Agriculture Biotechnology

Lovely Professional University

2011

SUBMITTED BY

SUBMITTED TO

Pathak Ratnesh Raman

Roll No.ROE162A-01 B.Tech (ME) Agriculture Biotechnology

Mr.Prashant Mohanpuria
LPU, Phagwara 14/11/11

ACKNOWLEDGEMENT I take this opportunity to present my votes of thanks to all those guidepost who really acted as lightening pillars to enlighten our way throughout this project that has led to successful and satisfactory completion of this study. We are really grateful to our HOD for providing us with an opportunity to undertake this project in this university and providing us with all the facilities. We are highly thankful to Mr.Prashant Mohanpuria for his active support, valuable time and advice, whole-hearted guidance, sincere cooperation and pains-taking involvement during the study and in completing the assignment of preparing the said project within the time stipulated. Lastly, We are thankful to all those, particularly the various friends , who have been instrumental in creating proper, healthy and conductive environment and including new and fresh innovative ideas for us during the project, their help, it would have been extremely difficult for us to prepare the project in a time bound framework.

Pathak Ratnesh Raman 14/11/2011

Agriculture Biotechnology
Table of contents:1. Gene 2. Clone 3. Gene cloning 4. Uses of gene cloning 5. Cloning process 6. Steps of gene cloning 7. Method of gene cloning 8. Techniques of gene cloning 9. Scnt (somatic cell nuclear transfer) 10. Genetically modified organisms 11. Types of cloning 12. Types of gene cloning 13. Uses of gene cloning 14. Advantage of gene cloning 15. Disadvantage of cloning 16. Benefits of gene cloning 17. Materials and method 18. Cloning of phytase gene 19. Researchist says 20. Conclusion 21. Refrence

Agriculture Biotechnology

What is Gene?
The basic unit of a cell that passes on the traits of parents to their children through the egg and sperm. Genes are pieces of DNA. They have information for

making specific proteins that control specific traits or activities. Examples of traits controlled by genes are eye color, foot size, and height. Examples of activity include the growth and repair of cells.

What Are the Uses of Cloning?

Cloning is the scientific process of creating an artificial reproduction of an existing organism, gene or set of genes. Cloning is different from the artificial insemination of an animal or artificial fertilization of a plant, in that cloning does not require sexual or asexual reproduction. The process creates an identical copy of the gene or organism using bacterium. There are several types of cloning and the uses of each are cause for controversy.

What is cloning?
Cloning is the creation of an organism that is an exact genetic copy of another. This means that every single bit of DNA is the same between the two! You might not believe it, but there are human clones among us right now. They weren't made in a lab, though: they're identical twins, created naturally. Below, we'll see how natural identical twins relate to modern cloning technologies.

1. Agriculture
Cloning is used in agriculture to produce additional crops by reproducing plants of existing crops. The type of cloning utilized in this situation is tissue sample cloning. A tissue sample from a parent plant is treated with a nutrient mixture that promotes the growth of roots. Roots sprout from the tissue sample to create an identical copy of the parent plant.

2. Stem Cells
Cloning of human cells is not used to make artificial identical twins, but to harvest stem cells for use in the medical field to
2

Agriculture Biotechnology
treat health conditions. The type of cloning in which stem cells are created is called therapeutic cloning. The stem cells that are grown are used to aid the body in boosting the immune system, replacing harmed or removed organs and curing various diseases including Parkinson's and Alzheimer's diseases.

How is cloning done?

We may have first heard of cloning when Dolly the Sheep showed up on the scene in 1997. Cloning technologies have been around for much longer than Dolly, though. How does one go about making an exact genetic copy of an organism? There are a couple of ways to do this: artificial embryo twinning and somatic cell nuclear transfer. How do these processes differ?

3. Misconceptions
Cloning is a topic of controversy and a subject of debate. Religious persons argue that cloning is unethical, however the current uses of cloning provide ways of assisting farmers and healing sick, rather than aiding sins of sloth, greed, and vanity. Controversy and debate will continue as the potential uses of cloning are explored.

1. Artificial Embryo Twinning

Artificial embryo twinning is the relatively low-tech version of cloning. As the name suggests, this technology mimics the natural process of creating identical twins. In nature, twins occur just after fertilization of an egg cell by a sperm cell. In rare cases, when the resulting fertilized egg, called a zygote, tries to divide into a twocelled embryo, the two cells separate. Each cell continues dividing on its own, ultimately developing into a separate individual within the mother. Since the two cells came from the same zygote, the resulting individuals are genetically identical. Artificial embryo twinning uses the same approach, but it occurs in a Petri dish instead of in the mother's body. This is accomplished by manually separating a very early embryo into individual cells, and then allowing each cell to divide and develop on its own. The resulting embryos are placed into a surrogate mother, where they are carried to term and delivered. Again, since all the embryos came from the same zygote, they are genetically identical.

4. Considerations
"Cloning in America." by Kelli Whitlock Burton, refers to approval studies on the uses of cloning. While approval for reproductive cloning is low, therapeutic cloning is more widely accepted as an ethical use of cloning. To prevent human cloning, the United States government has refused to fund such research and required all parties researching human cloning to obtain permission before beginning research.

5. Potential
The Office of Science Policy Analysis and the National Institutes of Health theorize the future uses of cloning to include advanced treatment of diseases, and perhaps even the cure of various diseases and disorders. Of these diseases, it is theorized that cloning has the potential to be used for reversing the effects of diabetes by reproducing insulin cells in the pancreas. Additionally, skin grafting and gene therapy may benefit from the future potential uses of cloning.

2. Somatic Cell Nuclear Transfer

Somatic cell nuclear transfer, (SCNT) uses a different approach than artificial embryo twinning, but it produces the same result: an exact clone, or genetic copy, of an individual. This was the method used to
1

Agriculture Biotechnology
create Dolly the Sheep. An embryo is composed of cells that contain two complete sets of chromosomes. The difference between fertilization and SCNT lies in where those two sets originated. In fertilization, the sperm and egg both contain one set of chromosomes. When the sperm and egg join, the resulting zygote ends up with two sets - one from the father (sperm) and one from the mother (egg). In SCNT, the egg cell's single set of chromosomes is removed. It is replaced by the nucleus from a somatic cell, which already contains two complete sets of chromosomes. Therefore, in the resulting embryo, both sets of chromosomes come from the somatic cell.

What does SCNT mean? Let's take it apart: Somatic cell: A somatic cell is any cell
in the body other than the two types of reproductive cells, sperm and egg. Sperm and egg are also called germ cells. In mammals, every somatic cell has two complete sets of chromosomes, whereas the germ cells only have one complete set.

Nuclear: The nucleus is like the cell's

brain. It's an enclosed compartment that contains all the information that cells need to form an organism. This information comes in the form of DNA. It's the differences in our DNA that make each of us unique.

Types of cloning
When the media report on cloning in the news, they are usually talking about only one type of cloning called reproductive cloning. It is extremely important to know that there are different types of cloning and that cloning technologies can be used for other purposes besides producing the genetic twin of another organism. A basic understanding of the different types of cloning is key to taking a more informed stance on current public policy issues and for making the best possible personal decisions. The following three types of cloning technologies will be discussed:

Transfer: Moving an object from one

place to another.To make Dolly, researchers isolated a somatic cell from an adult female sheep. Next, they transferred the nucleus from that cell to an egg cell from which the nucleus had been removed. After a couple of chemical tweaks, the egg cell, with its new nucleus, was behaving just like a freshly fertilized zygote. It developed into an embryo, which was implanted into a surrogate mother and carried to term. The lamb, Dolly, was an exact genetic replica of the adult female sheep that donated the somatic cell nucleus to the egg. She was the first-ever mammal to be cloned from an adult somatic cell.

(1)Recombinant DNA technology or DNA cloning, (2) Reproductive cloning, and (3) Therapeutic cloning. Recombinant DNA Technology or DNA Cloning:The terms "recombinant DNA technology," "DNA cloning," "molecular cloning,"or "gene cloning" all refer to the same
2

How does SCNT differ from the natural way of making an embryo?
The fertilization of an egg by a sperm and the SCNT cloning method both result in the same thing: a dividing ball of cells, called an embryo. So what exactly is the difference between these methods?

Agriculture Biotechnology
process: the transfer of a DNA fragment of interest from one organism to a selfreplicating genetic element such as a bacterial plasmid. The DNA of interest can then be propagated in a foreign host cell. This technology has been around since the 1970's, and it has become a common practice in molecular biology labs today. Scientists studying a particular gene often use bacterial plasmids to generate multiple copies of the same gene. Plasmids are selfreplicating extra-chromosomal circular DNA molecules, distinct from the normal bacterial genome. Plasmids and other types of cloning vectors are used by Human Genome Project researchers to copy genes and other pieces of chromosomes to generate enough identical material for further study. To "clone a gene," a DNA fragment containing the gene of interest is isolated from chromosomal DNA using restriction enzymes and then united with a plasmid that has been cut with the same restriction enzymes. When the fragment of chromosomal DNA is joined with its cloning vector in the lab, it is called a "recombinant DNA molecule." Following introduction into suitable host cells, the recombinant DNA can then be reproduced along with the host cell DNA. Plasmids can carry up to 20,000 bp of foreign DNA. Besides bacterial plasmids, some other cloning vectors include viruses, cosmids (artificially constructed cloning vectors that carry up to 45 kb of foreign DNA and can be packaged in lambda phage particles for infection into E. coli cells), bacteria artificial chromosomes called BACs (utilize the naturally occurring F-factor plasmid found in E. coli to carry 100-300 kb DNA inserts) and yeast artificial chromosomes, which can carry up to 1 MB of foreign DNA. Bacteria are most often used as the host cells for recombinant DNA molecules, but yeast and mammalian cells are also used. Reproductive Cloning:-Reproductive cloning is a technology used to generate an animal that has the same nuclear DNA as
3

another currently or previously existing animal. Dolly was created by reproductive cloning technology. In a process called "somatic cell nuclear transfer" (SCNT), scientists transfer genetic material from the nucleus of a donor adult cell to an egg whose nucleus, and thus its genetic material, has been removed.

The reconstructed egg containing the DNA from a donor cell must be treated with chemicals or electric current in order to stimulate cell division. Once the cloned embryo reaches a suitable stage, it is transferred to the uterus of a female host where it continues to develop until birth. Dolly or any other animal created using nuclear transfer technology is not truly an identical clone of the donor animal. Only the clone's chromosomal or nuclear DNA is the same as the donor. Some of the clone's genetic materials come from the mitochondria in the cytoplasm of the enucleated egg. Mitochondria, which are organelles that serve as power sources to the cell, contain their own short segments of DNA. Acquired mutations in mitochondrial DNA are believed to play an important role in the aging process. Dolly's success is truly remarkable because it proved that the genetic material from a

Agriculture Biotechnology
specialized adult cell, such as an udder cell programmed to express only those genes needed by udder cells, could be reprogrammed to generate an entire new organism. Before this demonstration, scientists believed that once a cell became specialized as a liver, heart, udder, bone, or any other type of cell, the change was permanent and other unneeded genes in the cell would become inactive. Some scientists believe that errors or incompleteness in the reprogramming process cause the high rates of death, deformity, and disability observed among animal clones. Therapeutic Cloning:-Therapeutic cloning, also called "embryo cloning," is the production of human embryos for use in research. extracted from the egg after it has divided for 5 days. The egg at this stage of development is called a blastocyst. The extraction process destroys the embryo, which raises a variety of ethical concerns. Many researchers hope that one day stem cells can be used to serve as replacement cells to treat heart disease, Alzheimer's, cancer, and other diseases. See more on the potential use of cloning in organ transplants. In November 2001, scientists from Advanced Cell Technologies (ACT), a biotechnology company in Massachusetts, announced that they had cloned the first human embryos for the purpose of advancing therapeutic research. To do this, they collected eggs from women's ovaries and then removed the genetic material from these eggs with a needle less than 2/10,000th of an inch wide. A skin cell was inserted inside the enucleated egg to serve as a new nucleus. The egg began to divide after it was stimulated with a chemical called ionomycin. The results were limited in success. Although this process was carried out with eight eggs, only three began dividing, and only one was able to divide into six cells before stopping.

Gene Cloning:Molecular genetics techniquesGene cloning is the act of making copies, or clones, of a single gene. Once a gene is identified, clones can be used in many areas of biomedical and industrial research. Genetic engineering is the process of cloning genes into new organisms, or altering the DNA sequence to change the protein product. Genetic engineering depends on our ability to perform the following essential procedures.

The goal of this process is not to create cloned human beings, but rather to harvest stem cells that can be used to study human development and to treat disease. Stem cells are important to biomedical researchers because they can be used to generate virtually any type of specialized cell in the human body. Stem cells are
4

1. Polymerase Chain Reaction

The discovery of thermostable DNA polymerases, such as Taq Polymerase, made it possible to manipulate DNA replication in the laboratory and was essential to the development ofPCR.

Agriculture Biotechnology
Primers specific to a particular region of DNA, on either side of the gene of interest, are used, and replication is stopped and started repetitively, generating millions of copies of that gene. These copies can then be separated and purified using gel electrophoresis. of self-replication, are known as plasmids. Plasmids are often used as vectors to transport genes between microorganisms. In biotechnology, once the gene of interest has been amplified and both the gene and plasmid are cut by restriction enzymes, they are ligated together generating what is known as a recombinant DNA. Viral (bacteriophage) DNA can also be used as a vector, as can cosmids, recombinant plasmids containing bacteriophage genes.

2. Restriction Enzymes
The discovery of enzymes known as restriction endonucleases has been essential to protein engineering. These enzymes cut DNA at specific locations based on the nucleotide sequence. Hundreds of different restriction enzymes, capable of cutting DNA at a distinct site, have been isolated from many different strains of bacteria. DNA cut with a restriction enzyme produces many smaller fragments, of varying sizes. These can be separated using gel electrophoresis or chromatography.

6. Method to Move a Vector into a Host Cell

The process of transferring genetic material on a vector such as a plasmid, into new host cells, is called transformation. This technique requires that the host cells are exposed to an environmental change which makes them "competent" or temporarily permeable to the vector. Electroporation is one such technique. The larger the plasmid, the lower the efficiency with which it is taken up by cells. Larger DNA segments are more easily cloned using bacteriophage, retrovirus or other viral vectors or cosmids in a method called transduction. Phage or viral vectors are often used in regenerative medicine but may cause insertion of DNA in parts of our chromosomes where we don't want it, causing complications and even cancer.

3. Electrophoresis
Purifying DNA from a cell culture, or cutting it using restriction enzymes wouldn't be of much use if we couldn't visualize the DNA - that is, find a way to view whether or not your extract contains anything, or what size fragments you've cut it into. One way to do this is by gel electrophoresis. Gels are used for a variety of purposes, from viewing cut DNA to detecting DNA inserts and knockouts.

4. Join Two Pieces of DNA

In genetic research it is often necessary to link two or more individual strands of DNA, to create a recombinant strand, or close a circular strand that has been cut with restriction enzymes. Enzymes called DNA ligases can create covalent bonds between nucleotide chains. The enzymes DNA polymerase I and polynucleotide kinase are also important in this process, for filling in gaps, or phosphorylating the 5' ends, respectively.

7. Methods to Select Transgenic Organisms

Not all cells will take up DNA during transformation. It is essential that there be a method of detecting the ones that do. Generally, plasmids carry genes for antibiotic resistance andtransgenic cells can be selected based on expression of those genes and their ability to grow on media containing that antibiotic. Alternative methods of selection depend on the presence of other reporter proteins such as the x-gal/ lacZ system, or green fluorescence protein, which allow selection based on color and fluorescence, respectively.

5. Selection of Replicating DNA

Small

Self-

Small circular pieces of DNA that are not part of a bacterial genome, but are capable
5

Agriculture Biotechnology
Gene cloning method
Cloning in E.coil

3. Safety
E. coli is naturally found in the intestinal tracts of humans and animals where it helps provide nutrients (vitamins K and B12) to its host. There are many different strains of E. colithat may produce toxins or cause varying levels of infection if in jested or allowed to invade other parts of the body. Despite the bad reputation of one particularly toxic strain (O157:H7), E. coli are generally relatively inocuous if handled with reasonable hygiene.

4. Conjugation and the Genome Sequence

The E. coli genome was the first to be completely sequenced. Genetic mapping in E. coli was made possible by the discovery of conjugation. E. coli is the most highly studied microorganism and an advanced knowledge of its protein expression mechanisms makes it simpler to use for experiments where expression of foreign proteins and selection of recombinants is essential.

1. Genetic Simplicity
Bacteria make useful tools for genetic research because of their relatively small genome size compared to eukaryotes. E. coli cells only have about 4,400 genes whereas the human genome project has determined that humans contain approximately 30,000 genes. Also, bacteria, including E. coli, live their entire lifetime in a haploid state, with no second allele to mask the effects of mutations during protein engineering experiments

4. Conjugation and the Genome Sequence

The E. coli genome was the first to be completely sequenced. Genetic mapping in E. coli was made possible by the discovery of conjugation. E. coli is the most highly studied microorganism and an advanced knowledge of its protein expression mechanisms makes it simpler to use for experiments where expression of foreign proteins and selection of recombinants is essential.

2. Growth Rate
Bacteria typically grow much faster than more complex organisms. E. coli grows rapidly at a rate of one generation per twenty minutes under typical growth conditions. This allows for preparation of log-phase (mid-way to maximum density) cultures overnight and genetic experimental results in mere hours instead of several days, months or years. Faster growth also means better production rates when cultures are used in scaled up fermentation processes.
6

Types of gene cloning:1. Clones-cloning-gene cloning 2. Vectors-gene cloning 3. Plasmids-gene cloning

Agriculture Biotechnology
Clones-cloning-gene cloning:
antibiotic resistance genes that can be used to test for expression of the plasmid DNA, on antibiotic petri plates. Gene transfer into plant cells is commonly performed using the soil bacterium Agrobacterium tumefaciens, which acts as a vector and inserts a large plasmid into the host cell.

A clone is an exact copy of an organism, organ, single cell, organelle or macromolecule. Cell lines for medical research are derived from a single cell allowed to replicate millions of times, producing masses of identical clones. Gene cloning is the act of making copies of a single gene. Creating millions of copies helps us visualize genes using methods like electrophoresis, which helps us determine the size of the gene. Cloning also helps us characterize factors affecting transcription and translation, and study the gene product, because we are able to create transgenic organisms to over express the gene (make lots of copies of the protein product). Once the gene product is characterized, clones of the gene can be used to control the molecular pathways in which they are involved, which can be useful in many areas of biomedical and industrial research.

Plasmids-gene cloning: A very

common vector for inserting a new gene into cells is the plasmid. Plasmids are small circular pieces of DNA that many bacteria produce, much smaller than their genomes (the circular DNA that carries the bulk of genes they need to survive). Plasmids can be isolated from bacteria, using what are now routine gene cloning techniques. The plasmid is cut with restriction enzymes, and the new gene inserted through a process called ligation, which reattaches the ends of the circular DNA strand. Plasmids often have genes on them for antibiotic resistance, which can be used to select GM cells after transformation on specialized media, but other marker genes can also be used, such as GFP or firefly luciferase. The presence of the vector can also be detected by agarose gel electrophoresis or by probing.

Vectors-gene

When geneticists use small pieces of DNA to clone a gene and create a GMO, that DNA is called a vector. The vector serves as the carrier for the transfer or insertion of gene(s). Vectors are among the essential tools for gene cloning and are most useful if they also encode some kind of marker gene encoding a bioindicator molecule that can be measured in a bioassay to ensure their insertion, and expression, in the host organism. In some cases, viruses are used to infect bacteria. These viruses are called bacteriophages, or phage, for short. Retroviruses are excellent vectors for introducing genes into animal cells. Plasmids, circular pieces of DNA, are generally used to introduce foreign DNA into bacterial cells. They often carry
7

cloning:

Agriculture Biotechnology
the chromosome.A few types of plasmids insert themselves into the bacterial chromosome for replication. Such plasmids are called episomes.The size and copy number of a plasmid is important. Copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell. Plasmids range from 1 kb to 250 kb. Plasmid smaller than 10 kb are preferred for vectors. Plasmids can be conjugative or nonconjugative. Conjugative plasmids are characterized by their ability to promote sexual conjugation between bacterial cells. Bacterial conjugation is the transfer of genetic material between bacteria through direct cell-to-cell contact. Conjugation and plasmid transfer are controlled by a set of transfer or tra genes which are present in conjugative genes but absent in nonconjugative genes. In order for the gene tranfer to be successful, the new gene must be flanked on the plamid by a promoter region and a transcription terminator sequence. The most useful plasmids have strong promoters or those that are inducible, meaning expression of the gene can be controlled in some way, by adding an inducing agent to the cell culture media. Besides having a means of detecting the plasmid in cells, it's important to be able to tell if the inserted gene is being expressed, by protein purification methods, and if the gene product is viable (eg. by measuring the specific activity).Plasmids are small circular DNA found in bacteria and some other organisms. Plasmids can replicate independently of the host cell chromosome. Plasmids can carry one ore more genes. Most plasmids possess at least one DNA sequence that can act as an origin of replication, so they are able to multiply within the cell independently of
8

To coexist in a cell, different plasmids must be compatible. If two plasmids are incompatible, one of them would quickly be lost from the cell. Thus plasmid can be assigned to different incompatibility groups. Naturally occuring plasmids are classified on the basis of the main characteristic code by the plasmid genes. 1. Fertility or F plasmids: carry only tra genes and have no characteristic beyond the ability to promote conjugation 2. Resistance or R plasmids: carry antibiotic resistance genes. Used as selectors in the lab 3. Col plasmids: code for colicins which are proteins that kill other bacteria 4. Degradative plasmids: allows the host bacteria to metabolize unusual molecules 5. Virulence plasmids: confer pathogenicity on the host bacteria.

Agriculture Biotechnology
Steps of gene cloning:The basic steps of gene cloning are 1) A fragment of DNA , containing the gene to be cloned, is inserted into a circular DNA molecule (vector) "Recombinant DNA molecule" or "Chimera" 2) The vector acts as a vehicle that transports the gene into a host cell (usually, bacterium) possibly other types of living cell. 3) Within the host cell the vector multiplies, producing numerous identical copies not only of itself but also of the gene that it carries. The gene that it carries. 4) When the host cell divides, copies of the Recombinant DNA molecule are passed to the Progeny and further vector replication takes Place. 5) After a large number of cell divisions, a Colony, or clone, of identical host cells is produced. Each cell in the clone contains one or more copies of the recombinant DNA molecule. The gene is cloned. as well as lmany other practical problems. Transferring genes between organisms offers many exciting prospects. Scientists now have the ability to take individual genes and create multiple copies of them; this is called gene cloning.

1. Mechanism
o

Genes can be multiplied in a test-tube, but it is often much easier to put the gene or DNA fragment into other organisms like bacteria which will then adopt the new DNA as their own and copy it for you.

Using vectors to transfer genes

o

Human genes are often transferred into bacteria or yeast because these microorganisms multiply quickly. In bacteria they form a huge population which expresses the gene and creates large quantities of the gene product.

Micro projectiles
o

Micro projectile refers to shooting DNA fragment into host cells. Remarkably, some of the cells recover and accept the foreign DNA.

Electroporation
o

Electroporation technique involves exposing the host cells to rapid, brief bursts of electricity which create temporary gaps in the cell surface through which foreign DNA can enter.

Liposomes
o

Liposome (i.e. artificial vesicle) is a preferred method of smuggling DNA into cells. DNA is inserted into Liposomes. The Liposomes fuse with the surface membrane of the host cell and introduce the DNA into the cytoplasm.

Gene cloning techniques

The science of genetics seeks to explain the mechanisms of inheritance and evolution
9

Calcium phosphate precipitation

Agriculture Biotechnology
o

Plasmids are mixed with calcium phosphate. As the calcium phosphate precipitates, grains are formed that contain DNA. These grains can enter the cells by endocytosis (i.e. incorporation of substances into a cell).

Why gene important?

cloning

is

so

Cloning can provide a pure sample of an individual gene.only cells containing the desired recombinant DNA molecule can divide and the clone of interest is automatically selected. Gene isolation by cloning.

eventually gene cloning will allow scientists to grow individual organs to be used in patients needing a transplant. According to The Gene School, in the U.K., scientists have found a way to insert human DNA in fish, rabbits, pigs, sheep, cows, and mice. Because many doctors have started to study using pig organs for transplants, the insertion of human DNA into pig organs could mean safer, more effective transplants with stronger organs. As stem cell research (the harvesting of cells from embryonic tissue) advances, scientists may eventually be able to grow individual organs.

Benefits of Gene Cloning:According to the Human Genome Project, gene cloning occurs when "a DNA fragment of interest from one organism [is transferred] to a self-replicating genetic element such as a bacterial plasmid," where it can be copied. Gene cloning has many benefits, from allowing scientists to combat diseases to creating much-needed organs for patients who are waiting for transplants to improving the taste and quality of the food you eat to even repopulating endangered populations of animals.

Better Food

In agriculture, gene cloning allows farmers to replicate their strongest crops and farm animals rather than resort to interbreeding, which can reduce the risk of diseases. Cloning also takes the guesswork out of animal reproduction. Rather than breeding the cow with the meatiest build to the cow with the second-meatiest build in the hopes of producing a third big cow, a farmer could simply clone the biggest cow and guarantee the quality of his stock.

Repopulation of Animals

Study of Genetic Disorders

Scientists can use gene cloning to combat diseases by isolating a disease-causing gene. After scientists study and take samples from several families who share a similar genetic disorder, the scientists can figure out which gene is responsible for causing the disorder. Gene cloning technology may then lead to the discovery of a cure for the disorder by allowing scientists to substitute healthy genes for the undesirable ones.

Organ Replacement

Advances in gene cloning allow scientists to delve deeper into the science of producing organs. There is hope that
10

According to the Human Genome Project, reproductive genetic cloning could also lead to the repopulation of endangered species. In 2001 a wild ox called a gaur was the first endangered wild animal to be cloned. Although the young ox named "Noah" died just 48 hours after its birth from a cow "mother" that had hosted the embryo, it inspired the expansion of the study of cloning wild animals. Later that year in Italy, an endangered wild sheep called a mouflon was successfully cloned and as of December 2009 was still living. In early 2009 British scientists were even able to resurrect an extinct breed of ibex by cloning its DNA. Although the ibex did not live more than a few months, its birth proved that scientists are closer to finding

Agriculture Biotechnology
a way to bring back endangered and even extinct animals.

Expression of O. proteus phyA and E. coli appA

The templates for PCR were the total genomic DNA of O. proteus B-6898 and E. coli XL-1 Blue. PCR amplification of DNA containing the phyA gene including the signal peptide was performed using primers PphyaECF (forward, 50CCCATATGACAATTTCTCTGTTTACA CA-30) and PphyaECR (reverse, 50CCGAATTCTATTGGCACTCCACCAG TTCGT-30) (theNdeI and EcoR1 restriction sites, respectively, are underlined).Amplified DNA was digested by NdeI and EcoRI and ligated into the respective sites of pET22b+ vector DNA. The obtained pETPhyA plasmid was used to transform E. coli BL21 (DE3). To express the E. coli appA gene, the same procedure was performed with different primers: PappaECF (forward, 50GCATATGAAAGCGATCTTAATCCCA T- 30) and PappaECR (reverse, 50GGGAATTCATTACAAACTGCACGCC G-30) (the NdeI and EcoRI restriction sites, respectively,are underlined). To obtain high level expression of recombinant phytases, cells were incubated for 20 h in 500 ml flasks containing 100 ml of LB plus the following components (w/v): 0.2% glucose, 1.5% lactose or 1 mM IPTG and ampicillin (100 lg ml_1). Recombinant protein produced by appA in E. coli was named AppA-coli. Recombinant protein produced by phyA in E. coli was named PhyA-coli.

Materials and methods Strains, plasmids and chemicals

The following strains were obtained from the Russian Collection of Industrial Microorganisms (VKPM) O.proteus B4567, B-6897, B-6898. E. coli strains and plasmids: XL-1 Blue (Strategne, La Jolla, CA), BL21(DE3), pET22b(+) (Novagen, Madison, WI) andpUC19 [19]. All strains were grown at 37 _C in LuriaBertani (LB) medium [20]. All chemicals were of the analytical grade, commercially available.

Cloning of the phytase gene

The O. proteus B-6898 genomic DNA was partially digested with Mph143I to obtain fragments of size 36 kb, and purified using DNA extraction Kit #K0513 (Fermentas AB, Vilnius, Lithuania). The DNA fragments were cloned into the BamHI site of pUC19 and transformed into E. coli XL-1 Blue. Transformants were tested for the phytase activity on LB plates by pouring over the Test Upper Layer cooled to 37 _C and containing (w/v) 1% agarose, 1% phytate, and 0.5% CaCl2. Positive clones caused clear zones around the colonies after 16 h of incubating with the upper layer. The clones were directly looped from beneath the upper layer in order to avoid the procedure of clone picking. The colonies harboring plasmids with DNA fragments encoding active phytase were named pPhyAn, where the last symbol n was the serial number. The size of insert was subcloned from the 4.2 kb insert by partial digestion with Mph143I to produce the final insert size of about 2.0 kb. The final pUC19 plasmid that harbored the subcloned DNA insert encoding the phytase activity, was named pPhyAmini. The insert DNA was sequenced by Syntol Co. (Moscow, Russia). The GenBank Accession No. is AY378096.

Purification of the phytases

After expression of phytase, cells were harvested, resuspended in 50 mM Tris HCl buffer, pH 7.0 and sonicated at 4 _C. Phytases were purified in two steps .At the first step, the majority of extraneous proteins were precipitated at low pH (AppA-coli and

11

Agriculture Biotechnology
PhyA-coli are resistant to low pH of 2.0) by adding to the crude extract sample an equal volume of 0.5 M glycineHCl buffer (pH 1.8). Solution was incubated 30 min at 37 _C and centrifugured at 14000g. At the second step, the enzymes were purified by FPLC gelfiltration Superdex 75-HR column. sequencing methods have opened up the door to all sorts of manipulative techniques for changing the structure of proteins through genetic alterations. The introduction of bacterial genes into cash crops, to enhance their growth, nutritional value or resistance to pests, is becoming rather commonplace in plant technology. One example that has made frequent headlines is the introduction of bacterial genes for natural pesticides into plants, in order to eliminate the need for chemical pesticide use. The drawback to this technology is public concern over the consequences of injesting these natural pesticides. Problems such as these might be alleviated by site-specific expression of the gene, or control of expression throughout the lifecycle. For example, it might cause less concern if expression of a pesticide gene in the leaves of young plants could be used to prevent foliage from being destroyed early on, without expression in the fruit later in the lifespan. In the early 1990's, it was proposed that newly emerging genetic techniques could result in GEMs, or "superbugs", for bioremediation, that could withstand extreme conditions and rapidly break down the recalcitrant chemicals plaguing our waste sites and brownfields. Issues such as how to control the spread of these superbugs and prevent an ecological upset, have hindered their development. Numerous proposals have been put forth and tested, from programmed cell death mechanisms to bio indicators to track their spread. However, the bioremediation industry today has not been able to fully take advantage of the technology available for developing microorganisms that can quickly eliminate some of our most toxic environmental contaminants. Despite efforts to control gene expression there are many unanswered questions and issues that arise and stand in the way of full
12

Determining of the N-terminal amino acid sequence of the protein

The phytase samples to be analyzed were prepared by SDSPAGE followed by semi-dry electroblotting of the separated material onto Immobilon-P membrane. The obtained Immobilon filter strip was used as a carrier in the automated Edman protein sequencing on an Applied Biosystems Procise cLC instrument. The N-terminal sequence was determined using the protein purified by a single-stage FPLC on a Superdex-75HR

What are GMOs?

GMO stands for genetically modified organism. The acronym can apply to plants, animals or microorganisms, whereas the term genetically engineered microorganism (GEM) refers only to bacteria, fungi, yeast or other microorganisms. In both cases, however, these terms refer to a living organism that has been genetically altered using molecular genetics techniques such as gene cloning and protein engineering. Recombinant GMOs can be produced by gene cloning methods in which a nonnative gene is introduced and expressed in a new organism. Generally the new protein has also been somewhat modified, or engineered, for proper expression in the new host. In particular, differences between microorganisms and eukaryotic cells must be overcome, such as the presence or absence of introns, occurrence of DNA methylation and certain posttranslational modifications to the protein itself for proper transport within or between cells. The advent of PCR and gene

Agriculture Biotechnology
acceptance of GMOs by the public. Fear of the unknown is one cause of public reluctance to use GMOs and GEMs. However, this concern is validated whenever a specific case proves the technology has gone awry, and is widely publicized. Examples of this are products that have allegedly caused the mass destruction of non-target insect populations by genetically modified cash crops or bioethical issues surrounding questions of seed ownership once a crop has been harvested, and issues over the cost of seeds and availability to farmers. Arguments against the use of GMOs include industrialization of agriculture, pushing out the small farmers in favor of mass production of crops and due to legalities surrounding IP and ownership of seeds. Another argument is that exports of less developed countries will suffer while over-developed states take over. An example of this is use of biotech sweeteners instead of sugarcane products from the Third World. In addition to these arguments there are countless claims of toxicity and carcinogenicity of biotech foods, which may or may not be warranted, depending on the individual products. Those opposed to the use of GMOs are also opposed to mass production of pharmaceuticals using cloned genes in plants, or fermentation products of yeast, bacteria or fungi. The benefits, however, to using this technology, might include reduced drug costs and greater availability, assuming, of course, that the technology is properly shared and applied and used for the good of everyone. Cloning of animals has proven to be a complicated and risky endeavor. Cloned pigs, sheep or other animals experience a long list of illnesses and complications that usually result in premature death. Strong opposition to all GMOs, however, cannot be based on these facts alone. The insertion of a single foreign gene to make a transgenic plant, for the production of a drug that will be harvested and purified, is
13

far less risky than cloning an entire pig with a human heart in order to harvest that heart for a human transplant patient. Likewise, cloned pesticide genes in food crops might be considered more risky, as they could affect the local insect population and upset the balance of nature, or adversely affect individuals who eat that food. Advocates for mandatory labelling of foods containing, or produced using GMOs, cite risks from unknown toxins or allergens that might be introduced during production, as their reason for caution. For each of the above examples of GMOs and issues surrounding them, there are countless others. Each of the different examples of GMOs has a relevant and useful application in the biotechnology industry. Each situation is unique and presents a new series of issues to be considered when debating the benefits versus safety and risks involved with that product.

Reference:1. Reddy, N.R., Sathe, S.K. and Salunkhe, D.K. (1982) Phytates in legumes and cereals. Adv. Food Res. 28, 192. 2. http://learn.genetics.utah.edu/conte nt/tech/cloning/whatiscloning/ 3. http://biotech.about.com/od/clonin g/tp/DNAcloning.htm 4. http://en.wikipedia.org/wiki/Clonin g 5. http://learn.genetics.utah.edu/conte nt/tech/cloning/whatiscloning/ 6. Plant biotechnology by-H.S Chawla 7. Lecture notes of class and various ppts and documents.
.

Agriculture Biotechnology

14