-fold less than the most abundant transcripts. IL-2, IL-4, IL-5, IL-6 and IL-12 were the least abundant templates as some RNA samples had no detectable copies.

4. Discussion In this study real-time RT-PCR reactions were designed to measure tissue expression of mRNA encoding a panel of mucosal cytokines. Real-time RT-PCR is particularly useful for this purpose as it is a sensitive and reproducible technique that allows accurate quantication of these relatively rare templates. Some of the cytokine transcripts were present at relatively low copy numbers that would be unlikely to be detected by conventional gel quantication. The ability to produce a linear dilution curve over a wide range of template concentrations in such assays is important due to the wide variation in copy numbers within the samples measured. Loss of linearity of the dilution series in the more dilute samples due to primer dimer formation or poor enzyme performance would lead to underestimation of the copy numbers present within these samples. As many of the cytokine transcripts were present at low copy numbers, this could overestimate the differences between individuals.

These low copy number cytokines required welldesigned assays with good sensitivity for quantication. It was also important to eliminate any factors which could interfere with the assay, especially primerdimer formation and genomic DNA contamination. Elimination of gDNA contamination is important when utilising a housekeeper gene for normalisation, as genomic contamination is a signicant problem when housekeeper genes such as G3PDH (German et al., 2000; Overbergh et al., 1999) and b-actin (Overbergh et al., 1999; Stordeur et al., 2002) are used in RT-PCR, as these genes are associated with the presence of multiple pseudogenes (Hanauer and Mandel, 1984; Ng et al., 1985). DNase digestion either during the purication step (Mena et al., 2002) or on the puried RNA (Leutenegger et al., 1999; Mena et al., 2002; Stordeur et al., 2002) has been used to eliminate this problem. For these reasons, the two tube/two-step RT-PCR method and double DNase digestion were selected for the analyses described in this study. All assays were tested against gDNA as the intron positions within the target genes were unknown, preventing design of reactions which would not amplify gDNA. The assays for IL-5, IL-10, IL-18, TNF-a and TGF-b mRNA did not amplify gDNA, whereas the other assays had Ct values approximately eight cycles later than that of the G3PDH assay. This is probably due to the presence of the G3PDH pseudogenes resulting in many more copies of this target per cell compared with the other gene targets. The RNA samples in this study all had no-RT Ct values of greater than 33 for the G3PDH assay and all the other targets had negative results for the no-RT controls. All 10 cytokine mRNAs could be quantied in the majority of samples tested in this study. Samples which had a negative result were difcult to assign a value for their relative copy number, as the lowest number of gene copies which the assays could detect was unknown. Absolute quantication against a plasmid standard curve with a known number of gene copies allows the limit of detection of an assay to be determined. However, the use of a standard containing millions of plasmid gene copies to produce a dilution series increases the risk of cross-contamination. The sensitivity of real-time PCR means that only a few copies from such a standard need contaminate an RNA

110

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111

sample to invalidate any measurement made from it, especially since most of the cytokine templates were present at low copy numbers. It was because of this that the relative copy number approach was selected, as once contamination of the working environment occurs it can be exceedingly difcult to eliminate. Real-time PCR reactions which are 100% efcient against plasmid standard curves have been able to quantify templates at the level of 110 copies per PCR with Ct values of approximately 40 (unpublished data). Therefore, it was likely that samples with a Ct value between 40 and 45 using these cytokine assays had between 1 and 10 copies per PCR. Samples with a negative result were assigned a relative copy number of 0, with no correction for the G3PDH measurement. The variation in cytokine mRNA expression between the biopsies from the different animals examined in this study could be due to a combination of effects including, the number of immune cells present within the biopsy as well as the level of cytokine mRNA expression within each individual cell. It was impossible to individually quantify the numbers of cells added to each RNA extraction without the use of cell sorting techniques as the biopsies were disrupted during the extraction phase. Contemporaneously collected biopsies from these animals were examined by a single histopathologist and at the light microscopic level these were an homogenous group of samples with respect to lamina propria cellularity. Moreover, the biopsies used in this study were obtained endoscopically in a routine fashion by a single operator and comprised the relatively supercial mucosal layer of the gut. It is therefore likely that the variation in mRNA expression in these samples does reect that present within the immune cells themselves. The application of this method to diseased tissue which possesses a more variable immune cell inltrate would be more difcult, as differences in expression between individuals might be more clearly due to a combination of the change in the number of immune cells present and the levels of mRNA expression within them. IL-4 mRNA has previously been found in the duodenal mucosa of a relatively small number of dogs. This transcript was detected in 3 of 28 dogs quantied by gel-based conventional RT-PCR (German et al., 2000) and 2 of 23 dogs quantied by real-time RT-

PCR (Fujiwara et al., 2002). Similar low levels of IL-4 expression have been found in mucosal samples from human patients with Crohns disease and ulcerative colitis measured by real-time RT-PCR (Autschbach et al., 2002). In the present study IL-4 mRNA was detected in 7/8 RNA samples and this increased detection rate is likely due to the sensitivity of the methods used (e.g. conventional versus real-time) and/ or the enzyme systems used (e.g. one-step versus twostep RT-PCR). In summary, we have developed TaqMan real-time RT-PCR assays for the quantication of a panel of cytokines in canine duodenal mucosa. These assays had a sensitivity which allowed them to detect relatively small amounts of cytokine mRNA. Quantication of cytokine mRNA in samples of normal duodenal mucosa revealed that some cytokine mRNAs are relatively abundant (e.g. IL-18, TGF-b and TNFa), whereas others were present at very low copy numbers (e.g. IL-2, IL-4, IL-5, IL-6 and IL-12). The results of this study will form the basis of further studies investigating the expression of mRNA encoding cytokines in mucosa from dogs with chronic enteropathies. In addition, these real-time PCR assays can also be used for the quantication of cytokine mRNA in other experimental systems.

Acknowledgement This study was supported by a grant from The Waltham Centre for Pet Nutrition. The contribution of the clinical staff who cared for these patients is gratefully acknowledged.

References
Autschbach, F., Giese, T., Gassler, N., Sido, B., Heuschen, G., Heuschen, U., Zuna, I., Schulz, P., Weckauf, H., Berger, I., Otto, H.F., Meuer, S.C., 2002. Cytokine/chemokine messengerRNA expression proles in ulcerative colitis and Crohns disease. Virchows Arch. 441, 500513. Bustin, S.A., 2000. Absolute quantication of mRNA using realtime reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169193. Bustin, S.A., 2002. Quantication of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29, 2339.

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111 Fujiwara, S., Yasunaga, S., Nakayama, H., Doi, K., Masuda, K., Ohno, K., Tsujimoto, H., 2002. Quantitative analysis of cytokine messenger RNAs in the duodenal mucosa in dogs with small intestinal inammatory bowel disease. J. Vet. Intern. Med. 16, 327. Fuss, I.J., Neurath, M., Boirivant, M., Klein, J.S., de la Motte, C., Strong, S.A., Fiocchi, C., Strober, W., 1996. Disparate CD4+ lamina propria (LP) lymphokine secretion proles in inammatory bowel disease. Crohns disease LP cells manifest increased secretion of IFN-g, whereas ulcerative colitis LP cells manifest increased secretion of IL-5. J. Immunol. 157, 12611270. German, A.J., Helps, C.R., Hall, E.J., Day, M.J., 2000. Cytokine mRNA expression in mucosal biopsies from German shepherd dogs with small intestinal enteropathies. Dig. Dis. Sci. 45, 717. Groux, H., OGarra, A., Bigler, M., Rouleau, M., Antonenko, S., de Vries, J.E., Roncarolo, M.G., 1997. A CD4+ T-cell subset inhibits antigen-specic T-cell responses and prevents colitis. Nature 389, 737742. Hanauer, A., Mandel, J.L., 1984. The glyceraldehyde 3 phosphate dehydrogenase gene family: structure of a human cDNA and of an X chromosome linked pseudogene; amazing complexity of the gene family in mouse. EMBO J. 3, 26272633. Husband, A., Beagley, K., McGhee, J., et al., 1999. Mucosal cytokines. In: Ogra, P.L., Mestecky, J., Lamm, M.E. (Eds.), Mucosal Immunology. Academic Press, San Diego, pp. 541 559. Leutenegger, C.M., Mislin, C.N., Sigrist, B., Ehrengruber, M.U., Hofmann-Lehmann, R., Lutz, H., 1999. Quantitative real-time PCR for the measurement of feline cytokine mRNA. Vet. Immunol. Immunopathol. 71, 291305. Mena, A., Ioannou, X.P., Van Kessel, A., Van Drunen Little-Van Den Hurk, S., Popowych, Y., Babiuk, L.A., Godson, D.L., 2002. Th1/ Th2 biasing effects of vaccination in cattle as determined by real-time PCR. J. Immunol. Methods 263, 1121. Ng, S.Y., Gunning, P., Eddy, R., Ponte, P., Leavitt, J., Shows, T., Kedes, L., 1985. Evolution of the functional human beta-actin gene and its multi-pseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes. Mol. Cell Biol. 5, 27202732.

111

Niessner, M., Volk, B.A., 1995. Altered Th1/Th2 cytokine proles in the intestinal mucosa of patients with inammatory bowel disease as assessed by quantitative reversed transcribed polymerase chain reaction (RT-PCR). Clin. Exp. Immunol. 101, 428435. Overbergh, L., Valckx, D., Waer, M., Mathieu, C., 1999. Quantication of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11, 305312. Papadakis, K.A., Targan, S.R., 2000. Role of cytokines in the pathogenesis of inammatory bowel disease. Annu. Rev. Med. 51, 289298. Peters, I.R., Helps, C.R., Batt, R.M., Day, M.J., Hall, E.J., 2003. Quantitative real-time RT-PCR measurement of mRNA encoding alpha-chain, pIgR and J-chain from canine duodenal mucosa. J. Immunol. Methods 275, 213222. Plevy, S.E., Landers, C.J., Prehn, J., Carramanzana, N.M., Deem, R.L., Shealy, D., Targan, S.R., 1997. A role for TNF-a and mucosal T helper-1 cytokines in the pathogenesis of Crohns disease. J. Immunol. 159, 62766282. Ridyard, A.E., Nuttall, T.J., Else, R.W., Simpson, J.W., Miller, H.R., 2002. Evaluation of Th1, Th2 and immunosuppressive cytokine mRNA expression within the colonic mucosa of dogs with idiopathic lymphocyticplasmacytic colitis. Vet. Immunol. Immunopathol. 86, 205214. Rozen, S., Skaletzky, H.J., 2000. Primer3 on the WWW for General Users and for Biologist Programmers. Humana Press, Totowa, NJ, pp. 365386. SantaLucia Jr., J., 1998. A unied view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc. Natl. Acad. Sci. U.S.A. 95, 14601465. Stordeur, P., Poulin, L.F., Craciun, L., Zhou, L., Schandene, L., de Lavareille, A., Goriely, S., Goldman, M., 2002. Cytokine mRNA quantication by real-time PCR. J. Immunol. Methods 259, 55 64. Strober, W., Fuss, I.J., Blumberg, R.S., 2002. The immunology of mucosal models of inammation. Annu. Rev. Immunol. 20, 495 549. Strober, W., Kelsall, B., Fuss, I., Marth, T., Ludviksson, B., Ehrhardt, R., Neurath, M., 1997. Reciprocal IFN-g and TGF-b responses regulate the occurrence of mucosal inammation. Immunol. Today 18, 6164.