This article was downloaded by: [117.201.17.

117] On: 10 January 2012, At: 07:42 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Avian Pathology
Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/cavp20

Effect of a live Mycoplasma synoviae vaccine on the production of eggshell apex abnormalities induced by a M. synoviae infection preceded by an infection with infectious bronchitis virus D1466
A. Feberwee , C. J. Morrow , S. A. Ghorashi , A. H. Noormohammadi & W. J. M. Landman
a b c d a d a b c c

Animal Health Service (GD), Arnsbergstraat 7, 7418 EZ, Deventer, the Netherlands Bioproperties Pty Ltd, Ringwood, Victoria, Australia School of Veterinary Science, University of Melbourne, Werribee, Victoria, Australia

Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 7, 3584, CL Utrecht, the Netherlands Available online: 18 Sep 2009

To cite this article: A. Feberwee, C. J. Morrow, S. A. Ghorashi, A. H. Noormohammadi & W. J. M. Landman (2009): Effect of a live Mycoplasma synoviae vaccine on the production of eggshell apex abnormalities induced by a M. synoviae infection preceded by an infection with infectious bronchitis virus D1466, Avian Pathology, 38:5, 333-340 To link to this article: http://dx.doi.org/10.1080/03079450903183652

PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material.

Avian Pathology (October 2009) 38(5), 333340

Effect of a live Mycoplasma synoviae vaccine on the production of eggshell apex abnormalities induced by a M. synoviae infection preceded by an infection with infectious bronchitis virus D1466
A. Feberwee1*, C. J. Morrow2, S. A. Ghorashi3, A. H. Noormohammadi3 and W. J. M. Landman1,4
Animal Health Service (GD), Arnsbergstraat 7, 7418 EZ, Deventer, the Netherlands, 2Bioproperties Pty Ltd, Ringwood, Victoria, Australia, 3School of Veterinary Science, University of Melbourne, Werribee, Victoria, Australia, and 4 Department of Farm Animal Health, Faculty of Veterinary Medicine,Utrecht University, Yalelaan 7, 3584 CL Utrecht, the Netherlands
1

Downloaded by [117.201.17.117] at 07:42 10 January 2012

An experimental study was conducted to assess the effect of a live Mycoplasma synoviae vaccine (Vaxsafe MS; Bioproperties Pty Ltd, Ringwood, Victoria, Australia) on M. synoviae-induced eggshell apex abnormalities (EAA). Four experimental groups of specified-pathogen-free white laying hens were made. All groups were inoculated with infectious bronchitis virus D1466 at 18 weeks of age. One group did not receive further treatment (non-vaccinated non-challenged (NVNC)). Two groups were vaccinated at 14 weeks of age against M. synoviae, and one of these groups was also challenged with an EAA-inducing M. synoviae strain 5 days after infectious bronchitis virus challenge (vaccinated non-challenged (VNC) and vaccinated challenged group (VC), respectively). The fourth group was not vaccinated but was challenged with M. synoviae (non-vaccinated challenged (NVC)). Eggs with EAA were produced only in the NVC and VC groups. However, the proportion of eggs with EAA and the mean daily production of eggs with EAA per chicken was significantly lower (PB0.05) in the VC group (88/741 (11.9%) and 0.0990.01 eggs per hen) compared with the NVC group (148/646 (22.9%) and 0.1490.01 eggs per hen). The mean daily egg production per chicken was significantly lower in the NVC group (0.4890.03 eggs) compared with that of the NVNC group (0.6090.03 eggs), but not significantly different from other groups. The eggshell strength of eggs with EAA (22.8 N) was significantly lower (PB0.05) than non-affected eggs from the other groups (33.7 to 39.5 N). Furthermore, the eggshell strength of non-affected eggs in the NVC group was significantly lower (PB0.05) compared with that of non-affected eggs from the flock of origin (33.7 versus 41.2 N), but not different from the other groups. It can be concluded from the present study that vaccination with a live M. synoviae vaccine reduces the occurrence of M. synoviae-induced EAA significantly.

Introduction Mycoplasma synoviae is traditionally considered the second most important avian Mycoplasma species for commercial chickens from the clinical and economical point of view. It has been associated with respiratory disease and subsequent condemnations due to air sacculitis in broilers and peritonitis and mortality in commercial layer hens, although subclinical infections of the respiratory tract seem predominant (Stipkovits & Kempf, 1996; Kleven, 2003). Furthermore, M. synoviae is also known to cause synovitis in chickens and turkeys (Olson et al., 1956; Kleven et al., 1975; Morrow et al., 1990; Landman & Feberwee, 2001, 2004; van Beek et al., 2002; Kleven, 2003). Since the year 2000 a novel eggshell apex abnormality (EAA) has been increasingly found in table eggproducing chicken flocks in the Netherlands. It was characterized by altered shell surface, shell thinning and cracks and breaks. The abnormalities were confined to a region up to approximately 2 cm from the apex of the egg, and in most cases there was a very clear demarcation zone and increased translucency visible at candling. Recent field and experimental studies (Feberwee et al., 2009) showed a causal relationship between the newlydescribed EAA and M. synoviae infection, thus further increasing the economic relevance of this Mycoplasma species. In vitro and field studies showed that oxytetracycline was effective against M. synoviae (Landman et al., 2008) and M. synoviae-induced EAA (Feberwee et al., 2009). However, due to the temporary effect of antibiotic treatment and the risk of residues in eggs for consumption, alternative strategies such as vaccination should be

*To whom correspondence should be addressed: Tel: '31 570 660384. E-mail: a.feberwee@gddeventer.com Received 6 February 2009 ISSN 0307-9457 (print)/ISSN 1465-3338 (online)/09/50333-08 # 2009 Houghton Trust Ltd DOI: 10.1080/03079450903183652

334 A. Feberwee et al.

considered for the control of M. synoviae-induced EAA. Therefore, the effect of a commercial live M. synoviae vaccine (Vaxsafe MS; Bioproperties Pty Ltd, Ringwood, Victoria, Australia) on M. synoviae-induced EAA egg production was investigated. It was evaluated using an animal model described previously by Feberwee et al. (2009). In this model a synergistic effect was found between infectious bronchitis virus (IBV) strain D1466 and a Dutch EAA-inducing M. synoviae isolate, therefore all experimental groups in the present study were inoculated with IBV D1466. Materials and Methods
M. synoviae vaccine. The vaccine used was Vaxsafe MS (batch MSH 072991A, expiry date October 2010; Bioproperties Pty Ltd). After arrival at the Animal Health Service (GD) (Deventer, the Netherlands), the vaccine viability in colony-forming units (CFU) was tested using Mycoplasma Experience (ME) agar (Mycoplasma Experience, Reigate, Surrey, UK) 5 days after storage at (708C. After vaccination as described below, the colour-changing units (CCU) of the retained vaccine were determined according to the protocol of Meynell & Meynell (1970) as prescribed by the manufacturer.

M. synoviae EAA and IBV D1466 inocula. Freeze-dried M. synoviae EAA culture was suspended in 1 ml distilled water and transferred to 50 ml ME broth and incubated at 378C until a change of colour was observed (within 3 days). For counting the CCU of the retained M. synoviae EAA inocula, 10-fold dilutions were prepared in ME broth and incubated for 14 days at 378C. The final M. synoviae concentration was determined as the highest dilution where a colour change was observed. It was expressed as CCU per millilitre according to the Spearman Karber method for quantal data (Finney, 1952; Hannan, 2000). Freeze-dried IBV D1466 (batch number 06500, Animal Health Service (GD)) in vials containing 2.5 )106.6 median embryo infective dose (EID50)/5 ml was dissolved in phosphate-buffered saline (PBS) to produce a concentration of 106 to 107 EID50/ml IBV D1466. In order to determine the IBV concentration (EID50/ml) of the inocula, 10-fold dilutions were made and 0.2 ml of each dilution was injected into the allantoic cavity of five 9-day-old specified-pathogenfree (SPF) embryos. The virus titre obtained was based on the mortality of embryos and was calculated according to the formula of Reed & Muench (1938). Experimental study. The experimental design is shown in Table 1. At the start of the experiment 72 SPF white layer chickens, 12 weeks old (Animal Health Service (GD)), were weighed, divided into weight

classes and allocated into four groups of 18 so that the average weights were not significantly different. They were housed in negative-pressure HEPA isolators (194 cm width, 95 cm height and 75 cm depth; Beyer & Eggelaar, Utrecht, the Netherlands) each containing four laying nests with plastic curtains. The housing temperature ranged from 23 to 278C. Throughout the experiment the birds were provided with 16 h of light per day and feed and drinking water was given ad libitum. The birds were free of Mycoplasma gallisepticum, M. synoviae and the common avian pathogens as described elsewhere (Feberwee et al., 2005). Blood samples for testing for IBV, M. synoviae and M. gallisepticum antibodies were collected and a pool of six tracheal swabs were tested per experimental group using the M. synoviae polymerase chain reaction (PCR) test. The start of the experiment is referred to as day 0 and the experimental period lasted for 18 weeks. The different groups are defined as: non-vaccinated non-challenged (NVNC), vaccinated non-challenged (VNC), non-vaccinated challenged (NVC) and vaccinated challenged (VC) following the treatments below. At week 2 of the experiment (14 weeks of age), two groups (NVNC and NVC) were sham vaccinated by eye drop with ME broth ( 23 ml), while the two other groups (VNC and VC) were vaccinated by this route with23 ml live M. synoviae vaccine according to the manufacturers instructions. One dropper was used for all experimental groups and a single droplet that formed at the tip of the dropper was allowed to fall onto one of the open eyes. Blood samples were collected from all groups at week 5 (17 weeks of age) for IBV and M. synoviae antibodies. At week 6 of the experiment (18 weeks of age), and 5 days before M. synoviae challenge, the birds in all four groups were inoculated with IBV D1466 in allantoic fluid containing 106.7 EID50/ml. Each bird was inoculated intratracheally (i.t.) with 1 ml fluid, and intramuscularly with 0.5 ml into the pectoral muscle. At week 7 (19 weeks of age), one sham-vaccinated group (NVNC) and one M. synoviae-vaccinated group (VNC) were inoculated with 1 ml ME broth i.t., while the other sham-vaccinated group (NVC) and vaccinated group (VC) were challenged i.t. with 1 ml ME broth containing 107 CCU M. synoviae EAA strain/ml. Egg production and the occurrence of eggs with EAA were recorded from week 7 until the end of the experiment at week 18. In order to minimize bias in egg production data and to avoid breakage of eggs with EAA, eggs were collected four times a day as, despite synchronization of lay, variation in the time of oviposition can occur. The daily egg production (including both whole and broken eggs) was recorded. At the end of the experiment, eggshell strength measurements were performed on all eggs with EAA that were not broken or cracked and on non-affected eggs of all experimental groups (n051 to 57) using an eggshell compression device (Futura 3/A, OQT-II; Futura-Werner Furste Gbr, Lohne, Germany). Moreover, measurement was also performed on 60 non-affected eggs from the original SPF flock (not infected), which were included as controls.

Downloaded by [117.201.17.117] at 07:42 10 January 2012

Table 1.
Time* (age of birds in weeks) D0 (12) D0 (12) W2 (14) W5 (17) W6 (18) W7 (19) W718 (1930) W18 (30) NVNC

Experimental design
NVC VC

VNC

SPF white layers 12 weeks of age, weighed, divided in weight classes and proportionally allocated in each experimental group (18/group) M. synoviae and M. gallisepticum RPA & M. synoviae PCR ME medium M. synoviae vaccine ME medium M. synoviae vaccine eyedrop eyedrop eyedrop eyedrop M. synoviae RPA and IBV HI IBV inoculation i.m. and i.t. (5 days before challenge) ME medium i.t. ME medium i.t. M. synoviae EAA i.t. M. synoviae EAA i.t. Recording of egg production and production of eggs with EAA Postmortem M. synoviae RPA and IBV HI M. synoviae VlhA PCR Mycoplasma culture oviduct and identification by M. synoviae PCR

*D0day, W 0weeks NVNC 0non-vaccinated non-challenged; VNC 0vaccinated non-challenged; NVC 0non-vaccinated challenged; VC 0vaccinated challenged; i.t. 0intratracheally and i.m. 0intramuscularly.

Vaccination and EAA

At the end of the experiment blood samples were collected for IBV and M. synoviae antibodies, and tracheal swabs were taken from all birds. Subsequently, 8 to 11 swabs from birds of the VNC, NVC and VC groups were used to determine the M. synoviae CFU equivalents in the trachea swabs by PCR. Furthermore, DNA obtained from all tracheal swabs was used for PCR amplification of the vlhA gene and highresolution melt (HRM) curve analysis. The birds were stunned using CO2'O2 and exsanguinated by incision of the jugular vein. General routine post-mortem examination was performed at the time that calcified eggs were expected in the uterus (i.e. between 9 and 10 a.m.) (lay was synchronized) and swabs were taken from the uterus for general bacteriology and mycoplasma culture. DNA of M. synoviae culture positive oviducts was also used for PCR amplification of the vlhA gene and HRM curve analysis.

335

Downloaded by [117.201.17.117] at 07:42 10 January 2012

Serology. M. synoviae serology was performed as described by Feberwee et al. (2005) using the rapid plate agglutination (RPA) test within 24 h of collection of blood samples. In short, sera diluted 1:2 were tested with the RPA antigen (Nobilis MS antigen batch number 01302; Intervet International, Boxmeer, the Netherlands). If agglutination occurred the serum was serially diluted from 1:4 to 1:32 in PBS pH 7.2 and re-tested. If a serum agglutinated at a dilution of 1:8 (titre 3 log2) or higher, it was considered to be a specific positive for M. synoviae. M. gallisepticum serology was carried out using RPA (Nobilis MG antigen batch number 650 600203; Intervet International) and the haemagglutination inhibition (HI) test as described previously (Feberwee et al., 2005). Agglutination and HI at dilution 1:2 (titre 1 log2) or lower was regarded as a specific negative result. IBV D1466 antibodies were assessed with the HI test (Alexander & Chettle, 1977; de Wit et al., 1997).

PCR amplification of the vlhA gene and HRM curve analysis. The oligonucleotide primers Link (5?-TACTATTAGCAGCTAGTGC-3?) and MSCons-R (5?-AGTAACCGATCCGCTTAAT-3?) were used to amplify the single-copy conserved 5? end of the vlhA genes as described before (Jeffery et al., 2007). A 25 ml reaction mixture consisted of 200 mM each dATP, dCTP, dGTP and dTTP, 2 mM MgSO4, 25 mM each primer, 1 U High Fidelity Platinium Taq DNA polymerase (Invitrogen), 2.5 ml 10x Platinium Taq DNA polymerase buffer, 10 mM SYTO 9 green fluorescent nucleic acid stain (Invitrogen), and 1 ml extracted M. synoviae genomic DNA. The reaction mixture was incubated at 968C for 2 min, then subjected to 40 cycles of 968C for 15 sec, 548C for 15 sec and 688C for 20 sec. DNA was extracted directly from tracheal swabs and M. synoviae cultures grown from oviducts as described above. In each set of PCR reactions, negative (H2O) and positive (M. synoviae vaccine) controls were included. HRM curve analysis was performed on a Rotor-Gene 6000 using the software Rotor-Gene 6000 1.7.87 and the HRM algorithm provided as described before (Jeffery et al., 2007). Identical volumes of PCR products were subjected to an increasing temperature from 80 to 908C at intervals (ramps) of 0.38C/s. All amplicons were tested in triplicate to detect variations induced by technical errors. Genotypes were defined by selecting a representative sample from M. synoviae EAA and M. synoviae vaccine strains. Specimens giving a confidence value of more than 90% to either of the reference profiles were considered identical to that profile. The threshold of 90% confidence percentage was applied according to a previous study (Jeffery et al., 2007) where a HRM curve analysis technique for classification of M. synoviae strains based on their vlhA gene sequence was developed. DNA sequence analysis. Amplicons from a number of specimens from each group were purified using the QIAquick PCR purification kit (Qiagen) according to the manufacturers instructions, eluted in 30 ml buffer E (Qiagen) and then subjected to automated sequencing (BigDye Terminator v3.1; Applied Biosystems) in both directions using the same primers used for PCR. The sequences were analysed using DNASTAR software (DNASTAR Inc., Madison, Wisconsin, USA). The nucleotide sequence of M. synoviae EAA strain was submitted to the GenBank under accession number FJ495803. Statistical analysis. The fraction of M. synoviae RPA-positive samples, the fraction of mycoplasma-positive culture results from oviducts, and the fraction of eggs with EAA on total egg production were analysed using the Two-Sample Proportion Test (Statistix , 2005). Proportions were considered significantly different if PB0.05. Weight at week 0, IBV D1466 titres, egg shell strength, egg production and production of eggs with EAA were analysed by means of the KruskalWallis one-way analysis of variance. The KruskalWallis all-pairwise comparisons test was performed as post hoc analysis in order to compare all possible pairwise differences between the means of the different treatment groups (Statistix , 2005). Means were considered significantly different if PB0.05. Ethical statement. Birds were housed, handled and treated following approval by the Institutional Animal Experimental Committee in accordance with the Dutch regulations on experimental animals.

Culture of the oviduct. The outer surface of the oviduct was first sterilized with a hot scalpel blade. Then an incision was made with a sterile scalpel and two sterile cotton swabs were used to swab both the isthmus and the uterus. One swab was plated out on a 5% sheep blood agar plate for general bacteriology and the other on a ME agar plate for mycoplasma culture. The ME agar plates were incubated at 378C in a humid environment and examined for colonies every 2 to 3 days up to 28 days. One well-separated colony was selected and plated out on a fresh ME agar, and a piece of ME agar, approximately 2 )0.5 cm2, bearing positive clones was transferred to 5 ml ME broth and incubated at 378C. Positive mycoplasma cultures were identified as M. synoviae by PCR as described below.

Molecular identification. Tracheal swabs were eluted per pools of six (at week 0) or individually (at week 18) in 1 ml PBS and were centrifuged for 10 min at 16,000 )g. The pellet was then resuspended in 1 ml PBS and centrifuged at 16,000 )g. Subsequently, it was resuspended in 25 ml PBS, incubated at 1108C for 15 min and cooled on ice for 5 min. After a final centrifugation for 2 min at 16,000 )g, supernatants were cooled at 48C and used directly for PCR. Positive mycoplasma broth cultures (colour change present) were pelleted for 10 min at 16,000)g and the pellets resuspended in 200 ml sterile PBS. DNA was extracted using the protocol for Cultured Animal Cells of the QiaAmp DNA mini kit (Qiagen Benelux B.V., Venlo, the Netherlands). The DNA extracts from tracheal swabs were tested quantitatively and expressed in the calculation of M. synoviae CFU equivalents/ml as described by Mekkes & Feberwee (2005). In short, for the calculation of CFU equivalents, aliquots of DNA from serial 10-fold dilutions (101 to 106) stored at (208C were used as standards in the M. synoviae RealTime PCR to calculate the M. synoviae concentrations (CFU equivalents/ml) in the samples. The concentration of M. synoviae in CFU equivalents/ml was calculated using the second derivative method included in the Light Cycler data analysis software. The DNA extracts from mycoplasma-positive broths were tested qualitatively by M. synoviae Real-Time PCR (M. synoviae present or not). The forward primer 5?-GAGAAGCAAAATAGTGATATCA-3? and the reverse primer 5?-CAGTCGTCTCCGAAGTTAACAA-3? (GenBank accession number X52083) were used. These primers amplify a 211 base pair sequence from the 16S ribosomal RNA gene of M. synoviae.

Results Viability and concentration of M. synoviae vaccine. The vaccine viability count after 5 days storage at (708C was 1.0 )108 CFU/ml, while the viability count as CCU/ ml of the retained vaccine was 9.1)107 CCU/ml. Therefore, one vaccine dose (23 ml) contained 2.1 )106 CCU, which was in accordance with the manufacturers recommendations (per bird ]105.7 CCU living M. synoviae strain MS-H). Concentration of M. synoviae EAA strain and IBV D1466 inocula. The IBV D1466 and M. synoviae EAA concentrations calculated from retained samples of the inocula

336 A. Feberwee et al.

were 106.7 EID50/ml allantoic fluid and 107 CCU/ml, respectively. Clinical observations. Inoculation with IBV induced mild respiratory signs in all experimental groups during 9 to 15 days. In total, four birds died during the experiment; one died due to acute pneumonia (VC group), a second due to severe osteomalacia (VNC group), a third due to peritonitis (NVC group), and a fourth had to be euthanized due to subcutaneous emphysema possibly induced by a ruptured air sac (VC group). The osteomalacia remained confined to a single case as all other birds, which were physically palpated (two to three birds per group), showed no signs of it and a feed analysis showed sufficient concentrations of calcium and phosphorous. Serology and PCR. At the start of the experiment the birds were serologically negative for M. gallisepticum and M. synoviae antibodies, and freedom of M. synoviae was further confirmed by PCR. Before IBV D1466 and M. synoviae EAA inoculation, no specific M. synoviae and IBV D1466 antibodies were found in any group

Downloaded by [117.201.17.117] at 07:42 10 January 2012

(Table 2). In the VNC group only one of 18 samples tested showed agglutination in the RPA test at dilution 1:2. At the end of the experiment, M. synoviae specific antibodies (agglutination at 1:8 dilution) were detected only in the M. synoviae-vaccinated and/or M. synoviaechallenged birds (5/17 birds in the VNC group, 17/17 birds in the NVC group and 11/16 birds in the VC group). However, in the VNC group, 7/17 samples showed agglutination at dilution 1:4 while the other five samples showed agglutination at dilution 1:2. All birds were serologically positive for IBV D1466 at the end of the experiment. There was no significant difference in mean IBV D1466 HI titre between the experimental groups (Table 2). The numbers of M. synoviae PCR-positive tracheal swabs at the end of the experiment were 9/11, 10/11 and 6/ 8 for the VNC, NVC and VC groups, respectively. There was no significant difference between the proportions of M. synoviae-positive swabs. Although there was a difference in the average number of tracheal CFU equivalents/ ml per chicken in the different groups (1758 CFU equivalents/ml in the VNC group, 2455 CFU equivalents/ml in the NVC group and 748 CFU equivalents/ml

Table 2. Serology, PCR, mycoplasma culture oviduct, egg production, production of eggs with EAA and eggshell strength of the experimental study
Time D0day W0week IBV D1466 HI titrea M. synoviae RPA positiveb,c M. gallisepticum RPA positived M. synoviae PCR positiveb Mycoplasma culture oviductb Total egg production Mean daily egg production/chickena Total production of eggs with EAA Proportion of eggs with EAA of total egg production (%)b Mean daily eggs with EAA/chickena Non-affected eggs (n 02528 per group)a Non-affected eggs (n 05160 per group)a Eggs with EAA (n0133 and n 088)a W5 W18 D0 W5 W18 D0 D0e W18f W18 NVNC n 018 3 (0) 8.7 (0.4)A 0/18 0/18 0/17A,g 0/18 0 0/18A VNC n 018 3 (0) 9.7 (0.3)A 0/18 0/18 5/17A,B,h,i 0/18 0 9/11A 0/17A NVC n018 3 (0) 9.1 (0.4)A 0/18 0/18 17/17C,h 0/18 0 10/11A 10/17B VC n 018 3 (0) 10.3 (0.3)A 0/18 0/18 11/16B,k 0/18 0 6/8A 9/16B SPF Flockl

W7-W18 W7-W18 W7-W18 W7-W18

Egg production and production of eggs with EAA 826 721 646 0.60 (0.03)A 0.54 (0.03)A,B 0.48 (0.03)B 0 0A 0 0A 148 22.9C

741 0.58 (0.03)A,B 88 11.9B

W7-W18

0.0 (0.0)A

0.0 (0.0)A,j Eggshell strength (N) 35.1 (1.4)A 39.3 (0.9)A,B j

0.14 (0.01)C

0.09 (0.01)B

W13 W17-18 W8-W18

40.8 (1.7)A

35.0 (1.6)A 33.7 (1.3)B 22.8 (0.4)C

35.1 (1.3)A 37.0 (1.1)A,B 22.8 (0.6)C

41.2 (1.0)A

39.5 (1.3)A,B

NVNC 0non-vaccinated non-challenged; VNC0vaccinated non-challenged; NVC 0non-vaccinated challenged and VC0vaccinated challenged. Means with the same uppercase superscript letter within the same row (for Eggshell strength also between rows) are significantly different (PB0.05). aMean (9 SEM) and statistiscal analysis with Kruskal-Wallis one-way analysis of variance. bTwoSample Proportion Test. cAgglutination M. synoviae RPA titres]1:8. dBoth M. gallisepticum RPA and HI titre]1:8. ePer isolator one pool of 6 trachea swabs. f811 samples were tested. gOne bird not tested. hOne bird died. iAnother 7/15 samples showed agglutination at dilution 1:4. jOnly one egg with EAA-like outer characteristics was produced, but it had normal eggshell strength (34 N). kTwo birds died. lEggs from the SPF flock from which the experimental birds originated were used as controls for eggshell strength measurements.

Vaccination and EAA

Proportion of eggs with EAA (%)

337

in the VC group), differences were not statistically significant (P !0.05). Egg production and EAA egg production. In all groups, egg production started within 1 week of M. synoviae challenge. The mean (9 standard error of the mean) daily egg production per chicken was significantly higher (PB0.05) in the NVNC group than in the NVC group (0.6090.03 eggs and 0.4890.03 eggs, respectively). In the other two groups the mean daily egg production (0.5590.03 eggs (VNC group) and 0.5790.03 eggs (VC group)) was not significantly different from the NVNC group and the NVC group (Table 2 and Figure 1). No eggs with EAA were produced in the NVNC and VNC groups, a total egg production of 826 and 721 eggs, respectively. The NVC and VC groups produced 148 and 88 eggs with EAA, respectively, while their total egg production was 646 and 741 eggs, respectively. Production of eggs in the NVC group and VC group started at 3 and 4 weeks after inoculation of M. synoviae EAA, respectively. Eggs with EAA were produced from then on in both groups; however, the weekly proportion of eggs with EAA in the VC group was lower than in the NVC group (Table 2 and Figure 2). In the VNC group, one egg showed the visual characteristics of EAA; however, this was not confirmed by a reduction in eggshell strength and therefore this egg was not recorded as having EAA. The proportion of eggs with EAA of the total egg production was significantly higher (PB0.05) in the NVC group (148/646 (22.9%)) than that of the VC group (88/741 (11.9%)). Also the mean daily production of eggs with EAA per chicken was significantly higher (PB0.05) in the NVC group (0.1490.01 eggs) than that of the VC group (0.0990.01 eggs) (Table 2). Eggshell strength. At week 13 the eggshell strength of non-affected eggs did not differ significantly (P !0.05) between the different experimental groups. However, at the end of the experiment the eggshell strength of nonaffected eggs of the NVC group was significantly lower (PB0.05) than that of the eggs derived from the SPF flock of origin, these being 33.791.3 N (n 057) and 41.291.0 N (n060), respectively. There was no significant difference between the VNC group and the NVNC group (39.591.3 N; n 055), the VNC group (39.390.9 N; n056) and the VC group (37.091.1 N; n051)
1.2

40

NVC VC

30

20

10

W1

W3

W5

W7

W9

W11

Weeks p.i. M. synoviae

Figure 2. Proportion of eggs with EAA (%) of total weekly egg production in non-vaccinated challenged (NVC) and vaccinated challenged group (VC).

Downloaded by [117.201.17.117] at 07:42 10 January 2012

regarding eggshell strength of non-affected eggs (Table 2). Moreover, these three groups did not differ significantly regarding non-affected eggs from the SPF flock of origin. The eggshell strength of the eggs with EAA from the NVC group and the VC group did not differ significantly (PB0.05) from each other, being 22.890.4 N (n0133) and 22.890.6 (n088), respectively; however, both differed significantly (PB0.05) from the eggshell strength of non-affected eggs of all experimental groups, including that of the SPF flock that served as a control (Table 2). Post-mortem examination and oviduct culture. At postmortem examination no gross macroscopic abnormalities of the oviduct were observed. In 67% of the birds in the NVNC group, in 47% of the birds in the VNC group, in 76% of the birds in the NVC group and in 69% of the birds in the VC group, an egg was present in the uterus. M. synoviae was not isolated from the oviducts of the NVNC group or the VNC group. However, it was cultured from the oviducts of 10/17 birds in the NVC group and from the oviducts of 9/16 birds in the VC group. In the VC group, one egg with EAA was found in the oviduct of a hen that was also M. synoviae culturepositive. In the NVC group, six eggs with EAA were found in the oviducts*of which five were culture-positive. The fractions of mycoplasma-positive cultures from oviducts of the NVC group and the VC group (10/17 and 9/16, respectively) were significantly different (PB0.05) from those of the NVNC group and the VNC group (0/18 and 0/17, respectively). There was no significant difference regarding the proportion of mycoplasma positive oviducts between the NVNC group and the VNC group. Moreover, there was also no significant difference (P !0.05) between the NVC group and the VC group (Table 2). No other pathogenic bacteria were isolated from oviducts. PCR amplification of the vlhA gene and HRM curve analysis. DNA extracted from tracheal swabs from the NVNC group did not produce a detectable PCR amplicon but those extracted from oviduct cultures and from tracheal swabs from all other groups generated amplicons that were subjected to HRM curve analysis. In conventional melt curve analysis, two peaks between 828C and 858C were generated from amplicons with curve shapes that could be categorized into two distinct profiles, one similar to the M. synoviae vaccine strain and the other to the M. synoviae EAA strain (Figure 3a

0.8

0.4

0.0 NVNC VNC NVC VC

Figure 1. Box and Whisker Plot showing the mean daily egg production per chicken per experimental group (NVNC 0nonvaccinated non-challenged, VNC 0vaccinated non-challenged, NVC0non-vaccinated challenged, VC0vaccinated challenged). The mean daily egg production per chicken was signicantly higher (PB0.05) in the NVNC group than in the NVC group. In the other two, the mean daily egg production was not signicantly different from the NVNC group and the NVC group.

338 A. Feberwee et al.

(a)
3.0 MSH vaccine strain Ms EAA strain VNC NVC VC Oviduct cultures

(b)
MSH vaccine strain Ms EAA strain VNC NVC VC Oviduct cultures

3.0

2.5

2.5

2.0

2.0

dF/dT

1.5

dF/dT
81.5 82.0 82.5 83.0 83.5 84.0 84.5 85.0 85.5 86.0

1.5

1.0

1.0

0.5

0.5

0 81.0

0.0 80.5 81.0 81.5 82.0 82.5 83.0 83.5 84.0 84.5 85.0 85.5 86.0

Temperature (C)

Temperature (C)

(c)
110 100 90 MSH vaccine strain Ms EAA strain VNC NVC VC Oviduct cultures

(d)
110 100 90 MSH vaccine strain Ms EAA strain VNC NVC VC Oviduct cultures

Normalised Fluorescence

Downloaded by [117.201.17.117] at 07:42 10 January 2012

Normalised Fluorescence

80 70 60 50 40 30 20 10

80 70 60 50 40 30 20 10

82.4 82.6 82.8 83.0 83.2 83.4 83.6 83.8 84.0 84.2 84.4 84.6 84.8 85.0 85.2 85.4 85.6 85.8

82.4 82.6 82.8 83.0 83.2 83.4 83.6 83.8 84.0 84.2 84.4 84.6 84.8 85.0 85.2 85.4 85.6 85.8

Temperature (C)

Temperature (C)

Figure 3. Individual (a and c) or means (b and d) of conventional (a and b) and normalised (c and d) high resolution melt curves of vlhA gene amplicons generated from tracheal swabs and oviduct cultures.

to c). All specimens (tracheal samples) from the VNC group generated vlhA amplicons that corresponded with each other and with the M. synoviae vaccine strain. All other specimens, including tracheal swabs from the NVC and VC groups, and M. synoviae cultures grown from oviducts from these groups, generated amplicons that corresponded with M. synoviae EAA strain. In the normalized HRM graphs, two distinct curve profiles were displayed, corresponding either to the vaccine or the M. synoviae EAA strain. The amplicons from tracheal swabs from group VNC generated normalized curves that were genotyped as vaccine type, while those from tracheal swabs and/or oviduct cultures from bird groups NVC and VC generated normalized curves that genotyped as M. synoviae EAA strain (Figure 3a to c). DNA sequence analysis. In order to establish the extent of sequence variability in the PCR products amplified from each profile, and also to confirm results from vlhAPCR HRM curve analysis, amplicons from M. synoviae vaccine and M. synoviae EAA strains as well as those from tracheal swabs and/or oviduct cultures from three to four birds in each group were subjected to nucleotide sequencing. Comparison of the sequences revealed that amplicons from tracheal swabs from the VNC group had identical nucleotide sequences to the M. synoviae vaccine strain, while amplicons from tracheal swabs and/or oviduct cultures from the NVC and VC groups had

identical sequences to the M. synoviae EAA strain. Alignment of the M. synoviae vaccine and M. synoviae EAA strain sequences revealed an insertion of 12 base pairs in the 5? end of the M. synoviae EAA amplicon and eight nucleotide substitutions spread throughout the amplicon (Figure 4). Discussion Vaccination with a commercial live M. synoviae vaccine was investigated in this experimental study as an alternative strategy for the control of M. synoviae-induced EAA due to the limited effect of antibiotic treatment and the risk of residues in eggs for consumption. The experimental model used was based on that described by Feberwee et al. (2009) and exploited the synergistic effect between IBV D1466 and a Dutch EAA-inducing M. synoviae isolate. Therefore all four experimental groups were inoculated with IBV D1466. The sample size (n0 18) used in each group was chosen to obtain enough power (0.80 and 95% confidence) to detect significant differences, and was also based on previous work (Feberwee et al., 2009). The results showed that vaccination could not completely prevent the occurrence of EAA, although a significant reduction of EAA egg production (approximately 50%; PB0.05) was found. Moreover, a delay in the onset of EAA egg production was observed in the

Vaccination and EAA

1 11 21 31 41 51 AGTGGCCATTGCTCCTGCTGTTATAGCAATTTCATGTGGTGATCAAACTCCAGCACCT C ..........................................................G. ..........................................................A. 61 71 81 91 101 111 TCCA ACACCTGGAAACCCAAATACTGATAATCCTCAAAACCCAAATCC ....------------............................................ ....GCACCTACTCCA............................................ 121 131 141 151 161 171 AGGAAA CCAGGTACTGATAAT CTCAAAACCCAAATCCAGGAAA CCAGGGGGTGGTAC ......T...............T......................T.............. ......C...............C......................C.............. 181 191 201 211 221 231 AGTTGACCCTGTAGAG CTGCTAAAACAGAAGCTAAAAC GCTATTGATGCTTCAGCAGA ................G......................C.................... ................A......................T.................... 241 251 261 271 281 291 ATTATCAGATTCAGTTAAAGAAGCATTAAAAAGACAAGTTGAAGCAACTACAACAGAA C ..........................................................G. ..........................................................T. 301 311 321 331 341 351 TGCAGCCAGAGATTTAAAAACTAAA CAGAAGCTCTTGTTTCAGCTGTAAAAGC .........................A............................ .........................G............................

339

consensus MS_H MS_EAA

consensus MS_H MS_EAA

consensus MS_H MS_EAA

consensus MS_H MS_EAA

consensus MS_H MS_EAA

consensus MS_H MS_EAA

Downloaded by [117.201.17.117] at 07:42 10 January 2012

Figure 4. Comparison of the nucleotide sequences of MS-H vaccine and M. synoviae EAA strains vlhA gene amplicons using CLUSTALW. Identical nucleotides and deletions are shown by . and -, respectively.

vaccinated VC group. Our data are in agreement with research performed by Markham et al. (1998a), who showed a reduction in M. synoviae-induced air sac lesions (from 65 to 12.5%) after a single eye drop vaccination with 30 ml MS-H vaccine containing 107 CCU/ml. The proportion of EAA eggs in the NVC group (22.9%) was higher than that of a similar experimental group of an earlier study (14%) where M. synoviae-induced eggshell pathology was first described (Feberwee et al., 2009). A second difference was that in the present study clinical signs due to IBV were observed in all groups, and yet another difference was that the NVC group here showed a significantly lower eggshell strength (PB0.05) in non-affected eggs than that of the non-affected eggs of the control SPF flock. The eggshell strength of unaffected eggs in the NVC group was also lower than that of unaffected eggs in the VC group; however, the difference was not statistically significant. Nevertheless, the results suggest a positive effect of M. synoviae vaccination on eggshell strength in M. synoviae EAA-challenged birds. The differences found between the two studies are possibly related to the fact that in this experiment SPF birds were used and not commercial hens. The mean daily egg production per chicken in the NVC group was lower than in all other groups. It was significantly lower than that of the NVNC group, indicating that M. synoviae EAA also has a negative effect on total egg production. This is consistent with the findings of the previous study (Feberwee et al., 2009). Although the mean daily egg production was lower than that of the VC group, the difference was not statistically different (P !0.05). However, as with observations for eggshell strength, the higher egg production results suggest a positive effect of vaccination on the egg production of M. synoviae EAA-challenged birds. The post-mortem findings of the birds that died during the experiment (peritonitis, airsacculitis and pneumonia) are consistent with descriptions of dual

infections of M. synoviae with IBV (Kleven, 2003). The presence of IBV antibodies in all groups and the presence of M. synoviae antibodies, together with M. synoviaepositive PCR results in the NVC and VC groups, suggest that IBV inoculation and M. synoviae EAA challenge were successful. M. synoviae antibodies were not found in the VNC group at 3 weeks after eye drop vaccination; however, at the end of the study (11 weeks after challenge), all samples showed agglutination at dilution 1:2, while seven and five samples were positive at dilutions 1:4 and 1:8, respectively. These results harmonize with a study performed by Markham et al. (1998b), who showed that the serological response following MS-H vaccination is slow with the first RPA reactions occurring 6 weeks after vaccination, and 100% reaction occurring at 16 to 20 weeks after vaccination. The development of M. synoviae antibodies and the positive M. synoviae PCR in the VNC group, and the mycoplasma counts of the M. synoviae vaccine used, all suggest that the experimental birds were correctly vaccinated. The PCR results and the HRM curve analyses showed that the M. synoviae EAA strain had colonized in the oviduct and trachea of the VC group. Although the average CFU equivalents/ml in tracheal samples from this group was lower than that of the NVC group, suggesting that vaccination has an effect on the excretion of the number of mycoplasmas, the difference was not statistically significant. A possible explanation for the lack of significance is the relatively low number of experimental birds used. However, mycoplasma shedding was only determined at the end of the experiment; had it been determined over the whole experimental period it would have enabled a better evaluation of the differences in shedding between vaccinated and non-vaccinated birds by performing area under the curve analysis, as was performed previously for a live M. gallisepticum vaccine (Feberwee et al., 2006). A previous study (Jeffery et al., 2007) reported on the value of HRM curve analysis for differentiation of pure

340 A. Feberwee et al.

Downloaded by [117.201.17.117] at 07:42 10 January 2012

cultures of different M. synoviae strains. The present work also demonstrated that this technique has good potential for identification of M. synoviae strains using DNA extracted directly from tracheal swabs. Minor melting temperature variations were observed in the peaks generated from swabs of birds in the same group. However, adjustment of the quantity of DNA templates greatly improved the consistency of the curves. DNA sequencing of the representative amplicons also confirmed the genotyping results from vlhA HRM curve analysis and that the minor variations seen in between specimens from the same group were not caused by differences in nucleotide sequence. The identification of EAA was based on the outer eggshell characteristics and egg candling in combination with eggshell strength measurement. Eggs with EAA are characterized by an altered shell surface, which is confined to the top cone of the egg. At candling a clear demarcation zone separates the altered eggshell from the normal part and the abnormal eggshell shows increased translucency. Based on visual inspection, one single egg in the VNC group showed the visual characteristics of EAA; however, the eggshell strength was not lowered (34 N) and this egg was therefore not included in the results. Moreover, mycoplasma cultures of oviducts of this group remained negative. Feberwee et al. (2009) previously showed that production of eggs with EAA was strongly correlated with a mycoplasma culture positive oviduct. Although M. synoviae vaccination significantly reduced (PB0.05) the occurrence of eggs with EAA in the present study, its efficacy may have been underestimated as in the experimental setting strong challenges with IBV and/or M. synoviae (necessary to get significance using small groups) may overwhelm the M. synoviae vaccineinduced immunity. Therefore, it would be interesting to study the efficacy of this vaccine in a transmission model where seeders and/or natural infection by aerosol are used. Such models have been used previously to study the effect of vaccination on the transmission of M. gallisepticum, mimicking more closely the situation in the field (Feberwee et al., 2006). Acknowledgements The authors thank Thea von Banniseht-Wysmuller for her technical assistance to this work. The work was funded by Bioproperties Pty Ltd. Funding to carry out vlhA-PCR HRM analysis and nucleotide sequencing was provided by the Australian Poultry Cooperative Research Centre. References
Alexander, D.J. & Chettle, N.J. (1977). Procedures for the haemagglutination and haemagglutination inhibition tests for avian infectious bronchitis virus. Avian Pathology, 6, 917. de Wit, J.J., Mekkes, D.R., Kouwenhoven, B. & Verheyden, J.H.M. (1997). Sensitivity and specicity of serological tests for detection of infectious bronchitis virus-induced antibodies in broilers. Avian Pathology, 26, 105118. Feberwee, A., Mekkes, D.R., de Wit, J.J., Hartman, E.G. & Pijpers, A. (2005). Comparison of culture, PCR and different serological tests for

detection of Mycoplasma gallisepticum and M. synoviae infections. Avian Diseases, 49, 260268. Feberwee, A., von Bannisseht-Wysmuller, Th.E., Vernooij, J.C.M., Gielkens, A.L.J. & Stegeman, J.A. (2006). The effect of a live vaccine on the horizontal transmission of Mycoplasma gallisepticum. Avian Pathology, 35, 359366. Feberwee, A., de Wit, J.J. & Landman, W.J.M. (2009). Induction of eggshell apex abnormalities by Mycoplasma synoviae: eld and experimental studies. Avian Pathology, 38, 7785. Finney, D. J. (1952). Statistical method in biological assay, 1st edn (pp. 524530). London: Charles Grifn and Co. Ltd. Hannan, P.C. (2000). Guidelines and recommendations for antimicrobial minimum inhibitory concentration (MIC) testing against veterinary mycoplasma species. Veterinary Research, 31, 373395. Jeffery, N., Gasser, R.B., Steer, P.A. & Noormohammadi, A.H. (2007). Classication of Mycoplasma synoviae strains using single-strand conformation polymorphism and high-resolution melting-curve analysis of the vlhA gene single-copy region. Microbiology, 153, 2679 2688. Kleven, S.H. (2003). Mycoplasma synoviae infection. In Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. McDougald & D.E. Swayne (Eds.), Diseases of Poultry, 11th edn (pp. 756766). Ames: Iowa State Press. Kleven, S.H., Fletcher, O.J. & Davis, R.B. (1975). Inuence of strain of Mycoplasma synoviae and route of infection on development of synovitis or airsacculitis in broilers. Avian Diseases, 19, 126135. Landman, W.J.M. & Feberwee, A. (2001). Field studies on the association between amyloid arthropathy and Mycoplasma synoviae infection, and experimental reproduction of the condition in brown layers. Avian Pathology, 30, 629639. Landman, W.J.M. & Feberwee, A. (2004). Aerosol-induced Mycoplasma synoviae arthritis: the synergistic effect of infectious bronchitis virus infection. Avian Pathology, 33, 591598. Landman, W.J.M., Mevius, D.J., Veldman, K.T. & Feberwee, A. (2008). In vitro antibiotic susceptibility of Dutch Mycoplasma synoviae eld isolates originating from joint lesions and the respiratory tract of commercial poultry. Avian Pathology, 37, 415420. Markham, J.F., Morrow, C.J. & Whithear, K.G. (1998a). Efcacy of a temperature-sensitive Mycoplasma synoviae live vaccine. Avian Diseases, 42, 671676. Markham, J.F., Scott, P.C. & Whithear, K.G. (1998b). Field evaluation of the safety and efcacy of a tempertature-sensitive Myoplasma synoviae live vaccine. Avian Diseases, 42, 682689. Mekkes, D.R. & Feberwee, A. (2005). Real-time PCR for the qualitative and quantitative detection of Mycoplasma gallisepticum. Avian Pathology, 34, 348354. Meynell, G.G. & Meynell, E. (1970). Theory in experimental bacteriology, 2nd edn (pp. 232233). Cambridge: Cambridge University Press. Morrow, C.J., Bell, I.G., Walker, S.B., Markham, P.F., Thorp, B.H. & Whithear, K.G. (1990). Isolation of Mycoplasma synoviae from infectious synovitis of chickens. Australian Veterinary Journal, 67, 121124. Olson, N.O., Shelton, D.C., Bletner, J.K., Munro, D.A. & Anderson, G.C. (1956). Studies of infectious synovitis in chickens. The American Journal of Veterinary Research, 17, 747754. Reed, L.J. & Muench, H. (1938). A simple method for estimating fty percent endpoints. American Journal of Hygiene, 27, 493497. Statistix (2005). Users Manual Analytical software version 8.0. Tallahassee, Florida. Stipkovits, L. & Kempf., I. (1996). Mycoplasmosis in poultry. Revue Scientique et Technique (International Ofce of Epizootics), 15, 14951525. van Beek, P.N.G.M., Feberwee, A., Fabri, T.H.F. & Heijmans, M.J.H.M. (2002). Longitudinal eld study on the presence of Mycoplasma synoviae in meat-turkey ocks with arthritis. In Proceedings of the 4th International Symposium on Turkey Diseases (pp. 177178). Berlin, Germany.