Sie sind auf Seite 1von 40

Multiplex PCR for rapid detection of Streptococcus suis serotype 2 and serotype 14 in hemoculture

By Phatcharaporn Lingloey 521110056 Advisor: Dr. Usanee Anukool Co-advisor: Assoc. Prof. Prasit Tharavichitkul

Streptococcus suis

Family: Streptococcaceae
Gram-positive cocci Pairs or chains Capsule Alpha-hemolytic streptococci Facultative anaerobic bacteria

Zoonotic bacteria

http://www.merckvetmanual.com/mvm/htm/bc/genps01.htm

Natural habitat : upper respiratory tract, tonsils, nasal cavities, genital and alimentary tracts of pigs

Streptococcus suis
Distinct capsular antigens 35 serotypes Serotype 2 is the most pathogenic for both humans and pigs (Gottschalk et al., 2007)

Pathogenesis : meningitis, septicemia, pneumonia and complication with hearing loss Cause of infections in humans : exposure to contaminated pig or pork

http://www.fao.org/docrep/003/t0756e/T 0756E05.htm

Diagnosis of S. suis infection in human


Culture method :The Blood, CSF diagnosis of S. suis conventional
Biochemical tests and serotyping is problematic
Negative culture Positive cultures Undiagnosed Misidentified

Molecular method
PCR Multiplex PCR Real-time PCR

rapid, accurate, highly specific & sensitive

Figure 1. World map of human Streptococcus suis cases with background pig density data. Published with permission from the Infectious Diseases Research Foundation (Heiman F et al., 2009)

Streptococcus suis infection in humans, Thailand: Distribution and Pathogenesis

Figure 2. Emergency Infection Disease (Kerdsin A et al., 2011)

Background
During the past decade, the number of reported human cases has increased, particularly in South-East Asia, with more than 700 S. suis infections (Wertheim et al., 2009)
Outbreak of human and pig infection in the Sichuan province in China in 2005

To date, the number of S. suis infections in humans reported in previous studies from Thailand exceeds 300 cases (Wertheim et al., 2009)

Background
Kerdsin et al., 2009 : Thailand
177 S. suis clinical isolated (During 2006-2008) 12 isolates (6.8%) : S. suis serotype 14

Takeuchi et al., 2012 : Phayao Province in Northern Thailand


S. suis serotype 2 (74.2%) S. suis serotype 14(25.8%) Fatality rate : 16.1%

Aims
To develop multiplex PCR (mPCR) technique for simultaneous detection of S. suis serotype 2 and serotype 14 To evaluate mPCR technique for detection of S. suis serotype 2 and serotype 14 DNA extracted from hemoculture

Materials and methods


Table 1. Bacteria used in this study
No. 1 2 3 4 5 Species
Streptococcus suis serotype 2 P1/7 Viridans Streptococcus Group B Streptococcus S. pneumoniae S. aureus

No. 10 11 12 13 14

Species
Streptococcus suis serotype 14 MNCH 57 MRSA ATCC 43300 S. epidermidis S. pyogenese N. meningitidis

6 7
8 9

K. pneumoniae
P. aeruginosa H. influenzae S. bovis

15 16
17 18

E. coli
S. typhi A. baumanii E. faecalis

DNA samples : 30 samples, collected and extracted in year 2009 and


storage at -20 oC (Assoc. Prof. Prasit Tharavichitkul)

10

Experimental design
Biochemical identification of S. suis DNA extraction mPCR optimization Sensitivity and specificity assays
Evaluation of mPCR

11

Identification of Streptococcus suis


Conventional techniques
Alpha-Streptococci isolated

6.5% NaCl (), [or PYR( )], VP (), Optochin (R)

Esculin and Trehalose Viridans streptococci +

S. suis
Arabinose () Lactose (+) Inulin (+)

12

DNA extraction
Bacterial cultured on BA
* BA = Blood agar

3-4 colonies were suspended in 0.1 g/ml lysozyme 25 l


Incubate 37C 10 min.

Add Proteinase K 0.1 g/ml 25 l and 0.1 M Tris-HCl 75 l


Incubate 37C 10 min. Incubate 95C 10 min.

DNA
(Kumari et al., 1997)

13

Table 2. Primer used in this study


No. 1 Sequence (5-3) TAAATACCTCAAGTGAGAA CAGTATTTACCGCATGGTAGATAT (Marois.et al., 2004) GGCGGTCTAGCAGATGCTCG GCGAATGTTAGCAAGAC (Smith.et al., 1999) CAAACGCAAGGAATTACGGTATC GAGTATCTAAAGAATGCCTATTG (Smith.et al., 1999) Target gene PCR product size (bp) 294

16S rRNA

cps1I

440

cps2J

675

14

1 Kb

B
Figure 3.Genetic organization of the cps2 gene (A), cps1 gene (B) cluster (Hilde E. Smith.et al., 1999 )

15

Optimization of mPCR
Annealing temperature
T = 54oC, 56oC, 58oC, 60oC and 62oC

Primers concentration
cps1I gene = 1.0, 1.2 M cps2J gene = 0.8, 1.0 M 16S rRNA gene = 0.3, 0.5 M

dNTP concentration
0.2, 0.3, 0.4 mM

MgCl2 concentration
1.5, 2.5, 3.0 mM

16

Multiplex PCR reaction


Reagent Steriled distill water 10X Buffer 1.25mM dNTPs Volume (l) 3.35 2.5 8.0 Final concentration 1X 0.4

50mM MgCl2 16M Forward primer 16S rRNA


16M Reverse primer 16S rRNA 16M Forward primer cps1J 16M Reverse primer cps1J 16M Forward primer cps2J 16M Reverse primer cps2J 5U Taq Polymerase DNA template Total

1.25 0.5
0.5 1.8 1.8 1.5 1.5 0.3 1 25

2.5 0.3
0.3 1.2 1.2 1.0 1.0 1.5 -

17

PCR amplification
Table 3. PCR program for detection 16S rRNA, cps1J and cps2J genes
Process Pre-Denaturation Temperature ( o C) 94 Time 7 min.

Denaturation
Annealing Extension

94
58 72

30 sec.
30 sec. 1 min.
30 cycles

Final extension

72

5 min.

** MJ research PTC-200 Peltier Thermal Cycler

18

Specificity and sensitivity

23

Specificity assay
M 1 2
700 bp 500 bp 300 bp 100 bp
Figure 9. Specificity of multiplex PCR for detecting S. suis serotype 2 and serotype 14
Lane 1 : Group B Streptococcus Lane 2 : S. typhi Lane 3 : S. enteritidis Lane 4 : S. aureus Lane 5 : MRSA Lane 6 : S. bovis Lane 7 : E.coli Lane 8 : H. influenzae Lane 9 : N. meningitidis Lane 10 : K. pneumoniae Lane 11 : S. epidermidis Lane N : Negative control C1 : Control of S. suis serotype 2 C2 : Control of S. suis serotype 14 C : Control

3 4

5 6 7

8 9 10 11 C 1 C 2 C N M

24

Specificity assay (cont.)


M 12
700 bp 500 bp 300 bp 100 bp

13 14 15

16 17 N

C1 C2

M
700 bp 500 bp 300 bp 100 bp

Specificity = 100 %

Figure 10. Specificity of multiplex PCR for detecting S. suis serotype 2 and serotype 14
Lane 12 : S. viridans Lane 13 : S. pneumoniae Lane 14 : A. baumanii Lane 15 : E. faecalis Lane 16 : P. aeruginosa Lane 17 : Gr. A Streptococcus Lane N : Negative control C1 : Control of S. suis serotype 2 C2 : Control of S. suis serotype 14 C : Control

25

Sensitivity assay
M
100 ng 10 ng 1 ng 10 -1 ng 10 -2 ng 10 -3 ng 10 -4 ng 10 -5 ng 10 -6 ng

700 bp 500 bp 300 bp


100 bp
Figure 11. Sensitivity of multiplex PCR for detecting S. suis serotype 2

Sensitivity of S. suis serotype 2 = 10 ng

26

Sensitivity assay (cont.)


M
100 ng 10 ng 5 ng

700 bp 500 bp 300 bp 100 bp


Figure 12. Sensitivity of multiplex PCR for detecting S. suis serotype 14

Sensitivity of S. suis serotype 14 = 10 ng

27

mPCR detection
M
700 bp 500 bp 300 bp
100 bp
Figure 13. Multiplex PCR for detecting S. suis serotype 2 and serotype 14 DNA extracted from hemoculture
Lane 1 : H9/52 MNCH Lane 2 : H7/52 MNCH Lane 4 : H3/52 MNCH Lane 5 : H5/52 MNCH Lane 7 : H14/ 52 MNCH Lane N : Negative control C1 : Control of S. suis serotype 2 C2 : Control of S. suis serotype 14 C : Control Lane 3 : H148 Lane 6 : H11/52 MNCH

C1 C2 C3 N

28

mPCR detection
M 8
700 bp 500 bp 300 bp
100 bp
Figure 14. Multiplex PCR for detecting S. suis serotype 2 and serotype 14 DNA extracted from hemoculture
Lane 8 : H17/52 LPH Lane 9 : H21/52 MNCH Lane 10 : H40/52 LPH Lane 11: H49/52 LPH Lane 12 : H51/52 LPH Lane 13 : H46/52 MNCH Lane N : Negative control C1 : Control of S. suis serotype 2 C2 : Control of S. suis serotype 14 C : Control

10 11 12

13 C1 C2 C3

29

mPCR detection
M
700 bp 500 bp 300 bp 100 bp
Figure 15. Multiplex PCR for detecting S. suis serotype 2 and serotype 14 DNA extracted from hemoculture
Lane 14 : H15/52 MNCH Lane 15 : H16/52 MNCH Lane 16 : H45/52 MNCH Lane 17 : H17/52 LPH Lane 18 : H32/52 LPH Lane 19 : H152/53 DSK Lane 20 : H18/52 MNCH Lane 21 : H14/E2 MNCH Lane 22 : H147/52 E2DSK Lane 23 : H148 E2 Lane N : Negative control C1 : Control of S. suis serotype 2 C2 : Control of S. suis serotype 14 C : Control

14 15 16 17 18 19 20 21 22 23 C1 C2 C3 N

30

mPCR detection
M 24 25 26 27 28 29 30 C1 C2 C3 N M
700 bp 500 bp 300 bp 100 bp
Figure 16. Multiplex PCR for detecting S. suis serotype 2 and serotype 14 DNA extracted from hemoculture Lane 24 : H151/53 DSK Lane 25 : 172 MNCH Lane 26 : H3/52 Lane 27 : H155 E2 Lane 28 were : H24/52 29 : H2/52MNCH There are 2/30 samples detected Lane by mPCR Lane 30 : H110 LPH 2 were Lane : Negative control 2 samples S. N suis serotype 2 C1 : Control of S. suis serotype 2 C2 : Control of S. suis serotype 14 1 sample (No.18): uncorrelated result C : Control

31

Discussion
The cps2J gene is present in serotype 2 and serotype 1/2 S. suis serotype 2 is the cause of > 95% of reported
human S. suis infection (Wertheim et al., 2009) S. suis serotype 1/2 infection has never been reported in humans

The cps1I gene is present in serotype 1 and serotype 14


S. suis serotype 1 and serotype 14 infection has been
reported in humans and pigs (Kerdsin et al., 2009)

32

Discussion
The mPCR developed can be used to detect S. suis serotype 2 and serotype 14 simultaneously with 100% specificity (17 species)
S. suis closely relate species Meningitis causing agent

There are primers that specific to 16S rRNA of S. suis

This mPCR method can be used for detect to other serotypes of S. suis

33

Discussion
Sensitivity of mPCR was 10 ng of bacterial chromosomal DNA at 25 l/PCR reaction
Equivalent to 4.6 x 106 CFU of S. suis serotype 2 P1/7

S. suis serotype 2 was detected by mPCR


(Pannee sangwong, 2009)

sensitivity was 20 ng

34

Discussion
mPCR positive 2 samples There are one uncorrelated result
mPCR positive culture negative
highly sensitivity culture negative 50 % (Nguyen et al., 2007)
antibiotics

35

Conclusion
The mPCR technique for simultaneous detection of S. suis serotype 2 and serotype 14 has been developed

Early detection and identification is necessary to apply effective antimicrobial agents and to successfully treat S. suis infection.

36

Acknowledgement
Dr.Usanee Anukool Assoc. Prof. Prasit Tharavichitkul Miss Monlica Rattanamuang Aj. Sudjai Pawichai Aj. Ratchadaporn Udpuan Aj. Santhana Buamongkol All staff of CMB

37

Thank You for your attention

38

DNA Concentration
Bacteria S. suis serotype 2 S. suis serotype 14 Group B Streptococcus S. enteritidis S. pneumoniae S. bovis S. aureus Con.(ng/l) 110 105 105 120 115 130 125 A260 0.022 0.021 0.021 0.024 0.023 0.026 0.025 A280 0.023 0.022 0.022 0.023 0.017 0.022 0.025 A260/280 0.956 0.954 0.955 1.043 1.350 1.18 1.00

E. faecalis A. baumanii

150 130

0.030 0.026

0.020 0.022

1.50 1.18

39

DNA Concentration (cont.)


Bacteria K. pneumoniae P. mirabilis P. aeruginosa H. influenza Con.(ng/l) 115 100 120 100 A260 0.023 0.020 0.024 0.020 A280 0.023 0.022 0.018 0.017 A260/280 1.00 0.909 1.33 1.176

E. coli
N. meningitis MRSA

140
120 180

0.028
0.024 0.036

0.025
0.022 0.036

1.12
1.09 1.00

S. typhi

100

0.020

0.017

1.180

40

Materials and methods


Sample for detection : DNA
No. 1 2 3 4 5 Code H9/52 H7/52 H148 H3/52 H5/52 No. 7 8 9 10 11 Code H14/52 H17/52 H21/52 H40/52 H49/52

H11/52

12

H51/52

41

Materials and methods


No. 13 14 15 16 17 18 Code H16/52 MNCH H15/52 H16/52 H45/52 H17/52 H32/LPH No. 22 23 24 25 26 27 Code H147 E2 DSK H148 E2 H151/53 DSK E2 H172 MNCH H3/52 H155 E2

19 20 21

H152/53 DSK E2 H18/52 MNCH H14/E2 MNCH

28 29 30

H24/52 H2/52 MNCH H110 LPH2

42

No.
1 2 3 4 5 6 7

Code
H2346-2347 H2600-2601 H2608-2609 H1094-95 H1190-91 H2494-95 H14

No.
11 12 13 14 15 16 17

Code
H1560-1561 H1979-1984 H2171-72 H2495 H2570-71 H2732 H1536

No.
21 22 23 24 25 26 27

Code
H2870 H2886 H2873-74 H1979-80 H2151-52 H2319-2320 H2861-62

8
9 10

H285-286
H913 H449-450

18
19 20

H1907-1908
H1990-1991 H2127-28

28
29 30

H482
H684-685 H689-690

43

http://www.uri.edu/research/gsc/resources/cndna.html
44