Beruflich Dokumente
Kultur Dokumente
Please note that this is a specimen paper and you have been given eight specimen questions to work through. One the actual paper there will be four questions, one each for Ecology, Genetics, Cell and Organismal Biology and Molecular biology and biochemistry. The examination paper will be 3 hours in duration and you will be expected to answer two questions from the four offered. Each question will have a short summary at the beginning of the paper. Short outline of each question:
ECOLOGY 1
This problem concerns root growth in grasses. How it can be measured, how it differs between species and how it is affected by the presence and patchiness of nutrients and organisms in the soil.
ECOLOGY 2
This question requires you to analyse data from field surveys of butterflies in grassland and woodland sites. You examine whether different types of butterfly species differ in their abundance between habitats. You are asked to critically evaluate the methods used by the student in their surveys, and to suggest new field work.
GENETICS 1
This question is about genetic mapping in bacteria (which has been incredibly important in the development of molecular biology) using conjugation, in which the circular chromosome of the donor cell is broken at a fixed point and transferred as a linear piece of DNA to a recipient.
GENETICS 2
This problem asks if the difference between alleles of a mutant locus is significant and if so, what might be the molecular explanation. Mutational changes in the DNA sequences another mutant locus are shown and molecular explanations for their effect are required.
ECOLOGY 1
This problem concerns root growth in grasses. How it can be measured, how it differs between species and how it is affected by the presence and patchiness of nutrients and organisms in the soil. STUDY 1 An ecology student interested in how five different grass species produced roots in an organic nutrient patch (milled Lolium perenne shoot material) added to soil grew plants from seed in microcosm units (dimensions 150 mm x 400 mm x 3 mm see Figure). The organic material was added as a 20 mm band across the microcosm 200 mm below the soil surface. The remainder of the microcosm was filled with soil. Seeds were planted 5 mm below the soil surface (see Figure).
Microcosms were placed in a growth cabinet under constant conditions of light, humidity and water. After 42 days the student harvested the plants. Roots from the organic patch were separated from the rest and their root length measured after which these roots were dried at 70oC to obtain their dry weight (D.W.). Root length and dry weights of the remaining roots were then recorded. These values were added to those from the organic patch band to obtain the length and dry weight of the entire root system (Table 1). Table 1. Root length (m) and root D.W. (mg) for the five grass species in the organic patch band and for the total root system. Plant Species Root length in organic patch band (m) 3.569 2.528 1.707 3.451 3.125 Total root length (m) 12.0 15.3 12.1 12.7 15.0 Root D.W. in organic patch band (mg) 22.0 15.3 8.1 12.2 13.0 Total root D.W. (mg) 2030 1870 1030 1670 1720
Lolium perenne Festuca arundinacea Poa pratensis Dactylis glomerata Phleum pratense
The student wished to calculate the root length density (RLD) which is the length of roots per unit volume of soil (cm cm-3) and specific root length (SRL) which is the root length per unit root dry weight (cm mg-1). For each of the five plant species calculate: a) The root length density (RLD; cm cm-3) in the organic patch band. (3 marks) b) The specific root length (SRL; cm mg-1) in the organic patch band. (4 marks) Please show all your calculations. STUDY 2 Using the same microcosm units the student then investigated how Lolium perenne plants captured nitrogen (N) from a range of organic substrates of varying carbon:nitrogen (C:N) ratio (Note: only one organic substrate was added to each microcosm). After 55 days the L. perenne plants were removed from the microcosm and the total shoot dry weight (D.W.) root dry D.W., and the percentage nitrogen (N) of the dried shoot and root material recorded (Table 2). Table 2. Total shoot D.W., root D.W. and N content (expressed as a %) of the shoots and roots of the Lolium perenne plants grown in the presence of each of the organic substrates added as discrete patches to the Lolium perennes root system. Organic Substrate Added Shoot material Root material Urea Amino acid mixture Algal cell material C:N Ratio of substrate 21:1 52:1 0.4:1 3.2:1 3.1:1 Total Shoot D.W. (g) 1.4864 1.0614 3.8441 3.2354 3.7447 N in Shoots (%) 1.32 1.09 1.48 1.25 1.09 Total Root D.W. (g) 0.7758 0.6022 1.3321 1.2543 1.1979 N in Roots (%) 1.01 0.85 0.89 0.87 0.84
From the data in Table 2 c) Calculate the total plant N content (as mg N) for the Lolium perenne plants grown in the presence of each of the organic substrates. Please show all your calculations and tabulate your answers. (7 marks) d) Calculate the root weight ratio (RWR: root weight per unit total plant weight) for the plants grown with each of the organic substrates. (4 marks) As the organic substrates were labelled with the stable isotope of nitrogen (15N) it was possible to follow the fate of the N originally added in the organic substrates in the different plant-soil-microbe pools (see Table 3).
Table 3.Percentage (%) of organic substrate N detected in plants, microbes and soil at the end of the 55 days experimental period.
Organic Substrate added C:N Ratio of substrate N from the organic substrate in the L. perenne plants (%) Total substrate N lost from the system (%) N from the organic substrate in the microbial biomass (%) Residual substrate N remaining in soil (%)
Shoot material Root material Urea Amino acid mixture Algal cell material
11 8 55 54 36
12 8 40 37 44
15 16 5 9 10
62 68 0 0 10
e) The amount of N that the Lolium perenne plants captured from the organic patches varied widely. Using the information in Table 3 describe in words what factors controlled the amount of N that the plants captured from these organic substrates. (2 marks) STUDY 3 In a field study close inspection of experimental plots suggested that the presence of litter was associated with the presence of faecal pellets produced from microarthropods (small soil animals). To test this hypothesis, a grid of 10 x 50 contiguous area samples, each 25 cm2 was marked out. The presence or absence of litter and faecal pellets was recorded for each sample. Of the 500 samples examined, litter was present in 325, faecal pellets in 144 and both litter and faecal pellets were present in 112. f) (13 marks) Show by conducting a statistical analysis how you would test the hypothesis that there is an association between litter and faecal pellets. Please show all your calculations including significance level, degrees of freedom and state the nature of the association if there is one.
ECOLOGY 2
This question requires you to analyse data from field surveys of butterflies in grassland and woodland sites. You examine whether different types of butterfly species differ in their abundance between habitats. You are asked to critically evaluate the methods used by the student in their surveys, and to suggest new field work. An ecology PhD student is investigating changes in the abundance of butterflies in Britain. In the first year of the PhD studies, the student collates existing data on butterfly abundance from four sites in Yorkshire. These data were collected by other researchers using standardised methods. The survey method involves an observer walking along a transect at a steady pace counting all butterflies seen. Surveys are carried out only in sunny weather when the temperature is above 17oC. Transects vary in length but are always 5m wide (i.e. butterflies are recorded 2.5m either side of the observer). Transects were in two different habitats; sites 1 and 2 were in woodland, and sites 3 and 4 in grassland. Table 1 shows data collected from the two woodland sites in 2005. Table 1. The total numbers of butterflies seen along two transects in woodland sites in Yorkshire in 2005. The two transects were surveyed by a different person but on the same day (20th July). The length of each transect is shown. The eight species that develop through several generations per year are marked with an asterisk (all other species develop through a single generation per year). Species Species A* Species B* Species C Species D* Species E* Species F* Species G* Species H* Species I* Species J Species K Species L Species M Species N Site 1 5.6 km 7 3 12 49 47 39 2 1 3 1 14 2 46 6 Site 2 4.3 km 8 16 6 17 62 53 5 0 6 0 9 2 19 4
1) The student is interested in investigating differences in butterfly abundance among sites. A) They decide to calculate the density per hectare (ha) of each species of butterfly at each site. Table 2 below gives these density values for each species at the two grassland sites, as well as the mean density for this habitat. In a similar way, calculate
density per hectare (ha) of each species for the two woodland sites and mean density for the woodland habitat. You should tabulate your answers. (4 marks) What might the student conclude about the relative distributions and abundances of the butterfly species in the two habitats? (5 marks) Table 2. The density per hectare (ha) of each species of butterfly at two grassland sites, and the mean butterfly density in the grassland habitat. Species Site 3 density 22.44 27.32 .49 2.93 3.41 22.44 13.17 27.32 19.02 .98 .49 .00 1.46 10.24 Site 4 density 20.00 25.95 .00 1.08 4.86 32.97 24.86 28.11 34.59 1.62 1.08 .00 3.24 17.30 Mean density in grassland 21.22 26.64 .25 2.01 4.14 27.71 19.02 27.72 26.81 1.30 .79 .00 2.35 13.77
Species A Species B Species C Species D Species E Species F Species G Species H Species I Species J Species K Species L Species M Species N
2) The student then decides to investigate differences in the ecologies of the species. The student was aware that the species differ in the number of generations they develop through each year. In Table 1 above, species that develop through several generations per year (multivoltine species) are marked with an asterisk, all other species develop through a single generation per year (univoltine). The student calculated the mean density of each species across all sites and then carried out a statistical test to determine whether multivoltine species have higher mean densities than univoltine species. The SPSS output from this test is shown below.
Group Statistics Std. Error Mean 1.36130 1.65777
TOT
N 6 8
t-test for Equality of Means 95% Confidence Interval of the Difference Lower Upper -15.21353 -14.97114 -5.38048 -5.62287
Sig. .886
t -4.563 -4.800
df 12 11.990
What statistical test did the student carry out? Explain what did they found. (4 marks) Do you think the student did the appropriate statistical test? Explain your answer. (3 marks) 3) The student was concerned that all these analyses were based on data from a single transect at each site in July. A) How might this affect the findings? (5 marks) B) Describe a series of observations or a field experiment that you could carry out to test these ideas (5 marks) 4) The PhD student was particularly interested in changes in the abundance of one butterfly species and collected data from surveys at Site 1 over the past 15 years. The number of butterflies recorded on the transect each year is shown in Table 3. The number of larval host-plants at the site was recorded as the mean percentage cover of plants in 20 1m x 1m quadrats. Data for temperature and rainfall were obtained from a meteorological station nearby. Table 3. The Table shows changes at Site 1 in the total number of butterflies recorded on the transect and the abundance of their larval host-plants over time. year 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 Total number of butterflies recorded 0 0 1 0 0 1 3 5 7 11 18 27 42 45 55 49 %cover of larval hostplants 60.1 9.2 44.1 30.1 28.2 62.1 5.2 2.8 25.4 10.1 50.3 43.7 9.2 17.2 22.1 25.7
The student decides to analyse their data by using stepwise multiple regression analysis to investigate whether host-plant abundance was affected by summer rainfall or temperature in either the current year of study, or in the previous year. The SPSS output from this analysis is shown below. Data for host-plant abundance were arcsinetransformed prior to analysis.
Model Summary Adjusted R Square .865 Std. Error of the Estimate .07839
Model 1
Coefficientsa Unstandardized Coefficients B Std. Error -8.05E-02 .044 3.712E-02 .004 Standardized Coefficients Beta .935
Model 1
t -1.837 9.543
b Excluded Variables
Model 1
Beta In RAINFALL current TEMP current TEMP previous -.102 -.068 .068
a
a. Predictors in the Model: (Constant), RAINFALL PREVIOUS YEAR b. Dependent Variable: ARCSIN PLANT COVER
A) Are any of the factors significant in the analysis? If so, list the significant factors(s). (1 mark) B) What is the value of the slope of the significant relationship? (1 mark) C) Why were data for plant cover arcsine transformed prior to analysis? (1 mark) D) Explain the R square (R2) value. (1 mark) E) Discuss the findings of this statistical analysis, and whether this was the most appropriate way to analyse the data. (3 marks)
GENETICS 1
This question is about genetic mapping in bacteria (which has been incredibly important in the development of molecular biology) using conjugation, in which the circular chromosome of the donor cell is broken at a fixed point and transferred as a linear piece of DNA to a recipient. A. Interrupted mating is a technique that is used for long distance mapping of genes on the E. coli chromosome. A donor strain transfers its chromosome linearly from a fixed point on the circular genome into a recipient strain that usually contains multiple mutations. Samples are removed from the mating culture at various time points after mixing the two strains and transfer of the DNA is halted. This is called interruption of mating. The bacteria in the interrupted sample are plated out on various selective media that will kill the donor strain and that lack a single requirement of the recipient strain, so that one can determine if, at the time of interruption, the recipients have inherited a particular gene. For example if the donor was arg+ leu+ pro+ thr+ streptomycin sensitive and the recipient arg- leu- pro- thr- streptomycin resistant, one would plate out the interrupted mating mix on four selective media. The selective plate for arg+ recombinants would contain leucine, proline, threonine and streptomycin but no arginine. Note that for the gene to be inherited, not only does it have to be transferred to the recipient but it has to be recombined into the recipients chromosome. In an undergraduate class practical on interrupted mating, the donor was arg+ leu+ pro+ thr+ and the recipient arg- leu- pro- thr- . When the organiser ran through the procedure before the practical, he obtained some bizarre results, that he interpreted correctly to mean that none of the selective plates contained leucine. However there was no time to make the plates again, so he decided to go ahead with the experiment anyway. The times of entry he had expected if the plates had been correct, were pro+ at 10 minutes after mixing, leu+ at 18 minutes, thr+ at 20 minutes and arg+ at 30 minutes. 1) What times of entry for each gene would the class observe? (3 marks) If two genes enter more than 5 minutes apart they behave as though they are unlinked i.e. the recombination frequency (RF) between them is 50%. The RF between leu+ and thr+ is 30%. 2) Write down the percentage of a) leu+, b) thr+, c) arg+ colonies observed by the class at late times (e.g 60 minutes), taking as 100%, the number they should have observed if the plates had been correct. (2 marks) B. A bacterial geneticist investigating the rotary motor that drives the flagellae of E.coli, isolates a spontaneous non motile mutant in the donor strain used in part A, and attempts to map it using conjugation. This time the recipient strain is pro(10min) leu- (18min) thr- (20min) arg- (30min) ilv- (34)min aro- (48min). For this mapping she cannot use interrupted mating to give time of entry of non-motility because there is no easy way to select for it. So instead she uses recombination frequencies. She allows the donor and recipient strains to conjugate for two hours and then plates 0.1ml of serial tenfold dilutions of the mixture out on the six different
types of selective plate (which this time are correctly made up) and counts the colonies that appear on the plates. She then calculates the number/ml of each type of recombinant in the original mating mix. The numbers she obtains are: pro+ leu+ thr+ arg+ ilv+ aro+ 6.0*107/ml 3.0*107/ml 2.9*107/ml 1.2*107/ml 9.4*106/ml 3.2*106/ml
3) Given that when counting bacterial colonies on plates there should be at least 50 and no more than 500, what dilutions of the mating mix should she have spread for each of the different recombinant types. (3 marks) 4) If the logarithm of the numbers of recombinants obtained are plotted on the y axis versus time of entry on the x axis a straight line is obtained. Comment on the relationship between time of entry and numbers of recombinants obtained. (4 marks) She then mapped the mutation that confers non-motility by laboriously picking 100 of each type of recombinant, growing them up and checking for mobility with a microscope. She obtains the following data. Recombinants pro+ leu+ thr+ arg+ ilv+ aro+ Number non-motile (out of 100) 9 16 19 60 70 50
From these data she concludes that the mutation conferring non-motility is exactly halfway between ilv+ and arg+. 5) Explain why there are fewer arg+ recombinants that are non-motile than ilv+ recombinants that are non-motile if the mutation is exactly equidistant from each. (4 marks) Now that she has mapped the defective gene she looks for candidate genes of unknown function in that place on the published genome of E.coli. She finds a cluster of five Open Reading Frames that have been designated as probable genes, all oriented in the same direction. 6) What is an Open Reading Frame and what property/properties would indicate that one is likely to be a gene? (3 marks) Close examination of the sequence containing the five ORFs suggests that it contains only a single promoter at the appropriate end and therefore that the five genes make
up a single transcription unit or operon. The geneticist scans the sequence for restriction sites, chooses an enzyme that will not cleave within the sequence but does so at appropriate distances beyond the ends, and uses it to clone the fragment into a plasmid. Having assured herself by partial sequencing that she has the appropriate fragment she inserts it into the original non-motile strain and finds that the bacteria are now motile. 7) What does she conclude? (2 marks) To find out which gene(s) the mutation is located in she separately clones each gene present in the fragment into a suitable expression vector (i.e. one that allows high expression of a cloned gene on addition of a suitable inducer) and puts each of the new constructs into the original non-motile strain. After addition of inducer she finds that none of the individual genes confers motility on the strain. 8) What can she conclude about a) the function of the genes in the operon and b) about the effect of the mutation? (6 marks) 9) The mutant and wild-type operons are sequenced and the mutation turns out to be a single base insertion in the coding part of the first gene. Explain how such a mutation might cause the phenotype of the mutant. (6 marks)
GENETICS 2
This problem asks if the difference between alleles of a mutant locus is significant and if so, what might be the molecular explanation. Mutational changes in the DNA sequences another mutant locus are shown and molecular explanations for their effect are required. Question 1 In Drosophila, the recessive mutation hirsute (hir) causes scutellar bristle length to increase by approximately 200% There are 2 bristles per individual fly measured. n = number of bristles measured n 20 20 20 20 avg. bristle length (m) 89.29 178.35 118.5 123.25 standard deviation 22 41 31.5 24.6
hir1/+ and hir2/+ have been included as controls. However the hir1/+ and hir2/+ heterozygotes appear to have longer bristles than wild type (wt). Calculate the standard errors (1 mark) Estimate if the differences are likely to be significant between wild type and the hir heterozygotes (1 marks) and explain your reasoning (1 mark) What are two possible genetic explanations for this result? (4 marks) After molecular analysis, hir1and hir2alleles are found to be null alleles. Which genetic explanation does this information favour? Explain your reasoning. (4 marks)
Question 2 The sideparting (spar) gene has been cloned and a cDNA isolated (below). The cDNA encodes a short protein, the start ATG codon is in lower case and the stop TGA codon is in lower case. TATAAGCATCCGATCCAACCCGAACCGATCatgGCAACCACTCCACGCAGCGGCGGT AA GTTCGAGATCTGGGACACGGCTGGCCAGGAGCGGTACCACAGCTTAGCTCCCATGTA TT ATCGAGGAtgaGAAAATGAAGGAAAACGAAAACCACAAAAAAAAAAAGAAAACCAA
A fragment of the genomic region of the spar gene in the spar1 mutant was sequenced. The underlined G was mutated to an A. By comparing the cDNA with the genomic sequence suggest what the molecular genetic consequence of such a mutation would be? (10 marks) .
TATAAGCATCCGATCCAACCCGAACCGATCATGGCAACCACTCCACGCAGCGGCGGTAAGTT CGA GATCTGGGACACGGCTGGCCAGGAGCGGTAAGTATCGCTGGATAGATCACCCAACTGAAAGC TTC ATCTGACATACTTATATTCGCTTTTGTAGGTACCACAGCTTAGCTCCCATGTATTATCGAGG ATG AGAAAATGAAGGAAAACGAAAACCACAAAAAAAAAAAGAAAACCAA
In the spar2 mutant stock the genomic region of the spar gene was sequenced. Three nucleotides were found to be missing (underlined). By aligning the cDNA sequence with the genomic sequence, suggest what type of molecular genetic defect the three missing nucleotides would generate (12 marks).
TATAAGCATCCGATCCAACCCGAACCGATCATGGCAACCACTCCACGCAGCGGCGGTAAGTT CGA GATCTGGGACACGGCTGGCCAGGAGCGGTAAGTATCGCTGGATAGATCACCCAACTGAAAGC TTC ATCTGACATACTTATATTCGCTTTTGTAGGTACCACAGCTTAGCTCCCATGTATTATCGAGG ATG AGAAAATGAAGGAAAACGAAAACCACAAAAAAAAAAAGAAAACCAA
Figure 2
Please show all relevant working and calculations. Question 1: (2 marks) How many amino acids are in the conceptual eWnt protein? Question 2: (2 marks)
The 1225 bp fragment containing the eWnt ORF is sub-cloned into the BamHI site of the 3400 bp pTran vector. The ligation reaction to sub-clone the eWnt ORF fragment into pTran requires a 3:1 molar ratio of insert DNA to vector DNA. 100 ng of pTran vector DNA is used in the ligation reaction. Assuming that the average base content in both vector and insert is the same, calculate the mass of insert DNA (in ng) which will be added to the reaction in order to give the 3:1 molar ratio of insert to vector DNA?
Question 3: (1 marks) A clone containing the ORF fragment in the correct orientation is identified. In order to produce a suitable transcription template the circular pTran-eWnt plasmid DNA must be linearised to enable the production of a run off RNA transcript. Which restriction enzyme must be used to produce the linear template required for the sythesis of a run off transcript containing the whole of the eWnt ORF and the poly adenylation signal sequence? Question 4: ( 3 marks) The eWnt mRNA has been transcribed and purified. The purified product is contained in a final volume of 20 l. A 1/1000 dilution of the product has an OD 260 of 0.014. 40 g/ml RNA has an OD of 1. What is the total mass (in g) of the mRNA product? Question 5: (3 marks) A cell lysate based in vitro translation system is used to investigate the processing of the eWnt protein. The addition of synthetic eWnt mRNA to the cell lysate results in de novo translation of eWnt protein. This assay requires the use of 1 g of mRNA per reaction. What volume of your transcription product will you need to use for each translation reaction? Question 6: (5 marks) The sizes of translation products are analyzed by SDS-PAGE. As predicted the size of the primary translation product is about 40 Kd. Endoplasmic reticulum vesicles purified from canine pancreas when added to the in vitro translation reactions allow post-translational modification of secreted proteins. The addition of ER vesicles to the reactions leads to a shift in size of the product to 48 Kd. Why does this shift in size occur? Question 7: (5 marks) When the translation product produced in the presence of ER vesicles is subsequently treated with the enzyme N-glycosidase the size of the product shifts to 38 Kd. Why is the product now smaller than the predicted primary product size of 40 Kd? Question 8: (6 marks) A region upstream of the transcriptional start site of the eWnt gene has been isolated and cloned upstream of a minimal eukaryotic promoter designed to drive expression of the luciferase enzyme based reporter gene. This construct is termed eWnt luc. Figure 3A shows the profile of the relative levels of expression from the endogenous Xenopus eWnt gene at a number of time points post fertilization. Figure 3B shows the profile of the relative levels of reporter activity in Xenopus embryos carrying the eWnt-luc transgene. What do these data tell us about the eWnt-luc transgene and the upstream sequence that it contains?
Figure 3A
Figure 3B
Question 9: (6 marks) In subsequent experiments eWnt protein is overexpressed from injected mRNA in embryos carrying the eWnt-luc transgene and in embryos carrying modified eWnt-luc transgenes in which either bases 1 to 30 or bases 31 to 54 have been deleted from the upstream region (eWnt-delta30-luc and eWnt-delta54-luc respectively). The sequence of the complete upstream region of eWnt-luc is shown in Figure 4A. Figure 4B shows reporter activity in embryos carrying these transgenes in the absence or presence of overexpressed eWnt protein. Present an hypothesis to explain the observed effects on reporter activity. Figure 4A Upstream region of eWnt
Figure 4B
Reporter expression
Relative expression
600 500 400 300 200 100 0 eWnt-luc eWntluc+eWnt protein eWnt-delta 30-luc eWnt-delta 30-luc+eWnt protein eWnt-delta 54-luc eWnt-delta 54-luc+eWnt protein
1. Mammals that dive under water at 10C use oxygen during submergence at the rates shown in Table 1. a. Draw graphs to show the relationship in Table 1 between the size of a mammal, its oxygen consumption and heart rate. (9 marks)
Summarise in words the differences in oxygen consumption between acquatic and terrestrial animals, and the effects of diving on oxygen consumption. (9 marks) 2. Suggest why the rates of heart beat, where known, are so low when diving compared with values at the surface and any other aspect of physiological adaptation associated with this. (5 marks) 3. Human divers commonly breathe compressed ordinary air (21% O2, 78% N2 and 1% Argon) when diving in shallow water. The hydrostatic pressure in water increases steadily by 1 atmosphere for each 10 metres below the surface a. How does the partial pressure of oxygen increase with depth? (2 marks) b. What would you expect the partial pressure of oxygen to be in the human body at 70 metres depth (show calculations)? (6 marks)
c. Oxygen is quickly toxic at a partial pressure of about 2 atm. At what depth would this be reached? (2 mark)
Table 1 Plasmid No. of colonies before growth in non-selective media media WT Mut1 Mut2 1189 467 904 media-ura 1322 504 655 No. of colonies after 4 generations without selection media 2055 1521 1505 media-ura 2263 489 441
1. Calculate the stability of each plasmid under non-selective conditions using the formula (6 marks): % cells that lose plasmid per generation X = (1 e ) 100 A ln( ) B Where: r N and A=% cells containing plasmid after N generations without selection, B=% cells containing plasmid before non-selective growth
r
2. Identify which of the three plasmids is most stable and which is most unstable (5 marks).
The plasmids used to generate the plasmid stability data were digested with HindIII, SmaI and EcoRI. The resulting DNA fragments were separated on an agarose gel, stained with ethidium bromide and visualised under UV light. The results are shown in Figure 2. 3. Construct a plasmid map for the Mut1 plasmid (10 marks). 4. Suggest a hypothesis for why the Mut1 and Mut2 plasmids are unstable (6 marks). 5. In the case of Mut1 how could you test your hypothesis (6 marks)?
0 Xba I 6120
Amp
ARS
Bam HI 4351 CEN Sma I 2220
Eco RI 2690
Figure 1. Map of plasmids used to investigate the function of gene X in yeast. Three plasmids were generated and tested. The plasmids possessed either the WT Gene X or one of two mutations believed to result in loss of function.
INDUCTION
0.2 0.28
0.4 0.56
Table 1. Cell density at 600 nm (A600) for growth at 37 C and 25 C. Note that cells were grown at 37 C for 3 hours before the cultures were divided for growth at the two temperatures.
Question 1 (12 marks 4 for each part) Using an appropriate form of graphical plot evaluate: (i) the lag time before the onset of logarithmic growth at 37 C (ii) the doubling time for the cell cultures at 37 C and 25 C (iii) stating any assumptions, estimate the value of A600 for the 25 C sample taken at 3 hours after induction of protein expression. Cells were harvested from 100 ml samples of the cell cultures grown for 3 hours at 37 C and 5 hours at 25 C (under the same conditions as Table 1, Part 2), lysed by sonication, and centrifuged to yield a supernatant fraction (S) and pellet fraction (P) for each growth temperature. A sample of total cell extract (T) was also taken before centrifugation. Small samples (from equivalent cell densities) were taken for protein analysis by denaturing polyacrylamide gel electrophoresis (SDS-PAGE). All three samples (T, P and S) from each growth temperature were denatured by boiling in SDS. The resulting gels were stained for total protein with Coomassie blue, and the results are shown diagrammatically in Figure 2. T S P T S P
(37 C)
(25 C)
(A)
(B)
Figure 1. SDS-PAGE gels of the total cell protein(T), and the soluble (S) and pellet (P) fractions of expressed protein from (A) the 37 C cell growth and (B) the 25 C cell growth cultures. The protein MW ladder is shown on the left of each gel.
Question 2 What conclusions do you draw from the SDS-PAGE results about the form of the expressed protein at the two temperatures? (5 marks) Samples of soluble protein fractions from 100 ml of the 37 C and 25 C cell cultures were dialysed for purification on a Ni-nitriloacetate (Ni-NTA) column, which binds His-tagged proteins. The his-tagged protein proteins were eluted by imidazole gradients (in separate experiments) as pure protein, as demonstrated by SDS-PAGE. The total amount of pure protein from the 37 C cells was 3.0 mg, and from the 25 C cells it was 25.2 mg. Question 3 From the total protein yield from the Ni-NTA column, calculate the concentration of soluble protein per ml of cell culture in the 37 C and 25 C cultures. (10 marks) Question 4 Outline how would you quantitatively assess the proportion of protein that was produced in soluble form at the two temperatures? (6 marks)