Sie sind auf Seite 1von 114

HERRAMIENTAS DE LA BIOLOGA MOLECULAR

GENMICA

GENMICA

Gen
La genmica fue propuesta por Thomas Roderick en 1986 para describir la disciplina cuyo objeto es: Genoma El mapeo El anlisis La secuenciacin De las funciones del genoma completo. Genmica comparativa

RAMAS DE LA GENMICA

Genmica estructural Genmica funcional

Genmica Comparativa
Analizar y comparar el material gentico desde el punto de vista global (genoma) de diferentes especies incluyendo sus interacciones con factores ambientales.

Objetivos: - Estudiar la evolucin y funcin de los genes. Extender las similitudes e individualidades que existen entre diferentes especies.

Aportes: Mayor entendimiento de: - Diversidad microbiana. - Regulacin gnica. - Elementos genmicos mviles (tramposones) y transferencia horizontal de genes. - Prediccin de enfermedades.

Genmica Estructural
Se ocupa del anlisis, construccin de mapas, identificacin y anotacin de los genes. As mismo genera y analiza la secuencia de genes.

Mapa Gentico
Mapa Gentico poblacional

Es un proceso que elaborar representaciones Mapa Citogentico esquemticas del ADN mostrando las posiciones relativas de genes y/o marcadores en los cromosomas. Mapa Fsico

Amerindios 0.01 % del genoma

Mapa Gentico cromosmico

Regiones genmica idnticas y especificas de todos los seres humanos 99.99 % del genoma

ATCAGTAGCATGCATGCATGCATGC

Mapas Citogenticos
Se conoce como mapa citogentico o cariograma a la apariencia visual de un cromosoma cuando se tie y se examina bajo un microscopio. Bandas claras Bandas oscuras (bandas G) son especialmente importantes, porque le dan a cada cromosoma una apariencia diferente y especfica para cada par cromosmico.

Esta caracterstica permite estudiar los cromosomas de una persona en un examen clnico llamado cariotipo, el cual permite observar alteraciones cromosmicas. ATCAGTAGCATGCATGCATGCATGC

Hibridacin In Situ (FISH)


Consiste en la localizacin y deteccin de secuencias especficas de ADN o ARN en un tejido o clula preservada morfolgicamente mediante la hibridacin de una sonda marcada que tiene una secuencia complementaria al objetivo.
Aplicaciones: Localizacin de DNA y mRNA endgenos o DNA/RNA forneos en clulas

(embebidas en parafina, criosecciones, preparaciones celulares y cromosomales) Ventajas: buena preservacin morfolgica, alta especificidad, aplicaciones a DNA o RNA, bajos costos en instrumentos e isotrmico. Desventajas: Baja sensibilidad.
Molculas sondas marcadas Muestras

Deteccin

Las molculas de sonda se unen a las muestras por complementariedad de bases.

Hibridacin Fluorescente In Situ (FISH)


La hibridacin fluorescente in situ (FISH) utiliza molculas fluorescentes para localizar genes o fragmentos de DNA. Esta tcnica es especialmente til para mapear genes o localizar anormalidades cromosmicas.

Sangre

ADN aislado Clulas aisladas

Fluorescencia

Sonda de ADN

Secuencia diana

FISH DE METAFASE:
Esta tcnica puede usarse sobre clulas en metafase para detectar microdeleciones especficas ms all de la resolucin de la citogentica de rutina o para identificar material extra de origen desconocido.

FISH DE INTERFASE:
Se puede determinar el nmero de copias de uno o varios cromosomas, as como para detectar algunas reorganizaciones especficas que son caractersticas de ciertos tipos de cncer.

Prueba de aneuploida

Se ha hibridado con una sonda "de pintado" para el cromosoma 4, que hace que el cromosoma completo emita fluorescencia.

Se observa los cromosomas 13, 18, 21, X e Y. El ncleo de la izquierda se ha hibridado con sondas para los cromosomas 13 (verde) y 21 (rojo).

Aplicaciones: Deteccin de secuencias de ADN ribosomal, ADN altamente y poco repetitivo. Deteccin de secuencias de bajo nmero de copias o de copia nica. Deteccin de transgenes. Integracin de mapas genticos con mapas fsicos. En humanos permite detectar anomalas gnicas o cromosmicas

Mapas Fsicos
Electroforesis Capilar
Equipo de electroforesis Interfase Electrodo Capa de nanotubos

50 cm

5 cm

10 nm

100 um

La electroforesis es un mtodo de separacin especies elctricamente cargadas en solucin, bajo la influencia de un campo elctrico. Caractersticas de la Electroforesis Capilar: Es una poderosa tcnica para la separacin eficiente de pequeas y grandes molculas Tiempo rpido de anlisis Utiliza pequeas cantidades de muestra Bajo Costo.

ELECTROFORESIS CAPILAR EN GEL: La separacin es basada en el tamao de las molculas. Polmeros (monmeros molcula qumica sencilla).

ELECTROFORESIS CAPILAR EN ZONA:

Separacin en funcin carga/masa. Separacin de iones + y - .

Aplicaciones de la Electroforesis Capilar: En la biomdica, en el campo de las protenas, ppticos, ADN, anlisis de lquidos de perfusin, monitoreo de drogas, marcadores genticos tumorales y neurobioqumicos, drogas xenobiticas, de abuso, y pericias forenses. En el rea biofarmacutica, para el control de calidad de productos farmacuticos y biotecnolgicos, quimioterpicos y de estructura quiral. En el rea de alimentos, se la aplica al fraccionamiento y cuantificacin de aminocidos, hidratos de carbono, cidos orgnicos, aditivos y contaminantes. En el rea de control ambiental, permite la identificacin de contaminantes y sus metabolitos, pesticidas, metales pesados e hidrocarburos.

Southern Blot:
Se utilizan sondas de DNA (molculas de DNA marcadas con radioactividad y con una secuencia conocida) para identificar qu bandas del gel contienen secuencias complementarias a la de la sonda.
4. Transferencia de membrana de nylon (blotting)

Clulas nucleadas

1. Extraccin del ADN

3. Electroforesis en geles de asarosa.

cDNA

5. Incubacin con la Sonde de cDNA marcada con P32

2. Digestin con enzimas de restriccin. 6. Exposicin de la membrana a placas de Rx.

Ventajas: Desventajas:

Aplicaciones de la tecnica southern blot en medicina. La preparacin de la sonda no requiere requiere de un cierto conocimiento de la secuencia de ADN Es una laboriosa que tiempo yprevio esfuerzo. 1. En eltcnica diagnstico y caracterizacin de diversas inmunodeficiencias. sometido a estudio. Por otro lado, tiene las desventajas tpicas de los mtodos de biologa molecular que 2. En la distrofia muscular de Duchenne. Aunque esta tcnica es puramente cualitativa,cruzada se puede obtener datos mediante trabajan con ADN: adrenal fenmeno de reactividad variabilidad entrecuantitativos secuencias, adems 3. En la hipoplasia congnita la deficiencia de glicerol-quinasa. el anlisis de la pueden intensidad de afectados la seal asociada a la hibridacin. los resultados verse por factores tales como el tejido de origen de la muestra o la forma en la cual ha sido procesada.

Nouthern Blot:
MDICAS DESVENTAJAS: Una tcnica de laboratorio APLICACIONES que se utiliza para identificar y localizar las secuencias de ARNm que En estudios de la modulacin de la sntesis interleucina 6 en con VENTAJAS: Un problema del northern blot esde que la degradacin de la muestra son complementarias a un fragmento decomn ADN o ARN llamado sonda. Lo localiza enpacientes un tejido en artritis reumatoide. Se la somete a la reaccin colorimtrica. por RNAsas (endgenas de la de muestra o a travs de contaminacin particular y la cual permite tambin determinar el tamao la trascripcin de ese ARN mensajero. En el anlisis de expresincualitativa de receptores que participan en la sntesis de Permite una estimacin y cuantitativa del antgeno. ambiental) que puede ser evitada por una apropiada esterilizacin de los molculas en cultivos celulares. materiales o como el uso de inhibidores de RNAsas como En anlisis de mutaciones y alteraciones del RNAm de enzimas. el dietilpirocarbonato. Muestra
Extraccin de ARN

Sondas etiquetadas

Electroforesis

Nourthen Blot (Transferencia de ARN en membrana)

Visualizacin de ARN etiquetado sobre pelcula de rayo X

ARN fijo a la membrana con UV o calor

Membrana hybridized con sondas etiquetadas

SECUENCIACION DE ADN
Es un conjunto de mtodos y tcnicas bioqumicas el cual nos determinan el orden de nucletidos en un oligonucletido de adn. La capacidad de secuenciar el adn ha permitido grandes avances en el conocimiento de la organizacin del genoma y de los genes; incluyendo su estructura, funcin y mecanismos de regulacin.

Histricamente hay 2 mtodos de secuenciacin de ADN :

Mtodo de maxam y Gilbert o secuenciacin qumica: Un fragmento de ADN se marca radioactivamente en sus extremos 32P o gamma 32s dATP por accin de la polinucletido quinasa. Esta tcnica consiste en romper estas molculas marcadas con reacciones qumicas especficas para cada una de las 4 bases. Posteriormente se da una ruptura de la secuencia, quedando as los productos.

Mtodo de Sanger Se utiliza pocos reactivos txicos y una menor radioactividad que el anterior mtodo. Se caracteriza por el uso de didesoxinucletidos trifosfato(ddNTPs). Estos son desoxinucleotidos de los 4 nucletidos diferentes (dATP, dTTP, dCTP, dGTP) que carecen de un grupo hidroxilo. Ya que carece del extremo 3OH para poder elongarse, al terminar la cadena se producen varios fragmentos de ADN los cuales son desnaturalizados por calor mediante una electroforesis en gel de poliacrimida-urea.

ADN Monocatenario que debe ser secuenciado

Los cuatro ddNTP

2 GENERACION
PIROSECUENCIACION La pirosecuenciacin es un mtodo de secuenciacin de ADN basado en la monitorizacin a tiempo real de la sntesis de ADN. Todos los pasos se realizan in vitro, a diferencia de la tcnica de Sanger.

PASO 1: OBTENER LIBRERA sstDNA 3: SECUENCIACION PASO 2:PASO Amplificacin de secuencias

Nebulizacin Despus de los termociclos de PCR

Adicin de adaptadores Y de desnaturalizar el ADN para dejar cadenas simples En cada pocillo caben muchas esferasSe con las enzimas pero solo 1 obtiene un amplicn con esfera con secuencias cada secuencia de la librera Se carga un repetida fragmento en muchas veces Despus el PICO TITER PLATE cada esfera se coloca en el secuenciador

Seleccin de adaptadores correctamente posicionados

PASO3: SECUENCIACION En todos los pocillos, el secuenciador repite un ciclo de vertido de un tipo de nucletidos y lavado. Por ejemplo: T-lavado-C-lavado-G-lavado, hasta completar la sntesis de secuencias complementarias a las secuencias moldes Si la polimerasa no incluye Lavado dela exceso de reactivos Cada vez que polimerasa El proceso concluye con la un nucletido. En el Lavado de exceso de reactivos introduce una base se determinacin de las secuencias de pirograma se dejan huecos El proceso se repite cclicamente la se siguiente los produce 400,00 pocillos de Pico hasta que vierta el Titer cascada enzimtica Plate nucletido correcto La polimerasa introducir mas de un nucletido segn PPi La emisin su depatrn. luz es recogida por la cmara CCD een el Esto se refleja Sulfurilasa interpretada porcomo un software pirograma una que genera unproporcional pirograma con intensidad al ATP la secuencia pocillo numero de cada nucletidos
T G

Aplicaciones:
Es una tcnica que se utiliza mucho en el diagnstico molecular, sobre todo cuando ya se sabe de antemano la secuencia que se desea obtener. Obtener la secuencia de un ADN problema(En el caso de no conocer la secuencia en particular, al mquina va liberando por orden las bases A, T, C, G)

3 GENERACION
1. Pacific Bioscience
Se basa en la deteccin de una sola molcula de DNA polimerasa trabajando de manera continua para obtener mayor velocidad y longitud de los reads.

Pacific Biosciences utiliza una molcula de ADN polimerasa atado a la parte inferior de un nanowell (IIa) que asegura que slo un colorante de nucletidos ligada puede ser excitado directamente a la vez. El colorante se elimina por la polimerasa cuando se incorpora el siguiente nucletido marcado (IIb) .

GENMICA FUNCIONAL
La Genmica Funcional clasifica los genes de las secuencias dilucidadas por la Genmica Estructural e identifica sus funciones. Es el estudio simultneo de todos los genes involucrados en un estado fisiolgico determinado o en un tejido en particular. Permite comprender la organizacin y los mecanismos genticos que en conjunto hacen a la fisiologa de un organismo.

PCR CUANTITATIVO(EN TIEMPO REAL)

La PCR en tiempo real (o PCR cuantitativa) surgi para resolver el problema de la cuantificacin de la tcnica de la PCR. En la PCR en tiempo real se emplean sondas marcadas con fluorocromos.

PCR TRADICIONAL

PCR EN TIEMPO REAL

MEDIDA
RESULTADO

Al final del proceso


Cualitativo Baja sensibilidad

En la fase exponencial
Cuantitativo Alta sensibilidad Rango alto

RANGO DE DETECCION

Pequeo rango

METODO DE DETECCIN
CONTAMINACION

Electroforesis en de agarosa
Si

Fluorescencia
No

APLICACIONES A LA MEDICINA: Cuantificacin viral Cuantificacin de expresin gnica Control de eficacia de frmacos Deteccin de patgenos Diagnsticos de tumores Discriminacin allica (polimorfismos)

Differential display
DDRT-PCR o DD-PCR o Tcnica de expresin diferencial de genes Mtodo: PRIMERO: Sntesis de DNAc a partir del RNAm (trancriptasa inversa) con cebador oligo dT ARP SEGUNDO: PCR : Amplificacin del DNAc TERCERO: Electroforesis de las muestras CUARTO: Revelado y seleccin de bandas

APLICACIN DE DD PCR
Inhibidores de genes Reduccin de falsos positivos

Figura. Uso de tcnicas. Gen Hunter. http://www.genhunter.com/support/

SAGE
Anlisis en serie de la expresin gnica Uso de "tags ( 10-14bp) de DNAc Mtodo: 1. Se sintetiza DNAc a partir de RNAm 2. Se corta el DNAc con enzimas de restriccin 3. Se une diferentes extremos mediante moleculas llamadas linker, formando as el Tag 4. Se forma Ditag, se procede a amplificar por PCR 5. Se eliminana los linkers. 6. Se secuencia e identifica

APLICACIONES SAGE
Identificacin del Cncer Clulas cancergenas incrementan la expresin gnica en la proliferacin y sobrevivencia Decrese la expresin de genes en diferenciacin celular p53: gen supresor del tumor Estudios inmunologicos Encuentra indicadores de la inmadurez del CD4+t linfocitos responsable de la patogenesis del SLE (Systemic lupus erythematosus).

Trastornos Mendelianos
Monognicos 3 tipos I. Trastorno autosmico dominante (TAD): Sndrome de Marfan II. Trastorno autosmico recesivo (TAR) III. Ligado al cromosoma X: Hemofilia

Splicing alternativo y cncer


Permite obtener a partir de un transcrito primario de mRNA distintas molculas de mRNA maduras. Eliminacin de intrones.

Enfermedades genticas
Trastornos de herencia multifactorial

Trastornos citogenticos
Nmero anormal de cromosomas.
Aneuploidas. 1(+) trisomas o 1(-) monosomas. Poliploidas. Polisoma. +47.

Enfermedades polignicas Dos o ms genes mutantes asociados a factores ambientales

Alteraciones en su estructura.
Isocromosomas. Traslocacin. Delecin. En anillo.

Cariotipo
Es una prueba para examinar cromosomas en una muestra de clulas Contar el nmero de cromosomas Buscar cambios estructurales en los cromosomas. Tincin Giemsa: G Banding

Sndrome de Down

Sndrome de Down
Trisoma del cromosoma 21: un cromosoma extra. Translocacin cromosmica: Segmento del cromosoma 21 se une al cromosoma 14. Carga gentica extra.

Mosaicismo o trisoma en mosaico: Solo un porcentaje de clulas son trismicas.

Determina la secuencia correcta de tres mil Farmaco millones de bases de ADN genmica Desarrollo de nuevas tecnologas para el secuenciamiento rpido abarataron el precio y redujeron el tiempo.
Genoma Humano
Toxi
genmica

Proyecto Genoma Humano Mapeo gentico Secuenciacin

Nutri
genmica

Farmacogenmica
La farmacogenmica es el trmino que se utiliza para describir al estudio de la contribucin de las diferencias en los genes de un individuo a la variacin en las respuestas a los medicamentos entre la poblacin. La farmacogenmica tambin permite a travs del estudio de los genes completos de un individuo disear frmacos a la medida adaptados a sus caractersticas hereditarias para incrementar la efectividad y minimizar los efectos secundarios indeseables.

Nutrigenmica

La nutrigenmica pretende el conocimiento extensivo e integrado de cmo las dietas o sus componentes afectan a los sistemas biolgicos a todos los niveles. La nutrigenmica se ocupa de conocer y caracterizar la diferente respuesta a la alimentacin segn el genotipo y segn la historia alimentaria individual. En realidad tenemos conocimientos sobre nutrigenmica desde hace muchos aos, y los aplicamos.

Toxigenmica
La toxicogenmica es un campo de la ciencia que se ocupa de la recogida, interpretacin y almacenamiento de la informacin gnica y actividad de la protena dentro de una determinada clula o tejido de un organismo en respuesta a sustancias txicas. La toxicogenmica combina con la genmica toxicologa u otros perfiles moleculares de alto rendimiento tecnologas como transcriptmica, protemicay metabolitos.

PROTEMICA

GENOMA:

TRANSCRIPTOMA:

PROTEOMA:

ESTRS

FRMACOS

PROTEOMA

HORMONAS

TEMPERATURA

PROTEMICA
La protemica es el conjunto de tcnicas que nos permite identificar, categorizar y clasificar las protenas con respecto a su funcin y a las interacciones que existen entre ellas as como tambin su funcin en las enfermedades.

Ramas de la protemica:
Protemica de expresin: Estudia la abundancia
relativa de las protenas y de sus modificaciones.

Protemica estructural: Estudio de la localizacin


subcelular de las protenas y de las interacciones protena protena.

Protemica funcional: Estudio y caracterizacin de un


grupo de protenas proporcionando informacin sobre sealizacin, mecanismos de la enfermedad o interacciones protena frmaco.

APLICACIONES DE LA PROTEMICA
Identificacin de marcadores para el diagnstico de enfermedades Su aplicacin en biomedicina busca la identificacin de nuevos frmacos, desarrollo de vacunas determinacin de mecanismos moleculares involucrados en la patogenia de enfermedades anlisis de rutas de transduccin de seales.

TCNICAS PARA ANALIZAR GLOBALMENTE EL PROTEOMA Y SEPARAR SUS PROTENAS

ELECTROFORESIS
La electroforesis es la migracin de solutos inicos bajo la influencia de un campo elctrico ; estas partculas migran hacia el ctodo o nodo (electrodos y +) en dependencia de una combinacin de su carga , peso molecular y estructura tridimensional.

Unidimensional BIDIMENSIONAL + PRIMERA DIMENSIN: Se separa a las protenas por su punto isoelctrico.(isoelectroenfoque) SEGUNDA DIMENSIONAL: Los solutos se separan por su peso molecular en un gel de poliacrilamida (SDS PAGE)

ELECTROFORESIS EN GELES DE POLIACRILAMIDA ( PAGE) POLIACRILAMIDA 1. PREPARACION DEL SOPORTE

ELECTROFORESIS UNIDIMENSIONAL SDS-PAGE


PREPARACIN DE LA MUESTRA

ELECTROFORESIS BIDIMENSIONAL

PRIMERA DIMENSIN: Las protenas migran en funcin de su punto isoelctrico(pl de una protena es un valor especfico de pH donde la carga neta de la protena es cero.)
SEGUNDA DIMENSIN SDS-PAGE
Las protenas se separan en funcin a su masa molecular

APLICACIONES DE LA 2D -PAGE
La deteccin de marcadores de la enfermedad en la investigacin Se pueden detectar diferentes tipos de agentes patgenos y enfermedades cancergenas. Pueden compararse por los patrones de protenas de un individuo sano frente a un individuo enfermo o de un mismo individuo expuesto a diversas situaciones. Estas estrategias se utilizan para analizar los efectos de diferentes tratamientos con frmacos o la exposicin a sustancias txicas.

WESTERN BLOTT
DEFINICIN

Es una tcnica analtica usada para detectar protenas especficas en una muestra determinada (una mezcla compleja de protenas , como un extracto tisular).

FUNDAMENTO

APLICACIONES:
Diagnstico Se usa principalmente para determinar la presencia o ausencia de una protena en una muestra Prueba de VIH Enfermedades inflamatorias Enfermedades infectocontagiosas Se emplea como prueba definitiva de la encefalopata espongiforme bovina enfermedad de las vacas locas

1903: us columnas de adsorcin para

separar pigmentos vegetales


Fase mvil Pigmentos vegetales

Tswett (1872-1919)
Chroma: color Graphein: escribir
CROMATOGRAFA
Fase estacionaria

La cromatografa es una tcnica que permite la separacin de los Componentes de una mezcla

CROMATOGRAFA PLANA Papel


Fase estacionaria

Cromatografa en papel
Cromatografa en capa fina

Adsorbente sobre soporte

Gel de slice, poliamida.


PROCESO CROMATOGRFICO

Lmina de vidrio, de plstico o metlica


Tapadera

Papel

Frente de fase mvil

Fase mvil

63

CROMATOGRAFA EN COLUMNA
Disolvente columna cromatogrfica

Muestra (mezcla de 3 compon entes

Relleno (solido adsorbente)

ENSANCHAMIENTO DE BANDAS

CROMATOGRAFA POR AFINIDAD


Se basa en la interaccin, especfica y reversible de un afinante y un ligando

Matriz: son generalmente Geles, las mas comunes son la agarosa y el Dextrano (Sephadex)

INMOVILIZACIN DEL LIGANDO

Directa: unin del ligando al soporte activo

Indirecta: unin del ligando aun brazo espaciador previamente fijado aun soporte activo

ADSORCIN DE LA MUESTRA

DESORCIN

Cromatografa de filtracin en gel


fase estacionaria Tener un tamao de poro controlado El tamao del poro no debe variar en las condiciones cromatogrficas La fase mvil

transportador

Las molculas de menor tamao difunden a travs de los poros de las partculas del gel y son retardadas en su paso por la columna. Las molculas grandes no entran en los poros de la matriz, por lo tanto eluyen primero.

PROCESO CROMATOGRFICO

Las elusin se da cuando haya pasado un volumen de liquido igual al Vt

El Vo es recorrido por las molculas cuyo tamao es mayor que el de los poros de el gel

Vt-Vo Las molculas intermedias sern extraidas con al diferencia

Cromatografa de Intercambio Inico


La cromatografa de intercambio catinico

La fase estacionaria

grupo sulfnico, SO3-.

La cromatografa de intercambio de aninico catin de amonio cuaternario ms corrientes son grupos aminos alifticos o aromticos.

Equilibrio

Aplicacin y Lavado

Elusin

Regeneracin

Cromatografia por afinidad

(A)

(B)

(C)

(D)

(E)

(A) Resina de intercambio catinico antes de aadir la muestra. (B) Se aade la muestra, una mezcla de Asp, Ser y Lys. (C) Se aade Na+ (NaCl), el Asp, el aminocido con menos carga positiva eluye el primero. (D) Se aumenta el Na+, a continuacin eluye la Ser. (E) Se aumenta el Na+, la Lys, el que posee ms carga positiva eluye el ltimo.

TCNICAS USADAS PARA ANALIZAR INDIVIDUALMENTE LAS PROTENAS

Principios de la espectrometra de masas

Sistemas de ionizacin
Sistemas de ionizacin en fase gaseosa: EI: Ionizacin por impacto de electrones. CI: Ionizacin qumica. PI: Fotoionizacin. Sistemas o fuentes de desorcin: ESI: Ionizacin por electrospray. LDI: Ionizacin por desorcin lser: MALDI: Ionizacin por desorcin lser asistida por una matriz. SELDI: Ionizacin por lser inducida en superficie. FAB: Bombardeo con tomos acelerados. DART Ionizacin por anlisis directo en tiempo real.

ESI: Ionizacin por electrospray.

MALDI: Ionizacin por desorcin lser asistida por una matriz

Analizadores de masa
Analizadores de sector magntico Filtros de masas de cudruplo Analizador de trampa de iones (IT-MS, ion-trap MS o ITD ion trap detector) Analizador de tiempo de vuelo (TOF, time of flight) Resonancia ciclotrnica por transformada de Fourier (FTICRMS Fourier transform ion cyclotron resonance MS)

TOF: Analizador de tiempo de vuelo

MALDI-TOF

SECUENCIACION DE UNA PROTEINA


1 Fase: Determinar la composicin de aa 2 Fase: Determinacin de los extremos Cterminal y N-terminal 3 Fase: Fragmentacin por hidrlisis selectiva 4 Fase: Degradacin de EDMAN o Espectrometra de masas

DEGRADACION DE EDMAN

IDENTIFICACIN DE LAS PROTENAS

IDENTIFICACIN DE LAS PROTENAS

1000

m/z Mass (m/z)


1500

2000

Extraccin de pptidos y anlisis de masas Separacin en gel 2D

Seleccin de la muestra Tratamiento con una enzima proteoltica Bsqueda en banco de datos

MAPA PEPTDICO DE MALDI-TOF

INTENSIDAD

m/z

LISTADO DE MASAS

LA HUELLA PEPTIDICA DE COMPARA CON LOS DATOS DE UNA DASE DE DATOS

COMPARACION

BIOMARCADORES

Cncer
Los lquidos humanos son la principal fuente de biomarcadores, en particular por su bajo costo, fcil recoleccin, procesamiento y el carcter no invasivo de sus muestras.

Comparacin de los biomarcadores propuestos con base en estudios protemicos y los biomarcadores usados en la actualidad en la deteccin de algunos tipos de cncer

BIOINFORMTICA

CONCEPTO
De acuerdo con el NIH :la bioinformtica es la investigacin, el desarrollo y la aplicacin de herramientas de cmputo y aproximaciones para la expansin del uso de datos biolgicos, mdicos, conductuales o de salud, incluyendo aquellas herramientas que sirvan para adquirir, almacenar, organizar, analizar o visualizar tales datos.

TRMINOS RELACIONADOS
La biologa computacional es el desarrollo y aplicacin de mtodos tericos y de anlisis de datos, modelado matemtico y tcnicas de simulacin computacional al estudio de sistemas biolgicos, conductuales y sociales. La biocomputacin es la construccin y uso de computadores que contienen componentes biolgicos o funcionan como organismos vivos.

HISTORIA
Fines de los aos ochenta y el primer lustro de los noventa, el campo de accin de la bioinformtica estaba relativamente limitado y lo impuls la generacin de bases de datos primarios. Surge la herramienta BLAST que permite la identificacin rpida y sensible de secuencias similares a la del usuario en una base de datos enorme. A partir del segundo lustro de los noventa, la consulta de bases de datos se comenz a realizar a travs de internet y ello contribuy an ms a la difusin de la bioinformtica

NCBI (Centro Nacional para la Informacin


Biotecnolgica)
Establecido en 1988 como un recurso para la informacin en biologa molecular, ha creado bases de datos pblicas, dirige investigacin en biologa computacional, desarrolla software para anlisis de datos de genomas, y disemina informacin biomdica. es parte de la Biblioteca Nacional de Medicina de Estados Unidos.

EMBL (Laboratorio Europeo de


Biologa Molecular)
Fue establecido en 1974, pertenece al EBI. Es financiada por 18 pases europeos. Sus objetivos son dirigir investigacin bsica en biologa molecular, proveer servicios esenciales a cientficos en sus estados miembros, adems del desarrollo de nuevas herramientas para la investigacin.

DDBJ (Banco de Datos de DNA del


Japn)
El Banco de Datos de DNA del Japn comenz sus actividades desde 1986. Es una de las bases de datos de secuencias biolgicas internacionales. Aqu se recolecta datos especialmente del Japn, aunque se aceptan los datos de investigadores de otros orbes, y se intercambia esta informacin con EMBL y NCBI.

BASES DE DATOS DE NUCLETIDOS


GenBank: es la base de datos de secuencias del NIH en EEUU. EMBL-Bank: Constituye el repositorio ms importante en Europa. DNA Data Bank of Japan (DDBJ) en el Centro de Informacin Biolgica.

OTRAS BASES DE DATOS


Mitomap: se trata de una base de datos de informacin sobre el genoma mitocondrial. OMIM: es una base de datos que cataloga todas las enfermedades con un componente gentico.

HAPMAP
Creado para desarrollar un mapa de haplotipos del genoma humano. Su contenido describe en qu consisten dichas variaciones, en qu sitios del genoma suceden y cmo se distribuyen en las diferentes poblaciones.

El objetivo es encontrar todos los elementos funcionales en el genoma humano. Gran parte de este ADN no codificante funcional est involucrado en la regulacin de la expresin de codificacin de los genes. Su publicacin sumaria afirm haber asignado funcin bioqumica para el 80% del genoma humano. El proyecto ENCODE ha descubierto unas 70.000 regiones promotoras, unas 400.000 regiones potenciadoras, 2,9 millones de regiones a las que se ligan protenas.

ENCODE PROJECT

PROGRAMAS
Es un programa para alineamiento de secuencias de ADN y de protenas. Agreg la posibilidad de hacer bsquedas de ADN contra ADN, ADN contra protenas traducidas . Programa ms sofisticado de aleatorizacin para evaluar la significancia estadstica de los resultados. Es un formato de solo texto.

BLAST
Es un programa informtico de alineamiento de secuencias de tipo local, ya sea de ADN, ARN o de protenas. Es bastante rpido pero no garantiza el mejor resultado solo el mejor alineamiento. Requiere dos secuencias como entrada: una secuencia de consulta (tambin llamada secuencia blanco) y una base de datos de secuencias. Es usado para encontrar probables genes homlogos, es decir con funciones similares.

ETAPAS
ENSEMILLADO: busca coincidencias exactas de una pequea longitud fija W entre la secuencia de consulta y las secuencias de la base de datos. EXTENSIN: extender la coincidencia en ambas direcciones, comenzando por la semilla. EVALUACIN: presenta los alineamientos relevantes estadsticamente son mostrados al usuario.

APLICACIONES
Anlisis de secuencias: se usan programas de computadora para estudiar el genoma de miles de organismos. Anlisis de la expresin gnica: desarrollo de herramientas estadsticas para separar la seal del ruido. Anlisis de mutaciones en cncer: se secuencian para identificar sustituciones individuales de bases (o puntos de mutacin de nucletidos) todava desconocidos en una variedad de genes en el cncer. Prediccin de la estructura de las protenas: La secuencia de aminocidos de una protena, tambin llamada estructura primaria, puede ser determinada fcilmente desde la secuencia de nucletidos sobre el gen que la codifica. Genmica comparativa: es el establecimiento de la correspondencia entre genes (anlisis ortlogo) o entre otras caractersticas genmicas de diferentes organismos.

BIOINFORMTICA Y LA MEDICINA
La bioinformtica clnica es una aplicacin de la bioinformtica en distintas reas y aspectos de la investigacin biomdica, as como en la prctica clnica. En la farmacologa, la bioinformtica clnica ha servido para identificar dianas teraputicas, disear ensayos clnicos, desarrollar biomarcadores, herramientas toxicogenmicas y farmacogenmicas. La bioinformtica permitir una representacin virtual de un organismo.

GRACIAS