J. Phycol.

37, 819835 (2001)

PHYLOGENY OF THE CHLOROPHYCEAE WITH SPECIAL REFERENCE TO THE SPHAEROPLEALES: A STUDY OF 18S AND 26S rDNA DATA 1
Mark A. Buchheim2
Faculty of Biological Science and the Mervin Bovaird Center for Molecular Biology and Biotechnology, The University of Tulsa, 600 South College Avenue, Tulsa, Oklahoma 74104

Eugenia A. Michalopulos3 and Julie A. Buchheim

Department of Biological Science, The University of Tulsa, 600 South College Avenue, Tulsa, Oklahoma 74104

Ultrastructural analyses of the flagellar apparatus suggested that Sphaeroplea, Atractomorpha, the Hydrodictyaceae, and the Neochloridaceae, all of which produce biflagellate motile cells with directly opposed (DO) basal bodies, are allied in an order Sphaeropleales. Recent studies of 18S rDNA sequence data supported an alliance of the DO group, but no data from Sphaeroplea and its allies were included. This investigation presented a test of the phylogenetic hypothesis suggested by the flagellar apparatus evidence using sequence data from the nuclear-encoded small-subunit rDNA (18S) and large subunit rDNA (26S) genes, combined with additional taxon sampling. Results from phylogenetic analyses weakly supported monophyly of biflagellate DO taxa and indicated that pyrenoids with cytoplasmic invaginations are present in numerous distinct lineages. Analysis of both molecular data sets supported a class Chlorophyceae comprised of at least six major groups that generally correspond to currently recognized orders or families: Chaetophorales, Chaetopeltidales, Chlamydomonadales, Sphaeropleales, Sphaeropleaceae, and Oedogoniales. In addition, Cylindrocapsa, Elakatothrix, Treubaria, and Trochiscia formed a seventh chlorophycean clade that is new to science. This investigation demonstrated that the 26S rDNA gene provides more phylogenetic signal, per unit sequence, than the 18S rDNA gene and that combined analysis yields topologies with more robust support than independent analysis of either data set. Key index words: 18S rDNA; 26S rDNA; Ankyra; Atractomorpha; Chaetopeltidales; Chaetophorales; Chlamydomonadales; Cylindrocapsa; Elakatothrix; flagellar apparatus; Oedogoniales; Ourococcus; phylogeny; Pseudoschroederia; pyrenoid; Schroederia; Sphaeroplea; Sphaeropleales; Treubaria; Trochiscia Abbreviations: DO, directly opposed; NNI, nearest neighbor interchange; ME, minimum evolution; ML, maximum likelihood; MP, maximum parsimony; PAUP,

phylogenetic analysis using parsimony; SRC, substitution rate calibration; TBR, tree-bisection-reconnection
The azoosporic, filamentous, green algal genus Sphaeroplea is distinctive in exhibiting both multinucleate (coenocytic) cells and oogamous sexual reproduction (Fritsch 1929). Traditional classifications based on comparative gross morphology placed Sphaeroplea in one of three orders, the Ulotrichales (Fritsch 1929, Smith 1950, Ramanathan 1964, Christensen 1966), Cladophorales (Oehlkers 1956, Fott 1971), or Sphaeropleales (Pascher 1931, Prescott 1951, Bourrelly 1990, Round 1971, Cceres and Robinson 1980, Silva 1982, Mattox and Stewart 1984, Bold and Wynne 1985). Ultrastructural investigations of Sphaeroplea (Cceres and Robinson 1980, 1981) rendered obsolete any classifications linking Sphaeroplea with Ulothrix or Cladophora. The latter two are now firmly regarded as belonging to the class Ulvophyceae (sensu Mattox and Stewart 1984), whereas Sphaeroplea is placed in the Chlorophyceae (sensu Mattox and Stewart 1984). Thus, the order Sphaeropleales remained as the only reasonable classification scheme. Although a narrowly circumscribed Sphaeropleales was readily defensible, this taxonomic assessment offered little insight into the allies of Sphaeroplea within the Chlorophyceae. Ultrastructural investigations cited similarities between sphaeropleacean taxa (including Atractomorpha [Hoffman 1983, 1984b]) and selected members of the Chlorococcales (Cceres and Robinson 1980, 1981, Hoffman 1983, 1984a, Buchheim 1988, van den Hoek et al. 1995) as indicative of an alliance. Studies of the flagellar apparatus (Cceres and Robinson 1981, Hoffman 1984b, Buchheim 1988, Buchheim and Hoffman 1985, 1986, 1987) demonstrated that Atractomorpha and Sphaeroplea possess biflagellate motile cells (male gametes) with basal bodies that are directly opposed (DO). The DO condition of biflagellate motile cells (gametes or zoospores) also was found in members of the Hydrodictyaceae (Wilcox and Floyd 1988), in the Neochloridaceae (Watanabe and Floyd 1989a), in the genus Characiopodium (Floyd et al. 1993), and in the genus Bracteacoccus (Watanabe and Floyd 1992). The DO condition of quadriflagellate zoospores was discovered in both basal body pairs of Chaetopeltis and allies (OKelly and Floyd 1984, OKelly et al. 1994) and in the upper
819

26 October 2000. Accepted 21 May 2001. for correspondence: e-mail mark-buchheim@utulsa.edu. address: Hamon Center for Therapeutic Oncology, University of Texas Southwestern Medical Center, Dallas, TX 75390.
2Author 3Present

1Received

820

MARK A. BUCHHEIM ET AL.

pair of basal bodies in zoospores of chaetophoralean taxa (Manton 1964, Melkonian 1975, Moestrup 1978, Floyd et al. 1980, Floyd and Hoops 1980, Bakker and Lokhorst 1984, Watanabe and Floyd 1989b). Deason et al. (1991) proposed an emended order Sphaeropleales that included all biflagellate DO taxa (but excluded taxa that possess DO basal bodies in quadriflagellate zoospores). OKelly et al. (1994) have since argued for recognizing another distinct order of DO taxa, the Chaetopeltidales. The Chaetopeltidales (sensu OKelly et al. 1994) include all taxa exhibiting quadriflagellate zoospores that possess an exclusively DO architecture (both pairs of basal bodies are DO). In support of a new order, Chaetopeltidales, OKelly et al. (1994) cited the presence of body scales on the zoospores of Chaetopeltis, Hormotilopsis, and Planophila as indicative of the distinctiveness of the group. Phylogenetic studies of 18S rDNA sequence data have been used to test hypotheses derived from the ultrastructural studies. The earliest of these investigations demonstrated a close alliance among Pediastrum, Hydrodictyon, Neochloris, and Characiopodium, all of which possess biflagellate motile cells (gametes or zoospores) exhibiting DO basal bodies (Wilcox et al. 1992, Lewis et al. 1992). In a more recent study, Lewis (1997) showed that molecular phylogenetic analysis of 18S rDNA data supports an alliance of the biflagellate DO taxon, Bracteacoccus, with the biflagellate DO taxa cited in previous 18S rDNA investigations (Wilcox et al. 1992, Lewis et al. 1992). In the latest investigation of 18S rDNA data, Booton et al. (1998b) found support for an alliance of the Chaetopeltidales (sensu OKelly et al. 1994) with the biflagellate DO taxa. Thus, the results from analyses of 18S rDNA data support the hypothesis of DO monophyly (exclusive of the Chaetophorales). As Lewis (1997) pointed out, sequence data from the critical DO taxa, Sphaeroplea and Atractomorpha, are needed to complete the test of the DO hypothesis. Furthermore, the 18S rDNA gene may not provide enough resolution at some of the critical nodes within the Chlorophyceae (Booton et al. 1998a,b), and limited taxon sampling within the Chlorophyceae may be influencing the resolution. Therefore, a new gene to augment the 18S rDNA data and additional sampling of chlorophycean taxa are needed to further our understanding of relationships within the class. This investigation has three principal goals. The first of these goals is to test the DO monophyly hypothesis (Deason et al. 1991, Wilcox et al. 1992, Lewis et al. 1992, Lewis 1997, Booton et al. 1998a,b) by examining three taxa that exhibit the DO architecture in biflagellate motile cells. Atractomorpha echinata (Hoffman 1984b), Sphaeroplea robusta (Buchheim and Hoffman 1986, Buchheim 1988), and Sphaeroplea soleirolii v. crassisepta have been documented as taxa bearing biflagellate motile cells with DO basal bodies (Buchheim 1988). The second goal of this investigation is to expand data sampling by including new data from the large subunit of the nuclear-encoded rRNA (26S rDNA) gene. A 2.2-kb segment at the 5 end of the 26S rDNA

gene was selected for study because early investigations of partial sequences indicated that the 26S rDNA gene was more variable than the 18S gene (Buchheim et al. 1990, Kantz et al. 1990, Zechman et al. 1990, Larson et al. 1991). More recent investigations of the 26S rDNA gene from selected trebouxiophyte green algae (Friedl and Rokitta 1997) and seed plants (Stefanovic et al. 1998, Kuzoff et al. 1998) indicated that this gene is likely to provide more phylogenetic information than the 18S rDNA gene. The final goal of this investigation is to sample additional chlorophycean taxa that exhibit morphological features that link them to sphaeropleacean taxa or that will provide a more complete taxonomic context in which to interpret sphaeroplealean and chlorophycean diversity. As a consequence of this new data-sampling scheme, the number of sites that can provide new character data for the green algae will be more than doubled. Furthermore, the new taxon-sampling scheme will provide the most comprehensive molecular phylogenetic study of the Chlorophyceae (sensu Mattox and Stewart 1984) to date.

materials and methods

Taxon selection. Fifty ingroup taxa were included in the phylogenetic analyses (Table 1). New 18S rDNA sequence data for Ankyra judayi, Aphanochaete magna, Atractomorpha echinata, Cylindrocapsa geminella, Elakatothrix viridis, Ourococcus multisporus, Pseudoschroederia antillarum, Schizomeris leibleinii, Schroederia setigera, Sphaeroplea soleirolii v. crassisepta, Sphaeroplea robusta, Treubaria schmidlei, Treubaria setigera, Trochiscia hystrix, and Uronema belkae are presented in this investigation (Table 1). Included are published 18S rDNA sequences (Table 1) from other members of the Sphaeropleales (sensu Deason et al. 1991); from the DO genera Bracteacoccus, Chaetopeltis, Hormotilopsis, and Planophila; from the Chlamydomonadales (including colonial forms); from the Chaetophorales; and from the Oedogoniales. Each taxa is generally regarded as a member of the class Chlorophyceae (sensu Mattox and Stewart 1984). New partial 26S rDNA sequence data for all of the 50 ingroup taxa were completed for this project (Table 1). With only a few exceptions (Carteria crucifera, Chlamydomonas reinhardtii, Fritschiella tuberosa, and Oedogonium cardiacum), the same isolates were used to generate sequencing templates for both the 18S and 26S rDNA data. DNA extraction and preparation of sequencing templates. Genomic DNA was obtained using extraction protocols described previously (Buchheim and Chapman 1992). Double-stranded DNA sequencing templates were obtained by symmetrically amplifying genomic DNA using PCR. Amplification of the 18S gene followed previous work (Buchheim et al. 1997a). The flanking primers used to amplify a portion of the 26S gene, ITS-4rc and 26F, are described by White et al. (1990) and Hamby et al. (1988), respectively (Table 2). In some cases, LS-18 (Table 2) was substituted for 26F as an amplification primer. Manual sequencing. Sequence data for two of the ingroup taxa (Sphaeroplea robusta and Atractomorpha echinata) were obtained by using the protocols and reagents for cycle sequencing that accompany the AmpliCycleTM cycle sequencing kit (Perkin-Elmer, Norwalk, CT). All manual sequencing reactions used in the present investigation have been described previously (Buchheim et al. 1997a). Automated sequencing. New sequence data from the remaining taxa (Table 1) were obtained with the protocols and reagents for cycle sequencing that accompany the four-color PRISM TM reagent cycle sequencing kit (Perkin-Elmer) designed for use in ABI automated DNA sequencing systems. All automated sequencing reactions used in the present investigation have been de-

PHYLOGENY OF THE CHLOROPHYCEAE Table 1. List of taxa, source of culture material, sequence accession number, and original literature citation.
18S rDNA data Taxon Sourcea Citation and accession Sourcea 26S rDNA data Citation and accession

821

NIES 421 UTEX 233 SAG 39.84 UTEX LB 1032 Carteria radiosa Korshikov UTEX LB 835 Carteria sp. UTEX 2 Chaetopeltis orbicularis Berthold UTEX 422 Chaetophora incrassata (Huds.) UTEX LB Hazen 1289 Characiopodium hindakii (Lee et UTEX 2098 Bold) Floyd et Wat. Chlamydomas moewusii Gerloff SAG 1111 Chlamydomonas noctigama SAG 33.72 Korshikov Chlamydomonas pitschmannii Ettl SAG 14.73 Chlamydomonas reinhardtii CC-400 Dangeard Chlamydopodium vacuolatum UTEX 2111 (Lee et Bold) Floyd et Wat. Chlorococcum echinozygotum Starr UTEX 118 Chlorococcum ellipsoideum UTEX 972 Deason et Bold Cylindrocapsa geminella Wolle SAG 3.87 Dunaliella parva Lerche UTEX LB 1983 Elakatothrix viridis (Snow) Printz LC-CH30 Fritschiella tuberosa lyengar UTEX 1821 Haematococcus zimbabwiensis UTEX LB Pocock 1758 Hormotilopsis tetravacuolaris UTEX 946 Trainor et Bold Hydrodictyon reticulatum (L.) CBS Lagerh. Neochloris aquatica Starr UTEX 138 Neochloris vigensis Archibald UTEX 1981 Oedogonium cardiacum Witt. UTEX 40 Ourococcus multisporus Bischoff UTEX 1240 et Bold Pediastrum duplex Meyen UTEX LB 1364 Planophila terrestris Groover et UTEX 1709 Hofstetter Protosiphon botryoides (Ktzing) UTEX 99 Klebs Pseudoschroederia antillarum SAG B 15.86 (Kom.) Hegewald et Schnepf Scenedesmus obliquus (Turp.) SAG 276-3a Ktzing Schizomeris leibleinii Ktzing UTEX LB 1228 Schroederia setigera (Schrd.) UTEX LB Lemm. 2454

Chlorella ellipsoidea Gerneck Fusochloris perforata (Lee et Bold) Floyd et al. Ankistrodesmus stipitatus (Chod.) Lemm Ankyra judayi (G. M. Smith) Fott Aphanochaete magna Godward Ascochloris multinucleata Bold et McEntee Atractomorpha echinata Hoffman Bracteacoccus giganteus Bischoff et Bold Bracteacoccus minor (Chodat) Petrova Bulbochaete hiloensis (Nordst.) Tiffany Carteria crucifera Korshikov Carteria eugametos Mitra Carteria obtusa Dill Carteria olivieri G. S. West

IAM C-87 UTEX 2104 SAG 202-5

Aimi et al. 1993 (D13324) Lewis et al. 1992 (M62999) Huss and Sogin 1990 (X56100)

IAM C-87 UTEX 2104 SAG 202-5

Aimi et al. 1994 (D17810) Present investigation (AF183467) Present investigation (AF183447)

SAG B 17.84 Present investigation (U73469) SAG B 17.84 Present investigation (AF183448) UTEX B 1909 Present investigation (AF182816) UTEX B 1909 Present investigation (AF183449) UTEX 2013 Lewis 1997 (U63106) UTEX 2013 Present investigation (AF277652) LRH UTEX 1251 UTEX 66 UTEX 952 Present investigation (U73470) Lewis 1997 (U63099) Lewis 1997 (U63097) Booton et al. 1998a (U83132) Nakayama et al. 1996 (D86501) Present investigation (U70595) Present investigation (AF182818) Present investigation (U70596) LRH UTEX 1251 UTEX 66 UTEX 952 Present investigation (AF183450) Present investigation (AF183451) Present investigation (AF183452) Present investigation (AF183453) Present investigation (AF183454) Present investigation (AF183455) Present investigation (AF183456) Present investigation (AF183457) Present investigation (AF183458) Present investigation (AF183459) Present investigation (AF183465) Present investigation (AF183471) Present investigation (AF183466) Present investigation (AF183461) Present investigation (AF183460) Present investigation (AF183462) Present investigation (AF183463) Present investigation (AF183468) Present investigation (AF183469) Present investigation (AF183470) Present investigation (AF183472) Present investigation (AF183473) Present investigation (AY008845) Present investigation (AF183474) Present investigation (AF183475) Present investigation (AF183476) Present investigation (AF183477) Present investigation (AF277653) Present investigation (AF277654) Present investigation (AF183478) Present investigation (AF277655) Present investigation (AF183479) Present investigation (AF183480) Present investigation (AF183481) Present investigation (AF277656) Present investigation (AF183482) Present investigation (AF183483) Present investigation (AF277657) (continued)

UTEX 432 UTEX 233 SAG 39.84 UTEX LB 1032 Present investigation (AF182819) UTEX LB 835 Present investigation (AF182817) UTEX 2 Booton et al. 1998b (U83125) UTEX 422 Booton et al. 1998a (U83130) UTEX LB 1289 Lewis et al. 1992 (M63000) UTEX 2098

Buchheim et al. 1997a (U70786) SAG 11-11 Buchheim et al. 1997a (U70782) SAG 33.72 Buchheim et al. 1997a (U70789) SAG 14.73 Gunderson et al. 1987 (M32703) CC-1952 Lewis et al. 1992 (M63001) Buchheim et al. 1996 (U57698) Present investigation (U70586) Present investigation (U73471) Lewis et al. 1992 (M62998) UTEX 2111 UTEX 118 UTEX 972

SAG 3.87 UTEX LB 1983 Present investigation (AY008844) LC-CH30 Booton et al. 1998a (U83129) CBS Buchheim et al. 1997a (U70797) UTEX LB 1758 Booton et al. 1998b (U83124) UTEX 946 Wilcox et al. 1992 (M74497) Lewis et al. 1992 (M62861) Wilcox et al. 1992 (M74496) Booton et al. 1998a (U83133) Present investigation (AF277648) Wilcox et al. 1992 (M62997) Booton et al. 1998b (U83127) Nakayama et al. 1996 (U41177) CBS UTEX 138 UTEX 1981 UTEX LB 39 UTEX 1240 UTEX LB 1364 UTEX 1709 UTEX 99

Present investigation (AF277649) SAG B 15.86 Huss and Sogin 1990 (X56103) SAG 276-3a

Present investigation (AF182820) UTEX LB 1228 Present investigation (AF277650) UTEX LB 2454

822
Table 1. Continued

MARK A. BUCHHEIM ET AL.

18S rDNA data Taxon Sourcea Citation and accession Sourcea

26S rDNA data Citation and accession

Sphaeroplea robusta Buchheim et LRH Present investigation (U73472) LRH Present investigation (AF183484) Hoffman Sphaeroplea soleirolii v. crassisepta LRH Present investigation (U73473) LRH Present investigation (AF183485) (Duby) Montag. ex. Ktz. Tetraspora sp. UTEX LB 234 Booton et al. 1998b (U83121) UTEX LB 234 Present investigation (AF183486) Treubaria schmidlei (Schrder) SAG 36.83 Present investigation (U73474) SAG 36.83 Present investigation (AF183487) Fott et Kovcik Treubaria setigera (Archer) G. M SAG 37.83 Present investigation (U73475) SAG 37.83 Present investigation (AF183488) Smith Trochiscia hystrix (Reinsch) UTEX LB 606 Present investigation (AF277651) UTEX LB 606 Present investigation (AF277658) Hansg. Uronema belkae Mattox et Bold UTEX 1179 Present investigation (AF182821) UTEX 1179 Present investigation (AF183489) (OKelly et Floyd) Volvox carteri Iyengar UTEX 1885 Rausch et al. 1989 (X53904) UTEX 1885 Present investigation (AF183490) aSource of taxa used to generate the data: CBS, from Carolina Biological Sypply; CC, from the Chlamydomonas Genetics Center at Duke University; PCC, from the Plymouth Culture Collection; SAG, from the Sammlung von Algenkulturen Gttingen; UTEX, from the Culture Collection at the University of Texas at Austin; LC, from the Loras College Collection of Freshwater Diatoms; LRH, from the culture collection of Larry R. Hoffman. scribed previously (Buchheim et al. 1997a). Sequencing primers for the 18S rDNA gene have been described previously (Hamby et al. 1988, Buchheim et al. 1997a). Sequencing primers for ca. 2200 base pairs on the 5 end of the 26S rDNA gene are presented in Table 2. Sequence alignments. Previous work (Buchheim et al. 1997a) served as the starting point for all 18S rDNA alignments. Alignments from Michalopulos (1998) served as the starting point for all 26S rDNA alignments. The manually aligned sequences were edited using SeqApp (Gilbert 1994). One hundred sites were excluded from the phylogenetic analyses of 18S data, and 170 sites were excluded from the phylogenetic analyses of 26S data. The exclusion sets are characterized by blocks of sequence data that are not clearly alignable (i.e. exhibit questionable homology due to base substitution coupled with sequence length heterogeneity) or correspond to a flanking primer region. The data sets and trees have been deposited in TreeBase. Table 2.
Name

Phylogenetic analyses of independent data sets. Three methods of phylogenetic reconstruction were initially used for independent analyses of 18S rDNA and 26S rDNA data: character analysis using maximum parsimony (MP) optimality criteria, a distance matrix approach using minimum evolution (ME) optimality criteria, and maximum likelihood (ML). Analyses were conducted using PAUP* (version 4.0b4a, Swofford 2000, or version 4.0b6, Swofford 2001). MP method: Tree searches for MP analyses were conducted heuristically using the tree-bisection-reconnection (TBR) option. To increase the probability of finding all islands of most parsimonious trees, the order of taxon addition was randomized 50 times. Bootstrap values (Felsenstein 1985) from 1000 resamplings using heuristic nearest-neighbor-interchange (NNI) searches with simple taxon addition were calculated for each set of data. All characters were regarded as unordered (Fitch 1971). No differential character weighting was used. Distance matrix method: Modeltest 3.0b (Posada and Crandall 1998) was used to test the goodness-of-fit of DNA substitution mod-

Amplification and sequencing primers for 5 end (ca. 2200 bp) of 26S rDNA gene.
Sequence (5 -3 ) Positiona Citation

ITS-4rc LS-1 LS-2 LS-3 LS-4 LS-13 LS-14 LS-16 LS-18 LS-19 LS-20 LS-21 26Arc 26B 26Brc 26C 26Crc 26D 26Drc 26Erc 26F
aPosition bAmplification

GCATATCAATAAGCGGAGGA b GTACCGTGAGGGAAAGATc,d ATCTTTCCCTCACGGTACc AGTAGCAAATATTCAAAc,d TTTGAATATTTGCTACTc GCTTACCAAAAATGGCc GGCCATTTTTGGTAAGCc,d GTTTTAATTAAACAGTc TCCCCTTGTCCGTACCAGTb,c TGAAGACTGAAGTGGAGAAA c,d TTTCTCCACTTCAGTCTTCAc GAGTTCTCTTTTCTTTTTc,d AGCGGAGGAAAAGAAAc,d GGTCCGTGTTTCAAGACGGG c CCCGTCTTGAAACACGGACC c,d GCTATCCTGAGGGAAACTTCGG c CCGAAGTTTCCCTCAGGATAGC c,d CTTGGAGACCTGCTGCGGc CCGCAGCAGGTCTCCAAGc,d CGTAACTTCGGGAAAAGGc,d CAGAGCACTGGGCAGAAATCAC b

38 352 369 1458 1442 1132 1116 2135 2114 1468 1487 1668 52 658 639 969 948 1853 1836 1911 2193

White et al. 1990 Present investigation Present investigation Present investigation Present investigation Present investigation Present investigation Present investigation Present investigation Present investigation Present investigation Present investigation Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988 Hamby et al. 1988

of priming sequence relative to published sequence of Oryza sativa. primer. cSequencing primer. dReverse primer.

PHYLOGENY OF THE CHLOROPHYCEAE els against the various data sets (18S rDNA, 26S rDNA, and combined 18S and 26S rDNA data) to be analyzed. In addition to identifying the model of DNA substitution that best fits a data set, Modeltest 3.0b (Posada and Crandall 1998) exploits PAUP* (Swofford 2000, 2001) to estimate the percent of invariant sites (I) and the shape parameter (G) for calculations assuming a discrete gamma distribution of site-to-site variation (Yang 1994). Based on results from the hierarchical series of likelihood ratio tests for 56 different models of nucleotide substitution (Posada and Crandall 1998), distance matrices for ME analysis were constructed using the general time-reversible model (Lanave et al. 1984, Rodrguez et al. 1990) as implemented in PAUP* (Swofford 2000, 2001) and I and G were estimated from the data. Tree searches for ME analyses were conducted heuristically using the TBR option. To increase the probability of finding all islands of optimal trees under the ME criterion, the order of taxon addition was randomized 50 times. Bootstrap values (Felsenstein 1985) from 1000 resamplings using heuristic NNI searches with simple taxon addition were calculated for the data. Starting trees for each replicate were obtained by the neighbor-joining method. Maximum likelihood: Parameter estimates (I and G) and rate matrix estimates derived from Modeltest 3.0b (Posada and Crandall 1998) analyses were used for heuristic search strategies using ML. Based on results from the likelihood ratio tests (Posada and Crandall 1998), the general time-reversible or the Tamura-Nei models of nucleotide substitution, as implemented in PAUP* (Swofford 2000, 2001), were used for ML analyses. Tree searches for ML analyses were conducted heuristically using the TBR option. Bootstrap values (Felsenstein 1985) from 100 resamplings using heuristic NNI searches with simple taxon addition were calculated for the data. Starting trees for each replicate were obtained by the neighbor-joining method. Rooting: The outgroup method was used to root all trees. Sequence data from Fusochloris perforata and Chlorella ellipsoidea (Table 1) were used to root the trees. These trebouxiophycean taxa (sensu Friedl 1995) have been resolved as part of a sister group to the Chlorophyceae (sensu Mattox and Stewart 1984) in previous studies of 18S rDNA data (Friedl 1995, Melkonian and Surek 1995). Combined data analysis. To assess the utility of combining data, statistical comparisons (Kishino-Hasegawa [ML and MP], Templeton, and Winning Sites) of trees derived from independent analyses of 18S and 26S rDNA were conducted using PAUP* 4.0b4a (Swofford 2000). In addition, the partition homogeneity test (Swofford 2000, see also Farris et al. 1994, who use the name incongruence length difference test) was applied to the 18S and 26S

823

rDNA data. Finally, the topologies of trees from independent analyses were compared to determine the number of shared nodes. Tree comparisons. Pairwise comparison of optimal trees from all analyses were undertaken using results from Kishino-Hasegawa (likelihood and parsimony), Templeton, and Winning Sites tests as recorded using PAUP* 4.0b4a (Swofford 2000). Similar tree comparisons (Kishino-Hasegawa [likelihood and parsimony], Templeton, and Winning Sites tests) were conducted to assess the statistical significance of differences between optimal trees and alternative phylogenetic hypotheses that were input to PAUP as constraint trees.

results Phylogenetic information content: 18S rDNA data. A total of 1631 aligned sites were included in the phylogenetic analyses of 18S rDNA. Aligned sequence data from all ingroup taxa yield 527 variable sites (excluding gap-only sites), of which 396 are informative for parsimony analysis. A summary of the variability in the 18S rDNA and 26 rDNA is presented in Table 3. 26S rDNA data. A total of 2053 aligned sites were included in the phylogenetic analyses of 26S rDNA. Aligned sequence data for the ingroup include 940 variable sites (excluding gap-only sites), of which 680 are phylogenetically informative. The partial 26S rDNA sequences used in this investigation include the structural domains IIV and a portion of domain V (Rau et al. 1988). A summary of the variability in the 26S rDNA (and 18S rDNA) studied in this investigation is presented in Table 3. Introns. A putative group I intron was revealed by sequence analysis of the 18S rDNA gene from Schroederia setigera (UTEX LB 2454). The intron extends from position 1129 to position 1575 of AF277650. A putative group I intron was also revealed by sequence analysis of the 26S rDNA gene from Neochloris aquatica (UTEX 138). The intron extends from position 883 to position 1258 of AF277653.

Table 3.

Comparison of sequence variability in the nuclear-encoded 18S and 26S rDNA data.
18S rDNA Data 26S rDNA Data

Category of Comparison

Total number of sites Total binary, variable sites Total nonbinary, variable sites Total number of variable sites Total AG binary transitions Total CT binary transitions Total AC binary transversions Total AT binary transversions Total CG binary transversions Total GT binary transversions Parsimony informative AG binary transitions Parsimony informative CT binary transitions Parsimony informative AC binary transversions Parsimony informative AT binary transversions Parsimony informative C G binary transversions Parsimony informative G T binary transversions Parsimony informative, non-binary sites Total number of informative sites Total number of informative sites with HI (homoplasy index)
aHI

0.000a

1631 (100%) 341 ( 21.0%) 186 (11.4%) 527 (32.3%) 97 (6.0%) 115 (7.1%) 19 (1.2%) 39 (2.4%) 31 (1.9%) 40 (2.5%) 66 (4.1%) 83 (5.1%) 9 (0.5%) 21 (1.3%) 17 (1.0%) 24 (1.5%) 176 (10.8%) 396 (24.3%) 184 (11.3%)

2053 (100%) 523 (25.5%) 417 (20.3%) 940 (45.8%) 162 (7.9%) 181 (8.8%) 43 (2.1%) 52 (2.5%) 49 (2.4%) 36 (1.8%) 99 (4.8%) 122 (5.9%) 20 (1.0%) 22 (1.1%) 22 (1.1%) 21 (1.0%) 374 (18.2%) 680 (33.1%) 325 (15.8%)

Percent of total number of sites is listed parenthetically. Outgroups were excluded. calculated in context of MP trees from independent analyses of 18S and 26S rDNA data.

824

MARK A. BUCHHEIM ET AL.

Phylogenetic reconstruction of independent data sets: MP analyses. The MP analysis of 18S rDNA data yielded four equally parsimonious resolutions (Fig. 1), and the MP analysis of 26S rDNA data yielded three equally parsimonious resolutions (Fig. 2). The results from MP analysis of the two data sets differ in topology in a number of general cases. The 18S data and the 26S data differ in the arrangement of taxa in a clade that includes Ascochloris, Chlamydopodium, Chlorococcum, Haematococcus, and Protosiphon. In addition, the two data sets differ in the relative position of the Carteria radiosa clade (Car. obtusa, Car. radiosa, Car. sp.), the Chaetopeltidales clade (Chaetopeltis, Hormotilopsis, and Planophila), the Oedogoniales clade (Bulbochaete and Oedogonium), the Cylindrocapsa clade (Cylindrocapsa, Elakatothrix, Treubaria, and Trochiscia), and the Sphaeroplea clade (Ankyra, Atractomorpha, and Sphaeroplea). Finally, the two data sets differ in the position of Pseudoschroederia relative to Schroederia and the position of Schizomeris relative to Aphanochaete. Overall, the trees from MP analyses of 18S and 26S data have 29 of 47 ingroup nodes in common with one another.

ME and ML analyses. The results from ME and ML analysis of 18S rDNA data (not shown) differ from the results of ME and ML analysis of 26S rDNA data (not shown) in the same general cases as described for the MP analysis (see above). The trees from ME analysis of 18S and 26S data share 28 of 47 ingroup nodes. The trees from ML analysis of 18S and 26S data share 29 of 47 ingroup nodes. Comparing trees from different methods. The results from MP, ME, and ML analysis of the 18S rDNA data differed principally in the relative position of the Chaetophorales clade, the Cylindrocapsa clade, and the two Carteria clades. The results from MP, ME, and ML analysis of 26S rDNA data differ principally in the relative position of the Sphaeroplea clade, the Cylindrocapsa clade, the Carteria crucifera clade, and the Oedogoniales clade. None of the nodes supporting the various alliances from different methods of analysis exhibited robust ( 75) bootstrap support. Combined analysis: comparing data sets. Statistical comparisons of trees derived from independent analyses

FIGS. 1 and 2. Minimal length cladograms from MP analysis of 18S rDNA and 26S rDNA sequence. Branch lengths are drawn proportional to changes along branches (see scale in upper left of each figure). Bootstrap values as percentages are presented at each node. Nodes without bootstrap percentages were supported in fewer than 50% of all replicates. Nodes that collapse in a strict consensus analysis are denoted by an asterisk. Nodes that differ in ML analyses of the same data are denoted by # and nodes that differ in ME analyses of the same data are denoted by . Brackets identify orders of chlorophycean (ingroup) green algae represented in the analyses. Fig. 1. One tree of four equally parsimonious solutions (L 1711, CI [Kluge and Farris 1969] 0.41, RI [Farris 1989] 0.66, RC [Farris 1989] 0.31) from MP analysis of 18S rDNA sequence data. Fig. 2. One tree of three equally parsimonious solutions (L 4172, CI [Kluge and Farris 1969] 0.33, RI [Farris 1989] 0.56, RC [Farris 1989] 0.22) from MP analysis of 26S rDNA sequence data.

PHYLOGENY OF THE CHLOROPHYCEAE

825

of 18S and 26S rDNA data indicated that the topologies from the two are significantly different (P 0.05) regardless of the method of analysis or the context of the comparison. In addition, partition homogeneity tests (Swofford 2000, Farris et al. 1994) revealed significant incongruence (P 0.01) between 18S and 26S rDNA data sets, suggesting that combination may result in a decrease in resolution when compared with results from independent analysis. However, empirical studies (Cunningham 1997) suggested that congruence tests can overestimate incongruence when, in fact, combined analysis of the same data yields improved phylogenetic accuracy. Recent studies have corroborated this observation (e.g. Gatesy et al. 1999, Smith 2000). As noted above, consensus analyses reveal that trees from different data sets share a majority of nodes. Moreover, most of the conflicting nodes in all sets of comparisons exhibit low bootstrap support in one or both

data sets. Long branches (e.g. the Sphaeroplea clade, Figs. 1 and 2) may be confounding the statistical tests of congruence. When the partition homogeneity test is administered after removal of some taxa that possess long branches in both independent analyses (i.e. the Sphaeroplea clade, the Cylindrocapsa clade, the Oedogoniales clade, and the Carteria radiosa clade), the resulting probability value (P 0.32) indicates that the two data sets are congruent. Because of these observations, two sets of combined analyses were completed. Combined analysis I was conducted using all ingroup taxa. Model parameters for combined analyses using ME and ML criteria were estimated using Modeltest and PAUP. In addition to MP, ME, and ML analyses, the substitution rate calibration (SRC) method of Van de Peer et al. (1993, 1996), as implemented in TREECON, was used to minimize the impact of longbranch attraction effects of some lineages. Combined analysis II was conducted using the same set of criteria as

FIG. 2.

826

MARK A. BUCHHEIM ET AL.

FIGS. 3 and 4. Results from combined analysis I (all ingroup taxa included in analyses) of 18S and 26S rDNA sequence data. Branch lengths are drawn proportional to estimates of evolution along branches (see scale in upper left of each figure). Bootstrap values as percentages are presented at each internode. Nodes without bootstrap percentages were supported in fewer than 50% of all replicates. Brackets identify orders of chlorophycean (ingroup) green algae represented in the analyses. Fig. 3. One tree of three equally parsimonious solutions (L 5925, CI [Kluge and Farris 1969] 0.35, RI [Farris 1989] 0.59, RC [Farris 1989] 0.24) from MP analysis of combined sequence data. Nodes that collapse in a strict consensus analysis are denoted by an asterisk. Nodes that differ in ML analyses of the same data are denoted by # and nodes that differ in ME analyses of the same data are denoted by . Fig. 4. Optimal tree (P 0.53) from analysis of combined sequence by substitution rate calibration (Van de Peer et al. 1993, 1996).

combined analysis I but included only a subset of all ingroup taxa in which potential long-branch lineages were removed. A total of 100 bootstrap replicates were completed for the SRC analysis. Combined analysis I: all taxa. Results from MP (Fig. 3), ME (not shown), ML (not shown), and SRC (Fig. 4) analysis of combined 18S and 26S rDNA data collectively differ in 1) the arrangement of taxa in a clade that includes Ascochloris, Chlamydopodium, Chlorococcum, Haematococcus, and Protosiphon; 2) the relative position of the Carteria radiosa clade; 3) the relative position of the Cylindrocapsa clade; 4) the relative position of the Oedogoniales clade; and 5) the position of Schizomeris relative to Aphanochaete. Combined analysis II: reduced data sets. Results from MP combined analyses, in which all members of the Cylindrocapsa clade, the Sphaeroplea clade, the Oedogoniales, and the Carteria radiosa clade were omitted, are presented in Figure 5. The tree from MP combined analysis

II differs from the ME and ML trees (not shown) only in the relative position of some members within the Sphaeropleales clade and the relative position of some members within the Chlamydomonadales clade (Fig. 5). Bootstrap values from MP, ME, and ML combined analysis II are generally larger than bootstrap values from independent MP, ME, and ML analyses of 18S and 26S data (Fig. 5). discussion Comparing data sets. The results from a study of variability in the 18S and 26S rDNA data sets (Table 3) demonstrate that the 26S data provide a higher density of both variable and parsimony-informative sites than the 18S data. Moreover, a greater percentage of informative sites in the 26S data have no detected homoplasy as compared with the 18S rDNA data (Table 3). Although the topologies from independent analyses of 18S (Fig. 1) and 26S (Fig. 2) data are significantly different from

PHYLOGENY OF THE CHLOROPHYCEAE

827

FIG. 4.

one another (P 0.05), the topologies from combined analysis I generally are not significantly different (P 0.05 [up to P 0.8335]) from the 26S topologies. In contrast, most of the 18S topologies (e.g. Fig. 1) are significantly different (P 0.05) from the topologies generated by combined analysis I (e.g. Fig. 3). These statistical comparisons indicate that the topologies from combined analysis I have the most support from the 26S data and that the 18S data are, at least in part, being overwhelmed. However, none of the cases of incongruence between the 18S topologies and the topologies from combined analysis I involves branches from the 18S trees that possess robust ( 75) support as assessed by the bootstrap. Furthermore, the results from combined analysis II (Fig. 5) reveal substantial topological congruence between 18S and 26S data when putative long-branch clades are removed from both sets of data. The partition homogeneity test (P 0.32) and a comparison of bootstrap

values from independent and combined data analyses (Table 4) confirm this assessment of high congruence between 18S and 26S data sets. The data in Table 4 demonstrate that combining data resulted in an enhancement of phylogenetic signal in comparison with results from analysis of independent data sets. Broad taxonomic perspectives. Six major clades that generally correspond to traditionally circumscribed orders or families (i.e. Chlamydomonadales, Chaetopeltidales, Chaetophorales, Oedogoniales, Sphaeropleales, and Sphaeropleaceae [Sphaeroplea and close allies]) are supported by independent data analysis (Figs. 1 and 2) and combined analysis I (Figs. 3 and 4). A seventh major clade that has no basis in traditional taxonomy, the Cylindrocapsa clade (incertae sedis, Figs. 14), is strongly supported by all analyses. Each of the major clades is examined in more detail in the following sections. Sphaeroplea and allies. Phylogenetic analysis of the 18S and 26S rDNA data confirms a close alliance between

828

MARK A. BUCHHEIM ET AL.

FIG. 5. Results from combined analysis II of 18S and 26S rDNA sequence data in which putative longbranch lineages were removed before analysis (see text). One tree of four equally parsimonious solutions (L 4237, CI [Kluge and Farris 1969] 0.47, RI [Farris 1989] 0.60, RC [Farris 1989] 0.29) from MP analysis. Branch lengths are drawn proportional to estimates of evolution along branches (see scale in upper left). Nodes that collapse in a strict consensus analysis are denoted by an asterisk. Nodes that differ in ME and ML analyses of the same data are denoted by #. Bootstrap values as percentages from ME, ML, and MP analysis are presented (stacked one on top of the other) at each internode. Nodes without bootstrap values were supported in fewer than 50% of all replicates. Brackets identify orders of chlorophycean green algae represented in the analyses.

Atractomorpha and Sphaeroplea, two of the recognized members of the Sphaeropleaceae (sensu Mattox and Stewart 1984). Thus, phylogenetic analysis of the 18S and 26S rDNA genes strongly supports the validity of a family Sphaeropleaceae that includes Atractomorpha and Sphaeroplea. Ankyra judayi, a zoosporic taxon for which

Table 4. Comparison of bootstrap values from combined analysis II (MP, ME, and ML criteria) with bootstrap values from independent analyses of 18S and 26S rDNA data sets.
Combined analysis II 18S data 26S data vs. 18S vs. 26S

MP ME ML

95.07 95.33 97.59

81.97 82.50 84.07

87.10 91.93 90.07

20.0 22.6 13.5

11.4 6.4 7.5

Bootstrap values are averaged across all nodes in columns 1 through 3 (Combined Analysis II, 18S data, and 26S data). The mean difference between bootstrap values on branches from combined analysis II and the corresponding branches from independent analyses are presented in columns 4 and 5 ( vs. 18S and vs. 26S).

no ultrastructural data are available, is resolved as the sister group to the clade that includes Sphaeroplea and Atractomorpha. In contrast to the Ankyra case, neither the 18S rDNA nor the 26S rDNA data support the Mattox and Stewart (1984) proposal that Cylindrocapsa should be regarded as a member of the Sphaeropleaceae. Mattox and Stewart (1984) also noted that Sphaeroplea and Cylindrocapsa share a distinctive pyrenoid in which the matrix is penetrated by cytoplasmic invaginations. An evolutionary interpretation of the pyrenoid evidence, which is discussed in more detail below, suggests that the pyrenoids with cytoplasmic invaginations in Sphaeroplea and Cylindrocapsa are either similar by analogy or represent a symplesiomorphy. Sphaeropleales clade: biflagellate DO taxa. All the biflagellate DO taxa included in these analyses (i.e. Characiopodium, Hydrodictyon, Neochloris, and Pediastrum) except Atractomorpha and Sphaeroplea are unambiguously resolved as part of a larger clade that includes a number of green algae that lack demonstrable motile stages (i.e. Scenedesmus, Ankistrodesmus, Ourococcus). In addition, Schroederia and

PHYLOGENY OF THE CHLOROPHYCEAE

829

Pseudoschroederia, for which no flagellar apparatus data are currently available, are zoosporic taxa with robust support as members of the sphaeroplealean clade (Figs. 14). The Sphaeropleaceae. Sphaeroplea and other members of the Sphaeropleaceae are resolved as sphaeroplealean taxa in all analyses of 18S rDNA data (Fig. 1) and in MP (Fig. 3), ME (not shown), and SRC (Fig. 4) global combined analyses. The 26S rDNA data alone do not support a monophyletic Sphaeropleales (sensu Deason et al. 1991). Furthermore, neither the 18S rDNA analyses nor the results from combined analysis I demonstrate robust support for a monophyletic Sphaeropleales (sensu Deason et al. 1991). However, results from SRC analysis, which is designed to minimize long-branch problems (Van de Peer et al. 1993, 1996), support a monophyletic Sphaeropleales (sensu Deason et al. 1991) with the Sphaeropleaceae as a basal member of the order (Fig. 4). Taxon deletion experiments. Results from taxon deletion experiments conducted in combined analysis II, in which taxa with putative long branches were excluded (Fig. 5), indicate that the core Sphaeropleales (minus the Sphaeropleaceae) are robustly resolved as the sister group to the Chlamydomonadales regardless of the method of analysis.
Table 5.
Taxon

MP tests of DO monophyly. Tests of four different hypotheses of DO monophyly were undertaken by constraining various groups of DO taxa using MP analysis and statistically comparing the constraint trees against the MP trees using PAUP* (Swofford 2000). The four DO hypotheses differ from one another by inclusion of the Sphaeropleaceae (Ankyra, Atractomorpha, Sphaeroplea), the Chaetopeltidales (Chaetopeltis, Hormotilopsis, Planophila), and/or the Chaetophorales (Aphanochaete, Chaetophora, Fritschiella, Schizomeris, Uronema) with the core Sphaeropleales (Ankistrodesmus, Bracteacoccus, Characiopodium, Hydrodictyon, Neochloris, Ourococcus, Pediastrum, Pseudoschroederia, Scenedesmus, and Schroederia). Results of the constraint tree comparisons indicate that monophyly of the core Sphaeropleales with the Sphaeropleaceae has the strongest support across data sets (values range from P 0.2817 to P 1.000). Among all DO taxa, the core Sphaeropleales and the Sphaeropleaceae share the biflagellate condition of zoospores (except Sphaeroplea and other autosporic taxa that lack a motile vegetative stage). Thus, the flagellate condition of vegetative motile cells coupled with the DO architecture may be structural indicators of a close phylogenetic relationship between the core Sphaeropleales and the Sphaeropleaceae. However,

Pyrenoid classification by invagination type among chlorophycean taxa.

Pyrenoid matrix invaginations

Aphanochaete Ankistrodesmus Ankyra Ascochloris Atractomorpha Bracteacoccus Bulbochaete Carteria Chaetophora Characiopodium Chlamydomonas Chlamydopodium Chlorococcum Chlorella Cylindrocapsa Dunaliella Elakatothrix Fritschiella Fusochloris Haematococcus Hormotilopsis Hydrodictyon Neochloris Oedogonium Ourococcus Pediastrum Planophila Protosiphon Pseudoschroederia Scenedesmus Schizomeris Schroederia Sphaeroplea Tetraspora Treubaria Troschiscia Uronema Volvox

Traversing thylakoids (Stewart et al. 1973) Pyrenoids absent Traversing cytoplasm (Swale and Belcher 1971) Traversing thylakoids (Buchheim, unpublished observations) Traversing cytoplasm (Hoffman and Ichimura 1986) Pyrenoids absent Traversing cytoplasm (Retallack and Butler 1970) Traversing thylakoids (Lembi 1975) Appressed thylakoids (Stewart et al. 1973) Invaginations absent (Floyd et al. 1993) Traversing thylakoids (Johnson and Porter 1968) Traversing thylakoids (Floyd et al. 1993) Traversing thylakoids (Buchheim, unpublished observations) Traversing thylakoids (Ikeda and Takeda 1995) Traversing cytoplasm (Hoffman 1976) Traversing thylakoids (Watanabe and Floyd 1989b) Traversing cytoplasm (Buchheim, unpublished observations) Appressed thylakoids (Stewart et al. 1973) Traversing thylakoids (Floyd et al. 1993) Traversing thylakoids (Buchheim, unpublished observations) Traversing cytoplasm (OKelly et al. 1994) Invaginations absent (Marchant and Pickett-Heaps 1972) Invaginations absent (Watanabe and Floyd 1989a) Traversing cytoplasm (Hoffman 1968) Invaginations absent (Buchheim, unpublished observations) Invaginations absent (Wilcox and Floyd 1988) Traversing cytoplasm (OKelly et al. 1994) Traversing thylakoids (Watanabe and Floyd 1989c) Invaginations absent (Hegewald and Schnepf 1986) Invaginations absent (Bisalputra and Weier 1964) Traversing thylakoids (Stewart et al. 1973) Invaginations absent (Hegewald and Schnepf 1986) Traversing cytoplasm (Cceres and Robinson 1980) Traversing thylakoids (Moreland et al. 2000) Traversing cytoplasm (Reymond 1980) Traversing cytoplasm (Buchheim, unpublished observations) Appressed thylakoids (Stewart et al. 1973) Traversing thylakoids (Hoops 1984)

830

MARK A. BUCHHEIM ET AL.

even the combined molecular data are largely ambiguous regarding alternative hypotheses of alliance among DO taxa. Only the constraint that forced monophyly of all DO taxa (core Sphaeropleales, Sphaeropleaceae, Chaetopeltidales, and Chaetophorales) using 26S rDNA data resulted in a uniform rejection of the null hypothesis of no difference between trees (values range from P 0.005 to P 0.0146). Cylindrocapsa and allies: Cylindrocapsa clade. One of the most striking findings presented here is the robust grouping of Cylindrocapsa with Treubaria, Trochiscia, and Elakatothrix (Figs. 14). Preliminary analyses of rbcL data also support an alliance of at least some members of this distinctive group of green algae (Buchheim, unpublished observations). An ultrastructural feature that unites Treubaria and Cylindrocapsa is the distinctive pyrenoid with cytoplasmic invaginations (see discussion below). In addition, preliminary ultrastructural analyses indicate that both Trochiscia and Elakatothrix possess pyrenoids with cytoplasmic invaginations (Table 5, Buchheim, unpublished observations). Despite these similarities, an alliance of Cylindrocapsa with Treubaria, Trochiscia, and Elakatothrix cannot easily be interpreted in a more traditional morphological and life history context. The filamentous Cylindrocapsa geminella produces quadriflagellate zoospores (Hoffman and Hofman 1975). In contrast, the unicellular Treubaria, Trochiscia, and Elakatothrix are described as autosporic taxa in general treatments (e.g. Smith 1950, Bourrelly 1990). However, Treubaria may not be exclusively autosporic. Reymond (1979, 1980) reported that Treubaria setigera is capable of producing quadriflagellate zoospores. Moreover, nonflagellated spores of Treubaria have been shown to exhibit contractile vacuoles and eyespots, earning the term hemizoospores (Fott and Kovcik 1975). Although this observation regarding Treubaria is not conclusive, it highlights another feature that could be used to support an alliance with Cylindrocapsa. Chlamydomonad alliance. More surprising than an alliance of Elakatothrix, Treubaria, Trochiscia, and Cylindrocapsa is the sister status of the Cylindrocapsa clade and the chlamydomonad flagellate lineage observed in several analyses (Figs. 1 and 4). Although an ultrastructural analysis of the flagellar apparatus orientation in zoospores of Cylindrocapsa has not been published, Hoffman (1976) described these motile cells as bearing a fine outer investment that exhibits a pattern similar to wire gauze. Grazing sections of this outer investment on zoospores of Cylindrocapsa (Hoffman 1976) resemble, in scale and pattern, the lattice of crystalline walls described for many members of the chlamydomonad lineage (Roberts 1974). A crystalline cell wall, or chlamys, appears to be a diagnostic feature of the chlamydomonad lineage (assuming loss in some taxa, see Buchheim et al. 1996) and forms the basis of a formal diagnosis of the group (Chlamydophyceae, sensu Ettl 1981). Thus, the wire gauze observed as an investment surrounding zoospores of Cylindrocapsa might be homologous to the chlamys found in virtually every member of the order Chlamydomonadales. Kouwets (1994) also ar-

gued, based on ultrastructural evidence, that Cylindrocapsa has its closest allies among chlamydomonad taxa. A basal alliance of chlamydomonad taxa producing quadriflagellate stages (i.e. Carteria) is consistent with observations of a quadriflagellate motile stage in Treubaria (Reymond 1979, 1980) and Cylindrocapsa. Given that an alliance of the Cylindrocapsa clade and the chlamydomonad clade is only weakly supported by the 18S data and is not supported by the 26S data, the phylogenetic affinities of the Cylindrocapsa lineage must remain an open question. Oedogonialean clade. The Oedogoniales are generally resolved as basal (Figs. 1 and 3) or near-basal (Figs. 2 and 4) members of the Chlorophyceae in the present investigation. These results are consistent with the original studies of 18S rDNA data from oedogonialean taxa (Booton et al. 1998b). However, no single analysis in the present investigation yielded a robust position for the Oedogoniales within the Chlorophyceae. This observation is likely attributable to the long oedogonialean branches associated with both the 18S (Fig. 1) and 26S data (Fig. 2). In such cases, combining data is unlikely to improve resolution (Felsenstein 1978). The combined analyses presented here fail to provide a robust or consistent placement for the Oedogoniales (Figs. 3 and 4). Unless future investigations reveal substantial variation within oedogonialean genera (Bulbochaete, Oedocladium, Oedogonium) that can be exploited for interrupting the long oedogonialean branch, the problem will only be resolved by the chance discovery of a cryptic sister group (if one exists) or by analysis using more conserved genes. Chaetopeltidales. When all taxa are included in phylogenetic analyses, the Chaetopeltidales (sensu OKelly et al. 1994) are variously supported as sister to the Sphaeroplea clade (Fig. 1), as sister to the Oedogoniales (not shown), as a near-basal member of a chlorophycean grade (Fig. 2), or as sister to the Chaetophorales (Fig. 3). Although an alliance of the Chaetopeltidales and the Sphaeropleales is consistent with previous investigations of 18S data (Booton et al. 1998a), none of the various chaetopeltidalean groupings has robust bootstrap support in the current investigation when all taxa are considered. Chaetophorales. The data presented here confirm the predictions of more traditional taxonomists (e.g. Mattox and Stewart 1984) who included Aphanochaete and Schizomeris in the order Chaetophorales. Both the 18S data (Fig. 1) and the 26S data (Fig. 2) identify Aphanochaete and Schizomeris as basal members of the order. Thus, the addition of these two taxa has expanded the known molecular diversity for the group. The Chaetophorales (sensu Mattox and Stewart 1984) are resolved as a basal or near-basal member of a chlorophycean grade (Figs. 1 and 2), as a sister to the Chlamydomonadales (not shown), or as sister to the Chaetopeltidales (Figs. 35). A sister relationship between the Chaetophorales and the Chlamydomonadales is consistent with previous 18S rDNA studies (Booton et al. 1998a), but none of the various chaetophoralean alliances is robustly supported in the present investigation.

PHYLOGENY OF THE CHLOROPHYCEAE

831

Test of the Chlamydomonadales/Chaetophorales alliance. A monophyletic Chlamydomonadales/Chaetophorales was constrained in an MP analysis and the resulting topologies were compared with the optimal MP topologies from analysis of all taxa. Although the values for the statistical comparisons were no higher than P 0.29, most of the trees constrained to fit the results of the Booton et al. (1998a) investigation were not statistically different from the optimal trees. Thus, global taxon sampling fails to identify a robust resolution for either the Chaetophorales or the Chaetopeltidales. Taxon deletion experiments. When long-branch taxa are excluded from the combined analyses, an alliance of the Chaetopeltidales and Chaetophorales is supported by MP, ME, and ML analysis (Fig. 5) with robust bootstrap values recorded in the MP and ML analyses. In support of this finding, OKelly et al. (1994) noted that the Chaetopeltidales and Chaetophorales show similarities in zoospore structure, including 1) the quadriflagellate condition of DO or near-DO basal bodies, 2) lack of proximal fibers, 3) proximal sheaths that subtend the basal bodies, 4) similar rhizoplast attachment points, and 5) a microtubule-associated component adjoining with the proximal end of the d rootlets. On the other hand, the Chaetopeltidales possess a number of unique features, such as body scales on zoospores (OKelly et al. 1994). OKelly et al. (1994) concluded that the distinctions between the Chaetopeltidales and the Chaetophorales were sufficiently large to preclude a close alliance. However, the Chaetophorales were hypothesized to be derived from a chaetopeltidaleanlike ancestor (OKelly et al. 1994). This conclusion is consistent with the results from combined analysis of the taxon-limited data set that supports a sister relationship between the Chaetopeltidales and Chaetophorales (Fig. 5). Reconciling chaetopeltidalean scales with the molecular phylogenetic analysis presented here, however, requires invoking one or more extra assumptions about scale evolution. At the present time, scales are only known from ulvophyte, prasinophyte, and streptophyte taxa (OKelly et al. 1994). Chlamydomonadalean clade. The limited taxon sampling within the chlamydomonadalean clade as compared with previous work (e.g. Buchheim et al. 1996, 1997a,b) does not permit new insights into relationships within the group. However, both the 26S data and the results from combined analysis corroborate earlier assertions of nonmonophyly for Carteria (Buchheim and Chapman 1992). Statistical comparisons demonstrate that constraint trees for Carteria monophyly are either significantly different from optimal trees or exhibit low P values (values range from P 0.003 to P 0.19). Thus, both data sets suggest that Carteria is not a monophyletic group and that the Carteria crucifera lineage is likely basal within the Chlamydomonadales. Character evolution: pyrenoids with cytoplasmic invaginations. Mattox and Stewart (1984) suggested that pyrenoids with cytoplasmic invaginations were rare and should be interpreted as an apomorphic feature. However, vegetative cells of a rather large number of

FIG. 6. Character evolution (pyrenoid invagination type and absolute orientation of basal bodies) is plotted on consensus topologies for the Chlorophyceae. Legends for the states of each character are presented below each consensus topology. The unordered character interpretations are polarized using data from trebouxiophycean taxa. (A) Consensus topology illustrating the hypothesis for the evolution of pyrenoid invagination types with three character states (thylakoids, cytoplasm, and absent). (B) Consensus topology illustrating the hypothesis for the evolution of the absolute orientation of basal body type with three character states (counter-clockwise, DO, clockwise). The Chaetophorales are coded as polymorphic for DO and clockwise forms. Absolute orientation data are available for neither the Oedogoniales nor the Cylindrocapsa alliance.

green algal taxa have been documented as possessing this distinctive pyrenoid architecture. Taxa known to possess this pyrenoid type include Atractomorpha (Hoffman and Ichimura 1986), Sphaeroplea (Cceres and Robinson 1980), Ankyra (Swale and Belcher 1971), Bulbochaete (Retallack and Butler 1970), Chaetopeltis (OKelly et al. 1994), Characiochloris (Lee 1974), Characiosiphon (Stewart et al. 1978), Cylindrocapsa (Hoffman 1976), Hafniomonas (Ettl and Moestrup 1980), Hormotilopsis (OKelly et al. 1994), Lobocharacium (Kugrens et al. 2000), Oedocladium (Markowitz and Hoffman 1974), Oedogonium (Hoffman 1968), Planophila (OKelly et al. 1994), and Treubaria (Reymond 1980). To formally examine the pyrenoid question, studies of character evolution in the Chlorophyceae using MacClade 3.1.1 (Maddison and Maddison 1992) were undertaken. The following assumptions were regarded as well supported by most or all analyses: 1) sister status of the Chaetopeltidales and the Chaetophorales; 2) basal status of the Oedogoniales, Chaetopeltidales, and Chaetophorales; and 3) monophyly of the Sphaeropleaceae, Sphaeropleales, Chlamydomonadales, and Cylindrocapsa clade. The distribution of known pyrenoid characters (Table 5) on a consensus topology (Fig. 6A) does not support the existence of a

832

MARK A. BUCHHEIM ET AL.

single lineage that can be diagnosed by the presence of cytoplasmically invaginated pyrenoids. Moreover, these tests of character evolution indicate that pyrenoids with cytoplasmic invaginations may be an ancient plesiomorphy for the class Chlorophyceae (Fig. 6A). Flagellar orientation. The stephanokont motile cells of the Oedogoniales cannot currently be assigned to any group of flagellar orientation types (counter-clockwise, clockwise, or DO). In addition, the Oedogoniales are basal or near-basal in most analyses of the Chlorophyceae (Booton et al. 1998b, present investigation). Consequently, it is difficult to unequivocally map the pattern of evolution of flagellar orientation within the Chlorophyceae to a consensus topology of molecular phylogenetic analyses. However, if the Chaetophorales are regarded as polymorphic (DO clockwise) for flagellar orientation, studies of character evolution using MacClade 3.1.1 (Maddison and Maddison 1992) indicate that the DO condition is likely plesiomorphic within the Chlorophyceae (Fig. 6B). Furthermore, this assessment of character evolution suggests that the clockwise orientation independently arose in the Chaetophorales and the Chlamydomonadales (Fig.6B). Summary and conclusions. Results from SRC analysis (Fig. 4), other combined analyses (Fig. 3), and some analyses of 18S data support the Deason et al. (1991) concept of a monophyletic Sphaeropleales diagnosed by the DO condition of biflagellate motile cells. Although the alliance of the Sphaeropleaceae within the Sphaeropleales is only weakly supported by molecular data, congruence between these data and interpretations of ultrastructural diversity lead to the conclusion that the Sphaeropleales (sensu Deason et al. 1991) should be retained until other data are presented that unambiguously falsify the hypothesis. If the Deason et al. (1991) concept of the Sphaeropleales is retained, the results presented here indicate that Ourococcus, Pseudoschroederia, and Schroederia should be regarded as sphaeroplealean taxa. Two quadriflagellate DO groups, the Chaetopeltidales and Chaetophorales, were not formally included in the Sphaeropleales (sensu Deason et al. 1991) and are not supported as sphaeroplealean in combined analyses. Rather, the Chaetopeltidales and Chaetophorales are resolved as sister taxa comprising a lineage separate from the Sphaeropleales. In taxon deletion experiments, the ChaetopeltidalesChaetophorales clade is resolved as basal to the Sphaeropleales and Chlamydomonadales. Long-branch problems likely confound interpretations of pattern for three major chlorophycean groups. Neither the placement of the Oedogoniales, the Sphaeropleaceae, nor the Cylindrocapsa clade could be determined without ambiguity. Ultrastructural investigations of motile cell architecture in Cylindrocapsa and Treubaria would have a profound impact on any systematic assessment, and these data are clearly needed to fill the gap in our understanding of what may be a new chlorophycean order. In the case of the Oedogoniales, detailed ultrastructural studies of development in the flagellar apparatus of the unusual stephanokont ga-

metes or zoospores might provide insights into the phylogeny of this distinctive group. As noted above, identifying sister taxa and studying conserved genes would likely help resolve the long-branch problems. Regardless of the approach taken, a better understanding of the phylogenetic position of the Oedogoniales within the Chlorophyceae is necessary if questions about character evolution are to be answered. Comparison of the 18S and 26S rDNA genes indicates that the latter is more variable and provides more phylogenetic information than the former (Table 3). The differences in phylogenetic information content between 18S and 26S rDNA indicate that the latter should be examined in other green algal groups for which 18S rDNA data have not yielded globally robust phylogenies due to numerous short internodal branches (e.g. the Trebouxiophyceae [Friedl 1995] and the basal streptophytes [Melkonian and Surek 1995]). The 18S and 26S data sets exhibit only modest levels of topological congruence when problematic branches (i.e. long branches) are included. When potentially confounding branches are excluded, the data sets exhibit high levels of topological congruence. Moreover, virtually all clades in combined analysis II recorded an enhancement of support, as determined by the bootstrap, over independent data analysis (Table 4). These findings are consistent with other studies that have discovered hidden support for groups when data sets are combined (Gatesy et al. 1999, Smith 2000). Similarly, Wenzel and Siddall (1999) concluded that combining data leads to an additive effect for the signal and an averaging of the noise associated with the independent data sets. Thus, despite the questions that remain unanswered, the results from the combined analyses presented here suggest that a fully and robustly resolved hypothesis for relationships among chlorophycean algae is an attainable goal. Additional data from other sources, including the chloroplast genome (e.g. McCourt et al. 2000) and the mitochondrial genome (e.g. Renzaglia et al. 2000), will almost certainly further advance our understanding of chlorophycean diversity. Moreover, molecular approaches to phylogeny allow green algal systematists to interpret structural data in new ways, and these data suggest new lines of structural investigation.
This research was supported by grants from the National Science Foundation (DEB 9220834 and 9726588), the DOE/NSF/ USDA Joint Program on Collaborative Research in Plant Biology (USDA grant no. 94-37105-0173 and 97-35105-4678), The University of Tulsa (Faculty Research and Summer Faculty Development grants), and the Mervin Bovaird Center for Molecular Biology and Biotechnology. EPSCoR support of The University of Tulsa DNA Sequencing Facility through the Oklahoma Biotechnology Network helped bring this project to fruition. Larry Hoffman provided the cultures of Atractomorpha and Sphaeroplea. Deborah Guthrie, Sean Larimore, Tonya Leonard, Joanna Michalopulos, Trish Merkel, Whitney Palmer, Matthew Rebstock, and Tracy Tran assisted with DNA extraction and amplification. Karen Draeger performed the automated DNA sequencing.

PHYLOGENY OF THE CHLOROPHYCEAE

Aimi, T., Yamada, T. & Murooka, Y. 1993. A group-I self-splicing intron in the nuclear small subunit rRNA-encoding gene of the green alga, Chlorella ellipsoidea C-87. Gene 139:6571. Aimi, T., Yamada, T., Yamashita, M. & Murooka, Y. 1994. Characterization of the nuclear large-subunit rRNA-encoding gene and the group-I self-splicing intron from Chlorella ellipsoidea C-87. Gene 145:13944. Bakker, M. E. & Lokhorst, G. M. 1984. Ultrastructure of Draparnaldia glomerata (Chaetophorales, Chlorophyceae). I. The flagellar apparatus of the zoospores. Nord. J. Bot. 4:26173. Bisalputra, T. & Weier, T. E. 1964. The pyrenoid of Scenedesmus quadricauda. Am. J. Bot. 51:88192. Bold, H. C. & Wynne, M. J. 1985. Introduction to the Algae. Structure and Reproduction. Prentice Hall, Englewood Cliffs, New Jersey, pp. 1856. Booton, G. C., Floyd, G. L. & Fuerst, P. A. 1998a. Polyphyly of tetrasporalean green algae inferred from nuclear small-subunit ribosomal DNA. J. Phycol. 34:30611. Booton, G. C., Floyd, G. L. & Fuerst, P. A. 1998b. Origins and affinities of the filamentous green algal orders Chaetophorales and Oedogoniales based on 18S rRNA gene sequences. J. Phycol. 34:3128. Bourrelly, P. 1990. Les Algues Deaux Douce. Tome 1. Les Algues Vertes. dition N. Boube et Cie, Paris, 571 pp. Buchheim, M. A. 1988. A Structural and Systematic Study of the Sphaeropleaceae (Chlorophyceae) With Special Reference to Sphaeroplea. Ph.D. thesis, University of Illinois at Urbana-Champaign, 191 pp. Buchheim, M. A, Buchheim, J. A. & Chapman, R. L. 1997a. Phylogeny of Chloromonas: a study of 18S rRNA gene sequences. J. Phycol. 33:28693. Buchheim, M. A, Buchheim, J. A. & Chapman, R. L. 1997b. Phylogeny of the VLE-14 Chlamydomonas (Chlorophyceae) group: a study of 18S rRNA gene sequences. J. Phycol. 33:102430. Buchheim, M. A. & Chapman, R. L. 1992. Phylogeny of Carteria (Chlorophyceae) inferred from organismal and molecular data. J. Phycol. 28:36274. Buchheim, M. A. & Hoffman, L. R. 1985. Sphaeroplea robusta n. sp., a new member of the Sphaeropleaceae (Chlorophyceae) from Texas. Trans. Am. Micro. Soc. 104:17887. Buchheim, M. A. & Hoffman, L. R. 1986. Ultrastructure of male gametes of Sphaeroplea robusta (Chlorophyceae). J. Phycol. 22: 17685. Buchheim, M. A. & Hoffman, L. R. 1987. Structure and reproduction in Sphaeroplea fragilis, sp. nov., a new member of the Sphaeropleaceae (Chlorophyceae) from California. Can. J. Bot. 65:23307. Buchheim, M. A., Turmel, M., Zimmer, E. A. & Chapman, R. L. 1990. Phylogeny of Chlamydomonas (Chlorophyta) based on cladistic analysis of nuclear 18S rRNA sequence data. J. Phycol. 26:68999. Buchheim, M. A., Lemieux, C., Otis, C., Gutell, R. R., Chapman, R. L. & Turmel, M. 1996. Phylogeny of the Chlamydomonadales (Chlorophyceae): a comparison of ribosomal RNA gene sequences from the nucleus and the chloroplast. Mol. Phyl. Evol. 5:391402. Cceres, E. J. & Robinson, D. G. 1980. Ultrastructural studies of Sphaeroplea annulina (Chlorophyceae). Vegetative structure and mitosis. J. Phycol. 16:31320. Cceres, E. J. & Robinson, D. G. 1981. Ultrastructural studies of Sphaeroplea annulina (Chlorophyceae). II. Spermatogenesis and male gamete structure. J. Phycol. 17:17380. Christensen, T. 1966. Alger. In Bocher, T. W., Lange, M. & Srensen, T. [Eds.] Botanik, Bd. 2, Systematisk Botanik, No. 2. Munksgaard, Copenhagen, pp. 1456. Cunningham, C. W. 1997. Can three incongruence tests predict when data should be combined? Mol. Biol. Evol. 14:73340. Deason, T. R., Silva, P. C., Watanabe, S. & Floyd, G. L. 1991. Taxonomic status of the species of the green algal genus Neochloris. Plant Syst. Evol. 177:2139. Ettl, H. 1981. Die neue Klasse Chlamydophyceae, eine natrliche Gruppe der Grnalgen (Chlorophyta). Pl. Syst. Evol. 137:10726. Ettl, H. & Moestrup, . 1980. Light and electron microscopical

833

studies on Hafniomonas gen. nov. (Chlorophyceae, Volvocales), a genus resembling Pyramimonas (Prasinophyceae). Pl. Syst. Evol. 135:177210. Farris, J. S. 1989. The retention index and the rescaled consistency index. Cladistics 5:4179. Farris, J. S., Kllersj, M., Kluge, A. G. & Bult, C. 1994. Testing significance of incongruence. Cladistics 10:3159. Felsenstein, J. 1978. Cases in which parsimony or compatibility methods will be positively misleading. Syst. Zool. 27:40110. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:66670. Fitch, W. M. 1971. Toward defining the course of evolution: minimal change for a specific tree topology. Syst. Zool. 20:40616. Floyd, G. L. & Hoops, H. J. 1980. Schizomeris leibleinii revisited: ultrastructure of the flagellar apparatus. J. Phycol. 16(Suppl.):11. Floyd, G. L., Hoops, H. J. & Swanson, J. A. 1980. Fine structure of the zoospore of Ulothrix belkae with emphasis on the flagellar apparatus. Protoplasma 104:1731. Floyd, G. L., Watanabe, S., & Deason, T. R. 1993. Comparative ultrastructure of the zoospores of eight species of Characium (Chlorophyta). Arch. Protistenkd. 143:6373. Fott, B. 1971. Algenkunde, 2nd ed. Gustav Fisher, Jena, pp. 36270. Fott, B. & Kovcik, L. 1975. ber die Gattung Treubaria (Chlorococcales, Chlorophyceae). Preslia 47:30516. Friedl, T. 1995. Inferring taxonomic positions and testing genus level assignments in coccoid green lichen algae: a phylogenetic analysis of 18S ribosomal RNA sequences from Dictyochloropsis reticulata and from members of the genus Myrmecia (Chlorophyta, Trebouxiophyceae Cl. Nov.). J. Phycol. 31:6329. Friedl, T. & Rokitta, C. 1997. Species relationships in the lichen alga Trebouxia (Chlorophyta, Trebouxiophyceae): molecular phylogenetic analyses of nuclear- encoded large subunit rRNA gene sequences. Symbiosis 23:12548. Fritsch, F. E. 1929. The genus Sphaeroplea. Ann. Bot. 43:126. Gatesy, J., OGrady, P., & Baker, R. H. 1999. Corroboration among data sets in simultaneous analysis: hidden support for phylogenetic relationships among higher level Artiodactyl taxa. Cladistics 15:271313. Gilbert, D. 1994. SeqApp v. 1.9a169: a Macintosh biosequence editor, analyzer, and network handyman. Indiana University, Bloomington, IN. Gunderson, J. H., Elwood, H., Ingold, A., Kindle, K. & Sogin, M. L. 1987. Phylogenetic relationships between chlorophytes, chrysophytes, and oomycetes. Proc. Nat. Acad. Sci. USA 84:58237. Hamby, R. K., Sims, L., Issel, L. & Zimmer, E. A. 1988. Direct ribosomal RNA sequencing: optimization of extraction and sequencing methods for work with higher plants. Plant Mol. Biol. Rep. 6:17592. Hegewald, V. E. & Schnepf, E. 1986. Zur struktur und taxonomie spindelfrmiger Chlorellales (Chlorophyta): Schroederia, Pseudoschroederia, gen. nov., Closteriopsis. Arch. Hydrobiol. Suppl. 73(Algol. Stud. 42):2148. Hoffman, L. R. 1968. Observations on the fine structure of Oedogonium. 5. Evidence of the de novo formation of pyrenoids in zoospores of Oe. cardiacum. J. Phycol. 4:2128. Hoffman, L. R. 1976. Fine structure of Cylindrocapsa zoospores. Protoplasma 87:191219. Hoffman, L. R. 1983. Atractomorpha echinata gen. et sp. nov., a new anisogamous member of the Sphaeropleaceae (Chlorophyceae). J. Phycol. 19:7686. Hoffman, L. R. 1984a. Atractomorpha porcata sp. nov., a new anisogamous member of the Sphaeropleaceae (Chlorophyceae) from California. J. Phycol. 20:22536. Hoffman, L. R. 1984b. Male gametes of Atractomorpha echinata Hoffman (Chlorophyceae). J. Phycol. 20:57384. Hoffman, L. R. & Hofman, C. S. 1975. Zoospore formation in Cylindrocapsa. Can. J. Bot. 53:43951. Hoffman, L. R. & Ichimura, T. 1986. Ankyraa chlorococcalean or sphaeroplealean alga? Abstracts of the Joint Meetings of the American Society of Limnology and Oceanography and the Phycological Society of America, Kingston, RI. Hoops, H. J. 1984. Somatic cell flagellar apparatuses in two species of Volvox (Chlorophyceae). J. Phycol. 20:207.

834

MARK A. BUCHHEIM ET AL.

domonadales and Chlorococcales inferred from 18S rDNA sequence data. Phycol. Res. 44:4756. Oehlkers, F. 1956. Das Leben der Gewchse. Die Pflanzen als Individuum. Springer- Verlag, Berlin, pp. 2478, 257. OKelly, C. J. & Floyd, G. L. 1984. Flagellar apparatus absolute orientations and the phylogeny of the green algae. BioSystems 16:22751. OKelly, C. J., Watanabe, S. & Floyd, G. L. 1994. Ultrastructure and phylogenetic relationships of Chaetopeltidales ord. nov. (Chlorophyta, Chlorophyceae). J. Phycol. 30:11828. Pascher, A. 1931. Systematische bersichte ber die mit Flagellaten in Zusammenhang stehenden Algenreihen und Versuch einer Einreihung dieser Algenstmme in die Stmme des Pflanzenreiches. Beihefte Bot. Centralbl. 48:31732. Posada, D. & Crandall, K. A. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14:8178. Prescott, G. W. 1951. Algae of the Western Great Lakes Area. Cranbrook Institute of Science, Bull. No. 31, Bloomfield Hills, Michigan, pp. 1101. Ramanathan, K. R. 1964. Ulotrichales. Indian Council of Agricultural Research, New Delhi, 188 pp. Rau, H. A., Klootwijk, J. & Musters, W. 1988. Evolutionary conservation of structure and function of high molecular weight ribosomal RNA. Prog. Biophys. Mol. Biol. 51:77129. Rausch, H., Larsen, N. & Schmitt, R. 1989. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons. J. Mol. Evol. 29:25565. Renzaglia, K. S., Duff, R. J., Nickrent, D. L. & Garbary, D. J. 2000. Vegetative and reproductive innovations of early land plants: implications for a unified phylogeny. Phil. Trans. R. Soc. Lond. B 355:76993. Retallack, B. & Butler, R. D. 1970. The development and structure of pyrenoids in Bulbochaete hiloensis. J. Cell. Sci. 6:22941. Reymond, O. L. 1979. Connaissance actuelle du genre Treubaria (Chlorococcales). Schweiz. Z. Hydrol. 40:3449. Reymond, O. L. 1980. Contribution ltude de Treubaria Bernard (Chlorococcales, Chlorophyceae). Candollea 35:3770. Roberts, K. 1974. Crystalline glycoprotein cell walls of algae: their structure, composition and assembly. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 268:12946. Rodrguez, F., Oliver, J. L., Marin, A. & Medina, J. R. 1990. The general stochastic model of nucleotide substitution. J. Theor. Biol. 142:485501. Round, F. E. 1971. The taxonomy of the Chlorophyta. II. Br. Phycol. J. 6:23564. Silva, P. C. 1982. Chlorophycota. In Parker, S. P. [Ed.] Synopsis and Classification of Living Organisms. Vol. 1. McGraw-Hill, New York, pp. 13364. Smith, G. M. 1950. The Freshwater Algae of the United States. McGrawHill, New York, 719 pp. Smith, J. F. 2000. Phylogenetic signal common to three data sets: combing data which initially appear heterogeneous. Plant Syst. Evol. 221:17998. Stefanovic, S., Jager, M., Deutsch, J., Broutin, J. & Masselot, M. 1998. Phylogenetic relationships of conifers inferred from partial 28S rRNA gene sequences. Am. J. Bot. 85:68897. Stewart, J. K., Stewart, J. R. & Bold, H. C. 1978. The morphology and life history of Characiosiphon rivularis Iyengar (Chlorophyceae, Characiosiphonaceae). Arch. Protistenkd. 120:31240. Stewart, J. R., Mattox, K. R. & Floyd, G. L. 1973. Mitosis, cytokinesis, the distribution of plasmodesmata, and other cytological characteristics in the Ulotrichales, Ulvales, and Chaetophorales: phylogenetic and taxonomic considerations. J. Phycol. 9:12841. Swale, E. M. F. & Belcher, J. H. 1971. Investigation of a species of Ankyra Fott by light and electron microscopy. Br. Phycol. J. 6:4150. Swofford, D. L. 2000. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, MA. Swofford, D. L. 2001. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, MA. Van de Peer, Y., Neefs, J.-M., De Rijk, P., & De Wachter, R. 1993. Reconstructing evolution from eukaryotic small ribosomal sub-

Huss, V. A. R. & Sogin, M. L. 1990. Phylogenetic position of some Chlorella species with the Chlorococcales based upon complete small-subunit ribosomal RNA sequences. J. Mol. Evol. 31:43242. Ikeda, T. & Takeda, H. 1995. Species-specific differences of pyrenoids in Chlorella (Chlorophyta). J. Phycol. 31:8138. Johnson, U. G. & Porter, K. R. 1968. Fine structure of cell division in Chlamydomonas reinhardi. Basal bodies and microtubules. J. Cell. Biol. 38:40325 Kantz, T. K., Theriot, E. C., Zimmer, E. A. & Chapman, R. L. 1990. The Pleurastrophyceae and Micromonadophyceae: a cladistic analysis of nuclear rRNA sequence data. J. Phycol. 26:71121. Kluge, A. G. & Farris, J. S. 1969. Quantitative phyletics and the evolution of Anurans. Syst. Zool. 18:132. Kouwets, F. 1994. The Cell Cycle in Multinucleate Coccoid Green Algae: Ultrastructure and Systematics. Rijksherbarium/Hortus Botanicus, Leiden, 161 pp. Kugrens, P., Clay, B. L. & Aguiar, R. 2000. Ultrastructure of Lobocharacium coloradoense, gen. et sp. nov. (Chlorophyta, Characiosiphonaceae), an unusual coenocyte from Colorado. J. Phycol. 36:42132. Kuzoff, R. K., Sweere, J. A., Soltis, D. E., Soltis, P. S. & Zimmer, E. A. 1998. The phylogenetic potential of entire 26S rDNA sequences in plants. Mol. Biol. Evol. 15:251263. Lanave, C., Preparata, G., Saccone, C. & Serio, G. 1984. A new method for calculating evolutionary substitution rates. J. Mol. Evol. 20:8693. Larson, A., Kirk, M. M. & Kirk, D. L. 1991. Molecular phylogeny of the volvocine flagellates. Mol. Biol. Evol. 9:85102. Lee, K. W. 1974. Ultrastructure of Characiochloris acuminata Lee et Bold. Br. Phycol. J. 9:3937. Lembi, C. A. 1975. The fine structure of the flagella apparatus of Carteria. J. Phycol. 11:19. Lewis, L. A. 1997. Diversity and phylogenetic placement of Bracteacoccus Tereg (Chlorophyceae, Chlorophyta) based on 18S rRNA gene sequence data. J. Phycol. 33:27985. Lewis, L. A., Wilcox, L. W., Fuerst, P. A. & Floyd, G. L. 1992. Concordance of molecular and ultrastructural data in the study of zoosporic chlorococcalean green algae. J. Phycol. 28:37580. Maddison, W. P. & Maddison, D. R. 1992. MacClade: analysis of phylogeny and character evolution. Version 3.0, Sinauer, Sunderland, MA. Manton, I. 1964. Observations of the fine structure of the zoospore and young germling of Stigeoclonium. J. Exp. Bot. 15:399411. Marchant, H. J. & Pickett-Heaps, J. D. 1972. Ultrastructure and differentiation of Hydrodictyon reticulatum. 3. Formation of the vegetative daughter net. Austral. J. Biol. Sci. 25:26578. Markowitz, M. M. & Hoffman, L. R. 1974. Chloroplast inclusions in zoospores of Oedocladium. J. Phycol. 10:30815. Mattox, K. R. & Stewart, K. D. 1984. Classification of the green algae: a concept based on comparative cytology. In Irvine, D. E. G. & John, D. [Eds.] Systematics of the Green Algae. University of Cambridge Press, Cambridge, pp. 2972. McCourt, R. M., Karol, K. G., Bell, J., Helm-Bychowski, K. M., Grajewska, A., Wojciechowski, M. F. & Hoshaw, R. W. 2000. Phylogeny of the conjugating green algae (Zygnemophyceae) based on rbcL sequences. J. Phycol. 36:74758. Melkonian, M. 1975. The fine structure of the zoospores of Fritschiella tuberosa Iyeng. (Chaetophorineae, Chlorophyceae). Protoplasma 86:391404. Melkonian, M. & Surek, B. 1995. Phylogeny of the Chlorophyta: congruence between ultrastructural and molecular evidence. Bull. Soc. Zool. Fr. 120:191208. Michalopulos, E. A. 1998. Phylogeny of the Green Algae: The 28S rRNA Gene and the Sphaeropleales. M.S. Thesis, 150 pp. The University of Tulsa, Tulsa, OK. Moestrup, . 1978. On the phylogenetic validity of the flagellar apparatus in green algae and other chlorophyll a and b containing plants. BioSystems 10:11744. Moreland, A., Buchheim, M. A. & Buchheim, J. A. 2000. Diversity among tetrasporalean taxa: evidence from ultrastructure and molecules. J. Phycol. 36(Suppl.):49. Nakayama, T., Watanabe, S., Mitsui, K., Uchida, H. & Inouye, I. 1996. The phylogenetic relationships between the Chlamy-

PHYLOGENY OF THE CHLOROPHYCEAE

unit RNA sequence: calibration of the molecular clock. J. Mol. Evol. 37:22132. Van de Peer, Y., Van der Auwera, G. & De Wachter, R. 1996. The evolution of stramenopiles and alveolates as derived by substitution rate calibration of small ribosomal subunit RNA. J. Mol. Evol. 42:20110. van den Hoek, C., Mann, D. G. & Jahns, H. M. 1995. Algae. An Introduction to Phycology. Cambridge University Press, Cambridge. Watanabe, S. & Floyd, G. L. 1989a. Comparative ultrastructure of the zoospores of nine species of Neochloris (Chlorophyta). Pl. Syst. Evol. 168:195219. Watanabe, S. & Floyd, G. L. 1989b. Ultrastructure of the quadriflagellate zoospores of the filamentous green algae Chaetophora incrassata and Pseudoschizomeris caudata (Chaetophorales, Chlorophyceae) with emphasis on the flagellar apparatus. Bot. Mag. Tokyo 102:53346. Watanabe, S. & Floyd, G. L. 1989c. Variation in the ultrastructure of the biflagellate motile cells of six unicellular genera of the Chlamydomonadales and Chlorococcales (Chlorophyceae), with emphasis on the flagellar apparatus. Am. J. Bot. 76:30717. Watanabe, S. & Floyd, G. L. 1992. Comparative ultrastructure of

835

zoospores with parallel basal bodies from the green algae Dictyochloris fragrans and Bracteacoccus sp. Am. J. Bot. 79:5515. Wenzel, J. W. & Siddall, M. E. 1999. Noise. Cladistics 15:5164. White, T. J., Bruns, T., Lee, S. & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M. A., Gelfand, D. H., Sninsky, J. J. & White, T. J. [Eds.] PCR Protocols. Academic Press, San Diego, CA, pp. 31522. Wilcox, L. W. & Floyd, G. L. 1988. Ultrastructure of the gamete of Pediastrum duplex (Chlorophyceae). J. Phycol. 24:1406. Wilcox, L. W., Lewis, L. A. Fuerst, P. A. & Floyd, G. L. 1992. Assessing the relationships of autosporic and zoosporic chlorococcalean green algae with 18S rDNA sequence data. J. Phycol. 28:3816. Yang, Z. 1994. Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over sites: approximate methods. J. Mol. Evol. 39:30614. Zechman, F. W., Theriot, E. C., Zimmer, E. A. & Chapman, R. L. 1990. Phylogeny of the Ulvophyceae (Chlorophyta): cladistic analysis of nuclear-encoded rRNA sequence data. J. Phycol. 26:70010.