Histochem Cell Biol DOI 10.

1007/s00418-008-0552-2

ORIGINAL PAPER

The ascorbic acid transporter SVCT2 is expressed in slow-twitch skeletal muscle Wbres
Marcela Low Daniel Sandoval Evelyn Avils Fernando Prez Francisco Nualart Juan Pablo Henrquez

Accepted: 7 December 2008 Springer-Verlag 2009

Abstract Ascorbic acid, the reduced form of vitamin C, functions as a potent antioxidant as well as in cell diVerentiation. Ascorbate is taken up by mammalian cells through the speciWc sodium/ascorbate co-transporters SVCT1 and SVCT2. Although skeletal muscle contains about 50% of the whole-body vitamin C, the expression of SVCT transporters has not been clearly addressed in this tissue. In this work, we analysed the expression pattern of SVCT2 during embryonic myogenesis using the chick as model system. We cloned the chick orthologue of SVCT2 (cSVCT2) that shares 93% identity with the mouse transporter. cSVCT2 mRNA and protein are expressed during chick embryonic muscle development. Immunohistochemical analyses showed that SVCT2 is preferentially expressed by type I slow-twitch muscle Wbres throughout chick myogenesis as well as in post-natal skeletal muscles of several species, including human. Our results suggest that SVCT2-mediated uptake of ascorbate is relevant to the oxidative nature of type I muscle Wbres. Keywords Human Slow muscle Ascorbate SVCT2 Chick

Introduction The biological value of vitamin C rests mainly on its ability to protect cells against the generation of reactive oxygen species (ROS) caused by oxidative stress (Frei et al. 1989). Indeed, several studies suggest that vitamin C supplementation has a protective eVect against the onset and progression of degenerative diseases with strong contribution of oxidative damage, such as cancer and cardiovascular disease (Duarte and Lunec 2005; Li and Schellhorn 2007). In addition, vitamin C is a cofactor of several enzymatic reactions and participates in collagen, steroids and neuropeptide biosynthesis (Englard and Seifter 1986) as well as in cell diVerentiation (Lee et al. 2003; Wu et al. 2004). Even though several species do synthesise vitamin C, most tissues lack this ability and therefore have evolved eYcient mechanisms to uptake vitamin C from extracellular sources. Oxidized vitamin C, dehydroascorbic acid (DHA) is taken up by facilitative hexose transporters (GLUT-1, -3 and -4) and then intracellularly reduced to ascorbic acid (AA) (Liang et al. 2001; Nualart et al. 2003). On the other hand, two diVerent isoforms of high aYnity sodium-dependent vitamin C co-transporters (SVCT1 and SVCT2) mediate AA transport (Faaland et al. 1998; Daruwala et al. 1999; Rajan et al. 1999; Tsukaguchi et al. 1999; Wang et al. 2000; Savini et al. 2008). SVCT1 has been associated to vitamin C absorption as it is mainly expressed in epithelial tissues, like intestine and kidney (Faaland et al. 1998; Daruwala et al. 1999; Tsukaguchi et al. 1999; Castro et al. 2008). In turn, SVCT2 displays higher aYnity and lower capacity to transport AA than SVCT1 and it is widely expressed in several metabolically active and specialized cells and tissues (Rajan et al. 1999; Tsukaguchi et al. 1999; Castro et al. 2001). DiVerent conditions like exercise, aging and pathology increase O2 consumption and, subsequently, the generation

M. Low and D. Sandoval have contributed equally. Electronic supplementary material The online version of this article (doi:10.1007/s00418-008-0552-2) contains supplementary material, which is available to authorized users. M. Low D. Sandoval E. Avils F. Nualart J. P. Henrquez (&) Research Ring for the Study of the Nervous System (PBCT-CONICYT), Laboratory of Developmental Neurobiology, Department of Cell Biology, Faculty of Biological Sciences, Universidad de Concepcin, Casilla 160-C, Concepcin, Chile e-mail: jhenriquez@udec.cl F. Prez Hospital Guillermo Grant Benavente, Concepcin, Chile

123

Histochem Cell Biol

of ROS in skeletal muscle (Rando et al. 1998; Pansarasa et al. 1999; Urso and Clarkson 2003; Jackson et al. 2007). Skeletal muscle cells possess protective systems, both enzymatic (e.g. superoxide dismutase and catalase) and non-enzymatic (e.g. glutathione and vitamin E), to counteract the deleterious eVects of ROS. Interestingly, pulse and chase experiments have shown that about 50% of the injected radioactive vitamin C is incorporated into skeletal muscles (Toutain et al. 1997), where it reaches a concentration of 34 mg/100 g tissue (Peake 2003). Vitamin C uptake into skeletal muscle cells has been associated with protection against oxidative stress (Peake 2003; Urso and Clarkson 2003), carnitine biosynthesis (Thoma and Henderson 1984) and inhibition of glycolytic enzymes (Russell et al. 2006). SVCT2 has been detected in mice skeletal muscle (Kuo et al. 2004) as well as in two murine muscle cell lines (Savini et al. 2005, Savini et al. 2007b). However, a detailed study of the spatio-temporal expression pattern of SVCT2 in skeletal muscle tissue has not been previously addressed. In this work, we have cloned the chick orthologue of SVCT2 (cSVCT2), a protein with high identity to mouse and human SVCT2 that is expressed in several embryonic tissues. Immunolocalisation studies throughout chick embryonic myogenesis and in post-natal muscles of chick and mammalian species, including human, reveal that SVCT2 expression is located to type I slow-twitch muscle Wbres, a relevant Wnding given the oxidative metabolism of these muscle Wbres.

Hamilton 1992). Adult chicks (8-weeks old), rats (4-weeks old), rabbits (4-weeks old) and guinea-pigs (4-weeks old) were obtained from local animal facilities. Human samples were obtained during surgical resection of adult individuals with spinal cord disease at Hospital Guillermo Grant Benavente (Concepcion, Chile). Experiments were conducted following the guidelines outlined in the Biosafety and Bioethics Manual of the National Commission of ScientiWc and Technological Research (CONICYT, Chilean Government). The Ethics Committee of Universidad de Concepcion (Concepcion, Chile) approved all experimental procedures carried out during this study. Cloning and sequencing of chick SVCT2 transporter We performed BLAST analysis of mouse SVCT2 mRNA sequence against the entire NCBI chicken genome database. A predicted chick sequence highly identical to mouse SVCT2 was employed as template to design speciWc primers to Xank sequences at 5 (containing an Xho I site) and 3 (containing a Sal I site) untranslated regions. Total RNA was extracted from HH42 chick brain and used for RT-PCR ampliWcation with Pfu polymerase (Stratagene, La Jolla, CA, USA). The resulting 2.1 kb product [Electronic Supplementary Material (ESM) Fig. 1] was further cloned into TOPO cloning vector for sequencing (Invitrogen, Carlsbad, CA, USA). A set of primers matching internal regions of the predicted chick SVCT2 sequence (cSVCT2) were designed for automated sequencing (Table 1). The resulting nucleotide sequence has been registered with the GenBank accession FJ577639. Reverse transcription-polymerase chain reaction (RT-PCR)

Materials and methods Animals Fertilized chick eggs were incubated at 37.5C in a circulated air incubator. Chick embryos were staged according to Hamburger and Hamilton (HH stages) (Hamburger and
Table 1 Sequences of primers used in this study Primer cSVCT2_fw_full mRNA cSVCT2_fw_sq1 cSVCT2_fw_sq2 cSVCT2_fw_sq3 cSVCT2_fw_sq4 cSVCT2_rev_full mRNA cSVCT2_rv_sq1 cSVCT2_rv_sq2 cSVCT2_fw_exp cSVCT2_rv_exp chick -actin_fw_exp chick -actin_rv_exp

Total RNA from diVerent embryonic chick tissues, as well as from adult chick skeletal muscles, was puriWed using Trizol reagent (Invitrogen) and quantiWed in a SmartSpec 300 spectrophotometer (Bio-Rad, Hercules, CA, USA). For
Purpose Sequencing Sequencing Sequencing Sequencing Sequencing Sequencing Sequencing Sequencing Expression Expression Expression Expression Primer sequence (53) GAAGCATTCTCGAGGGTCCTGT GAAGCATTCTCTTGGGTCCTGT GTGGAACTATAGCAGTTCCC GGGGACTGCCAACAATTTCA TTGTCCTTCCAAGCTATCTC TCTGTGTCGACTCTGGTTCCAG CACACATGGCATCAGCTAGC CAAAACACAGGAGAGACCCT TGCCAGATTGTCTTGTGCTC GCCTTCCAGTGACTTGCTTC ACGTCGCACTGGATTTCGAG TGTCAGCAATGCCAGGGTAC

123

Histochem Cell Biol

RT-PCR, 1 g of RNA was pre-treated with DNase I (Fermentas, ON, Canada) and further incubated in a buVer containing 10 M oligo dT, reverse transcription buVer (0.5 M TrisHCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs at 37C for 5 min. Stratascript reverse transcriptase (Stratagene) was added (160 U) and the mix was further incubated at 42C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. For ampliWcation, a cDNA aliquot in a volume of 12.5 l containing 20 mM Tris buVer pH 8.4, 50 mM KCl, 1.6 mM MgCl2, 0.4 mM dNTPs and 0.04 U Taq polymerase (Genlab, Santiago, Chile) was incubated 95C for 5 min, 95C for 30 s, 58C for 30 s and 72C for 30 s for 35 cycles. Primers were designed based on the predicted chick SVCT2 sequence (expected product 589 bp) (Table 1). As housekeeping control, a 282 bp fragment of chick -actin mRNA was also ampliWed with speciWc primers (Table 1). PCR products were separated by 1.2% agarose gel electrophoresis and visualized following ethidium bromide staining. For semiquantitative RT-PCR experiments, the number of cycles was reduced to 30 and the relative intensity of the bands obtained for cSVCT2 and -actin mRNA expression was quantiWed. Western blot A mixture of skeletal muscles from embryonic chick hindlimbs at diVerent stages, as well as from adult chick slow and fast skeletal muscles, was disrupted with Wve 10 s pulses at 50% power in a vibra cell sonicator (Sonics, Newtown, CT, USA) in a solution containing 0.3 M sucrose and a protease inhibitor cocktail (80 M aprotinin, 1.5 mM pepstatin A, 2 mM leupeptin, 104 mM AEBSF, 4 mM Bestatin, 1.4 mM E-64) (Sigma, St. Louis, MO, USA). Supernatants containing the total protein extracts were obtained after centrifuging at 6000g for 10 min at 4C. Extracts from stage HH31 chick brain were obtained in a similar way. For immunoblotting, 100 g of muscle proteins were loaded in each lane and fractionated by polyacrylamide gel electrophoresis in the presence of sodium dodecylsulfate, transferred to PVDF membranes, and probed against goat anti rat SVCT2 1/200 (G-19, Santa Cruz Biotechnology, Santa Cruz, CA, USA), goat anti human -actin 1/5,000 (Santa Cruz Biotechnology) and mouse anti sea urchin -tubulin (1/1,500) (Sigma) antibodies overnight at 4C. Peroxidase-conjugated secondary antibodies (1:2,000) (Jackson Immuno Research, West Grove, PA, USA) were incubated for 2 h at room temperature. Reactions were developed with enhanced chemiluminiscence according to the ECL Western blotting analysis system (Perkin Elmer, Waltham, MA, USA).

Immunohistochemistry Chick embryos at diVerent stages (HH36HH45) were quickly removed from the egg and decapitated. Hindlimbs were removed, mounted in OCT (Sakura Finetek, Torrance, CA, USA) and quickly frozen in isopentane cooled with liquid nitrogen (Gordon et al. 1977). Thoracic regions from HH42 chick embryos, slow and fast muscles from adult chicks and human lumbar skeletal muscles were processed in a similar way. Cryosections (20 m) were immunostained with primary antibodies diluted in blocking solution (1% BSA in Tris phosphate buVer) 1215 h at 4C. Antibodies were goat anti rat SVCT2, S58 (a monoclonal antibody against slow myosin heavy chain) (Crow and Stockdale 1986), 5D2 (a monoclonal antibody against fast chick sarco/endoplasmic reticulum calcium ATPase) (Kaprielian and Fambrough 1987) and A4.74 (a monoclonal antibody against fast human myosin heavy chain) (Webster et al. 1988). S58, 5D2 and A4.74 antibodies were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA, USA. Corresponding alexa488, alexa546 and alexa633-conjugated secondary immunoglobulins (Invitrogen) were incubated for 2 h at room temperature and the slides were subsequently mounted with aqueous medium for Xuorescence (Sigma). Images were acquired with a laser confocal Nikon Eclipse TE2000-U microscope. Control experiments were performed in the absence of primary antibodies, using an irrelevant goat anti human MAP-1B antibody (Santa Cruz Biotechnology) and by co-incubation of anti SVCT2 antibody along with its commercially available inhibitory peptide, following the instructions of the manufacturer (Santa Cruz Biotechnology) (ESM Fig. 2). Nuclei of adult chick slow and fast muscles were stained with ToPro-3 (Invitrogen). NADH-thioreductase staining was performed as described (Barnard et al. 1971).

Results Cloning and expression pattern of chick SVCT2 In order to clone the chick orthologue of SVCT2 (cSVCT2) we Wrst performed a BLAST comparison of the mouse SVCT2 mRNA sequence against the entire NCBI chicken genome database. We found signiWcant alignment with a sequence contained in chromosome 22 of Gallus gallus. A putative mRNA sequence deduced by in silico analyses was employed to design speciWc primers to amplify the entire coding region of the predicted cSVCT2. A unique 2.1 kb RT-PCR product was obtained from HH42 chick brain and

123

Histochem Cell Biol

Fig. 1 Comparison of cSVCT2 amino acid sequence with cloned mammalian orthologues. The predicted amino acid sequence of cSVCT2 protein (GenBank accession FJ577639) is aligned with that of

mouse (GenBank accession AY004874) and human (GenBank accession EF032501) proteins. Asterisks indicate identical residues and the predicted 12 transmembrane domains are highlighted by gray shading

hindlimb skeletal muscle cDNAs (ESM Fig. 1a). The RTPCR product from HH42 brain was cloned and sequenced. Following this procedure, we obtained a partial 2,126 nucleotide mRNA sequence for cSVCT2 highly identical (>75%) to their mammalian orthologues (ESM Fig. 1b). The predicted primary sequence of cSVCT2 is a 658 amino acid protein that shares 93% identity with mouse and human SVCT2 sequences (Fig. 1). To our knowledge, this is the Wrst reported cloning of any avian SVCT transporter. To globally describe the tissue-speciWc expression pattern of cSVCT2, we prepared total RNA from diVerent organs of HH42 chick embryos and performed RT-PCR experiments using internal primers to amplify a 589 bp speciWc fragment. As shown in Fig. 2a, cSVCT2 is expressed in a variety of embryonic tissues including brain, lung, spleen and small intestine. Interestingly, cSVCT2 mRNA was also detected in chick skeletal muscles from the bodywall (anterior latissimus dorsi) and the hindlimb (lateral gastrocnemius) (Fig. 2a). Thus, cSVCT2 is expressed in several embryonic tissues of G. gallus, including skeletal muscles. Temporal expression of cSVCT2 during myogenesis The presence of the mRNA for cSVCT2 is skeletal muscles prompted us to analyse in greater detail the expression pattern of the transporter during myogenesis. We performed RT-PCR experiments in total RNA samples obtained from a mixture of hindlimb skeletal muscles between HH28 and

Fig. 2 cSVCT2 mRNA is expressed throughout myogenesis. a Total RNA was obtained from diVerent tissues of HH42 chick embryos for RT-PCR analysis to detect cSVCT2 (589 bp) and chick -actin (282 bp). RNA from HH42 chick brain (lane 1) was used as positive control and reverse transcriptase negative reactions (lane 2) as negative control. b Total RNA obtained from HH28 to HH45 chick hindlimb skeletal muscles were either treated (RT+) or not treated (RT) with reverse transcriptase. RT-PCR analyses were performed using speciWc primers aimed to detect cSVCT2 (589 bp) and chick -actin (282 bp). Arrows on the right of each panel indicate the molecular size of the observed bands

HH45 chick embryos. Negative control RT-PCR experiments performed in the absence of reverse transcriptase did not show PCR products. As shown in Fig. 2b, a speciWc 589 bp fragment was detected in skeletal muscle samples

123

Histochem Cell Biol

Fig. 3 cSVCT2 protein is expressed during embryonic skeletal muscle development. Total proteins from a mixture of chick hindlimb skeletal muscles between stages HH28 and HH45 were extracted and analysed by Western blot using a polyclonal anti rat SVCT2 antibody. Proteins from HH31 chick brain were used as positive control and -actin protein levels are shown as loading control. Arrows on the right of each panel indicate the Mr of the observed bands

obtained from HH28 to HH45, demonstrating that cSVCT2 transcripts are expressed during chick myogenesis. To analyze the expression of cSVCT2 at the protein level, we performed Western blot analyses using a speciWc polyclonal antibody raised against a peptide mapping a region towards the N-terminus of rat SVCT2. Control experiments using chick brain extracts from stage HH31 embryos showed a single band of Mr 65,000 Da. A band with similar Mr was detected in the chick embryonic hindlimb skeletal muscle extracts analyzed (Fig. 3). Interestingly, additional 180,000 and 53,000 Da bands were detected from stage HH38 onwards (Fig. 3), suggesting the presence of diVerent forms of cSVCT2 at late stages of embryonic myogenesis. Thus, our results show that SVCT2 is expressed in skeletal muscles throughout chick embryonic development. cSVCT2 is preferentially expressed in embryonic slow-twitch skeletal muscle Wbres To precisely describe the localisation of cSVCT2 in skeletal muscle Wbres, immunoXuorescent staining was performed on chick embryonic hindlimb transversal cryosections at stage HH42 (Fig. 4). Haematoxylin/eosin staining showed that this region is composed of coexisting small and large diameter muscle Wbres. NADH-thioreductase staining showed dark blue staining in large diameter Wbres, suggesting that they correspond to mitochondria-

rich, slow-twitch muscle Wbres (Fig. 4a). An anti SVCT2 polyclonal antibody labelled a subset of large diameter skeletal muscle Wbres in this region suggesting its expression in slow muscle Wbres (Fig. 4a). We next performed double immunostaining with an antibody that speciWcally recognizes the slow isoform of chick myosin heavy chain. Immunohistochemical studies in muscle cryosections obtained between HH36 and HH45 chick embryos showed a strong co-localisation of anti SVCT2 and anti slow myosin antibodies (Fig. 4b), revealing that cSVCT2 is preferentially expressed by type I skeletal muscle Wbres. In order to assess the general relevance of our Wndings we studied the expression pattern of cSVCT2 in two anatomically close body wall slow- and fast-twitch skeletal muscles obtained from HH42 chick embryos, anterior latissimus dorsi (ALD) and posterior latissimus dorsi (PLD), respectively. As control, we used a mouse monoclonal antibody raised against the speciWc fast isoform of the sarco/endoplasmic reticulum calcium ATPase. Figure 5 shows that all embryonic ALD Wbres are positive for anti slow myosin staining and negative for anti fast calcium ATPase staining; in contrast, most embryonic PLD Wbres are positive for anti fast calcium ATPase. As seen in hindlimb skeletal muscles, the anti SVCT2 antibody stains all type I muscle Wbres in the ALD as well as the few scattered slow Wbres in the PLD. Our results in hindlimb and body wall skeletal muscles from chick embryos strongly suggest that cSVCT2 is preferentially expressed in slow-twitch skeletal muscle Wbres. Post-natal type I skeletal muscle Wbres express SVCT2 Based on the diVerential distribution of cSVCT2 in embryonic slow and fast muscle Wbres, we aimed to study the expression pattern of the transporter in ALD and PLD muscles of adult chicks. We Wrst performed double immunostaining with anti slow myosin or anti fast calcium ATPase antibodies. As seen in chick embryos, cSVCT2 is expressed in all ALD slow muscle Wbres whereas fast PLD Wbres show negative staining (Fig. 6a). Remarkably, a similar expression pattern was observed in lumbar skeletal muscles obtained from adult human skeletal muscles (Fig. 7) as well as from other mammalian species like rat, rabbit and guinea pig (ESM Fig. 3). In order to quantify the diVerential expression of cSVCT2 in type I muscle Wbres we next performed semiquantitative RT-PCR experiments in adult chick ALD and PLD muscles. Figure 6b shows that ALD has a much higher expression (1.66 0.06) of cSVCT2 mRNA when compared to PLD (0.12 0.02). At the protein level, Western blot experiments show that the anti SVCT2 antibody blotted three bands in ALD protein samples as seen in hindlimb muscles at late embryonic development. However,

123

Histochem Cell Biol Fig. 4 cSVCT2 is preferentially expressed in slow-twitch muscle Wbres during chick myogenesis. Hindlimbs from chick embryos at diVerent stages were dissected out, embedded in OCT and cryosectioned at 20 m. Images correspond to an internal region of the lateral gastrocnemius muscle. a Serial sections from HH42 chick hindlimbs were stained with haematoxylin/eosin (left panel) to visualize morphology. Similar sections were stained to reveal NADH-thioreductase activity (blue staining, middle panel). Another set of similar sections were stained with a polyclonal goat antibody against rat SVCT2 (right panel). b Chick hindlimb cryosections from stage HH36 to HH45 were double stained with a goat anti SVCT2 antibody (upper panel) together with a mouse anti slow myosin heavy chain antibody (middle panel). Alexa488conjugated anti goat and alexa546-conjugated anti mouse immunoglobulins were used as secondary antibodies. Merge images (lower panel) indicate the co-localisation of anti SVCT2 with anti slow myosin staining. Bars, 100 m (a), 50 m (b)

none of these bands were detected in fast PLD muscles (Fig. 6c). Taken together, our results demonstrate that developing as well as post-natal skeletal muscles express the sodium/ascorbate co-transporter SVCT2, where it is preferentially distributed in type I slow-twitch muscle Wbres.

Discussion Original reports on the expression of sodium/ascorbate co-transporters showed either the absence of expression of SVCTs in skeletal muscles of human (Rajan et al. 1999; Liang et al. 2001) and rat origin (Tsukaguchi et al. 1999) or the presence of low amounts of SVCT2 transcripts in mouse skeletal muscle (Kuo et al. 2004). In culture, SVCT2 -but not SVCT1- was detected by RT-PCR, Western blot and kinetic analyses in two murine muscle cell lines (Savini et al. 2005, 2007b). Here we provide molecular, biochemical and immunohistochemical evidence to demonstrate that the ascorbic acid transporter SVCT2 is expressed in chick embryonic skeletal muscle cells, where it is preferentially distributed in oxidative type I slow-twitch muscle Wbres. In

addition, we found that skeletal muscle cells from postnatal chick, rat, rabbit, guinea pig and human displayed a similar expression pattern. We report here the Wrst molecular cloning of a sodium ascorbate co-transporter from G. gallus. The predicted primary sequence of the chick SVCT2 orthologue (cSVCT2) is a 658 amino acid protein with high identity to mouse and human transporters. cSVCT2 contains an alternative open reading frame 27nt upstream of the mouse translation start codon, suggesting the potential addition of nine amino acids in the cytosolic N-terminal region. Although structural information on SVCT2 is still poor, the transporter cloned from G. gallus shares conserved potential regulatory residues with their mammalian orthologues including: (1) two conserved N-linked glycosylation sites in the second extracellular loop (Tsukaguchi et al. 1999; Liang et al. 2001), (2) four proline residues with potential structural and functional properties in the fourth extracellular loop (Liang et al. 2001), (3) a 18% content of acidic residues in the N-terminus with possible regulatory functions (Liang et al. 2001) and (4) Wve potential protein kinase C-dependent phosphorylation sites in diVerent portions of the protein (Savini et al. 2008).

123

Histochem Cell Biol

Fig. 5 Expression pattern of cSVCT2 in thoracic fast- and slowtwitch embryonic muscles. Longitudinal cryosections of HH42 chick embryos at thoracic level display transversal Wbres of the slow anterior latissimus dorsi (ALD) and the fast posterior latissimus dorsi (PLD) muscles. a, b Sections were double stained with a goat anti SVCT2 antibody (upper panels) together with a mouse anti fast sarco/endoplasmic reticulum calcium ATPase antibody (a middle panel) or with

a mouse anti slow myosin heavy chain antibody (b middle panel). Alexa488-conjugated anti goat and alexa546-conjugated anti mouse immunoglobulins were used as secondary antibodies. The merge images (lower panels) show the distribution of cSVCT2 in all Wbres of the slow muscle ALD as well as in some scattered type I Wbres in the PLD. Bar 50 m

The cSVCT2 transcript was detected in hindlimb skeletal muscles of all embryonic stages analyzed, from HH28 to HH45. Importantly, stage HH34 marks the onset of secondary myogenesis in the chick hindlimb (Fredette and Landmesser 1991), which allowed us to analyze primary as well as secondary formed muscle Wbres. In adult chick skeletal muscles, cSVCT2 mRNA shows a 14-fold higher expression in slow versus fast muscles. Although these results do not discard the possibility that the cSVCT2 protein is present at low basal levels in fast muscle Wbres, they demonstrate that the expression of this transporter is signiWcantly upregulated in type I muscle Wbres. Our Western blot analyses showed an expected band (based on the primary sequence) of 65,000 Da in all embryonic stages and in adulthood but also the presence of additional 53,000 and 180,000 Da bands in hindlimb muscles at late developmental stages as well as in adult chick slow skeletal muscles. However, none of these bands were detected in adult fast skeletal muscles. DiVerent studies on SVCT2 in mouse, rat and human cells have shown either a single immunoreactive band of 50,000 Da (Li et al. 2003; Godoy et al. 2007; Savini et al. 2007a) or a 65,00075,000 Da doublet, possibly due to glycosylation (Garcia Mde et al. 2005; Savini et al. 2007b). Moreover, a truncated 53,000 Da protein have been described as a dominant negative splice variant of SVCT2 in human cells (Lutsenko et al. 2004). Although further research has to be made to

elucidate the nature of these diVerent forms of the transporter, their appearance towards late myogenesis and in adulthood could be functionally relevant to the described decreasing concentration of vitamin C in skeletal muscles as chick development proceeds (Wilson 1990). What is the potential relevance of our Wndings to muscle physiology? The contractile activity of diVerent skeletal muscles depends in part on the fast/slow Wbres ratio they contain. Fast type II muscle Wbres rely on glycolytic metabolism as a major energy source and are susceptible to fatigue. In turn, slow type I muscle Wbres are resistant to fatigue as they mainly use oxidative metabolism for energy production, which provides a permanent supply of ATP (Pette and Staron 2001). Although oxidative metabolism involves an increase in the generation of ROS, numerous studies have shown that ROS stimulate a variety of antioxidant responses in type I muscle Wbres (Hood 2001; Jackson et al. 2007). In this regard, a recent report describes an increase in the expression of SVCT2 in the mouse muscle satellite cell line C2C12 upon hydrogen peroxide treatment (Savini et al. 2007b). Our data showing that SVCT2 is selectively expressed by oxidative type-I slow muscle Wbres are consistent with these observations. Therefore, considering that ascorbic acid is the most important watersoluble antioxidant in plasma (Frei et al. 1989), the high aYnity/low capacity ascorbate transporter SVCT2 may function as an endogenous mechanism to counteract oxidation

123

Histochem Cell Biol

Fig. 6 Selective expression of cSVCT2 in type I Wbres from adult chicks. a Transversal cryosections from adult chick ALD and PLD muscles were double stained with a goat anti SVCT2 antibody (upper panels) together with a mouse anti fast sarco/endoplasmic reticulum calcium ATPase antibody (left middle panel) or with a mouse anti-slow myosin heavy chain antibody (right middle panel). Alexa488-conjugated anti goat and alexa546-conjugated anti mouse immunoglobulins were used as secondary antibodies. The merge images (lower panels) show the selective distribution of SVCT2 in type I muscle Wbres. Bar 100 m. b Semiquantitative RT-PCR experiments were performed on total RNA samples obtained from adult chick ALD and PLD muscles

to detect cSVCT2 (589 bp) and chick -actin (282 bp). A representative agarose gel of RT-PCR products stained with ethidium bromide (upper panel) and quantiWcation of the relative expression of cSVCT2, normalised to -actin (lower panel), are shown. Data are expressed as the mean SEM of three independent experiments analysed by triplicate (**P < 0.01). c Total proteins from adult chick ALD and PLD muscles were extracted and analysed by Western blot using a polyclonal anti rat SVCT2 antibody. -tubulin protein levels are shown as loading control. Arrows on the right of each panel indicate the Mr of the observed bands

in skeletal muscle tissue since early development. Furthermore, our results demonstrating that SVCT2 is expressed in slow-twitch skeletal muscle Wbres from post-natal species that lack the ability to synthesize vitamin C, as guinea-pig and human, suggest a crucial and evolutionary conserved function for this transporter in conditions of vitamin C deWciency. Altogether, our Wndings are particularly relevant in conditions that increase oxidative stress in skeletal muscle

like exercise, aging and muscular dystrophy (Webster et al. 1988; Rando et al. 1998; Pansarasa et al. 1999; Urso and Clarkson 2003). On the other hand, our data suggest an involvement of cSVCT2 in chick skeletal muscle patterning. Skeletal muscle Wbre types are deWned from embryogenesis to adulthood through a process that depends on the patterning of muscle precursors (Miller and Stockdale 1986), innervation (Rafuse et al. 1996; DiMario and Stockdale

123

Histochem Cell Biol C cotransporter-1 along the proximal tubule of the mouse and human kidney. Kidney Int 74:12781286 Crow MT, Stockdale FE (1986) Myosin expression and specialization among the earliest muscle Wbers of the developing avian limb. Dev Biol 113:238254 Daruwala R, Song J, Koh WS, Rumsey SC, Levine M (1999) Cloning and functional characterization of the human sodium-dependent vitamin C transporters hSVCT1 and hSVCT2. FEBS Lett 460:480484 DiMario JX, Stockdale FE (1997) Both myoblast lineage and innervation determine Wber type and are required for expression of the slow myosin heavy chain 2 gene. Dev Biol 188:167180 Duarte TL, Lunec J (2005) Review: When is an antioxidant not an antioxidant? A review of novel actions and reactions of vitamin C. Free Radic Res 39:671686 Englard S, Seifter S (1986) The biochemical functions of ascorbic acid. Annu Rev Nutr 6:365406 Faaland CA, Race JE, Ricken G, Warner FJ, Williams WJ, Holtzman EJ (1998) Molecular characterization of two novel transporters from human and mouse kidney and from LLC-PK1 cells reveals a novel conserved family that is homologous to bacterial and Aspergillus nucleobase transporters. Biochim Biophys Acta 1442:353360 Fredette BJ, Landmesser LT (1991) Relationship of primary and secondary myogenesis to Wber type development in embryonic chick muscle. Dev Biol 143:118 Frei B, England L, Ames BN (1989) Ascorbate is an outstanding antioxidant in human blood plasma. Proc Natl Acad Sci USA 86:63776381 Garcia Mde L, Salazar K, Millan C, Rodriguez F, Montecinos H, Caprile T, Silva C, Cortes C, Reinicke K, Vera JC, Aguayo LG, Olate J, Molina B, Nualart F (2005) Sodium vitamin C cotransporter SVCT2 is expressed in hypothalamic glial cells. Glia 50:3247 Godoy A, Ormazabal V, Moraga-Cid G, Zuniga FA, Sotomayor P, Barra V, Vasquez O, Montecinos V, Mardones L, Guzman C, Villagran M, Aguayo LG, Onate SA, Reyes AM, Carcamo JG, Rivas CI, Vera JC (2007) Mechanistic insights and functional determinants of the transport cycle of the ascorbic acid transporter SVCT2. Activation by sodium and absolute dependence on bivalent cations. J Biol Chem 282:615624 Gordon T, Perry R, Srihari T, Vrbova G (1977) DiVerentiation of slow and fast muscles in chickens. Cell Tissue Res 180:211222 Hamburger V, Hamilton HL (1992) A series of normal stages in the development of the chick embryo. 1951. Dev Dyn 195:231272 Hood DA (2001) Invited review: contractile activity-induced mitochondrial biogenesis in skeletal muscle. J Appl Physiol 90:11371157 Jackson MJ, Pye D, Palomero J (2007) The production of reactive oxygen and nitrogen species by skeletal muscle. J Appl Physiol 102:16641670 Kaprielian Z, Fambrough DM (1987) Expression of fast and slow isoforms of the Ca2+-ATPase in developing chick skeletal muscle. Dev Biol 124:490503 Kuo SM, MacLean ME, McCormick K, Wilson JX (2004) Gender and sodium-ascorbate transporter isoforms determine ascorbate concentrations in mice. J Nutr 134:22162221 Lee JY, Chang MY, Park CH, Kim HY, Kim JH, Son H, Lee YS, Lee SH (2003) Ascorbate-induced diVerentiation of embryonic cortical precursors into neurons and astrocytes. J Neurosci Res 73:156165 Li X, Huang J, May JM (2003) Ascorbic acid spares alpha-tocopherol and decreases lipid peroxidation in neuronal cells. Biochem Biophys Res Commun 305:656661 Li Y, Schellhorn HE (2007) New developments and novel therapeutic perspectives for vitamin C. J Nutr 137:21712184 Liang WJ, Johnson D, Jarvis SM (2001) Vitamin C transport systems of mammalian cells. Mol Membr Biol 18:8795

Fig. 7 SVCT2 is expressed in type I Wbres from human skeletal muscles. Transversal cryosections from human lumbar skeletal muscles were double stained with a goat anti SVCT2 antibody (upper panels) together with a mouse anti fast human myosin heavy chain antibody (left middle panel) or with a mouse anti slow myosin heavy chain antibody (right middle panel). Alexa488-conjugated anti goat and alexa546-conjugated anti mouse immunoglobulins were used as secondary antibodies. The merge images (lower panels) show the preferential distribution of SVCT2 in type I muscle Wbres. Bar 100 m

1997) and exercise training (Pette and Staron 2001). Thus, the expression of SVCT2 throughout myogenesis suggest that this transporter might not only be an adaptive response to oxidative stress but also that SVCT2 is one of the genes that footprints the slow skeletal muscle Wbre phenotype.
Acknowledegments The authors are indebted to Sylvain Marcellini, Nelson Osses, Maria de los Angeles Garca, Hugo Olguin and members of our laboratory for useful discussion and comments on the manuscript. This work was supported by grants Anillo PBCT-CONICYT ACT-02 and ACI-12, DIUC-UdeC 204.031.098-1.0 and Fundacin Andes C-13960/28.

References
Barnard RJ, Edgerton VR, Furukawa T, Peter JB (1971) Histochemical, biochemical, and contractile properties of red, white, and intermediate Wbers. Am J Physiol 220:410414 Castro M, Caprile T, Astuya A, Millan C, Reinicke K, Vera JC, Vasquez O, Aguayo LG, Nualart F (2001) High-aYnity sodium vitamin C co-transporters (SVCT) expression in embryonic mouse neurons. J Neurochem 78:815823 Castro T, Low M, Salazar K, Montecinos H, Cifuentes M, Yanez AJ, Slebe JC, Figueroa CD, Reinicke K, s Garcia M, Henriquez JP, Nualart F (2008) DiVerential distribution of the sodiumvitamin

123

Histochem Cell Biol Lutsenko EA, Carcamo JM, Golde DW (2004) A human sodiumdependent vitamin C transporter 2 isoform acts as a dominantnegative inhibitor of ascorbic acid transport. Mol Cell Biol 24:31503156 Miller JB, Stockdale FE (1986) Developmental regulation of the multiple myogenic cell lineages of the avian embryo. J Cell Biol 103:21972208 Nualart FJ, Rivas CI, Montecinos VP, Godoy AS, Guaiquil VH, Golde DW, Vera JC (2003) Recycling of vitamin C by a bystander eVect. J Biol Chem 278:1012810133 Pansarasa O, Bertorelli L, Vecchiet J, Felzani G, Marzatico F (1999) Age-dependent changes of antioxidant activities and markers of free radical damage in human skeletal muscle. Free Radic Biol Med 27:617622 Peake JM (2003) Vitamin C: eVects of exercise and requirements with training. Int J Sport Nutr Exerc Metab 13:125151 Pette D, Staron RS (2001) Transitions of muscle Wber phenotypic proWles. Histochem Cell Biol 115:359372 Rafuse VF, Milner LD, Landmesser LT (1996) Selective innervation of fast and slow muscle regions during early chick neuromuscular development. J Neurosci 16:68646877 Rajan DP, Huang W, Dutta B, Devoe LD, Leibach FH, Ganapathy V, Prasad PD (1999) Human placental sodium-dependent vitamin C transporter (SVCT2): molecular cloning and transport function. Biochem Biophys Res Commun 262:762768 Rando TA, Disatnik MH, Yu Y, Franco A (1998) Muscle cells from mdx mice have an increased susceptibility to oxidative stress. Neuromuscul Disord 8:1421 Russell PJ, Williams A, Abbott A, DeRosales B, Vargas R (2006) Characteristics of rabbit muscle adenylate kinase inhibition by ascorbate. J Enzyme Inhib Med Chem 21:6167 Savini I, Catani MV, Arnone R, Rossi A, Frega G, Del Principe D, Avigliano L (2007a) Translational control of the ascorbic acid transporter SVCT2 in human platelets. Free Radic Biol Med 42:608616 Savini I, Catani MV, Duranti G, Ceci R, Sabatini S, Avigliano L (2005) Vitamin C homeostasis in skeletal muscle cells. Free Radic Biol Med 38:898907 Savini I, Rossi A, Catani MV, Ceci R, Avigliano L (2007b) Redox regulation of vitamin C transporter SVCT2 in C2C12 myotubes. Biochem Biophys Res Commun 361:385390 Savini I, Rossi A, Pierro C, Avigliano L, Catani MV (2008) SVCT1 and SVCT2: key proteins for vitamin C uptake. Amino Acids 34:347355 Thoma WJ, Henderson LM (1984) EVect of vitamin C deWciency on hydroxylation of trimethylaminobutyrate to carnitine in the guinea pig. Biochim Biophys Acta 797:136139 Toutain PL, Bechu D, Hidiroglou M (1997) Ascorbic acid disposition kinetics in the plasma and tissues of calves. Am J Physiol 273:R1585R1597 Tsukaguchi H, Tokui T, Mackenzie B, Berger UV, Chen XZ, Wang Y, Brubaker RF, Hediger MA (1999) A family of mammalian Na+dependent L-ascorbic acid transporters. Nature 399:7075 Urso ML, Clarkson PM (2003) Oxidative stress, exercise, and antioxidant supplementation. Toxicology 189:4154 Wang Y, Mackenzie B, Tsukaguchi H, Weremowicz S, Morton CC, Hediger MA (2000) Human vitamin C (L-ascorbic acid) transporter SVCT1. Biochem Biophys Res Commun 267:488494 Webster C, Silberstein L, Hays AP, Blau HM (1988) Fast muscle Wbers are preferentially aVected in Duchenne muscular dystrophy. Cell 52:503513 Wilson JX (1990) Regulation of ascorbic acid concentration in embryonic chick brain. Dev Biol 139:292298 Wu X, Itoh N, Taniguchi T, Hirano J, Nakanishi T, Tanaka K (2004) Stimulation of diVerentiation in sodium-dependent vitamin C transporter 2 overexpressing MC3T3E1 osteoblasts. Biochem Biophys Res Commun 317:11591164

123