Biology 200, Fall 2011 Final Exam

*****KEY*****

*** Graded final exams can be picked up in Hck 318 (Biology Program Office) with a UW ID and will be available through January 2012. *** 1. a. (4) Class of biological macromolecule that contains nitrogen. b.(4) Protein that has a transmembrane domain c. (4) Molecule that can pass through a lipid bilayer unaided. d. (4) Cellular process that requires a gradient across a membrane. protein, nucleic acid (carbohydrates, lipids) any protein that resides in a membrane O2, CO2, H2O, etc... oxidative phosphorylation, fast block to polyspermy, acrosome reaction

2. a. (3) Diane: IAIA Jack: IAIB Jed: IAi b. (4) Where could the mutation have arisen to result in Jeds genotype? (Circle ALL that apply) ii. A spermatogonium cell in Jack iv. A haploid cell in Diane c. (4) Where can you find the functional protein coded for by the ABO gene? (Circle ALL that apply) - red blood cells - Golgi apparatus

d. (2) What ABO blood types can donate blood to Jed? A, O e. (2) What kind of mutation most likely caused Jeds genotype? (Circle the BEST answer) - Deletion f. (2) 50% (1/2)

Biology 200, Fall 2011 Final Exam

*****KEY*****

3. Hemophilia, the disease in which blood does not clot (resulting in too much bleeding), is caused by a mutant allele of the "clotting factor 8" (CF8) gene on the X-chromosome. a. (3) Which of the following statements is LEAST likely to be true? (Circle ONE) iii. The CF8 gene only exists in blood cells. b. (3)

ii. Because this gene has introns

c. (3) The mutant protein is caused by an error in splicing in which exon 3 is spliced out along with its flanking introns. d. (4) XhY XH Xh

XhY

XH Xh

e. (3) A girl with genotype XH Xh could have hemophilia if by chance the X chromosome with the H allele is inactivated in most or all cells at the 16-32 cell stage of development.

Biology 200, Fall 2011 Final Exam

*****KEY*****

4. Imagine that you are a plant breeder, producing an ornamental plant, Biologia, for sale to commercial nurseries. Biologia is naturally tetraploid (it has 4 copies of every chromosome) and is a hermaphrodite (it can self-fertilize). Wild-type plants have purple flowers. One day you discover a mutant with white flowers. When you analyze the chromosomes you find that one of the alleles of a single gene has a 21-bp deletion. (See diagram above) a. (2) dominant b. (2) Aaaa c. (2) Aa, aa d. (1) aaaa e. (2) No f. (2) AAaa

deletion

g. (3) ii. An enzyme which breaks down anthocyanin is mutated so that it cannot be allosterically inhibited. 21 bp that are deleted in white plants 5GAATCTCGATATTCCGATATCGGATATAGCGCTATTAGCGTGCAGATCGATACGATAGATCTTAA3 3CTTAGAGCTATAAGGCTATAGCCTATATCGCGATAATCGCACGTCTAGCTATGCTATCTAGAATT5 h. (4) 5' GAATC and 5'TTAAG3' You run PCR with these primers on the DNA from three different plants (labeled 1-3), and your friend Jerry runs PCR on plant #1. All of the PCR products were separated by gel electrophoresis and visualized. The results are shown in the gel on the bottom of the page. g. (3) 1. Aa?? h. (2) 3 i. (4) i. He chose primers that were complementary to more than one location in the DNA iv. He contaminated his DNA with other species plant DNA 2. aaaa 3. AAAA

Biology 200, Fall 2011 Final Exam

*****KEY*****

5. You discover the chick embryo shown on the right when doing the development lab. a. (2) Which layer developed differently compared to normal embryos? (Circle ONE) -mesoderm b. (2) When did the difference in development occur? (Circle ONE) iv. after body folding c. (4) No, differentiation could occur because we see the hearts beating meaning that muscle cells have differentiated. d. (4) You identify a protein in the mutant embryo that has the following extra amino acids inserted:

2 beating hearts

N-Trp-Met-Trp-Cys-C

5' UUGAUGUUGUGU3' OR 5' UUGAUGUUGUGC3' e. (4) If the embryo above were to keep developing and hatch as a chick, what part of the chick would most likely look different from normal? (Circle ALL that apply) (i. The dorsal side of the body) OK ii. The ventral side of the body

Biology 200, Fall 2011 Final Exam

*****KEY*****

6. Green Fluorescent Protein (GFP) fluoresces green under certain light wavelengths. In the lab, researchers often "fuse" the gene for GFP to a gene coding for a protein of interest. Then the scientist can see where in a cell their protein resides based on the green color. Remember, the protein only fluoresces if it is fully synthesized. a. In the table below, write the letter of the location in which green color will be detected initially (during protein synthesis) and after localization (final destination). Each box will have ONE answer and some answers may be used more than once. Protein Attached to GFP Resact (example) i.(2) Histone ii.(2) Rhesus Factor iii. (2) -galactosidase iv. (2) Heavy chain of Antibody Starting location of green fluorescence B A B A B Final destination of green fluorescence G F E A E or G

Location: A. Cytoplasm B. Rough ER C. Smooth ER D. Mitochondria E. Plasma Membrane F. Nucleus G. Outside of cell

b. (2) Imagine you created a person with the antibody light chain gene fused to GFP in their genome. Name a type of cell that would glow green. B-cell c. (2) Imagine a virus entered the person in 6b. Would the total amount of green in their body increase or decrease during the immune response? increase d. (2) After a macrophage eats a pathogen coated with antibody in the person in 6b, which of the following are bonds in GFP that get broken down? (Circle ALL that apply) - hydrogen bonds - peptide bonds

e. (4) Imagine a different person who has no immunity and must live in a sterile (germ-free) environment. Choose the mutation below that will cause this severe phenotype and explain how it does so in 1-2 sentences. i. Mutation in both heavy chain alleles that deletes one of the 51 V segments ii. Deletion in both heavy chain alleles that eliminates most of the intracellular domain A deletion of the intracellular domain makes the B-cell receptor unable to generate a response to the binding of an antigen (signal) to the extracellular variable region. Therefore cell signaling doesn't occur and no immune response occurs to any pathogen.