Sie sind auf Seite 1von 17

Introduction to Molecular Biology and Genomics

BMI/CS 776 www.biostat.wisc.edu/~craven/776.html Mark Craven craven@biostat.wisc.edu January 2002

image from the DOE Human Genome Program http://www.ornl.gov/hgmis

DNA
can be thought of as the blueprint for an organism composed of small molecules called nucleotides four different nucleotides distinguished by the four bases: adenine (A), cytosine (C), guanine (G) and thymine (T) a polymer: large molecule consisting of similar units (nucleotides in this case)

DNA
a single strand of DNA can be thought of as a string composed of the four letters: A, C, G, T ctgctggaccgggtgctaggaccctgactgcc cggggccgggggtgcggggcccgctgag

The Double Helix


DNA molecules usually consist of two strands arranged in the famous double helix

Watson-Crick Base Pairs


in double-strand DNA
A always bonds to T C always bonds to G

The Double Helix


each strand of DNA has a direction at one end, the terminal carbon atom in the backbone is the 5 carbon atom of the terminal sugar at the other end, the terminal carbon atom is the 3 carbon atom of the terminal sugar therefore we can talk about the 5 and the 3 ends of a DNA strand in a double helix, the strands are antiparallel (arrows drawn from the 5 end to the 3 end go in opposite directions)

image from the DOE Human Genome Program http://www.ornl.gov/hgmis

Chromosomes
DNA is packaged into individual chromosomes (along with proteins) prokaryotes (single-celled organisms lacking nuclei) have a single circular chromosome eukaryotes (organisms with nuclei) have a species-specific number of linear chromosomes

Human Chromosomes

Genomes
the term genome refers to the complete complement of DNA for a given species the human genome consists of 46 chromosomes. every cell (except sex cells and mature red blood cells) contains the complete genome of an organism

Proteins
proteins are molecules composed of one or more polypeptides a polypeptide is a polymer composed of amino acids cells build their proteins from 20 different amino acids a polypeptide can be thought of as a string composed from a 20-character alphabet

Protein Functions
structural support storage of amino acids transport of other substances coordination of an organisms activities response of cell to chemical stimuli movement protection against disease selective acceleration of chemical reactions

Amino Acids
Alanine Arginine Aspartic Acid Asparagine Cysteine Glutamic Acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Ala Arg Asp Asn Cys Glu Gln Gly His Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val A R D N C E Q G H I L K M F P S T W Y V

Amino Acid Sequence of Hexokinase


1 31 61 91 121 151 181 211 241 271 301 331 361 391 421 451 A T G S X T X S V A X L I G K X A T S R E X X G C X H R A S P X S R F S F Q V V C K X X A X I S 5 X X L L S A A N X T X X Y R X A D D A A S X D A Q F X X A D I X X D I A X A I A D E A D F Y T X S X V S A F X Y S K X L R S P A L D M M G S D W F N D F L G A 10 V S G X S L S C R S F X V F I E A G T V A H D K X X G V S D V A G T P X G S A A A D C X G H A D A L L I T F K A Q X N E X S L I G X L X P N N G I S G 15 X I E P F K X I S X V I X A A V P V S T L X A L G E A A T A F M I D F I V D P Q N X I X X I V L L X S N A Q S S K C N X V P I W E A Y A I L S T Q X V 20 P G X G A M T D X R Y X K N I P W L N G X D A Y D P M K I X X V A X A N A G X V A K G Y S I L G A K A X X X L K X Y G I L K Y X E X I X T M I V S W A 25 Q Q Q S X F K G L X Q V S P S A V E N V P M G N Y K R G Q S V X S A I A G A X K L R H S Q V G S A K G I G X X P X I A X S S I F G D I X S X H L A X X 30 I Q X S Q X F M P G F F A X X A A A S I X G X X Q D L X S A

Hexokinase

Hemoglobin

protein built from 4 polypeptides responsible for carrying oxygen in red blood cells

Genes
genes are the basic units of heredity a gene is a sequence of bases that carries the information required for constructing a particular protein (polypeptide really) a gene is said to encode a protein the human genome comprises ~ 40,000 genes there is some controversy about this number

Gene Density
not all of the DNA in a genome encodes protein:

microbes human

90% coding 3% coding

gene/kb gene/35kb

The Central Dogma

10

RNA
RNA is like DNA except: backbone is a little different usually single stranded the base uracil (U) is used in place of thymine (T) a strand of RNA can be thought of as a string composed of the four letters: A, C, G, U

Transcription

11

Transcription
RNA polymerase is the enzyme that builds an RNA strand from a gene RNA that is transcribed from a gene is called messenger RNA (mRNA) well talk about other varieties of RNA later in the course

The Genetic Code

12

image from the DOE Human Genome Program http://www.ornl.gov/hgmis

Translation
ribosomes are the machines that synthesize proteins from mRNA the grouping of codons is called the reading frame translation begins with the start codon translation ends with the stop codon

13

Codons and Reading Frames

Translation

14

RNA Processing in Eukaryotes


eukaryotes are organisms that have enclosed nuclei in their cells in eukaryotes, mRNA consists of alternating exon/intron segments exons are the coding parts introns are spliced out before translation

RNA Splicing

15

Protein Synthesis in Eukaryotes vs. Prokaryotes

image from the DOE Human Genome Program http://www.ornl.gov/hgmis

16

Summary

17

Das könnte Ihnen auch gefallen