This article was downloaded by: [117.201.17.

117] On: 10 January 2012, At: 07:39 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Avian Pathology
Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/cavp20

Co-circulation of four types of infectious bronchitis virus (793/B, 624/I, B1648 and Massachusetts)
I. Capua , Z. Minta , E. Karpinska , Karen Mawditt , P. Britton , D. Cavanagh & R. E. Gough
a d e a b c d d

Istituto Zooprofilattico delle Venezie, Via Romea 14/A, Legnaro, Padova, 35020, Italy
b c d

National Veterinary Research Institute, Pulawy, 24-100, Poland Faculty of Veterinary Medicine, Warsaw, 03-849, Poland

Institute for Animal Health, Compton, Newbury, Berkshire, RG20 7NN, UK

e

Central Veterinary Laboratory, New Haw Addlestone, Surrey, KT15 3NB, UK Available online: 17 Jun 2010

To cite this article: I. Capua, Z. Minta, E. Karpinska, Karen Mawditt, P. Britton, D. Cavanagh & R. E. Gough (1999): Co-circulation of four types of infectious bronchitis virus (793/B, 624/I, B1648 and Massachusetts), Avian Pathology, 28:6, 587-592 To link to this article: http://dx.doi.org/10.1080/03079459994380

PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material.

Avian Pathology (1999) 28, 587592

Co-circulation of four types of infectious bronchitis virus (793/B, 624/I, B1648 and Massachusetts)
I. Capua 1*, Z. Minta2, E. Karpinska3, Karen Mawditt4, P. Britton4, D. Cavanagh 4 and R. E. Gough5
1

Istituto Zoopro lattico delle Venezie, Via Romea 14/A, 35020 Legnaro, Padova, Italy, 2National Veterinary Research Institute, 24 100 Pulawy, Poland, 3Faculty of Veterinary Medicine, Warsaw 03 849, Poland, 4Institute for Animal Health, Compton, Newbury, Berkshire RG20 7NN, UK, and 5 Central Veterinary Laboratory, New Haw Addlestone KT15 3NB, Surrey UK

Downloaded by [117.201.17.117] at 07:39 10 January 2012

Eighteen isolates of infectious bronchitis virus (IBV) from Italy and Poland in 1997 to 1998 were comprehensively analysed by serum haemagglutination inhibition and virus neutralization tests, and by type-speci c polymerase chain reactions and spike protein S1 gene sequencing. Four types of IBV (793/B, 624/I, B1648 and Massachusetts) were detected in Italy, while the presence of 793/B was con rmed in Poland. This showed that not only were four types of IBV co-existing within a single year, but also that several types of IBV have persisted in Europe for many years (at least 13 to 14 years for types B1648 and 793/B). Sequencing of the S1 gene of the 624/I isolate con rmed this as a unique type of IBV.

Introduction Infectious bronchitis (IB) is still a major health problem in the chicken industry in most European countries. Infection is present both in the broiler industry, with respiratory and nephrosis forms, and in egg layers and broiler breeders with drops in egg production. In the past few years, several new variants have been isolated and characterized in Europe and in Italy (Gough et al., 1992; Parsons et al., 1992; Capua et al., 1994), while others seem to persist throughout the years (Cislaghi et al., 1997) and others appear to re-emerge after periods of non-detection (Gough et al., 1996). In order to establish which infectious bronchitis virus (IBV) variants have been circulating in Italy and Poland in recent years, a selection of IBV isolates obtained between 1997 and 1998 were collected and characterized by serological procedures, haemagglutination inhibition (HI) and virus neutralization (VN), and by molecular biological techniques, the polymerase chain reaction (PCR) and sequencing. It was also of interest to compare the deductions based on the different types of analysis; for some isolates, all the tests were in agreement, while for others there was discrepancy between the tests.
* To whom correspondenc e should be addressed. Tel: 1 Received 4 January 1999. Accepted 18 May 1999.

Materials and Methods

Viruses As a result of routine diagnostic activity, tissue samples collected from suspect IB outbreaks in eastern Italy and various regions of Poland were submitted for virological investigation. Clari ed suspensions (10% w/v) of tissue homogenate s were inoculated into the allantoic cavity of eggs of 9- to 11-day-ol d embryonated speci c pathogen free (SPF) fowl. From the third passage onwards, the allantoic uid was harvested and examined by negative contrast electron microscopy for the presence of coronavirus particles. All (10/10) of the Polish and 5/8 of the Italian isolates were from broilers, most of which exhibited nephrosis, of 17 days of age or older. The remaining three Italian isolates were from commercial layers, exhibiting falls in egg production. Only live IB vaccines of the Massachusetts type had been applied.

Serological characterization Isolates were characterized serologically by means of a one-way HI test (Alexander & Chettle, 1977) in both the Padova and Weybridge laboratories for the Italian isolates and in Weybridge for the Polish isolates. The HI tests were performed using monospeci c antisera against the following reference IBV strains: Massachusetts M41, 624/I (Capua et al.,1994), 793/B (UK 4/91; Gough et al., 1992; Parsons et al., 1992), the Dutch variants D1466 and D274 (Davelaar et al., 1984) , and a negative SPF serum. The Italian isolates were also processed by one-way VN test in SPF eggs, as described by Dawson & Gough (1971) (constant virus-varying serum).

39 049 8084369 . Fax: 1 39 49 8084360 . E-mail: diagmi.izs@interbusiness.i t

ISSN 0307-945 7 (print)/ISSN 1465-3338 (online)/99/060587-0 6

1999 Houghton Trust Ltd

588

I. Capua et al. Table 1. Sequence and position of the S1 gene oligonucleotide primers used in RT-PCRs Position in sequence a 1170 to 1193 729 to 749 1093 to 1111 958 to 978 895 to 915 817 to 837 1601 to 1620 31 to 47

Oligonucleotide XCE2 2 XCE1 1 XCE3 2 BCE1 1 DCE1 1 MCE1 1 S1Uni1 2 S1Uni2 1

a

Sequence (59 39 ) CTCTATAAACACCCTTACA CACTGGTAATTTTTCAGATG G CAGATTGCTTACAACCACC AGTAGTTTTGTGTATAAACC A ATACAATTATATCAAACCAG C AATACTACTTTTACGTTACAC CCTACTAATTTACCACCAG A (CCC) bAATTTGAAAACTGAACA

Reference Adzhar et al., 1997 Adzhar et al., 1997 Adzhar et al., 1997 Adzhar et al., 1997 Adzhar et al., 1997 Adzhar et al., 1997 Binns et al., 1985 Binns et al., 1985

The position of the oligonucleotides is in relation to the sequences published in the references that are given. b The nucleotides CCC at the 59 end of oligonucleotide S1Uni2 1 are non-template residues, i.e. do not correspond to IBV sequence (Adzhar et al., 1997).

Downloaded by [117.201.17.117] at 07:39 10 January 2012

Molecular characterizatio n General reverse transcription-PCR procedur e. Viral RNA was extracted from infectious allantoic uid or tracheal swabs, as described by Adzhar et al. (1996). The same general procedur e was used for all reverse transcription (RT)-PCRs. RNA (0.5 m l) was added to a reaction whose nal volume was 5 m l and contained 500 units (u) RnaseH murine Moloney leukaemia virus reverse transcriptase (Superscript II; Life Technologies) , 0.5 u RNAsin (Promega), 0.25 m l of a 1:10 dilution of stock negative sense oligonucleotide , 0.5 mM dNTPs (Promega), 50 mM TrisHCl (pH 8.3), 10 mM dithiothreitol, 75 mM KCl and 3 mM MgCl2. This was incubated at 45 C for 60 min, after which it was heated at 72 C for 10 min. All (5 m l) of the RT reaction containing cDNA was added to a 50 m l nal volume PCR reaction containing 1 m l of a 1:10 dilution of appropriate positive-sense oligonucleotid e primer and 1 m l of a 1:10 dilution of the negative-sens e oligonucleotide used for the RT reaction, 5 m l of 3 10 PCR buffer (100 mM TrisHCl (pH 9.0), 500 mM KCl, 1% Triton X-100), 3.5 m ml of 25 mM MgCl2, 1 m l of 10 mM dNTPs, 1.7 u Taq polymerase (Promega) and 34 m l water. The mixture was overlaid with 50 m l mineral oil and the PCR performed using the following conditions: denaturation (94C, 1 min), annealing (48C, 1.5 min), extension (72C, 2 min), 30 cycles. The nested PCR was performed with 2 m l of the rst PCR reaction in a nal volume of 20 m l with the same composition as the rst PCR, including additional dNTPs at 0.5 mM plus 1 m l of 1:10 dilutions of the appropriate stock negative- and positive-sense oligonucleotides . The nested PCR was for 30 cycles under the same conditions as the rst PCR. The resultant DNA was analysed by electrophoresi s in 2% agarose (LE, analytical grade; Promega) gel, stained with ethidium bromide and visualized by UV transillumination. Multiplex nested RT-PCR for IBV. Isolates were rst analysed in a multiplex RT-PCR designed to detect and differentiate strains of the 793/B (also known as 4/91 and CR88), D274 and Massachusetts types. The sequenc e of the oligonucleotid e for priming the RT reaction (XCE2, negative sense) was common to all three types of IBV (Table 1) and was used with oligonucleotid e XCE1 1 , which was also designed to function with each of the three types of IBV. The 464 base pair (bp) product was used in a nested PCR with oligonucleotid e XCE3, designed to hybridize to RNA from all three types, and oligonucleotide s BCE1 1 , DCE1 1 and MCE1 1 speci c for types 793/B, D274 and Massachusetts , respectively, generating cDNAs of 154, 217 and 295 bp, respectively. In order to sequenc e isolates that were positive for 793/B, a RT-PCR was performed using oligonucleotide s XCE2 and XCE1 1 , followed by sequencing with the same oligonucleotide s (Table 1).

Additional nested RT-PCRs and sequencin g. Sequence data for isolates 1007/97, 1204/97 and 1034/97 were obtained in the following ways. For 1007/97, a RT-PCR was performed with universal oligonucleotides S1Uni1 and XCE1 1 , followed by a semi-nested PCR using oligonucleotide s XCE3 and XCE1 1 , and sequenced using XCE3 and XCE1 1 (Table 1). For isolate 1034/97, the same procedur e was followed except that oligonucleotide XCE2 was used in place of S1Uni1. These procedures gave sequenc e data at approximatel y two-thirds down the length of the S1 gene. Sequence near the beginning of the S1 gene was generated for isolates 1007 and 1204 by an RT-PCR with universal oligonucleotide s XCE3 and S1Uni2 1 , followed by sequencin g using S1Uni2 1 . Isolate 21911/97 did not yield DNA in the multiplex PCR. Therefore, a RT-PCR was performed with oligonucleotide s XCE2 and S1Uni2 1 , followed by a semi-nested PCR using XCE3 and S1Uni2 1 , and the beginning sequence d with S1Uni2 1 . DNA was produced for isolate 624/I by a RT-PCR using oligonucleotide s XCE3 and S1Uni2 1 , followed by sequencing with XCE3, S1Uni2 1 and XCE1 1 . The sequence s of two regions of the S1 gene of the 624/I isolate have been submitted to the EMBL Nucleotide Sequence Databank. The sequences were nucleotides 169 to 536 (Accession Number AJ243261 ) and nucleotides correspondin g to position 814 to 1032 in Figure 1 of Adzhar et al. (1997) (Accession Number AJ243262) .

Results All strains exhibited haemagglutinating activity only after treatment with an extract of Clostridium perfringens type C culture. Italian isolates Isolates 1213/97, 21913/97 and 21914/97 were identi ed as being of the 793/B type (Gough et al., 1992; Parsons et al., 1992; Adzhar et al., 1997) on the basis of HI, VN and PCR tests, and nucleotide sequencing; all analyses were in agreement, and results are reported for isolate 1213/97 in Table 2, panel (a). The three isolates differed from UK/7/ 91, an early British isolate of the 793/B type, by only 1.6 to 4.2% of nucleotides at position 785 to 1010 in the S1 gene. For comparison, the H120

Co-circulation of IBV strains Table 2. Serological and molecular characterization of Italian isolates 1213/97 (793/B type), 2191 2/97 (Massachusetts type), 2191 1/97 (624/I type) and 1204/97 (B1648 type) (a) 1213/97 Test HI (IZSa) HI (CVLb) VN (IZSa) PCR Sequencing (b) 21912/97 Test HI (IZS) HI (CVL) VN (IZS) PCR 1 (c) 21911/97 Test HI (IZS) HI (CVL) VN (IZS) PCR Sequencing (d) 1204/97 Test HI (IZS) HI (CVL) VN (IZS) PCR ,
a

589

Strain M41

624/I

793/B

D1466

D274

3c 3 , 3c f

, 3 nd d

4 3

6 7 , 7.5 1 e 1 g ,

3 3 3 nd

, 3 f

5 4

7 7 7
e

4 5 5.5 nd ,

2 6 3

5 3 3 nd

, 3

3 4

Downloaded by [117.201.17.117] at 07:39 10 January 2012

4 5 3.25 1

7 8 7 nd
g

3 6 3.5

3 1 3 nd

3 4 nd

3 5 3

, 3 nd 1

6 8

3 6 3
e

3 4 3

, 3

4 6

Tests performed at the Istituto Zoopro lattico delle Venezie, Italy. Tests performed at the Central Veterinary Laboratory, Weybridge, UK. c Titres are expressed as a log2 of the reciprocal of the highest dilution of serum giving 100% HI or neutralization. d nd 5 not done. e A DNA product of a size characteristic of this type was obtained in the multiplex RT-PCR, which was designed to detect 793/B, D274 and Massachusetts types of IBV. f No DNA product characteristic of these IBV types was obtained in the multiplex RT-PCR. g Nucleotide sequencing of part of the spike S1 gene con rmed the identity as being of this type.
b

Massachusetts type strain differs from UK/7/91 by 18.9% in the corresponding region. Thus this type of IBV was widespread in several Italian regions. All the tests performed on isolate 21912/97, which was isolated from 36-week-old commercial layers, indicated that this isolate belonged to the Massachusetts type (Table 2, panel (b)). Serological characterization of isolate 21911/97 (Table 2, panel (c)), indicated that this isolate was closely related to strain 624/I. The latter was rst isolated in 1993 in Italy and was at that time a previously undescribed serotype (Capua et al., 1994). No PCR product was obtained with the multiplex RT-PCR as it was designed to detect

only the 793/B, D274 and Massachusetts types. As no sequence data was available for the 624/I type, universal IBV oligonucleotide primers were used to amplify the rst 75% of the S1 gene of both isolate 21911/97 and the prototype strain 624/I. Sequencing of nucleotides 837 to 968 of 21911/ 97 revealed that it differed by only 5.3% of nucleotides from the original isolate 624/I. For comparison, UK/7/91 of the 793/B type differed by 19.2% from isolate 624/I in the corresponding region. There was only 1.0% difference between 624/I and 21911 for nucleotides 15 to 110. Thus, sequence and serological analyses were in agreement.

590

I. Capua et al.

Table 3. Comparison of sequences of parts of the S1 gene of IBV 624/I with those of some European and North American isolates Difference (%) for nucleotides Isolate UK/918/67 UK/7/91 NL/D207/78 B/B1648/87 NL/1466/78 US/SE-17 US/ARK 99 US/M41 US/GRAY US/DE-07292 15 to 573 22 26 22 20 48 25 26 26 26 45 836 to 1066 15 20 19 24 40 20 22 23 25 63

isolates indicated that three of them were of the 793/B type and one of the 624/I type. One isolate showed no signi cant inhibition with any of the reference antisera and did not produce a PCR product using the multiplex PCR. RT-PCR analysis of the ve isolates already mentioned and ve other IBV RNAs recovered from swabs suggested that eight of them were of the 793/B type. The S1 cDNA of the two RT-PCR-positive isolates was partially sequenced and the difference of nucleotides 858 to 1006 from UK7/91, a 793/B strain, was 4.7 and 5.4%, respectively. The nucleotide difference between the two Polish isolates was 4% (Minta et al., 1998). Thus, these two isolates were con rmed as being of the 793/B type.

Given that strains of the 624/I type were still present in Italy, we sequenced two parts of the S1 gene of 624/I, equivalent to 57% of the S1 gene. This revealed that it differed substantially from all S1 sequences available from the nucleotide sequence databanks, a selection of which are presented in Table 3. For comparison, the UK/7/91 isolate differs from strains H120 and D274 by 25 and 24%, respectively, between nucleotides 15 to 573, and by 24 and 19%, respectively, between nucleotides 836 to 1066. Thus, 624/I is clearly a previously undescribed genotype. Strains 1007/97, 1034/97 and 1204/97 exhibited a common behaviour which may be summarized as follows (Table 2, panel (d)). The HI test indicated serological identity with strain 624/I, but this was not con rmed by the VN test. In the multiplex PCR, these isolates generated cDNA of a size suggesting that they were of the 793/B genotype. In view of the lack of correlation among the serological and PCR results, cDNA was generated using universal IBV oligonucleotide primers. Sequencing revealed that they were clearly not of the 793/B genotype. Moreover, further sequence comparisons showed that isolates 1007/97, 1034/97 and 1204/97 were very closely related to the 1984 Belgian nephropathogeni c isolate B1648. Sequencing of nucleotides 2258 of the S1 gene of isolates 1007/97 and 1204/97 showed them to have 98.5% identity with each other and 96.6 to 96.9% identity with B1648. For comparison, the H120 strain has only 73% identity in this region with B1648. Sequencing of nucleotides 7971018 of the S1 gene of isolates 1007/97 and 1034/97 showed them to have 98.6% identity with each other and 94.5 to 95.7% identity with B1648. Thus, the three Italian isolates were clearly of the B1648 type, but were more closely related to each other than to B1648. Polish isolates One-way HI tests performed on ve of the Polish

Discussion We have presented, for the rst time, sequence data for the 624/I isolate, revealing this to be of a previously undescribed genotype. Our characterization of the various IBV eld isolates was very comprehensive, comprising two serological tests and two nucleic acid approaches. The results have highlighted the dif culties involved in unequivocally identifying isolates of IBV. In many instances in this study, the one-way HI test and type-speci c PCR led to the same conclusion as to the type of IBV, the deduction being con rmed by sequencing. However, neither the HI test nor the type-speci c PCRs led to the correct identi cation in the case of the isolates that subsequently proved to be of the B1648 type (Table 2 panel (d)). Sequence analysis has revealed that B1648 has an overall S1 gene sequence very different from that of 793/B (Shaw et al., 1996). Unfortunately, the sequence at the position of the supposedl y 793/B-speci c oligonucleotide (BCE1 1 , Table 1) was suf ciently similar to the corresponding region of B1648 that the oligonucleotide hybridized well and gave a positive result with B1648 isolates. This problem can be addressed by the selection of two 793/B-speci c oligonucleotides for the PCR, rather than just one. Universal oligonucleotides, such as S1Uni1, S1Uni2 1 and XCE1 1 , XCE2 and XCE3 1 (Table 1; Adzhar et al., 1996), can be used to detect many types of IBV. However, to identify the type of IBV, the DNA product would need to be analysed further, e.g. by gene sequencing, if a new type was suspected, or if technology was either not available or not logistically feasible in all diagnostic laboratories. Although the HI test is the simplest to perform, one-way only tests may occasionally lead to wrong conclusions (Brown & Bracewell, 1985). Serum VN tests give fewer cross-reactions and are more speci c than HI tests (Cook et al., 1987). However, viruses that have

Downloaded by [117.201.17.117] at 07:39 10 January 2012

Co-circulation of IBV strains

591

extremely similar S1 gene sequences may appear unrelated in VN tests, again leading to erroneous conclusions (Cavanagh et al., 1992). Thus, there are potential problems with all characterization tests for IBV; a combination of tests is perhaps most appropriate. The rst isolation of the 793/B type of IBV type was in 1985, in France (see Cavanagh et al., 1998a). It spread to the UK in 1990/1991 (Gough et al., 1992; Parsons et al., 1992) and was detected elsewhere in Europe, and in Thailand and Mexico, in the early years of this decade (Cook et al., 1996), and is the major type of IBV in the UK currently (Cavanagh et al., 1998b). Our analysis has shown that type 793/B has become a major component of the IBV population in regions of Italy and in Poland. Extensive analysis of the S1 gene of the 624/I isolate showed that this strain was clearly of a genotype distinct from that of all others described. It was rst detected, in Italy, in 1993, with serological and virological evidence for its presence since that time (Capua et al., 1995, 1996) and isolation in 1997, as reported herein. There is serological evidence for its presence in Poland (this communication) and in the Republic of South Africa (R. E. Gough, unpublished observation). Our analysis of isolates 1007/97, 1034/97 and 1204/97 revealed that yet another type of IBV has persisted in Europe for many years; namely, the B1648 type, rst isolated, in Belgium, in 1984 (Meulemans et al., 1987). At that time, B1648 was associated with nephritis and subsequent high mortality (Meulemans et al., 1987). The Italian isolates of the B1648 type were associated with nephrosis and drops in egg production. As far as we are aware, isolates of the B1648 type have not been reported in recent years. It is of practical interest that HI tests had indicated that Italian isolates 1007/97, 1034/97 and 1204/97 were related to 624/I, while the multiplex RT-PCR had indicated that they were of the 793/B type. In the VN test, isolates 1204/97 and 1034/97 were not neutralized with any of the reference antisera (Table 2, panel (d)). In the event, sequencing revealed that none of the deductions was correct. It may be, therefore, that strains of B1648 have been in Italy for some years but have not been correctly identi ed. Notwithstanding, the B1648 type of IBV is clearly present in Italy and may be present elsewhere. An important conclusion from this study is that although the Italian isolates were obtained during only a single year, 1997, from one part of the country, at least three types of IBV were co-existing (four types if the Massachusetts isolate is included). This is similar to the situation reported for The Netherlands in the late 1970s and early 1980s, where four other types of IBV co-existed (Davelaar et al., 1984). Massachusetts-type vaccines have been shown to be only partially effective against B1648 (Meulemans et al., 1987;

Lambrechts et al., 1993; Pensaert & Lambrechts, 1994) and 793/B (Parsons et al., 1992). One reason, therefore, for the persistence of different types of IBV may be that Massachusetts strains are the most commonly used IBV vaccines in Italy and Poland, as elsewhere in Europe. Evidence reported in this paper suggests that the distribution of IBV variants should be carefully studied in order to develop and implement appropriate vaccination programmes for given areas.

Acknowledgements Financial support was partially provided by of the British Chicken Association and the Ministry of Agriculture, Fisheries and Food, UK. The technical assistance of Daniela Antonucci, Maura Pisciella, Cristina Saccardin and Bill Cox is gratefully acknowledged. References
Adzhar , A., Shaw, K., Britton, P. & Cavanagh , D. (1996). Universal oligonucleotide s for the detection of infectious bronchitis virus by the polymerase chain reaction. Avian Pathology, 25, 817836. Adzhar , A., Gough, R.E., Haydon, D., Shaw, K., Britton, P. & Cavanagh , D. (1997). Molecular analysis of the 793/B serotype of infectious bronchitis virus in Great Britain. Avian Pathology, 26, 625640. Alexander, D.J. & Chettle, N.J. (1977). Procedures for the haemagglu tination and the haemagglutinatio n inhibition tests for avian infectious bronchitis virus. Avian Pathology, 6, 917. Binns, M.M., Bournsell, M.E.G., Cavanagh , D., Pappin, D.J.C. & Brown, T.D.K. (1985). Cloning and sequencing of the gene encoding the spike protein of the coronavirus IBV. Journal of General Virology, 66, 719726. Brown, A.J. & Bracewell, C.D. (1985). Application of the haemagglu tination inhibition test to typing infectious bronchitis virus. The Veterinary Record, 116, 4748. Capua, I., Gough, R.E., Mancini, M., Casaccia, C. & Weiss, C. (1994). A `novel infectious bronchitis strain infecting broiler chickens in Italy. Journal of Veterinary Medicine B, 41, 8389. Capua, I., Gough, R.E., Mancini, M., Casaccia, C. & Calzetta, G. (1995). Isolamento e caratterizzazion e preliminare del ceppo di bronchite infettiva 624/I implicato nella sindrome respiratoria del pollo da carne. Proceeding s XXXIII Convegno della Societa Italiana di Patologia Aviare, February (pp. 5355). Forli: Zootecnica International. Capua, I., Grasso, G., Ferdinandi , S., Weiss, C. & Casaccia, C. (1996). Osservazioni su focolai di nefrite nefrosi e di calo dell ovodeposizion e associat i ad infezione da virus bronchit e infettiva 624/I. Proceedings XXXIV Convegno della Societa Italiana di Patologia Aviare, June (pp. 4951). Forli: Zootecnica International. Cavanagh , D., Davis, P.J., Cook, J.K.A., Li, D., Kant, A. & Koch, G. (1992). Location of the amino acid differences in the S1 spike glycoprotei n subuni t of closely related serotypes of infectious bronchitis virus. Avian Pathology, 21, 3343. Cavanagh , D., Mawditt, K., Gough, R., Picault, J.-P. & Britton, P. (1998a). Sequence analysis of strains of the 793/B genotype (CR88, 4/91) of IBV isolated between 1985 and 1997. Proceeding s of the International Symposium on Infectious Bronchitis and Pneumovirus Infections in Poultry, June (pp. 252256). Rauischholzhausen , Germany. Cavanagh , D., Mawditt, K., Britton, P. & Naylor, C. J. (1998b) . Longitudinal studies of infectious bronchitis virus in broilers using genotype-speci c quantitative PCRs. Proceeding s of the International Symposium on Infectious Bronchitis and Pneumovirus

Downloaded by [117.201.17.117] at 07:39 10 January 2012

592

I. Capua et al.
RESUME Co-circulation de quatre types de virus de la bronchite infectieuse (793/B, 624/I, B1648 et Massachusetts) Dix huit souches de virus de la bronchit e infectieuse (IBV) isolees en Italie et en Pologne en 19971998 ont fait l objet de tests d inhibition de l hemagglutination (HI), de se roneutralisation, de reactions speci ques de type par ampli cation en cha par polymerase (PCRs) ne et de sequencage du ge ne S1 correspondan t a la proteine de spicule. Quatre types d IBV (793B, 624/I, B1648 et Massachusetts) ont ete detectes en Italie alors que la presence du virus 793/B a ete con rmee en Pologne. Ceci a montre qu il n y avait pas seulement quatre types d IBV coexistants au cours d une meme annee, mais egalement que plusieurs types d IBV ont persiste en Europe durant plusieurs annees (au moins 13 a 14 annees pour les types B1648 et 793/B). Le se age du ge ne S1 de l isolat 624/I a con rme qu il representait quenc un type unique d IBV.

Infections in Poultry, June (pp. 215219). Rauischholzhausen , Germany. Cislaghi, G., Martino, B.A., & Zanella, A. (1997) Bronchite infettiva aviare: persistenza nel nostro paese del virus nefropatogen o sierotipo AZ 23/74. Proceeding s XXXV Convegn o Societa Italiana di Patologia Aviare, Forl . La Selezione Veterinaria, 89, 597605. Cook, J.K.A., Brown, A.J. & Bracewell, C.D. (1987). Comparison of the haemagglutinatio n inhibition test and the serum neutralisation test in tracheal organ cultures for typing infectious bronchitis virus strains. Avian Pathology, 16, 505511. Cook, J.K.A., Orbell, S.J., Woods, M.A. & Huggins, M.B. (1996). A survey of the presence of a new infectious bronchitis virus designated 4/91 (793B). The Veterinary Record, 138, 178180. Davelaar , F.G., Kouwenhoven , B. & Burger, A.G. (1984). Experience with vaccination against infectious bronchitis in broilers and signi cance of the vaccination against variant infectious bronchitis viruses in breeders and layers in The Netherlands. Clinica Veterinaria, 106, 711. Dawson, P.S. & Gough, R.E. (1971). Antigenic variation in strains of avian infectious bronchitis virus. Archiv fur die gesamte Virusforschung, 34, 3239. Gough, R.E., Randall, C.J., Dagless, M., Alexander , D.J, Cox, W.J. & Pearson, D. (1992) . A `new strain of infectious bronchitis virus infecting domestic fowl in Great Britain. Veterinary Record, 130, 493494. Gough, R.E., Cox, W.J., Gutierrez, E., MacKenzie, G., Wood, A.M. & Dagless, M.D. (1996). Isolation of `variant strains of infectious bronchitis virus from vaccinated chickens in Great Britain. Veterinary Record, 139, 552. Lambrechts, C., Pensaert, M. & Ducatelle, R. (1993). Challenge experiments to evaluate cross-protectio n induced at the trachea and kidney level by vaccine strains and Belgian nephropathogeni c isolates of avian infectious bronchitis virus. Avian Pathology, 22, 577590. Meulemans, G., Carlier, M.C., Gonze, M, Petit, P. & Vandenbrouck , M. (1987). Incidence, characterizatio n and prophylaxi s of nephropathogeni c avian infectious bronchitis virus. Veterinary Record, 120, 205206. Minta, Z., Bugajak, P., Karpinska, E., Gough, R., Cavanagh , D., Mawditt, K., Cox,W.J., Bartnicka, P. & Wiercinski, J. (1998) . Isolation of new strains of IBV from broiler chickens in Poland. Proceeding s of the Internationa l Symposium on Infectious Bronchitis and Pneumovirus Infections in Poultry, June (pp. 180188). Rauischholzhausen , Germany. Parsons, D., Ellis, M.M., Cavanagh , D. & Cook, J.K.A. (1992) . Characterisation of an infectious bronchitis virus from vaccinated broiler breeders. Veterinary Record, 131, 408411. Pensaert, M. & Lambrechts, C. (1994). Vaccination of chickens against a Belgian nephropathogeni c variant of infectious bronchitis virus B1648 using attenuated homologou s and heterologou s strains. Avian Pathology, 23, 631641. Shaw, K., Britton, P. & Cavanagh , D. (1996). Sequence of the spike protein of the Belgian B1648 isolate of nephropathogeni c infectious bronchitis virus. Avian Pathology, 25, 607611.

ZUSAMMENFASSUNG Gemeinsames Vorkommen von vier Typen des Bronchitisvirus (793/B, 624/I, B1648 und Massachusetts) Achtzehn Bronchitisvirus (IBV)-Isolate aus Italien und Polen aus den Jahren 199798 wurden mittels Hamagglutinationshemmung s (HAH) und Virusneutralisationstest s und mittels typspezi scher Polymerasekettenreaktione n (PCRs) und Sequenzierun g des SpikeproteinS1-Gens umfassend analysiert. Vier IBV-Typen (793/B, 624/I, B1648 und Massachusetts ) wurden in Italien nachgewiesen , wahrend die Prasenz von 793/B in Polen besta tigt wurde. Dies zeigte nicht nur, dass innerhal b eines einzigen Jahres vier IBV-Typen nebeneinande r vorkamen , sondern auch, dass mehrere IBV-Typen viele Jahre lang (die Typen B1648 und 793/B mindestens 13 bis 14 Jahre) in Europa persistiert haben. Die Sequenzierun g des S1-Gens des Isolats 624/I bestatigte dieses als einen aub ergewohnlichen IBV-Typ.

Downloaded by [117.201.17.117] at 07:39 10 January 2012

RESUMEN Co-circulacion de cuatro tipos de virus de bronquitis infecciosa (793/B, 624/I, B1648 y Massachusetts) Se analizaron dieciocho aislados del virus de la bronquitis infecciosa procedentes de Italia y Polonia en el periodo 19978, mediante tecnicas de inhibicion de la hemoaglutinaci on (HI) y seroneutraliza cion y mediante pruebas de la reaccion de la polimerasa en cadena espec cas para cada tipo, as como secuenciaci o n del gen S1 de la prote de esp (spike protein). Se identi caron cuatro tipos de na cula IBV en Italia (793/B, 624/I, B1648 y Massachusetts ) mientras que se con rmo la presenci a del tipo 793/B en Polonia. Esto demuestra que no solo han coexistido cuatro tipos de IBV en un ano sino que tambien hay varios tipos de IBV que han persistido en Europa durante muchos anos (por lo menos de 13 a 14 an os en el caso de los tipos B1648 y 793/B). La secuenciaci o n del gen S1 en el caso del aislado 624/I con rmo que se trata de un solo tipo de IBV.